ANNÉE 2015

THÈSE / UNIVERSITÉ DE RENNES 1

sous le sceau de l’Université Européenne de Bretagne

pour le grade de

DOCTEUR DE L’UNIVERSITÉ DE RENNES 1

Mention : Biologie et Sciences de la Santé

École doctorale Vie-Agro-Santé

présentée par Ahmad CHARANEK Préparée dans l’Unité de Recherche INSERM UMR 991 «Foie, Métabolismes et Cancer» (Pharmacie)

Thèse soutenue à Rennes The Bile Canaliculus le 10 Juin 2015 devant le jury composé de : Revisited: Pr Chantal HOUSSET Professeur des Universités Morphological And Université de Paris 6 / rapporteur Pr Marc PALLARDY Functional Professeur des Universités Université de Paris 11 / rapporteur Alterations Induced Pr Pierre BRISSOT Professeur des Universités By Cholestatic Université de Rennes 1 / examinateur Dr Richard WEAVER Drugs In HepaRG Scientific Director INSTITUT DE RECHERCHES INTERNATIONALES SERVIER / examinateur Cells Dr Christiane GUGUEN-GUILLOUZO Directeur de Recherches Emérite Inserm Université de Rennes 1 / examinateur Pr André GUILLOUZO Professeur des Universités Université de Rennes 1 / directeur de thèse 1 The test of our progress is not whether we add more to the abundance of those who have much; it is whether we provide enough for those who have little.

Franklin Delano Roosevelt

2 Acknowledgment

Foremost, I would like to express my sincere gratitude to my supervisor Pr. André

Guillouzo, for his constant guidance, continuous encouragement, and patience along the thesis preparation. I am grateful to the trust he gave me, and the moral support he provided. I highly appreciate his confidence in my ambitious goals, and his enormous efforts to provide me with all the required facilities. I am so thankful for his priceless advices that will pave the road for my future career.

I would like to thank to all jury members: Mme Chantal Housset, Mr Marc Pallardy, Mr

Pierre Brissot, and Mr Richard Weaver. Thank you for giving me the honor of judging my thesis work.

I won’t be able to complete this journey without the support and guidance of Mme

Guillouzo, I highly acknowledge her massive assistance, fruitful discussions, directions, patience, great scientific ideas, and attention to tiny details that taught me to strive towards my goal with steady steps.

Special thanks and appreciation are expressed to Pr. Ziad Abdel-Razzak. Words cannot express my gratitude and respect for you. Your help and support are unforgettable. I can’t forget your patience, insistence, and massive effort you did to help me finding a way to d thios thesis “I won’t be able to do this thesis without your favor”. You were always supportive in need. May Allah reward you for all what you did.

I would to express my sincere gratitude and deep thanks for the Lebanese

Association for Scientific Research (LASeR) for supporting financially a part of my thesis work.

3 I would like also to express my gratitude for all the members of INSERM U991 especially, Mme Marie-Anne Robin, Mr Bernard Fromenty for all your support and help in need. Special and deep gratitude for my lab-mates, no words can express my appreciation and love for you all: Eva, Dounia, Anais, Camille, Nicolas, Sacha,

Simon, Karima, Pégah, Yasmine, Sofie, Thomas O., Thomas G., Karim, Rozenn and

Sebastien.

I would like to thank Mr Dominique Rainteau and his team for their generous help and measurement of bile acids in his laboratory.

I greatly appreciate Rémy Le Guével for his availability, effort, and enormous time he passed in image analysis.

I won’t be able to complete this journey without the support of my Lebanese friends;

Fida and Elise, since I arrived to Rennes you were very supportive and encouraging, thank you for the nice moments we passed together.

Houssein you are special, you are a real brother, we shared all the good and bad moments of the thesis together, I don’t know how it could be without you, and how hard to be lonely. I will never forget your spontaneous support, kindness and generous help. Thank you because you don’t know how to say “NO”. Thank you for all the time you made me laugh when I was stressed. You compensated the feelings of loneliness since you arrived. May Allah bless you and compensate you by the best.

Pamela, I can’t find the words to express my gratitude for you and your family; Ellie and Marcosa. Thank you for all what you did, for the amazing days we passed together I hope that we will have again the opportunity to work together, I greatly appreciate your assistance, support and advices. I can tell you there is only

4 cyclosporine in the life “hahahha”. I can’t compensate you for all what you did but

Allah will do.

My special appreciation and deep gratitude are expressed to you Audrey. You are exceptional. This work would not have been possible unless you were beside me, not only for the enormous experimental work you did and enormous effort in the success of this thesis, but also for your great will of assistance, support and encouragement.

Your generosity, love and care compensated the feelings of loneliness, foreignness, and weakness I have experienced during hard moments away from my family. Thank you for cheering me up and stood by me through all the times.

Sure I won’t forget to thank you Matthew, you deserves special and best thanks not only for participating in the success of the thesis, but also for the amazing moments, jokes and the interesting ambience we experienced together. I wont forget how much you were attentive with me especialy when I was sick.

At the end, I will not forget my family, I would like to express my profound gratitude and high appreciation to you Rawaa, Rima, Nijmi, Mohammad and Omar for your precious support, and your continuous encouragement and prays, for all the sacrifices that you have made on my behalf. This work is dedicated for you MOM and

DAD, how can I compensate everything you did for me, I am indebted for you. May

Allah guard and reward you.

I feel so blessed with everything, thanks to almighty Allah for everything.

5 6 Abstract Cholestasis is one of the most common manifestations of drug-induced liver injury (DILI). Since up to now it is unpredictable in 40% of all cases its accurate prediction represents a major challenge. First, we validated that differentiated HepaRG human liver cells are a suitable in vitro model to study drug-induced cholestasis, by comparing localization of influx and efflux transporters and their functional activity in these cells and primary human hepatocytes. All tested influx and efflux transporters were correctly localized to canalicular (BSEP, MRP2, MDR1, and MDR3) or basolateral (NTCP, MRP3) membrane domains and were functional. In addition, the HepaRG cell line also exhibits bile acids (BAs) metabolizing enzymes and has the capacity to synthesize BAs and to further amidate these BAs with taurine and glycine as well as sulfate, at a rate similar to that of primary hepatocytes. Concentration- dependent changes were observed in total BAs disposition after treatment of HepaRG cells by the cholestatic drug cyclosporine A (CsA). Inhibition of efflux and uptake of taurocholate was evidenced as early as 15 min and 1 h respectively. These early effects were associated with deregulation of cPKC pathway and induction of endoplasmic reticulum stress that preceded generation of oxidative stress. We also showed for the first time intracellular accumulation of endogenous BAs by a cholestatic drug in vitro. In addition, our work brings evidences that motility of bile canaliculi (BC) is essential for BAs clearance where ROCK pathway and actomyosin complex are highly implicated. We provided the first demonstration that ROCK pathway and BC dynamics are major targets of cholestatic compounds. Our data should help in the development of screening methods for early prediction of drug- induced cholestatic side effects.

7 Résumé La cholestase est l’une des manifestations les plus courantes des lésions induites par des médicaments. Dans 40% des cas elle n’est pas prévisible; une meilleure prédictibilité représente donc un défi majeur. Tout d’abord, nous avons démontré que les cellules hépatiques humaines HepaRG différenciées sont un modèle approprié pour étudier la cholestase induite par les médicaments en comparant la localisation et l’activité des transporteurs d’influx et d’efflux avec les hépatocytes humains primaires. Tous les transporteurs d’efflux et d’influx testés ont été correctement localisés au niveau des membranes canaliculaire (BSEP, MRP2, MDR1 et MDR3) et basolatéral (NTCP, MRP3) et sont fonctionnels. En outre, ces cellules expriment également les enzymes qui métabolisent les acides biliaires (ABs) et ont la capacité de les synthétiser et de les conjuguer avec la taurine, la glycine et le sulfate, à un taux similaire à celui des hépatocytes primaires. Des changements ont été observés sur la répartition des ABs totaux après traitements de cellules HepaRG par un médicament cholestatique, la cyclosporine A (CsA), de manière concentration- dépendante. L’inhibition de l’efflux et de l’influx de taurocholate a été observée après 15 min et 1 h respectivement. Ces premiers effets ont été associés à la dérégulation de la voie des cPKC et l’induction d’un stress du réticulum endoplasmique puis d’un stress oxydant. Nous avons également montré pour la première fois une accumulation intracellulaire d’ABs endogènes avec un médicament cholestatique in vitro. En outre, notre travail apporte des preuves que la motilité des canalicules biliaires (BC) est indispensable à la clairance des ABs. La voie ROCK et le complexe actomyosine sont fortement impliqués. Nous avons fourni la première démonstration que la voie ROCK et les dynamiques des BC sont des cibles majeures des composés cholestatiques. Nos données devraient contribuer à l’élaboration de méthodes de screening pour la prédiction précoce des effets secondaires induits par les médicaments cholestatiques.

8 Table of content General Introduction ...... 20 I. The liver: Metabolism and elimination of xenobiotics and endogenous compounds...... 22

I.1. Histology of the liver ...... 22

I.1.1. The hepatic lobule: the structural unit of the liver ...... 22

I.1.2. The hepatic acinus is the functional unit of the liver ...... 22

I.1.3. Structure and motility of bile canaliculi ...... 24

I.1.4. The Biliary System ...... 26

I.2. Metabolism and elimination of xenobiotics and endogenous compounds...... 27

I.3. The liver: the primary target of toxic xenobiotics...... 28

I.3.1. Intrinsic toxicity ...... 28

I.3.2. Idiosyncratic toxicity...... 29

I.3.3. Types of drug-induced hepatic lesions...... 29

A. Hepatocellular injury...... 30

B. Cholestasis...... 31

C. Steatosis ...... 31

D. Phospholipidosis...... 32

E. Chronic active hepatitis, fibrosis and cirrhosis...... 32

F. Other lesions (Liver tumors,) ...... 32

I.3.4. Mechanisms of DILI ...... 35

I.3.4.1. The role of adaptive immunity in iDILI ...... 37

I.3.5. Risk factors ...... 38

I.3.5.1. Genetic related drug-induced hepatotoxicity ...... 38

I.3.6. Models for liver toxicity studies ...... 40

A. Different models used to study drug-induced liver injuries...... 40

9 B. The HepaRG cell line...... 41 II. Synthesis and excretion of bile...... 46

II.1. Synthesis of bile acids...... 46

II.2. Conjugation of bile acids ...... 48

II.3. Enterohepatic circulation of bile acids...... 51

II.4. Regulation of bile acid synthesis by nuclear receptors...... 53

II.5. Models to study synthesis and perturbation of bile acid pool...... 56

II.6. Hepatocellular transport system...... 57

II.6.1. Uptake of bile acids ...... 58

A. Sodium-dependent uptake...... 58

B. Sodium-independent uptake...... 59

II.6.2. Efflux of bile acids...... 59

A. Canalicular efflux of bile acids...... 59

B. Basolateral bile salt efflux ...... 61

II.6.3. Intracellular trafficking and regulation of canalicular ATP-Binding Cassette (ABC) transporters...... 64 III. Cholestasis ...... 68

III.1. Definition and Etiology...... 68

III.2. Hereditary transporter defects as a cause of cholestasis ...... 69

A. MDR3...... 69

B. BSEP...... 70

C. FIC-1...... 70

D. MRP2 ...... 71

III.3. Acquired cholestasis...... 71

III.3.1. Drug-induced cholestasis ...... 71

A. Drug-induced alteration of bile acid transporters...... 73

B. Drug-induced alteration of bile canaliculi motility and bile flow...... 74

10 III.3.2. Inflammatory cholestasis ...... 75

III.3.3. Intrahepatic cholestasis of pregnancy (ICP) ...... 76

III.4. Molecular regulation of hepatobiliary transporters expression during cholestasis ...... 77

III.5. Adaptive feedback mechanisms...... 78

III.5.1. Uptake inhibition...... 78

III.5.2. Increasing hydroxylation and conjugation of bile acids ...... 79

III.5.3. Inhibition of bile acid synthesis...... 80

III.5.4. Induction of the expression of canalicular transporters ...... 81

III.5.5. Increase in basolateral excretion of bile acids ...... 81

III.6. Major considerations beyond direct inhibition of BSEP while investigating drug-induced cholestasis ...... 83 IV. Cyclosporine A: An intrinsic cholestatic drug ...... 86

IV.1. History and structure of cyclosporine A...... 86

IV.2. Therapeutic use of CsA...... 87

IV.3. Mechanisms of action ...... 87

IV.4. Metabolism of CsA ...... 88

IV.5. CsA-induced adverse effects ...... 89

III.5.1. CsA-induced hepatotoxicity...... 90

IV.5.1.1. CsA-induced cholestasis ...... 91

A. Reduction of bile acid-dependent bile flow (BADF)...... 92

B. Alterations of cytoskelton and pericanalicular F-actin microfilament...... 94

C. Reduction of bile acid-independent bile ow (BAIF)...... 95

D. Decreased cellular membrane fluidity ...... 95 Results...... 98 Chapter 1...... 102 Chapter 2...... 104

11 Chapter 3...... 106 Chapter 4...... 146 General Conclusion & Perspectives...... 182 References ...... 188

12 List of Figures Figure 1: The hepatic lobule ...... 24

Figure 2: The biliary tree...... 26

Figure 3: Types of drug-induced hepatic lesions...... 30

Figure 4: Phase-contrast micrographs of HepaRG cells...... 45

Figure 5: Representative structure of bile acids ...... 47

Figure 6: Biosynthesis of bile acids...... 49

Figure 7: Enterohepatic circulation of bile acids in human...... 53

Figure 8: Bile acid feedback regulation of CYP7A1 and CYP8B1 gene transcription ...... 54

Figure 9: Localization and function of sinusoidal and canalicular transporters in hepatocytes...... 62

Figure 10: Ligand-activated regulation of gene expression that determines the hepatic clearance of bile salts, bilirubin and xenobiotics...... 82

Figure 11: Summary of the potential mechanism(s) by which a drug or metabolite can impact the hepatobiliary disposition of BAs...... 84

Figure 12: Molecular structure of cyclosporin A...... 86

Figure 13: Seeding and culture of HepaRG cells ...... 100

List of Tables Table 1: Most common or well-described DILI agents and the patterns of their liver injury ... 33

Table 2: Percent different bile acids (BAs) in human serum, urine, liver tissue, cecum, bile, and feces of human...... 50

Table 3: Hepatocellular basolateral and canalicular transporters: nomenclature and function ...... 62

13 List of abbreviations

AGT : Alanine-glyoxylate aminotransferase AhR : Aryl hydrocarbon receptor AP : Alkaline phosphatase ASBT : Apical sodium-dependent bile acid transporter BACS : Bile acid-CoA synthase BADF : Bile acid-dependent bile flow BAIF : Bile acid-independent bile flow BAREs : Bile acid response elements BAs : Bile acids BAT : Bile acid-amino acid transferase BCRP : Breast cancer resistance protein Br- : Bilirubin BrG- : Bilirubin glucuronides BRIC-2 : Benign recurrent intrahepatic cholestasis BS- : Bile salts BSEP : Bile salt export pump CA : Cholic acid CAR : Constitutive androstane receptor CBDL : Common bile duct ligation CDCA : Chenodeoxycholic acid CDFDA : 5(6)-Carboxy-2′ ,7′ -dichlorofluorescein diacetate CPZ : Chlorpromazine CRP : C-Reactive Protein CsA : Cyclosporine A CYP27A1 : Sterol 27-hydroxylase CYP7A1 : Cholesterol 7α -hydroxylase CYP8B1 : Sterol 12α -hydroxylase CypD : Cyclophilin D protein CYPs : Cytochromes P450 DCA : Deoxycholic acid DILI : Drug-induced liver injury DMSO : Dimethylsulfoxyde EH : Epoxide hydrolases Fgf : Fibroblast growth factor FTF : α -fetoprotein transcription factors FXR : Farsenoid X receptor GCA : Glycocholic acid GCDCA : Glycochenodeoxycholic acid GCShc : Gamma-glutamylcysteine synthetase heavy chain subunits

14 GCSlc : Gamma-glutamylcysteine synthetase light chain subunits GSH : Glutathione GST : Glutathione-transferases ’ ’ H2-DCFDA : 2 ,7 -dichlorodihydrofluorescein H2O2 : Peroxyde d’hydrogène HH : Human hepatocytes HNF : Hepatocyte nucleor factor HO1 : Heme oxygenase-1 ICP : Intrahepatic cholestasis of pregnancy IL-1β : Interleukine-1β IL-6 : Interleukine 6 IL-8 : Interleukin 8 JAMs : Junctional adhesion molecules LCA : Lithocholic acid LDH : Lactate dehydrogenase LPAC : Low-phospholipid-associated cholelithiasis LPS : Lipopolysaccharides LRH-1 : Liver receptor homolog 1 LXR : Liver X receptor MAPK : Mitogen-activated protein kinase MDR : Multidrug resistance protein MK571 : (E)-3-[[[3-[2-(7-chloro-2-quinolinyl)ethenyl]phenyl]-[[3- dimethylamino)-3-oxopropyl]thio]methyl]thio]-acide propanoique MnSOD : Manganese superoxide dismutase MRP : Multidrug resistance-associated protein MPTP : Mitochondrial permeability transition pore MTT : Methylthiazoletetrazolium NAC : N-acetylcysteine NaOH : Hydroxyde de sodium NAT : N-acetyltransferases NFAT : Nuclear factor of activated T-cells Nrf2 : NF-E2-related factor 2 NTCP : Na+-Taurocholate cotransporting polypeptide OA- : Organic anions OATP : Organic anions transporting polypeptide OC+ Organic cations OCT : Organic cation transporter OST : Organic solute transporter PBS : Phosphate Buffered saline PC : Phosphatidylcholine

15 PFIC : Progressive familial intrahepatic cholestasis PK-ADME-TOX : Pharmacokinetic-absorption-distribution-metabolism- excretion-toxicity PKC : Protein kinase C PXR : Pregnane X receptor ROS : Reactive oxygen species SULT : Sulfotransferase TCA : Taurocholic acid TCDCA : Taurochenodeoxycholi c acid TNFα : Tumor Necrosis Factor α UDCA : Ursodeoxycholic acid UGT : Uridine 5’-diphospho-glucunosyltransferases YFP : Yellow fluorescent protein ZO : Zonula occludens proteins LSD1 : Lysine-specific histone demethylase1

16 17 Foreword

Drug-induced liver injury (DILI) is the major cause of drug withdrawal during the development and marketing process. It is assumed that DILIs are responsible for more than 50% of liver diseases. Adverse drug reactions are usually classified either as dose-dependent and reproducible (intrinsic) such as those observed with cyclosporine A (CsA) or unpredictable (idiosyncratic) occurring only in certain susceptible patients as observed with chlorpromazine (CPZ). The drug-induced liver toxicity can be characterized by different lesions: apoptosis/necrosis, phospholipidosis, steatosis, cholestasis which chronically can lead fibrosis and cirrhosis. The mechanisms involved in the idiosyncratic liver toxicity remain poorly understood.

Better prediction of DILI toxicity represents a major challenge. In vivo animal models are widely used to study adverse drugs effects on the liver. Even though they are essential for the pre-clinical investigations, they are not always the appropriate model to predict drug-induced toxicity because of the interspecies variation. By contrast, hepatocyte cultures are recognized as a very potent in vitro model for toxicological studies. Primary human hepatocytes (HH) represent the golden model for such studies allowing researchers to avoid the problem of interspecies variability.

However, the scarcity and inter-individual variation of enzymatic functions remain the major limitation of their use. In the last decade the hepatic cell line, HepaRG, has emerged as an alternative to primary HH. Derived from a cholangio- hepatocarcinoma, it can differentiate into two cellular population; mature hepatocytes surrounded by biliary-like/progenitor cells. Today, this metabolically competent

18 hepatic cell line appears as a unique model to study metabolism and acute and chronic toxicity of drugs.

Drug-induced cholestasis represents a frequent manifestation of DILIs in humans.

Around 40% of DILIs lead to intrahepatic cholestatic diseases which can develop to severe liver injuries that could end with mortality. A major problem of drug-induced cholestasis is that the accurate prediction of risk of this DILI is dramatically low. Till now, up to 40% of drug-induced cholestatic cases remain unpredictable. The aim of work was to induce cholestasis by various cholestatic drugs in HepaRG cells, to investigate the mechanisms implicated in such lesions and identify new biomarkers of drug-induced cholestasis that could be of great help in the development of screening methods for early prediction of drug-induced cholestatic side effects.

19 General Introduction

20 21 I. The liver: Metabolism and elimination of xenobiotics and endogenous compounds

The liver is the largest organ of the body and a vital organ of the digestive system present in vertebrates and some other animals. It plays a major role inmetabolismand supports a number of key functions in the body, including glycogen storage, destruction of red blood cells, plasma protein synthesis, hormone production, and detoxification. It produces bile, an alkaline compound which aids in digestion via the emulsification of lipids.

I.1. Histology of the liver

I.1.1. The hepatic lobule: the structural unit of the liver

The liver is a heterogeneous tissue consisting of many cell types (hepatocytes, endothelial cells, Kupffer cells, stellate cells, bile duct cells…). Sheets of connective tissue divide the liver into thousands of small units called lobules. The lobule is the structural unit of the liver; it is roughly hexagonal in shape, with portal triads at the vertices and a central vein in the middle (Figure 1). Each lobule is constructed around a central vein that collects the sinusoidal blood containing a mixture of blood supplied by branches of the portal vein and the hepatic artery. The hepatic lobule consists of anastomosing plates of hepatocytes limiting blood sinusoidal spaces. Each cellular plate is two cells thick and between the two cells are small bile canaliculi that empty into terminal bile ducts. Branches of the hepatic artery and portal vein, together with a bile duct, form the classic portal triad found in the portal space surrounding the hexagonal-shaped hepatic lobule (Lima 1980).

I.1.2. The hepatic acinus is the functional unit of the liver

The acinus is more difficult to define histologically than the lobule, but represents a unit that is of more relevance to hepatic function because it is oriented around the afferent vascular system (Rappaport et al. 1954). The acinus consists of an irregular shaped, roughly ellipsoidal mass of hepatocytes aligned around the hepatic arterioles and portal venules just as they anastomose into sinusoids. The acinus is roughly

22 divided into zones that correspond to distance from the arterial blood supply, with different metabolic functions in hepatocytes in each zone (Lima 1980). The functional liver cells, the hepatocytes, are the liver parenchymal cells (Blouin et al. 1977). These are polarized cells with three different and specialized membrane domains: the basolateral, lateral and canalicular domains. - Basolateral or sinusoidal domain: Each hepatocyte is in contact with at least two of its faces with the blood at the sinusoids, at the level of the space of Disse. The sinusoidal membrane of the hepatocytes represents 70% of the total membrane surface. Hepatocyte-blood exchanges occur mainly by endocytosis/exocytosis phenomena through this membrane domain. Exchanges that take place at the basolateral domain are bidirectional; substances that are transported by blood can be absorbed by the hepatocyte, whereas plasma proteins albumin, fibrinogen, prothrombin and some coagulation factors are secreted into the blood stream (Treyer and Musch 2013). - Canalicular or apical domain: Canalicular plasma membrane domain represents 15% of the cell surface. This pole is also known as the biliary pole of the hepatocyte. It forms the bile canaliculus (see below in paragraph I.1.3); the latter is formed by the space between the opposed faces of two adjacent hepatocytes. A network of contractile microfilaments located in the cytoplasmic region that controls the opening of the tubules and thus the bile flow. However, the diameter of the bile canaliculus varies with its place in the acinus.

23 Figure 1: The hepatic lobule (modified from Servier Medical Art)

I.1.3. Structure and motility of bile canaliculi

Bile canaliculi are small channels formed between two or more adjacent hepatocytes. Canalicular space, approximately 0.75 -1 µm in diameter (Watanabe et al. 1991b), is formed by the opposing membranes of contiguous hepatocytes and are delimited and separated from the basolateral region of the hepatocytes by tight junctions supported by adherens junctions (Gallin 1997; Oda et al. 1974). These tight junctions appear to be sufficiently impermeable to ions thus they support a potential difference between the canalicular lumen and the basolateral surface of approximately -10 to - 15 mV (Wehner and Guth 1991). The canalicular membranes form extensive microvilli. Canalicular microvilli extend from the plasma membrane surface into the canalicular space; these microvilli are 500 to 1000 nm in length and 100 nm in diameter and contain bundles of actin filaments (Tsukita and Tsukita 1989; Watanabe et al. 1991a).

24 The cytoplasmic face of the canalicular membrane is associated with a dense cytoskeletal network consisting of actin microfilaments and cytokeratin intermediate filaments. The pericanalicular web consists of two populations of filaments. The first, directly underlying the apical plasma membrane, and it is a web of microfilaments into which the microvilli microfilament cores are inserted (Ishii et al. 1991). The second is a more distal and a highly oriented band of microfilaments that insert into the adherens junctions that are just basal to the tight junctions (Ishii et al. 1991). Associated with this actin canalicular sheath of microfilaments is a dense network of keratin intermediate filaments and myosin in the pericanalicular cytoplasm (Watanabe et al. 1991a; Yasuura et al. 1989). In addition, several tight junction-associated proteins have been identified and may interact with pericanalicular actin (Grosse et al. 2013). Tight junctions segregate the apical surface from the basolateral surface of the hepatocytes, thereby maintaining cell polarity (Kojima et al. 2003). In hepatocytes tight junctions have the same components as in other epithelial and endothelial cells, they are composed mainly of claudins, occludin, junctional adhesion molecules (JAMs), Zonula occludens proteins (ZO)-1, ZO-2, ZO-3, and others (Lee and Luk 2010). It has been thought that bile canaliculi are rigid structures that lack motility and that function as mere conduits conveying bile to the portal bile ducts. However, a concept that pericanalicular actin filaments control a canalicular contractile process to facilitate bile flow was evolved in 1974 (Oda et al. 1974). Using time lapse microscopy, strong evidence for bile canalicular motility came from in vitro studies using isolated rat hepatocyte couplets (IRHC). It has been shown that bile canaliculi open and close repeatedly; this dynamic process is accompanied by the expelling of a bolus of bile (Oda et al. 1974; Oshio and Phillips 1981; Phillips et al. 1975). Contractile proteins are noticed to be present throughout the cytoplasm in hepatocytes and are particularly found beneath the pericanalicular region by electron microscopy (Phillips et al. 1975; Phillips et al. 1981), immunostaining (Tsukada et al. 1994; Watanabe et al. 1991a), and biochemical analysis (Gordon et al. 1977), and it has been shown that disturbance of canalicular contraction may lead to intrahepatic cholestasis (Oshio and Phillips 1981; Watanabe et al. 1991b). However, further investigations are required for better elucidating the role of canalicular dynamics in biliary excretion and development of cholestatic pathology.

25 I.1.4. The Biliary System

The biliary system is a series of channels and ducts that conveys bile, a secretory and excretory product of hepatocytes, from the liver into the lumen of the small intestine. Hepatocytes are arranged in "plates" with their apical surfaces facing and surrounding the sinusoids. The basal faces of adjoining hepatocytes are welded together by junctional complexes to form canaliculi, the first channel in the biliary system (Figure 2). A bile canaliculus is not a duct, but rather, the dilated intercellular space between adjacent hepatocytes. At the ends of the canaliculi, bile flows into bile ducts, which are true ducts lined with epithelial cells. Bile ducts thus begin in very close proximity to a hepatic arteriole and a portal venule and form together the portal triad. These bile ducts drain bile and to the right and left hepatic ducts which join into the common hepatic duct. The common hepatic duct then joins with the cystic duct from the gallbladder. This is a sac-like structure adhering to the liver which leads directly into the common bile duct that empty in the duodenum. During periods of time when bile is not flowing into the intestine, it is diverted into the gall bladder, where it is dehydrated and stored until needed.

Figure 2: The biliary tree (Boyer 2013).

26 I.2. Metabolism and elimination of xenobiotics and endogenous compounds

A major and essential function of the liver is detoxification. This organ is capable of metabolizing many xenobiotics and endogenous substrates due to its developed enzymatic machinery (cytochromes P450 (CYPs) and phase II enzymes). Indeed, most of the substances that enter the body, including drugs, are metabolized primarily in the liver. Generally, they are subjected to three biotransformation steps facilitating their elimination from the body: phase reactions I, II and III. Phase I reactions involve mainly modification of the functional group of the compounds rendering them more polar (water soluble) and thus reduce their toxicity. However, sometimes these reactions lead to more toxic effects than the parent drug substances. Phase I consists mainly of oxidation (hydroxylation, epoxidation, dehydrogenation), reduction and hydrolysis reactions (David Josephy et al. 2005; Iyanagi 2007), which are mainly catalyzed by the cytochrome P450s (Evans and Relling 1999). Phase I reactions are generally followed by phase II reactions since the phase I metabolites are not polar enough to be easily eliminated. Phase II reactions provide conjugation of phase I metabolites to endogenous molecules (glucuronic acid, activated sulfate, glutathione...) in order to increase their solubility and facilitating their elimination (Testa and Kramer 2008). Among the enzymes catalyzing these reactions are found UDP-glucuronosyltransferases (UGT), glutathione-transferases (GST), sulfotransferases (SULT), N-acetyltransferases (NAT) and epoxide hydrolases (EH). After undergoing the necessary modification by the phase I and II enzymes, metabolized compounds are carried by transport proteins (phase III) to be excreted without undergoing chemical modifications. The activity of these enzymes can vary greatly from one individual to another, depending on numerous factors (genetic, physiological, pathological and environmental), by acting at the transcriptional, post- transcriptional and post-translational levels. In addition, many compounds can inhibit or induce the activity of these enzymes (David Josephy et al. 2005). It is reported that 2/3 of the drugs are metabolized by CYPs and 1/3 by the UGTSs and other enzymes. The total contribution of CYPs and UGTs in drug metabolism is

27 estimated about 80%. The liver is responsible for the degradation of several hormones such as thyroid hormone, glucocorticoids, insulin, glucagon, estrogen and etc... The degradation products of these hormones are then excreted in the bile (Nebert and Russell 2002; Park et al. 2005a; Wilkinson 2005).

I.3. The liver: the primary target of toxic xenobiotics

Although all body organs may suffer toxicity of xenobiotics, the liver is the primary target organ, with the heart and the blood vessels, of adverse drug reactions (Lee 2003). Hepatic toxicity is one of the main causes of the withdrawal of drugs during preclinical and clinical studies or post-marketing; it represents a major health problem that it is responsible for more than half of the cases of acute liver failure worldwide. Certain drugs (and other xenobiotics) can induce hepatotoxicity in most exposed individuals, while others affect only few susceptible individuals following acute or chronic exposure (Lioy et al. 2011; Liu et al. 2005; Tournel et al. 2011), mostly due to the formation of reactive metabolites during their biotransformation. More than 1000 drugs and herbal products are recognized as hepatotoxic (Biour et al. 2004). The types and severity of lesions induced by hepatotoxic agents depend on the dose and the exposure mode. A single or short-term exposure to a hepatotoxic compound can cause cell death (necrosis/apoptosis), cholestasis, inflammation, steatosis, phospholipidosis while repeated exposures can lead to more severe lesions as fibrosis and even cirrhosis. Two major types of toxicity induced by hepatotoxic compounds are usually distinguished; intrinsic (predictable) toxicity and idiosyncratic (unpredictable) toxicity.

I.3.1. Intrinsic toxicity

Intrinsic toxicity is induced regularly by a high dose or repeated exposure to normal doses of a toxic agent. This type of toxicity is characterized by high incidence, reproducibility and predictability in humans and in animals. It is characterized by a dose-response effect, and the higher the dose is, the higher the toxicity. Acetaminophen (APAP), which is one of the most used over-the-counter (non- prescribed) drugs for its antipyretic and analgesic effect can induce intrinsic toxicity. Even though this drug is not toxic at the therapeutic dose, it is, due to chronic

28 exposure or after high acute dose, representing the major cause of drug-induced liver failure and death in the United States (Lee 2004; Ostapowicz et al. 2002).

I.3.2. Idiosyncratic toxicity

Idiosyncratic toxicity is a drug reaction that occurs rarely and unpredictably among the population which makes it a relatively difficult investigation. An idiosyncratic response to a xenobiotic is an unexpected response, triggered generally by exposure to non-toxic doses; the severity of this toxicity shows no dependence on the dose. Amiodarone (Lu et al. 2012) and chlorpromazine (Buchweitz et al. 2002) are examples of drugs inducing idiosyncratic toxicity. Idiosyncratic drug-induced liver (iDILI) is frequently associated with high daily doses > 50mg. Mechanisms underlying iDILI remain unproven and are associated with occurrence of inflammation and immune reaction in susceptible patients. Clinical manifestations of idiosyncratic hepatotoxicity induced by xenobiotics, are relatively the same as in intrinsic toxicity.

I.3.3. Types of drug-induced hepatic lesions

Various drugs, such as certain hypotensive, vasodilators, anti-inflammatory agents and oral contraceptives, can cause a transient increase in transaminase levels which revert to normal level after the drug is stopped. These reactions cannot be predicted (Goldfarb 1976). Besides, a number of drugs can induce a large spectrum of clinical and pathological manifestations of liver lesions. The various types are shown in Figure 3. In some cases the mechanism may involve the parent compound, while in others a metabolite may be responsible. In the following we discuss briefly the frequent drug-induced hepatic lesions and the known underlying mechanisms using specific examples, according to the type of injury. In Table 1 the most drugs that are known to induce hepatic injuries.

29 Figure 3: Types of drug-induced hepatic lesions (Kshirsagar et al., 2008).

A. Hepatocellular injury

A number of drugs may cause direct damage to the liver parenchyma. However, it may have various underlying mechanisms. Paracetamol causes predictable centrilobular hepatic necrosis in experimental animals as well as man after overdoses (Boyd and Bereczky 1966). It is well characterized and the mechanisms are mostly understood. Paracetamol induces a predictable liver damage due to direct cytotoxicity of a metabolite as indicated by extensive studies on both experimental animals and man. Three pathways are responsible for paracetamol metabolism, two of which are conjugation reactions that remove rapidly a major portion of the drug. A minor pathway accounting for about 5 % of the dose, catalysed by the microsomal enzymes that lead to generation of a reactive metabolite, N-acetyl-p-benzoquinone imine (NAPQI). Following normal doses, NAPQI is detoxified by conjugation with the ubiquitous tripeptide glutathione, and excreted as the N-acetylcysteine derivative in the urine. However, after overdoses the amount of reactive metabolites is sufficient to deplete the available hepatic glutathione. The reactive metabolite then reacts covalently with cellular macromolecules.

30 B. Cholestasis

Intrahepatic cholestasis is a frequent manifestation of DILI and its characterized by inability of the hepatocyte to secrete bile due to impairment of the transport system or alterations of bile canaliculi or bile ducts (Popper 1968). Cholestasis is frequently mixed, i.e. associated with hepatocellular injury. Classification, features and mechanism of drug-induced cholestasis are detailed in Chapter III. As examples, phenothiazines like chlorpromazine, trifluoperazine, promazine, pecazine, etc. can induce cholestasis, not dose-dependent, after an initial period of sensitization of 1-4 weeks or previous exposure. Chlorpromazine may cause mixed hepatocanalicular jaundice with parenchymal injury as well as cholestasis. Other drugs such as cyclosporine A induce dose-dependent cholestasis. Anabolic and androgenic agents and oral contraceptives may also induce this type of cholestasis. Cholestasis induced by steroids is usually mild and reversible when the drug is stopped. Electron microscopic examination of the rat liver following the administration of these drugs would reveal important changes in bile canaliculi such as dilation and loss of microvilli (Breen et al. 1975).

C. Steatosis

Steatosis refers as to an accumulation of triglycerides into intracytoplasmic vesicles in hepatocytes. It represents a reversible state of metabolic dysfunction that can possibly progress to inflammatory steatohepatitis, fibrosis, cirrhosis, and even hepatocellular carcinoma (Antherieu et al. 2012; Begriche et al. 2011). Tetracycline is an antibiotic which is found to induce fatty liver (steatosis) following over intravenous doses. This toxic effect is very rare after oral doses and occurs more commonly in females than males. Tetracycline induces direct, predictable and dose-dependent steatosis, and can be reproduced in experimental animals. The major effect seems to be inhibition of transport of lipid out of the hepatocyte, which can be detected within 30 minutes of exposure in experimental animals. This effect may well be due to the inhibition of protein synthesis caused by tetracycline which will inhibit the production of the apolipoprotein complex involved in transport of the very low density lipoprotein (VLDL) out of the hepatocyte (Breen et al. 1972). Alternative mechanisms may

31 involve decreased fatty acid oxidation, increased triglyceride uptake or increased fatty acid uptake.

D. Phospholipidosis

Phospholipidosis is characterized by an excessive intracellular accumulation of phospholipids typified as lamellar bodies that are easily detected by electron microscopy examination. A number of cationic amphiphilic drugs, including amiodarone and chlorpromazine, have been reported to induce phospholipidosis in few patients (Shaikh et al. 1987), and various organs may be affected. The features of this form of hepatic damage are an accumulation of phospholipids in hepatocytes, bile duct proliferation and inflammation in the portal area. The mechanism is thought to involve the formation of complexes between lipid micelles or liposomes, and the drug. The interaction between phospholipids and the drug is believed to alter the surface charge of the phospholipid micelle or liposome in such a way that block the ability of phospholipases to break them down (Bahri et al. 1981).

E. Chronic active hepatitis, fibrosis and cirrhosis

Chronic active hepatitis (after more than 6 months treatment) which is characterized by inflammation and hepatocyte necrosis leads to development of fibrosis and cirrhosis; it is observed with the use of a number of drugs such as nitrofurantoin and isoniazid. Long term administration of the antitubercular drug isoniazid leads to hepatic dysfunction in a significant proportion of recipients (10-20%). These effects are usually mild and subside despite continued therapy. However, some 0.1-1% of patients develops severe hepatic injury. Pre-existing liver dysfunction, such as alcoholic cirrhosis increases susceptibility. The mechanism of isoniazid induced hepatic injury involves production of toxic metabolites, acetylisoniazid and especially acetylhydrazine, that are extremely hepatotoxic causing centrilobular hepatic necrosis.

F. Other lesions (Liver tumors,…)

The underlying mechanisms of drug-related tumors remain poorly understood. Anabolic steroids have been implicated as responsible for primary hepatocellular

32 carcinomas and adenomas. Similarly use of contraceptive steroids has been associated with liver tumors.

Table 1: Most common or well-described DILI agents and the patterns of their liver injury (Chalasani et al. 2014).

Antibiotics Latencya Typical pattern of injury/identifying features Amoxicillin/clavulanate Short to Cholestatic injury, but can be hepatocellular; moderate DILI onset is frequently detected after drug cessation Isoniazid Moderate Acute hepatocellular injury similar to acute to long viral hepatitis Trimethoprim/sulfamethoxazole Short to Cholestatic injury, but can be hepatocellular; moderate often with immunoallergic features (e.g., fever, rash, eosinophilia) Fluoroquinolones Short Variable: hepatocellular, cholestatic, or mixed in relatively similar proportions Macrolides Short Hepatocellular, but can be cholestatic Nitrofurantoin Acute form (rare) Short Hepatocellular Chronic form Moderate Typically hepatocellular; often resembles to long idiopathic autoimmune hepatitis (months– years) Minocycline Moderate Hepatocellular and often resembles to long autoimmune hepatitis Anti-epileptics Phenytoin Short to Hepatocellular, mixed, or cholestatic often moderate with immune-allergic features (e.g., fever, rash, eosinophilia) (anti-convulsant hypersensitivity syndrome) Carbamazepine Moderate Hepatocellular, mixed, or cholestatic often with immune-allergic features (anti-convulsant hypersensitivity syndrome) Lamotrigine Moderate Hepatocellular often with immune-allergic features (anti-convulsant hypersensitivity syndrome) Valproate Hyperammonemia Moderate Elevated blood ammonia, encephalopathy to long Hepatocellular Moderate Hepatocellular to long Reye-like syndrome Moderate Hepatocellular, acidosis; microvesicular steatosis on biopsy

33 Analgesics Non-steroidal anti-inflammatory Moderate Hepatocellular injury agents to long Immune modulators Interferon-β Moderate Hepatocellular to long Interferon-α Moderate Hepatocellular, autoimmune hepatitis-like Anti-TNF agents Moderate Hepatocellular. Can have autoimmune to long hepatitis features Azathioprine Moderate Cholestatic or hepatocellular, but can present to long with portal hypertension (veno-occlusive disease, nodular regenerative hyperplasia) Herbals and dietary supplements Green tea extract (catechin) Short to Hepatocellular moderate Anabolic steroids Moderate Cholestatic; likely contained as adulterants in to long performance-enhancing products Pyrrolizidne alkaloids Moderate Sinusoidal obstruction syndrome/veno- to long occlusive disease; contained in some teas Flavocoxib Short to Mixed hepatocellular and cholestatic moderate Miscellaneous Methotrexate (oral) Long Fatty liver, fibrosis Allopurinol Short to Hepatocellular or mixed. Often with immune- moderate allergic features. Granulomas often present on biopsy Amiodarone (oral) Moderate Hepatocellular, mixed, or cholestatic. to long Macrovesicular steatosis and steatohepatitis on biopsy Androgen-containing steroids Moderate Cholestatic. Can present with peliosis hepatis, to long nodular regenerative hyperplasia, or hepatocellular carcinoma Inhaled anesthetics Short Hepatocellular. May have immune-allergic features±fever Sulfasalazine Short to Mixed, hepatocellular, or cholestatic. Often moderate with immunoallergic features Proton pump inhibitors Short Hepatocellular; very rare DILI, drug-induced liver injury; TNF, tumor necrosis factor. a Short=3–30 days; moderate=30–90 days; long >90 days.

34 I.3.4. Mechanisms of DILI

Over the past decades, much effort has been put into research to understand the mechanisms of hepatotoxicity and explore biomarkers for DILI surveillance. The underlying mechanisms of drug-induced toxicity are variable and sometimes poorly defined. It could be due to genetic polymorphism of the enzymes involved in the metabolism of the drug, or drug-drug interactions, mitochondrial toxicity, or generation of highly reactive intermediates and therefore oxidative stress (Grober 2012; McGill and Jaeschke 2013). Direct hepatotoxicity is often caused by the direct action of a drug, or more often a reactive metabolite of a drug, against hepatocytes. One classically studied drug used to examine the mechanisms of hepatotoxicity is acetaminophen (APAP). APAP overdose depletes glutathione and initiates covalent binding to cellular proteins. These events lead to the disruption of calcium homeostasis, mitochondrial dysfunction, and oxidative stress and may eventually culminate in cellular damage and death. Fortunately, drug candidates that induce significant direct hepatotoxicity at therapeutic doses are more likely to be detected during preclinical toxicity screening and thus rarely reach the pharmaceutical market. Reactive metabolites are mostly formed through oxidation or reduction by cytochromes P450 (CYP). Intermediate reactive drug metabolites are also believed to be an important factor in iDILI development (Leone et al. 2014). The reactive nature of these metabolites enables them to covalently bind to cellular proteins and consequently interfere with protein activity. In addition, reactive drug metabolites can cause enhanced level of reactive oxygen species (ROS) through redox cycling or glutathione depletion, potentially leading to cellular stress, activation of signal transduction pathways and subsequent hepatocyte injury/death (Chen et al. 2013). Many environmental insults or drugs (tetracycline, amiodarone, valproate and various antiviral nucleoside analogues) can directly damage mitochondria and deplete mitochondrial DNA. Inhibition of the electron transport chain leads to accumulation of reducing equivalents which generate ROS. Damage from ROS, such as oxidation of mitochondrial proteins, lipids and DNA, builds up within mitochondria. DILI related to mitochondrial toxicity is generally characterized by

35 microvesicular steatosis, focal necrosis and cholestasis. In most instances of DILI, it appears that hepatocyte damage triggers the activation of other cells, which can initiate an inflammatory reaction and/or an adaptive immune response. These secondary events may overwhelm the capacity of the liver for adaptive repair and regeneration, thereby contributing to the pathogenesis of liver injury. Inflammation and innate immune system also found to be involved in DILI, following some extent of initial cell death, the released cellular content of dead cells may activate innate immune cells including Kupffer cells, infiltrating monocytes and neutrophils in a paracrine fashion. High mobility group box 1 (HMGB1), as well as heat shock proteins and DNAs, are released from necrotic hepatocytes (Antoine et al. 2009; Kubes and Mehal 2012). These molecules have been termed damage- associated molecular patterns (DAMPS). DAMPs are able to bind to toll-like receptors of innate immune cells and promote the production of the cytokines such as TNF-alpha, IFNγ and IL-1 which could further modulate the intracellular events. Hepatic inflammation is frequently observed in DILI. It is conceivable these pro- inflammatory cytokines sensitize hepatocytes to biochemical stress, or regulate the adaptive immune-mediated cell injury. Trovafloxacin causes idiosyncratic liver injury in human, but is nontoxic to mice. Co-administration of LPS and trovafloxacin renders mice susceptible to severe hepatic necrosis (Shaw et al. 2007). This suggests that an innate immune response could mediate DILI. However, clinical relevance of this model is unclear since the injury caused by this drug in humans appears to involve the adaptive immune system. The role of innate immune response in hepatic necrosis is quite controversial. It is believed that innate immunity is more likely beneficial in the clearance of necrotic cells and promoting tissue repair. Even though both intrinsic and idiosyncratic DILI intersect in the mechanisms explained above, adverse reactions of iDILI are more complicated, and are not predicted by typical preclinical toxicity testing. The infrequency of most iDILI responses suggests that individual susceptibility as well as characteristics of the offending drug are needed to elicit a response. A longstanding hypothesis is that iDILI-associated drugs activate a damaging adaptive immune response (Uetrecht 1999).

36 I.3.4.1. The role of adaptive immunity in iDILI

Some DILI cases (for example: sulindac, phenytoin, and amoxicillin-clavulanic acid) have classic features of an allergic reaction such as a rash, fever and eosinophilia. The hypothesis is the drug or its metabolites act as haptens and covalently bind to hepatic proteins such as cytochrome P450. The drug-protein adducts are further processed in the macrophage/dendritic cell and presented as an antigen in complex with major histocompatibility complex (MHC) class II molecules, triggering the adaptive immune response by binding to T cell receptors of CD4 cells. This leads to CD8+ cytotoxic T-cell activation. The sensitized CD8+ T cells express FasL, TNF- alpha, and perforin that mediate cell death of hepatocytes. Although, most idiosyncratic DILI cases lack features of the systemic allergic reaction, adaptive immunity is believed to play a pivotal role in initiation and propagation of liver injury (Kaplowitz 2012). The best example of involvement of delayed adaptive immune response and DILI is that observed with β -lactam antibiotics. Indeed, Formation of hapten–protein complexes with various β -lactam antibiotics occurs via the nucleophilic opening of the β -lactam ring and results in hapten addition to lysine residues. Most research on hapten–protein complexes with β -lactams in humans and animals has identified human serum albumin (HSA) as the major target for β -lactams. Flucloxacillin is a β -lactam antibiotic that is effective against β -lactamase-producing bacteria. Human exposure is associated with hypersensitivity reactions that target the liver. Flucloxacillin, a β -lactam antibiotic widely used in Europe, can lead to a characteristic cholestatic hepatitis in a minority (<1%) of patients within 45 days of starting treatment. Flucloxacillin is able to bind irreversibly to HSA after lysine residues modification. Hapten–protein complex formation occurred with both flucloxacillin and its 5-hydroxymethyl metabolite (Carey and van Pelt 2005). Drug- responsive T-cells have been identified in peripheral blood of patients presenting with each form of adverse reaction (Mousavi et al. 2009). In patients with flucloxacillin- induced cholestatic liver injury, CD8+ T-cells are preferentially activated by drug antigens. Flucloxacillin-specific CD8+ clones express gut homing chemokine receptors and secrete IFN-γ and cytolytic molecules including Fas-L, perforin, and granzyme-B when activated.

37 Some drugs, especially biologic immune modulators can activate underlying autoimmune hepatitis. In addition, a few other drugs (e.g. minocycline, nitrofurantoin) appear to cause a rare form of idiosyncratic adverse reactions indistinguishable from autoimmune hepatitis that could be reduced after stopping of the drug (Czaja 2011). These cases represent an interesting liver manifestation as a result of interaction between drugs and the host immune system.

I.3.5. Risk factors

The risk of developing hepatotoxicity involves a complex interplay between the chemical properties of the drug, environmental factors (e.g., the use of concomitant drugs or alcohol), age, sex, underlying diseases (e.g., HIV or diabetes), and genetic factors (Kaplowitz 2004). The most extensively documented risk factors are concomitant drug use and diseases. There is recent evidence for an increase in drug-induced liver disease among patients with HIV, hepatitis B virus, and hepatitis C virus infections. Genetic factors include genes that control the handling of the drug (metabolism, detoxification, and transport), as well as those that influence cell injury and repair. Additionally, genetic polymorphisms in genes related to immunological responses are believed to play a pivotal role in the hypersensitivity and occurrence of idiosyncratic hepatotoxicity in the susceptible patients (Shear and Spielberg 1988).

I.3.5.1. Genetic related drug-induced hepatotoxicity

Genome-Wide Association Studies (GWAS) provided several evidences that genetics has a critical role in the development of drug-induced hepatotoxicity of both intrinsic and idiosyncratic. Researchers believe that genetics could control the expression of phase I and phase II enzymes, cytokine expression or any enzyme system that has a role in the development of hepatotoxicity in response to drugs. Genetic polymorphisms in expression of CYP450 enzymes have been considered. For instance, CYP2E1*1A has been associated with the generation of a toxic metabolite of anti-tuberculous drugs (Huang et al. 2003) in addition to the development of reactive oxygen species (Vuilleumier et al. 2006). CYP2C8 has been associated with hepatotoxicity following the generation of toxic metabolites of diclofenac (Daly et al. 2007). Phase II enzymes have long been associated with

38 differences in metabolism; and shown to affect the development of drug-induced hepatotoxicity. Isoniazid is well-known to induce hepatotoxicity related to multiple reactive metabolites. Two of these reactive metabolites acetylhydrazine and hyadrazine are known to be hepatotoxic and are metabolized by N-acetyl transferase. Individuals with N-acetyl transferase 2 polymorphisms (slow metabolizers) have delayed detoxification of these toxic metabolites and thus more susceptible of isoniazid. GST also has a key role in detoxification of reactive metabolites from isoniazid in addition to neutralization of reactive oxygen species. Isoniazid is not the only drug associated with hepatotoxicity where abnormalities in phase II enzymes have been detected. Diclofenac hepatotoxicity has been associated with abnormalities in uridine-5’-diphosphate glucuronosyl transferase (UGT) 2B7*2 where the mechanism of toxicity is believed to arise from increased formation of toxic metabolites (Daly et al. 2007). In addition differences in expression of proteins associated with drug disposition have been detected in patients with drug-induced hepatotoxicity. In these situations, proteins such as multidrug resistance protein and bile salt export pump that are responsible for the excretion toxic products of drug into the bile have been associated with drug-induced hepatotoxicity. In addition to pharmacokinetic-related genes, immunological related-genes, especially the human leukocyte antigen (HLA) haplotypes, have been identified as a genetic markers to estimate the risk for idiosyncratic toxicity following certain drugs and explain drug hypersensitivity. GWAS revealed a strong association between idiosyncratic DILI (iDILI) and genetic polymorphisms in HLA region on chromosome 6, suggesting a prominent role for the immune system in iDILI (Hautekeete et al. 1999; O’Donohue et al. 2000). HLA genotyping of 75 Spanish amoxicillin-clavulanate hepatotoxicity cases has also demonstrated phenotype-specific HLA associations (Stephens et al. 2013). A justification for the detected HLA associations would be the involvement of haptenization, whereby reactive drug metabolites covalently bind to carrier proteins to form adducts that can function as neoantigens. Neoantigens are then presented in HLA grooves on antigen-presenting cells and subsequently mislead the immune system into mounting an immune response against healthy hepatocytes (Lavergne et al. 2008). A GWAS on flucloxacillin hepatotoxicity has revealed a strong association with the HLA-B*57 : 01 allele (Daly et al. 2009) and

39 hapten formations between flucloxacillin and albumin were recently confirmed (Carey and van Pelt 2005). However, It should be emphasized that not all patients with flucloxacillin-induced liver injury express B*57:01, and drug-specific, MHC-restricted T-cell responses are also detectable in B*57:01 negative individuals. Furthermore, CD8+ T-cells from HLA-B*57:01 positive and negative human donors can be primed with flucloxacillin through dendritic cell presentation of the drug-derived antigen to naïve T-cells (Monshi et al. 2013; Nattrass et al. 2015).

I.3.6. Models for liver toxicity studies

A. Different models used to study drug-induced liver injuries

In vivo animal models are widely used to study adverse drugs effects on the liver. Even though they are essential for the pre-clinical investigations, they are not always the appropriate model to predict drug-induced toxicity because of the interspecies variation. Indeed, some drugs have been found to exert hepatotoxicity in humans, although this toxicity was not predicted in rodents (Jemnitz et al. 2010). It is admitted that there is no appropriate animal model for preclinical identification of drugs causing idiosyncratic toxicity. In vitro models such as isolated perfused liver, liver slices and subcellular fractions (isolated mitochondria, microsomes) were considered; however, difficulty in obtaining them and their limited lifetime to few hours represent the main limitations of these models. By contrast, primary hepatocyte cultures are recognized as a very potent in vitro model for toxicological studies. Primary human hepatocytes (HH) represent the golden model for such studies allowing researchers to avoid the problem of interspecies variability. However, in primary culture, HH quickly lose their enzymatic activities, integrity of the bile canaliculi, and functionality of hepatobiliary transporters (Guguen-Guillouzo and Guillouzo 2010). These disadvantages are relatively reduced by culturing hepatocytes in a sandwich configuration that better preserves metabolism and transport activities (Guguen-Guillouzo and Guillouzo 2010; Swift et al. 2010). However, the availability of HH remains the major limitation to their use. Hepatic cell lines have the advantage of being cultivated "indefinitely" and widely available. They are generally obtained from human hepatomas, e.g. HepG2 (Knowles et al. 1980) and Hep3B. All known hepatic cell lines including HepG2 show

40 a major loss of cytochrome P450 activity (Wilkening et al. 2003). The human metabolically competent hepatic cell line HepaRG represents an exception and this in vitro model is now widely used to investigate drug metabolism and liver injuries. In the following paragraph we discuss the major characteristics, the relevant functions, and promises of HepaRG cells

B. The HepaRG cell line

HepaRG cells have been isolated from a cholangio-hepatocarcinoma of a female patient with chronic hepatitis C infection (Gripon et al. 2002). When seeded at low density HepaRG cells transdifferentiated into bipotent progenitors and actively divided to reach confluence after 2 weeks. During the proliferation phase, the cellular population appears to be homogeneous with epithelial-like phenotype. Undifferentiated cells express specific markers of liver progenitor cells (α -fetoprotein). Progressive morphological changes are observed as they reach confluence. At this time, two different cell types started to be distinguished. Addition of dimethyl sulfoxide (DMSO) reinforces differentiation into two cellular populations: hepatocyte- like cells resembling primary human hepatocytes and epithelial-like cells which are large and flattened. After 2 weeks of confluence in the presence of DMSO, HepaRG hepatocytes represent about 50-55% of the culture (Figures 4). At the differentiated stage, HepaRG hepatocyte colonies express both morphological and functional characteristics of mature hepatocytes, which include the expression of specific glycolytic enzymes in parallel with an increase of the liver hepatic nuclear factor 4 (HNF4) transcription factors. In comparison, transient changes in β -catenin localization and HNF3β expression correlate to Notch3 up-regulation during hepatobiliary commitment of HepaRG cells (Cerec et al. 2007). Differentiated cells express liver-specific mRNAs such as those of albumin, aldolase B, CYPs (1A1, 1A2, 2B6, 2C9, 2D6, 2E1 and 3A4), phase II enzymes (UGT1A1, GSTA4, GSTA1/A2, GSTM1) and nuclear receptors (Constitutive androstane receptor (CAR), Aryl hydrocarbon receptor (AhR), Pregnane X receptor (PXR)). When HepaRG cells proliferate and differentiate toward hepatocyte-like cells, the mRNAs encoding drug-metabolizing enzymes attain levels of expression close to those found in primary human hepatocytes. It is reported that relative levels of expression of the major CYP enzymes in HepaRG cells at the differentiated stage in

41 the presence of DMSO are close to or higher than those in freshly isolated human hepatocytes (Aninat et al. 2006). Furthermore, the expression of the CYP enzymes is maintained in the differentiated HepaRG cells for at least 1 month at confluence when cultured in the presence of DMSO (Josse et al. 2008). Removal of DMSO from culture media leads to a significant reduction in the levels of expression of the CYP enzymes, although their expression remains stable at a lower level in differentiated HepaRG cell cultures for up to 2 weeks. A whole genome expression profile analysis showed that profiles of drug metabolizing genes in HepaRG cells and primary human hepatocytes are very close. HepaRG cells express genes at levels more similar to primary human hepatocytes and human liver tissue than other liver cell lines (Hart et al. 2010). Detailed investigation of the expression of 115 genes involved in xenobiotic metabolism and disposition demonstrated similar levels in HepaRG cells and primary human hepatocytes with a few exceptions. For example, CYPs 1A2, 2A6 and 2D6 showed a lower expression in HepaRG cells than in primary human hepatocytes (Andersson et al. 2012). Rogue et al. also compared the trancriptome of HepaRG cells and primary human hepatocytes (PHH) and found that HepaRG cells expressed 81 to 92% of the genes active in PHH. They also express an additional set of around 2900 genes usually expressed in cancerous and stem cells or related to the cell cycle (Rogue et al. 2012). In addition to CYP 1, 2 and 3 families, HepaRG cells also express enzymes of CYP4 family which play important roles in lipid metabolism and homeostasis such as: CYP4A11 and CYP4F3B isoforms (Madec et al. 2011). Furthermore, the transcription factors, peroxisome proliferator-activated receptors (PPAR) α and γ , which are important for the regulation of CYP4 genes and for lipid metabolism, are also expressed in the differentiated HepaRG cells. The similar expression profiles of the genes involved in lipid metabolism suggest that HepaRG cells provide an excellent human relevant in vitro model for studies of regulation of lipid metabolism and of the cellular effects of drug compounds which act as PPARα agonists or dual PPARα /γ agonists (Rogue et al. 2011). Phase II drug-metabolizing enzymes in HepaRG cells has been also evaluated. Glutathione S-transferases (GSTs) are expressed at the same level (GSTA1/2) or at lower level (GSTA4, GSTM1) in differentiated HepaRG cells than in primary human

42 hepatocytes. Uridine-5′ -diphosphate-glucuronosyltransferase UGT1A1 and UGT2B7 were reported to be expressed at higher or similar level in HepaRG cells than in freshly isolated human hepatocytes. Similarly, expression of all Phase II enzymes decreased when DMSO was removed from the culture (Aninat et al. 2006). Several investigations have explored the relative levels of expression of transporters in HepaRG cells (Antherieu et al. 2010; Le Vee et al. 2006). Differentiated HepaRG cells exhibit a phenotype close to that of human hepatocytes and express functional bile canalicular structures as evidenced by fluorescein excretion (Cerec et al. 2007). HepaRG cells express the majority of influx and efflux transporters of bile acids, organic anions and cations and drugs (as OCT1 (organic cation transport 1), OATP (organic anion transporting polypeptide) - B, OATP-C, NTCP (Na+-taurocholate co- transporting polypeptide), MRP (multidrug resistance-associated protein) 2, MRP3, BSEP (bile salt export pump) and MDR (multidrug resistance protein 1) (Le Vee et al. 2006; Le Vee et al. 2013). The uptake transporters seem to be expressed at a lower level than in primary human hepatocytes, with the exception of OATP2B1. On the other hand, the efflux transporters in the HepaRG cells seem to be expressed at higher or at the same level as in primary human hepatocytes, except for BSEP which is expressed at a lower level in HepaRG cells. In common with BSEP, the expression of sodium/bile acid co-transporter, NTCP, is also lower in HepaRG cells than in primary human hepatocytes (Kanebratt and Andersson 2008; Le Vee et al. 2006). It has been found that expression of the MDR1, MRP2 and BSEP transporters could be induced by the nuclear receptor agonists rifampicin, phenobarbital and chenodeoxycholic acid, respectively, indicating that the regulation of expression of drug transporters is similar in HepaRG cells as in primary human hepatocytes. The functional activity of the efflux transporters MRP2, BSEP and MRP1 has been demonstrated in differentiated HepaRG cells by using fluorescent substrates and quantifying appearance of the probes by fluorescence microscopy (Antherieu et al. 2010). The accumulation was restricted to the canalicular spaces between cells, indicating a correct plasma membrane distribution of theses transporters in the polarization of HepaRG cells. In polarized hepatocytes, the basolateral and apical plasma membrane domains are separated by tight junctions, which seal the lumen of bile canaliculi between adjacent hepatocytes and provide a barrier that prevents

43 diffusion between the blood and bile. It has been reported that formation of tight junctions and the location of canaliculi in cultured HepaRG cells by staining of the ZO-1 protein, which is a tight junction-specific protein. This suggests that HepaRG cells could be utilized as an in vivo-like uptake–metabolism–secretion model for use in biliary secretion studies of both parent compounds and of metabolites formed within liver cells. These characteristics render the HepaRG cell line as a relevant model to investigate drug effects on bile flow. Recently induction of cholestasis by the cholestatic drug chloropromazine has been evidenced in HepaRG cells (Antherieu et al. 2013) The differentiation of HepaRG cells to both hepatocyte- and biliary-like cells with a stable phenotype is very useful for drug metabolism and disposition in vitro models in drug discovery and development. By contrast, primary human hepatocytes exhibit poor preservation of many functions in culture. In particular, cell suspensions of primary human hepatocytes rapidly lose their drug-metabolizing and drug-transporter activities, which limit their utility and reliability as an in vitro tool in drug discovery. The HepaRG cells could thus replace primary human hepatocytes in many in vitro models. One immediate application has been the use of HepaRG cells as a human relevant CYP induction model which reliably predicts the liability of drug compounds to induce CYP enzymes in vivo in humans. The long-term stability of the expression of drug-metabolizing enzymes and transporters in combination with the correct plasma membrane polarization also makes the HepaRG cells especially useful in drug disposition models. The long-term stability of the functionality of the HepaRG cells means that they are well suited to liver toxicity studies. The HepaRG cells have been used to explore metabolism-dependent genotoxicity and liver toxicity and also to assess toxicity involving other mechanisms (e.g., steatosis, phospholipidosis, or cholestasis).

44 Figure 4: Phase-contrast micrographs of HepaRG cells.

45 II. Synthesis and excretion of bile

Bile is a complex liquid secreted by the liver. It is essential for the elimination of xenobiotics (drugs), and endogenous metabolic products such as cholesterol, bile acids, bilirubin, phospholipids and certain hormones. Discharged in the duodenum, bile ensures the absorption of dietary lipid and fat-soluble vitamin in the intestinal lumen (Zollner et al. 2006a). Bile acids (BAs) are the major components (67%) of bile, followed by phospholipids (22%), proteins (4.5%), cholesterol (4%) and bilirubin (0.3%). The primary bile acids, cholic acid (CA) and chenodeoxycholic acid (CDCA), represent nearly 50% of total bile acids, whereas the secondary bile acids, such as deoxycholic acid (DCA), lithocholic acid (LCA), ursodeoxycholic acid (UDCA) and sulfolithocholic acid are found in lesser amounts in the bile (Reshetnyak 2013). Bile formation involves different cellular and molecular processes for the synthesis of bile acids. BAs have two different origins; either they are synthesized in hepatocytes from their precursor cholesterol, or re-taken back by the hepatocytes from the circulating blood in the liver sinusoids. Regardless of their origin, BAs excreted into the bile ducts, are responsible for driving bile flow (Zollner et al. 2006b). Under normal conditions, 200-600 mg primary BAs are formed daily (Chiang 2009; Shefer et al. 1988). Bile acid synthesis increases in the morning independent of food intake (Galman et al. 2005). In humans, bile acid synthesis exhibits a diurnal rhythm with two peaks around 3:00 PM and 9:00 PM (Chiang 2009). Synthesis, uptake and excretion of BAs involve the intervention of many enzymes and different transport systems that allow synthesis and transfer of BAs to the biliary pole hepatocytes. In figure 5 a representative structure of BAs is shown.

II.1. Synthesis of bile acids

Synthesis of BAs from cholesterol involves a complex multistep process consisting of a cascade of 14 reactions, and recruiting several enzymes of the cytoplasm, mitochondria, endoplasmic reticulum, and peroxisomes. Most of these enzymes are cytochrome P450s (Figure 6). Genes encoding these enzymes are under tight regulatory control to ensure bile acid homeostasis (Chiang 1998). Synthesis of BAs can be done in two pathways. Conversion of cholesterol to 7α -hydroxycholesterol by

46 the microsomal liver enzyme 7α -hydroxylase (CYP7A1) is the first and rate-limiting step in the formation of BAs in the so called the classic pathway (neutral pathway). This pathway begins by modification of the sterol ring of cholesterol, then followed by oxidation of the side chain to reach finally the production of the primary bile acids, CA and CDCA (Myant and Mitropoulos 1977; Russell 2003). CYP8B1 (or sterol 12α - hydroxylase), another CYP playing a role in the formation of BAs in the classical pathway, is involved in the synthesis of CA and it controls the CA/CDCA ratio. In humans, under normal physiological conditions the classical pathway is considered the main route for bile acid synthesis and it generally results in the formation of CA and CDCA in equivalent amounts (Chiang 2004; Li and Chiang 2009). The second pathway is the alternative pathway, also known as the acidic pathway. It is initiated by the CYP27A1 (sterol 27-hydroxylase) resulting in the production of the CDCA (Pikuleva et al. 1998). It modifies the side chain to form acid intermediates, hence its name. This pathway represents only 10 to 15% of the total BAs synthesis (Monte et al. 2009; Norlin and Wikvall 2007; Russell 2003). While primary BAs are synthesized by the two pathways mentioned above, secondary BAs such as LCA and DCA result from deamidation or dehydroxylation of primary BAs by the gut bacterial flora.

Figure 5: Representative structure of bile acids (Rodrigues et al. 2014)

47 II.2. Conjugation of bile acids

Under physiological conditions, once primary BAs formed, they can undergo extensive enzyme-catalyzed taurine and glycine conjugation (amidation) giving rise to amidated BAs (taurocholic acid (T-CA), glycocholic acid (G-CA), glycochenodeoxycholic acid (G-CDCA), and taurochenodeoxycholic acid (T-CDCA)) (Chiang 2009; Russell 2003; Russell and Setchell 1992). Conjugation decreases BA toxicity and provides them the ability to ionize at physiological pH (more polar compounds) thereby increasing their solubility in water and thus facilitates their secretion into the bile (Meier 1995; Russell 2003). Conjugation of free cholic acids with glycine or taurine is accomplished by hepatocyte acyltransferases. Bile acid-CoA synthase (BACS) and bile acid-amino acid transferase (BAT) are two key enzymes involved in amino conjugation of bile acids (Chiang 2009). FXR stimulates bile acid conjugation by inducing expression of genes encoding BACS and BAT, which also are induced by hepatocyte nuclear factor (HNF)4α (Inoue et al. 2004). Thus, FXR and HNF4α may coordinately regulate bile acid synthesis and conjugation. Normally in human the ratio of the glycine/taurine conjugated bile acids is 3:1. This ratio could be modified due to the influence of alimentary and hormonal factors, in some liver diseases. The presence of unconjugated bile acids in the bile most frequently is an indication of hepatic disease. In the intestine, glyco- and tauro-conjugated CA and CDCA could be deconjugated (deamidated) and a 7α -hydroxy group is removed by 7α -dehydroxylase activity of bacterial flora to form secondary BAs, CA is transformed to deoxycholic acid (DCA) and CDCA to lithocholic acid (LCA) and ursodeoxycholic acid (UDCA) (Figure 6) (Chiang 2009; Gonzalez 2012; Ridlon et al. 2006; Rodrigues et al. 2014; Trauner and Boyer 2003). As shown in Table 2, the BA pool in the cecum (vs. liver tissue and gallbladder bile) is dominated by nonamidated BAs mainly LCA (17.5%), DCA (29.5%), CDCA (20.1%), CA (14.8%), and UDCA (3.5%) (Rodrigues et al. 2014). In addition to amidation, during their enterohepatic cycling, BAs may also undergo glucuronidation or 3-O-sulfation in the liver by UDP-glucuronosyltransferase and 3-O- sulfotransferase (SULT2A1) respectively, which reduces their toxic properties and promotes their excretion (Reshetnyak 2013). Even though, a small fraction of

48 circulating bile acids are sulfoconjugated, sulfation is the major route for detoxification of extremely hydrophobic bile acids mainly LCA (Reshetnyak 2013).

Figure 6: Biosynthesis of bile acids (BAs) (Chiang 2009; Reshetnyak 2013) (modified).

49 Table 2: Percent different bile acids (BAs) in human serum, urine, liver tissue, cecum, bile, and feces of human (Rodrigues et al. 2014) (modified) BA Mean % Total BAs

Serum Urine Liver Gallbladder Caecal Stool Tissue Bile Contents

Nonsulfated LCA ≤ 0.5 ≤ 0.5 ≤ 0.5 ≤ 0.5 17.5 32.1 G-LCA ≤ 0.5 ≤ 0.5 1.5 ≤ 0.5 ≤ 0.5 ≤ 0.5 T-LCA ≤ 0.5 ≤ 0.5 0.9 ≤ 0.5 ≤ 0.5 ≤ 0.5 DCA 11.2 2.2 ≤ 0.5 ≤ 0.5 29.5 60.6 G-DCA 11.8 ≤ 0.5 17.5 10.3 ≤ 0.5 0.61 T-DCA 2.2 ≤ 0.5 6.9 5.4 ≤ 0.5 ≤0.5 CDCA 8.2 ≤ 0.5 ≤ 0.5 ≤ 0.5 20.1 1.73 G-CDCA 32.6 ≤ 0.5 33.1 26 1.3 0.70 T-CDCA 3.9 ≤ 0.5 17.5 13 1.3 ≤ 0.5 CA 7.8 14.6 ≤ 0.5 ≤ 0.5 14.8 1.41 G-CA 5.2 5.6 16.9 26 ≤0.5 ≤0.5 T-CA 1.9 1.9 6.9 11 0.5 ≤0.5 UDCA 2.7 ≤ 0.5 ≤ 0.5 ≤ 0.5 3.5 0.85 G-UDCA 4.6 ≤ 0.5 1.6 1.4 ≤0.5 ≤0.5 T-UDCA ≤ 0.5 ≤ 0.5 ≤ 0.5 0.7 ≤0.5 ≤0.5 Sulfated

LCA-3S ≤ 0.5 ≤ 0.5 — — 1.4 ≤0.5 CA-3S ≤ 0.5 ≤ 0.5 — — ≤0.5 ≤0.5 CDCA-3S ≤ 0.5 2.3 — — 3.9 ≤0.5 UDCA-3S ≤ 0.5 2.9 — — ≤0.5 ≤0.5 DCA-3S ≤ 0.5 5.8 — — 1.2 ≤0.5 T-UDCA- ≤ 0.5 6.3 — — ≤0.5 ≤0.5 3S

50 T-LCA-3S 2.5 12.7 — ≤ 0.5 ≤0.5 ≤0.5 G-LCA-3S 3.5 21.8 — ≤ 0.5 ≤0.5 ≤0.5 G-UDCA- 1.8 23.6 — — 0.6 ≤0.5 3S Total 100.0 99.8 102.7 93.8 96.1 97.9

Abbreviations for Table 2: CA, cholic acid; CA-3S, cholic acid 3-O-sulfate; CDCA, chenodeoxycholic acid; CDCA-3S, chenodeoxycholic acid 3-O-sulfate; DCA, deoxycholic acid; DCA-3S, deoxycholic acid 3-O-sulfate; G-LCA, glycolithocholic acid; G-LCA-3S, glycolithocholic acid 3-O-sulfate; LCA, lithocholic acid; LCA-3S, lithocholic acid 3-O-sulfate; T-LCA, taurolithocholic acid; G-UDCA, glycoursodeoxycholic acid; T-UDCA, tauroursodeoxycholic acid; UDCA, ursodeoxycholic acid; G-DCA, glycodeoxycholic acid; T- DCA, taurodeoxycholic acid; G-CDCA, glycochenodeoxycholic acid; T-CDCA, taurochenodeoxycholic acid; G-CA, glycocholic acid; T-CA, taurocholic acid; T-UDCA-3S, tauroursodeoxycholic acid 3-O-sulfate; G-UDCA-3S, glycoursodeoxycholic acid 3-O-sulfate; UDCA-3S, ursodeoxycholic acid 3-O-sulfate; T-LCA-3S, taurolithocholic acid 3-O-sulfate; LCA-3S, lithocholic acid 3-O-sulfate. II.3. Enterohepatic circulation of bile acids

Enterohepatic circulation allows reabsorption of about 95% of BAs secreted in the intestinal lumen (Ridlon et al. 2006). Indeed, after excretion in the bile ducts, BAs and other components of the bile are stored and concentrated in the gallbladder and then released into the upper small intestine (duodenum). Under normal conditions, such transport renders a very concentrated BA pool in the gallbladder (100 mM total BAs) compared with liver tissue (20 µM), small intestine lumen (2–10 mM), serum (2 µM), and urine (1 µM) (Garcia-Canaveras et al. 2012; Humbert et al. 2012; Northfield and McColl 1973; Takikawa et al. 1983). After performing their role in digestion and absorption of fat, a large proportion of BAs are reabsorbed by passive diffusion and, on reaching the ileum, they are subjected to active uptake via apical sodium- dependent bile acid transporter (ASBT) and basolateral organic solute transporter (OST) (Hofmann 1999b; Martinez-Augustin and Sanchez de Medina 2008). BAs absorbed in the intestines return to the liver via the portal vein to complete the enterohepatic cycle (Martinez-Augustin and Sanchez de Medina 2008). In the liver, re-extracted BAs enter the BAs pool and undergo amino acid conjugation and then vectorial transport again to be excreted by canalicular transporters in order to start

51 the cycle. However, they could also be released into the systemic blood circulation by basolateral membrane transporters in certain pathological conditions. BAs which escape reabsorption may be converted into secondary BAs in the large intestine under the action of gut micro biota (microorganisms) and reabsorbed. A small fraction, not exceeding 5%, of BAs is lost in each cycle and excreted in feces. BAs lost in the feces (0.2-0.6 g/day) are replenished by de novo synthesis in the liver to maintain a constant BA pool about 3 g, which is recycled 4–12 times a day (Chiang 2009; Reshetnyak 2013) (Figure 7). Precisely during the enterohepatic circulation CA, CDCA, and DCA are reabsorbed in the intestine and transported back to the liver to inhibit bile acid synthesis (negative feedback regulation). Most of the LCA is excreted in feces. The small amount of LCA circulated to the liver, undergoes sulfo-conjugation at the 3-hydroxy position by sulfotransferase (SULT2A1) and rapidly secreted into the bile (Chiang 2009). It has been reported that a given BA will undergo ~20 cycles of enterohepatic circulation before elimination (Gonzalez 2012).

52 Figure 7: Enterohepatic circulation of bile acids in human (Chiang 2009)

II.4. Regulation of bile acid synthesis by nuclear receptors

CYP7A1 mRNA transcripts have a very short half-life of about 30 min (Baker et al. 2000; Pandak et al. 1996). It has been reported that BAs reduce CYP7A1 mRNA stability via the bile acid response elements (BAREs) located in the 3′ -untranslated region (Agellon and Cheema 1997; Baker et al. 2000). Numerous studies have demonstrated that BAs, steroid hormones, inflammatory cytokines, insulin, and growth factors inhibit CYP7A1 mRNA expression (Crestani et al. 1998; Li et al. 2006). The liver is able to respond to increases in BA. This response is possible through the coordinated interplay of at least three nuclear receptors (NHRs): Farnesoid X receptor (FXR), PXR, and CAR. Various BAs have been shown to be agonists of these receptors (Chiang 2009; Guo et al. 2003; Li and Chiang 2013). CDCA, DCA,

53 UDCA and LCA are FXR agonists; LCA is a PXR agonist (Parks et al. 1999; Staudinger et al. 2001). Certainly, expression of CYP7A1 is largely controlled by BAs since its promoter contains at least two bile acids responsive elements (BARE-I) capable of binding to LRH-1 (Liver receptor homolog 1), LXR (Liver X receptor) and HNF4α (Crestani et al. 1998; Lu et al. 2000; Stroup et al. 1997). Activation of FXR by BAs induces the expression of SHP-1 which by inhibiting the activity of LRH-1 represses the expression of CYP7A1. A study on rat hepatocytes showed that only LRH-1 binding site and not of LXR and HNF4α , is essential for the inhibition of CYP7A1 by BAs (Goodwin et al. 2000). Moreover, the promoter regions of CYP27A1 and CYP8B1 contain HNF4α binding site (Chen and Chiang 2003; Zhang and Chiang 2001), while that of CYP8B1 has also a binding site for α -fetoprotein transcription factors (FTF) (Zhang and Chiang 2001). Thus, bile acids can suppress CYP8B1 via FXR/SHP while they are less efficient in inhibiting CYP27A1 (Zollner et al. 2006a) (Figure 8).

Figure 8: Bile acid feedback regulation of CYP7A1 and CYP8B1 gene transcription (Chiang 2009).

54 FXR stimulates BA conjugation by inducing the genes encoding BACS and BAT, which also are induced by HNF4α (Inoue et al. 2004). Accordingly, FXR and HNF4α may coordinately regulate BAs synthesis and conjugation (Figure 8). It has been reported that peroxisome proliferator activated receptor α (PPARα ) also plays a role in the regulation of synthesis of BA (Hunt et al. 2000). It was proved that BAs activate PPARα transcription through activation of FXR (Pineda Torra et al. 2003). PPARα inhibits human CYP7A1 expression by repressing HNF4α transactivation activity (Marrapodi and Chiang 2000). PPARα may play a role in balancing the amount of conjugated and free BAs. Its activation was reported to increase unconjugated BAs by inducting the peroxisomal bile acid thioesterase (Solaas et al. 2004). Several other FXR-independent mechanisms of CYP7A1 regulation by BAs are also identified. LCA, the secondary BA, is an agonist of PXR and vitamin D receptor (VDR). These two receptors bind to the BARE-I at the human CYP7A1 promoter and inhibit CYP7A1 expression (Han and Chiang 2009; Li and Chiang 2005). PXR interacts with HNF4α and blocks the recruitment of PGC-1α (Peroxisome proliferator- activated receptor-gamma co-activator 1 alpha) to CYP7A1 resulting in inhibition of CYP7A1 expression. In the intestinal cells PXR induces CYP27A1 transcription, but not in the hepatocytes (Li et al. 2007). It has been reported that CAR binds to the DR1 motif in the CYP7A1 promoter and competes with HNF4α , thus inhibiting PGC- 1α and glucocorticoid receptor interacting protein-1, and as a consequence, inhibiting CYP7A1 transcription (Miao et al. 2006). It is reported that in humans BAs synthesis exhibits a diurnal rhythm with two peaks around 3 and 9 pm. The Orphan nuclear receptor Rev-erbα , a clock gene, is involved in controlling the regulation circadian rhythmicity of BA synthesis (Duez et al. 2008; Preitner et al. 2002; Yin and Lazar 2005; Yin et al. 2006). It has been well evidenced that CYP7A1 and CYP8B1 expression exhibits a pronounced diurnal rhythm cycle (Kawamoto et al. 2006; Noshiro et al. 1990). CYP7A1 expression was found to be regulated by the diurnal clock genes mainly, it is induced by D-site binding protein (Mueller et al. 1990; Wuarin and Schibler 1990) and Rev-erbα (Noshiro et al. 2007), but repressed by the clock genes DEC2 and E4BP4 (Noshiro et al. 2004; Noshiro et al. 2007). In contrast, Rev-erbα does not regulate the circadian rhythm of CYP8B1.

55 II.5. Models to study synthesis and perturbation of bile acid pool

In the last 20 years, research has developed significantly our understanding of the mechanisms of BAs synthesis conjugation, regulation, and transport, in addition to understanding of pathologies and liver diseases that accompany perturbation of BA pool. CYP7A1 mRNA expression, the rate-limiting step in BA synthesis, has become a biomarker for studying lipid metabolism, fatty liver disease, diabetes, obesity, and cholestasis in animal models. However, mechanism(s) underlying repression of CYP7A1 expression and BA synthesis remains not clearly elucidated. Animal models, especially, the genetically modified mouse models are widely used for investigating BA synthesis and regulation. However, great and distinct species differences in composition of BA pool, synthesis, and regulation between humans and mice were evidenced. In addition, the extensive modification of each individual bile acid in enterohepatic circulation renders the pharmacokinetic-absorption-distribution-metabolism-excretion- toxicity (PK-ADME-TOX) profile signature of each individual BA highly complex, which cannot be extrapolated from animal models to human. Unsurprisingly, animal models often fail to predict drug-induced perturbation of BA and related liver injury in human subjects. In toto, such given complexity, in addition to the known species differences in BA transporter expression, activity, and regulation, renders it imperative that a suitable human model system should be developed to verify results from animal studies and predict the BA-perturbation related pathologies. Ultimately, progress will be enabled by the development of validated human in vitro models that facilitate the routine profiling of individual BA, and provide a complete in vitro data that support the in vitro-in vivo extrapolations and provide mechanistic insight. De novo synthesis of BAs is difficult to maintain in cultured cells. Primary cultured human hepatocytes have the capacity to synthesize the normal primary BAs, CA and CDCA (Ellis et al. 1998), conjugate and excrete them into the medium (Axelson et al. 2000; Einarsson et al. 2000; Everson and Polokoff 1986). However, these cells are of more and more erratic access, exhibit large inter-donor variability in various functions including BA production that varies from 1 to 12-fold (Ellis and Nilsson 2010) and have a limited life span in vitro, which limited the efficiency in their use.

56 Human liver cell lines have also been tested. The hepatoblastoma HepG2 cell line synthesizes some BAs, but the levels are low, and they are defective in oxidation of the side chain, conjugation, and transport (Axelson et al. 2000; Einarsson et al. 2000; Everson and Polokoff 1986). The rat hepatoma–human fibroblast hybrid cell line WIF-B9, which has structural and functional characteristics of normal differentiated hepatocytes (Bravo et al. 1998; Decaens et al. 1996) also produce BAs, but they lack the ability to further conjugate primary BAs (Monte et al. 2001). In contrary, the human liver HepaRG cell line, expresses features of mature hepatocytes and is considered as a surrogate to primary human hepatocytes (Antherieu et al. 2012). HepaRG cells are highly polarized cells with specialized apical and sinusoidal domains, are able to transport BAs, and exhibit typical cholestatic features in response to treatment with cholestatic drugs (Antherieu et al. 2013; Sharanek et al. 2014). However, the ability of these cells to synthesize and conjugate endogenous BAs has not been precisely investigated and no information exists regarding changes in BA profiles caused by cholestatic drugs. Thus, it is important to characterize endogenous BA profiles and synthesis in HepaRG cells, and to assess occurrence of BA hydroxylation and amidation in addition to determine the inducibility and regulation of BA metabolizing enzymes in normal and in cholestatic conditions.

II.6. Hepatocellular transport system

The transport of bile salts, organic anions and cations, bilirubin and other substances from the portal blood into the biliary system is accomplished through the action of an array of transporter proteins in the hepatocytes (Dawson et al. 2009). BAs circulating in the portal blood are reabsorbed by hepatocytes in the sinusoidal domain. The largest fraction of bile acids binds to intracellular proteins (Agellon and Torchia 2000), and diffuses toward the canalicular pole while the remaining fraction diffuses in a free form. When they are in high concentrations in the cytoplasm, BAs are disposed into intracellular organelles such as endoplasmic reticulum and the Golgi apparatus (Agellon and Torchia 2000) where they will be encompassed in vesicles before targeting the appropriate carriers (Kipp and Arias 2002). However, the mechanisms involved in the transport of BAs from the basolateral to the canalicular pole are not

57 yet fully known. The influx and excretion of BAs involve a wide range of transporters present in hepatocytes (Figure 9) and (Table 3). The basolateral and canalicular membranes differ in their biochemical composition and functional characteristics. They are separated by tight junctions that seal off the bile canaliculi and hence form a barrier maintaining the concentration gradients between blood and bile. The presence and activity of these transporters (Figure 9) whose expression is regulated at the transcriptional and post-transcriptional level are subjected to wide variations affecting the normal flow of bile (Trauner and Boyer 2003).

II.6.1. Uptake of bile acids

The recovery of BAs by sinusoidal path is an essential process in the formation of bile. As mentioned above 95% of BAs secreted by the liver are reabsorbed from the intestines and reclaimed to the liver via the enterohepatic circulation (Hofmann 1999a). Hepatic uptake of biliary constituents (and their precursors) is initiated at the basolateral membrane, which is in direct contact with portal blood plasma at the space of Disse. The basolateral (sinusoidal) domain expresses different transport systems for this function. The hepatic uptake of BAs can be divided into two categories: sodium-dependent and sodium-independent uptake (Nathanson and Boyer 1991).

A. Sodium-dependent uptake

Sodium-dependent BA uptake occurs via Na+-taurocholate cotransporting polypeptide (NTCP or SLC10A1), a membrane glycoprotein composed of 349 amino acids responsive to sodium. Bile salt uptake via NTCP is unidirectional with a sodium-to-taurocholate stoichiometry of 2:1, i.e. co-transport of two Na+ with one taurocholate molecule. NTCP can uptake all the physiological BAs; however it is mainly active on taurine and glycine conjugated BAs but less effective on free or sulfated BAs (Dawson et al. 2009), it transports less than 50% of unconjugated bile acids. It has a very high affinity for conjugated BAs (Hagenbuch and Meier 1996), where it transports more than 80% of conjugated taurocholate (Kullak-Ublick et al. 2000a; Meier and Stieger 2002).

58 Because most bile salts are conjugated, and since NTCP is highly expressed on the sinusoidal membrane of the hepatocytes, NTCP represents the most relevant Na+- dependent bile salt uptake system (Trauner and Boyer 2003) (Figure 9) and (Table 3). In addition, NTCP interacts with a wide variety of drugs and steroids assuming a possible role of this transporter in the elimination of some drugs and/or their metabolites (Kim et al. 1999).

B. Sodium-independent uptake

Sodium-independent uptake of BAs is mediated by organic anion transporters, OATPs (SLC21A), and is quantitatively less significant than sodium-dependent uptake (Kullak-Ublick et al. 2000a). OATPs exhibit a wide range of specificity with particular preference for the amphiphatic organic compounds including bilirubin, neutral steroids and unconjugated or sulfoconjugated BAs (Kullak-Ublick et al. 2000a; Meier et al. 1997; Meier and Stieger 2002). OATP-C, which is selectively expressed on the basolateral membrane of hepatocytes, is the major isoform involved in BAs uptake (Kullak-Ublick et al. 2000b; Meier and Stieger 2002) (Figure 9) and (Table 3). It carries taurocholate, bilirubin monoglucuronide or unconjugated bilirubin, conjugated steroids, thyroid hormones and other substrates (Kullak-Ublick et al. 2000a). OATP-A, is weakly expressed in the liver, and has a limited role in BA transport (Meier and Stieger 2002). OATP-8 which is expressed at the basolateral domain of the hepatocytes, its role in BA transport remains unclear, and contradictory results were reported regarding its contribution in the uptake of BAs (Konig et al. 2000; Kullak-Ublick et al. 2001; Kullak-Ublick et al. 2000b). OATP-B, another member of the same family, is expressed on the basolateral membrane of hepatocytes, but it has no role in transporting BAs (Kullak-Ublick et al. 2001; Tamai et al. 2001).

II.6.2. Efflux of bile acids

A. Canalicular efflux of bile acids

Efflux of bile acids occurs mainly via canalicular transporters expressed on the bile canaliculi located between the hepatocytes. While the flux of certain bile constituents is dependent on bile acid flow, the other is not. Indeed, formation of bile and

59 generation of bile flow are driven by the active secretion of bile salts, lipids and electrolytes into the canalicular and bile duct lumens, followed by the osmotic movement of water. This promotes the excretion of phospholipids and cholesterol in the bile, thus forming micelles for protecting biliary epithelial cells from the toxic detergent properties of BAs. This flow is known as the bile acid-dependent bile flow (BAAF). Another fraction of bile flow is the so-called bile salt-independent canalicular bile flow (BIAF), where the reduced glutathione (GSH) and bicarbonate (HCO3-) are the major determinants of this type of bile flow (Nathanson and Boyer 1991). Biliary excretion at the bile canaliculi represents the rate-limiting step of BA flow, and occurs against steep concentration gradients across the canalicular membrane that are often in the range of 100- to 1000-fold (Trauner and Boyer 2003). Canalicular excretion is mediated by transporters belonging to ATP-binding cassette (ABC) superfamily. BSEP (ABCB11) is the major transporter responsible for canalicular transport of (Figure 9) and (Table 3). It has a preferential affinity for monovalent conjugated BAs (Noe et al. 2002). In addition to BAs, which are the major physiological substrates of BSEP, this canalicular transporter is able to transport certain drugs such as pravastatin (Hirano et al. 2005) and interact with others such as cyclosporine A (CsA), glibenclamide and rifampicin without being necessarily substrates for this transporter. Such interactions can inhibit the canalicular efflux and thus represent a major mechanism of hepatotoxicity in drug-induced cholestasis (Stieger et al. 2007). In addition to BSEP, other canalicular transporters play a crucial or complementary role in the excretion of BAs and other bile constituents. One of these transporters is MRP2 (ABCC2). MRP2 is mainly responsible for transporting divalent BAs conjugated with sulfate, glucuronic acid (Akita et al. 2001; Monte et al. 2009), and reduced glutathione formed by phase II conjugation in the hepatocytes (Zollner et al. 2006a), in addition to other glutathione conjugated amphiphatic compounds. Monovalent BAs are not substrates for this transporter (Keppler and Konig 2000). MDR1 (ABCB1), another canalicular transporter, is primarily responsible for transporting large amphipathic organic cations such as drugs, in addition to its contribution in the transport of sulfated BAs (Lam et al. 2005). MDR3 (ABCB4) is a flippase that transports phospholipids through the plasma membrane into bile (Lefebvre et al. 2009). The canalicular membrane also exhibits

60 other transporters i.e. FIC1-1 and AE2. FIC1-1 is a flippase for phosphatidylserine (Wagner et al. 2009), while AE2 is an anion exchanger that excretes HCO3- into bile and stimulates bile salt-independent bile flow. It represents the only transporter at the canalicular membrane, which is functionally independent of ATP (Prieto et al. 1999; Prieto et al. 1993) (Figure 9) and (Table 3).

B. Basolateral bile salt efflux

BAs efflux transporters are not only present on the canalicular membrane, but also on the basolateral membrane of hepatocytes. They are weakly expressed in normal physiological conditions (Boyer et al. 2006). The basolateral BA transporters are also ATP-dependent and they belong to the MRP family; the best known are MRP3 and MRP4, in addition to OSTα /OSTβ (Dawson et al. 2005) (Figure 9) and (Table 3). MRP4 (ABCC4) transports mainly sulfated derivatives and handle the co-transport of BAs with glutathione, while MRP3 (ABCC3) carries glucuronidated derivatives, divalent BAs, as well as glutathione (Keppler and Konig 2000; Soroka et al. 2010). Regarding OSTα /OSTβ , the presence of two subunits is essential for its proper function, and it carries different BAs and their conjugates (Dawson et al. 2005; Seward et al. 2003). This basolateral efflux system plays a role in BA efflux, as a compensatory mechanism, from hepatocytes toward blood when BAs are accumulated under cholestatic conditions (Keppler and Konig 2000; Soroka et al. 2010).

61 Figure 9: Localization and function of sinusoidal and canalicular transporters in hepatocytes. Abbreviations of the figure: Bile salts (BS-) ; organic anions (OA-), bilirubin (Br-), organic cations (OC+) glutathione (GSH), phosphatidylcholine (PC) bilirubin glucuronides (BrG-).

Table 3: Hepatocellular basolateral and canalicular transporters: nomenclature and function (Halilbasic et al. 2013; Kullak-Ublick et al. 2000a; Trauner et al. 1998b; Yang et al. 2013) Basolateral transporters NTCP SLC10A1 Sodium-dependent uptake of BAs Sodium-independent BAs transport, SLCO1A2; SLC21A3; organic anions, conjugated steroids, OATP1A2 OATP; OATP-A; some types of cations and many OATPA drugs SLCO2B1; SLC21A9; Possible role in the transport of OATP2B1 OATP2B1; OATP-B; sulfated steroids OATPB Transport of conjugated BAs, bilirubin, SLCO1B1; SLC21A6; glucuronides, conjugated bilirubin, OATP1B1 OATP2; OATP-C; conjugated steroid and thyroid OATPC hormones OATP1B3 SLCO1B3; SLC21A8; Transport of conjugated BAs, organic

62 OATP8; OATP-8 anions and 17β -glucuronosyl estradiol OCT1 SLC22A1 Excretion of certain types of cations Transport of divalent BAs and MRP3 ABCC3 bilirubin–glucuronides Co-transport of BAs with glutathione, MRP4 ABCC4 and transport conjugated steroids and certain drugs Possible role in the transport of MRP6 ABCC6 glutathione conjugates Transport of glycine and taurine OSTα /β SLC51 conjugated BAs Canalicular transporters ATP-dependent transport of BSEP ABCB11 monovalent BAs into bile; Activation of bile acid-dependent bile flow ATP-dependent transport of organic anions (bilirubin-diglucuronide) into MRP2 ABCC2 the bile as well as sulfated BAs; Contribution to independent bile flow of BAs ATP-dependent excretion of various MDR1 ABCB1 organic cations, xenobiotics and cytotoxins in bile ATP-dependent transport of MDR3 ABCB4 phospholipids of the inner sheet to the outer leaflet of the membrane bilayer Transport of drugs. Its role in the BCRP ABCG2 excretion of BAs is not yet confirmed Its role in the biliary excretion is not MATE 1 SLC47A1 yet confirmed

63 II.6.3. Intracellular trafficking and regulation of canalicular ATP-Binding Cassette (ABC) transporters

Intrahepatic circulation of BAs, particularly canalicular efflux of bile salts, is a highly regulated process. Hepatocytes are under exposure to variable loads of bile salts, and they should react rapidly to achieve constant BAs homeostasis. This fast regulatory capacity (that occurs in few minutes) cannot be developed by transcriptional regulation and absolutely requires adaptive post-transcriptional processes. Such a mechanism mainly includes recruitment of transporters from the intracellular pools, leading to an increased insertion at the plasma membrane. In addition, functional activity of the transporters may be regulated through phosphorylation/dephosphorylating or protein-protein interactions that could be other alternatives of fast regulatory mechanisms as well (Kullak-Ublick et al. 2004). In vivo studies on rats proposed that BAs canalicular transporters (Bsep, Mrp2, Mdr1 and Mdr2), under normal conditions, are distributed at the canalicular membrane and in an intracellular cytoplasmic vesicular compartment distinct from bile canalicular membrane (intracellular pools). The half-lifes of Mdr1, Mdr2, Bsep and Mrp2 are 5 days in rat liver and can traffic between these compartments via endo- and exocytosis upon demand (Dombrowski et al. 2000; Gerloff et al. 1998; Reichen and Paumgartner 1976). In isolated perfused rat livers, bile secretion was significantly and very rapidly enhanced by administration of the second messenger adenosine 3′ , 5′ -cyclic monophosphate (cAMP) and the bile salt taurocholate (Kipp and Arias 2002). Since pretreatment with cycloheximide, an inhibitor of protein biosynthesis, does not prevent the increase in the density of canalicular ABC transporters this increase in canalicular efflux of bile salts accounted for increased recruitment of pre-existing ABC transporters from intracellular pool and their insertion at the canalicular membrane, rather than increased transcription or translation (de novo synthesis) of canalicular transporters (Kipp et al. 2001). The prompt responses to cAMP and taurocholate were diminished by pre-administration of the microtubules blocker, colchicine, indicating that the fast recruitment is a microtubule–dependent process (Gatmaitan et al. 1997). Imaging of BSEP tagged with yellow fluorescent protein (YFP) revealed microtubular-dependent oscillatory movement of cargo-containing

64 vesicles along microtubules to apical plasma membranes where kinesins drag these vesicles along microtubules. Delivery of canalicular membrane proteins requires an intact microtubule structure that is affected by PAR-1, a kinase for microtubular- associated proteins and inhibition of PAR-1 prevents canalicular formation in WIFB cells (Cohen et al. 2004). The PI3-K kinase inhibitor, wortmannin, decreases the cAMP- and taurocholate- canalicular insertion of Mrp2, Mdr2, and Bsep (but not Mdr1) in the canalicular membrane (Kipp and Arias 2002), indicating that the intracellular microtubule- dependent transport mechanism is also relatively dependent on active PI3K. This is required for ABC transporters traffic to the canalicular membrane. Previous studies in rats (Gatmaitan et al. 1997) and in isolated perfused rat liver (Misra et al. 1998; Misra et al. 1999) showed that the effects of cAMP and taurocholate on canalicular insertion of ABC transporter are additive rather than alternative suggesting the presence of at least two distinct intrahepatic pools of ABC transporters: one is the so called “cAMP pool” and induced to the canalicular membrane by cAMP, while the other is called “taurocholate pool” mobilized by taurocholate. The “cAMP pool” probably differs from the “taurocholate pool” (Kipp et al. 2001). Targeting of the newly synthesized BSEP through intrahepatic compartments to the bile canalicular membrane is enhanced only by cAMP, not by taurocholate. This indicates that the cAMP pool contains the newly synthesized Bsep (Kipp and Arias 2002). Newly synthesized Bsep, after being targeted through an endosomal compartment, accumulates in an intrahepatic cAMP pool and later equilibrates with the taurocholate pool. Newly synthesized Mdr1 and Mdr2 bypass intracellular pools and pass directly from the Golgi to the bile canalicular membrane (Kipp and Arias 2002; Sai et al. 1999). However, it is observed that at steady-state rat Mdr1 and Mdr2 are also mobilized to the bile canalicular membrane by cAMP and taurocholate. This suggests that these ABC transporters also equilibrate with intrahepatic pools after reaching the bile canalicular membrane. Under basal conditions, the majority of Mdr1, Mdr2, and Bsep proteins appear to be localized in cytoplasmic intrahepatic pools, and a small potion at the canalicular membranes with an intrahepatic/canalicular ratio more than 6:1 (Kipp and Arias 2002).

65 In addition to PI3 kinase, Ca2+-dependent protein kinase C (PKC) isoforms are important for intracellular transporter trafficking to the canalicular membrane as well. They were found to modulate canalicular insertion/retrieval of Bsep (Anwer 2004; Roma et al. 2008). Activation of PKC by UDCA or by the phorbol ester 12-myristate- 13-acetate increases rapidly Mrp2 transporter insertion at the canalicular membrane (Beuers et al. 2001; Kubitz et al. 2001). Furthermore, UDCA-induced insertion of ABC transporters into the canalicular membrane may involve p38 mitogen-activated protein kinase and extracellular signal-related kinases (Kubitz et al. 2004; Kurz et al. 2001; Paumgartner and Beuers 2002). In addition, hypo-osmolarity induces recruitment of intracellular Bsep to the canalicular whereas hyperosmolarity induces retrieval of both Bsep and Mrp2 into intracellular vesicles causing cholestasis (Schmitt et al. 2001). This complex intracellular trafficking of ABC transporters requires in addition to the appropriate glycosylation of cellular proteins that bind ABC transporters containing vesicles and facilitates their targeting (Mochizuki et al. 2007). In yeast, two-hybrid screens HAX-1 and myosin-II regulatory light chain (MLC2) were identified as potential binding partners for BSEP, MDR1, and Mdr2 (Chan et al. 2005; Ortiz et al. 2004). HAX-1 interacts with the actin-binding protein, cortactin (Ortiz et al. 2004). Both, HAX-1 and cortactin participate in clathrin-mediated endocytosis of BSEP as well as other ABC transporters from the apical membrane. In contrast, phosphorylation of MLC2 is required for apical delivery of newly synthesized BSEP and possibly other ABC transporters to the apical membrane (Chan et al. 2005). MLC2 phosphorylation/dephosphorylation status is regulated upstream by MLC kinase, Rho-kinase and MLC phosphatase. In MDCK cells, blebistatin A, which inhibits MLC kinase, reduced BSEP trafficking to the canalicular membrane (Chan et al. 2005). However, the roles of these upstream regulators under both normal and pathological cholestatic conditions are poorly investigated. The Rab GTPase family is known as “master regulator of membrane trafficking” (Pfeffer 2001). Rab proteins selectively bind to cytoskeletal components and protein kinases, thereby facilitating discrete steps in membrane transport. In hepatocytes, Rab11 co-localizes with vesicles containing ABC transporters before their insertion in the canalicular membrane (Wakabayashi et al. 2005). Rab11 binds to downstream effector proteins that localize to recycling endosomes and controls vesicle sorting

66 (Pfeffer 2001). Rab4 and Rab5 facilitate both endocytosis and vesicle fusion (Bananis et al. 2003). Mrp2 canalicular localization is dependent on the presence of radixin, a member of the ezrin-radixin-moesin complex that crosslinks actin filaments and integral membrane proteins. These crosslinking activities are regulated by the small GTP- binding protein Rho (Hirao et al. 1996). Radixin is concentrated in bile canalicular membranes, and its absence in radixin null mice decreased Mrp2 density as compared with other canalicular transporter proteins (Kikuchi et al. 2002). Furthermore, several arguments support the role of cytoskeletal actin in ABC transporters trafficking. (a) The activity of Rab GTPases requires interaction with the actin cytoskeleton as evidenced by their co-localization (Wakabayashi et al. 2005). (b) Impaired actin polymerization by cytochalasin and latrunculin A, resulted in a rapid decline of taurocholate- and cAMP-mediated increases in BAs secretion in vivo (Misra et al. 1999) and in vitro using WIFB cells (Decaens et al. 1996), and prevented endocytosis indicating the cycling of canalicular BSEP (Sheff et al. 2002; Wakabayashi et al. 2005). (c) Additionally, it has been shown in MDCK cells that actin participates in clathrin-mediated endocytosis of BSEP from the canalicular domain (Ortiz et al. 2004). (d) Finally, in radixin null mouse, removal of radixin, that is concentrated in the bile canalicular domain and cross-links actin filaments and integral membrane proteins, leads to progressive dilation of the canaliculus, decreased microvilli, impaired apical trafficking of MRP2, and disappearance of other canalicular ABC transporters; thus, resulting in cholestasis, and consequently supporting the role of actin in trafficking of BAs transporters (Kikuchi et al. 2002). However, the mechanism by which actin participates in BSEP apical trafficking, cycling, and endocytosis remains unclear. In addition, insufficient amounts or malfunctioning of ABC transporters in the canalicular membrane may be anticipated causing impaired bile formation and cholestasis.

67 III. Cholestasis

III.1. Definition and Etiology

Cholestasis is defined as the blockage of normal bile flow from the liver to the intestine, resulting in accumulation of BAs and other bile components either in the liver or in the hepatobiliary tract. Cholestasis may either result from a functional defect in bile formation at the level of hepatocytes, or from impairment in bile secretion and flow at the level of small, or large bile ducts (Arrese and Trauner 2003). Cholestasis can be intrahepatic when it results from the diminution in the canalicular excretion, leading to accumulation of bile constituents in the cytoplasm of hepatocytes or extrahepatic when it results from obstruction of bile ducts that prevents flow of bile. The main clinical and biochemical characteristics and some of the histological characteristics of intrahepatic and extrahepatic cholestasis are very similar. It is associated with an increase in serum bilirubin and alkaline phosphatase, and may be manifested by jaundice, pruritus and steatorrhoea (Zimmerman 1979). Prolonged exposure of hepatocytes, in the case of an intrahepatic cholestasis, or epithelial cells of bile ducts in the case of extrahepatic cholestasis, to hydrophobic BAs is believed to play an important role in liver injury by inducing cellular apoptosis or necrosis. Several mechanisms may account for the cytotoxicity associated with the hydrophobic BAs in cholestatic liver diseases. BAs could disrupt cell membranes through their detergent action on lipid components and promote the generation of reactive oxygen species (ROS) and mitochondrial dysfunction (Perez and Briz 2009; Rolo et al. 2004). Indeed, due to their amphipathic nature, BAs possess a detergent property that confers a solubilizing potential of cholesterol and phospholipids and consequently disrupting the plasma membrane integrity (Lamireau et al. 2003; Monte et al. 2009). At physiological concentrations, the toxic effect of BAs is countered by the cholesterol present in the cell membrane and the formation of micelles with phospholipids on one hand, and by their rapid excretion through the bile on the other hand. Thus reducing the exposure of plasma membrane to these cholephilic compounds (Monte et al. 2009; Trauner et al. 2008). However, in cholestatic context, when bile flow is interrupted, the plasma membranes are exposed to high BAs concentrations and subjected to a prolonged duration to their toxic effects.

68 Hence, the proper functioning of the various membrane systems of transport along the enterohepatic circulation of bile and a correct transcriptional regulation of these transporters are essential for proper synthesis and normal excretion of bile components. However, several factors like hereditary (mutations of genes encoding BA transporters) or acquired ones (exposure to cholestatic agents such as drugs and proinflammatory cytokines, etc...) can alter the expression and function of hepatobiliary transporters leading to cholestasis (Wagner et al. 2009). In addition to the defects in the activity of BA transporters, alteration of cell polarity, canalicular tight junctions, and the cytoskeleton may also represent important mechanisms for cholestasis (Wagner et al. 2009).

III.2. Hereditary transporter defects as a cause of cholestasis

Polymorphisms and mutations affecting genes of hepatobiliary transporters are usually the cause of alteration of the expression and function of proteins encoded by these genes (Lang et al. 2006). Most mutations identified in genes of BA transporters cause more or less severe progressive cholestatic syndromes in neonates and children. However, these syndromes are extremely rare and have limited clinical relevance (Zollner and Trauner 2006). Other less severe genetic defects (heterozygous variants) of BA transporters may result in cholestatic syndromes which manifest later in juvenile or even adult life. These mutations constitute a susceptibility factor for the development of acquired cholestasis such as predisposition of intrahepatic cholestasis of pregnancy, drug-induced cholestasis, intrahepatic cholelithiasis and other types of adult acquired cholestatic disorders (Wagner et al. 2009). In the following dissertation, we discuss the effects of mutations of certain BA acid transporters and resulting diseases.

A. MDR3

MDR3 is a flippase, responsible for translocating into the bile, the phospholipids required to protect the bile duct epithelium from the detergent properties of BAs. Certain mutations at the MDR3 genes lead to nonfunctional MDR3 transporters. Thus, absence of biliary phospholipids results in bile-induced damage of apical membranes of cholangiocytes and hepatocytes. The frequent manifestation is progressive familial intrahepatic cholestasis subtype 3 (PFIC-3) characterized by high

69 γ-glutamyl transpeptidase (GGT) levels, bile duct disease, and progressive cholestasis in infants leading to end-stage liver disease requiring liver transplantation in 50% of patients (Jacquemin et al. 2001). MDR3 variants are also associated with a cholesterol cholelithiasis disorder known as low-phospholipid-associated cholelithiasis syndrome (LPAC), which is characterized by cholesterol gallstones recurring after cholecystectomy, and mild chronic cholestasis due to intrahepatic stones (Wagner et al. 2009). In addition to diseases that result directly, MDR3 gene polymorphisms and mutations may also play an important role in acquired cholestatic disorders. Thus, healthy patients having mutations at MDR3 are more likely to develop cholestasis such as drug-induced cholestasis (Lang et al. 2007), as well as some forms of intrahepatic cholestasis of pregnancy (ICP), where exposure to high levels of sex hormones during pregnancy may unmask latent defects and result in cholestasis (Jacquemin et al. 2001).

B. BSEP

Mutations in the gene BSEP are the basis of another subtype of PFIC, the PFIC-2 (Strautnieks et al. 1998). In this case, only hepatocytes are damaged due to intracellular accumulation of BAs that are unable to reach bile canaliculi and bile ducts. Hepatitis that accompanies this pathology causes a severe liver tissue damage that could end by requiring liver transplantation (Oude Elferink et al. 2006). PFIC-2 is characterized by the absence of extrahepatic symptoms since BSEP is expressed only in the liver. Unlike the PFIC-3, GGT levels sustained at normal limits in individuals suffering from this type of cholestasis. A less severe form of the PFIC-2 is benign intrahepatic recurrent cholestasis (BRIC-2), which is also associated with a high risk for the development of gallstones (Oude Elferink et al. 2006). Identically to MDR3, mutations at BSEP increase the incidence of ICP (Meier et al. 2008), and susceptibility to drug-induced cholestasis (Lang et al. 2007).

C. FIC-1

FIC-1 is considered to be an inward flippase for phosphatidylserine which may be crucial for maintaining cell membrane asymmetry. While the role of FIC-1 in excretion of BAs is not clearly evidenced, a deficiency of this transporter causes PFIC-1 that occurs during the neonatal period and is characterized by a rapid progression to

70 advanced stages that end by early liver transplantation. It is associated with high levels of BAs, bilirubin and transaminases in serum, while GGT level remains low. A less severe form of the PFIC1 is the BRIC1 which is characterized by recurrent episodes of cholestasis that do not necessarily lead to liver cirrhosis. Unlike mutations of BSEP, the effects of those of FIC-1 are not restricted to the liver because this transporter is expressed in other tissues such as the pancreas and the kidneys (Bull et al. 1998).

D. MRP2

MRP2 gene mutations are associated with Dubin-Johnson syndrome characterized by a deficiency of the biliary excretion of bilirubin, and thus an increase in serum without elevated transaminase levels (Paulusma et al. 1997). Patients with this syndrome are not really cholestatic but hyperbilirubinaemic. ICP is the only form of acquired cholestasis that appears to be associated to MRP2 polymorphism (Sookoian et al. 2008). In addition to gene mutations of hepatobiliary transporters, variations in genes encoding tight junction proteins and those encoding certain nuclear receptors including FXR (Farsenoid X receptor) and PXR, that are known to have a key role in the regulation of expression of transporters, may also constitute causing and/or aggravating factors of cholestasis (Hadj-Rabia et al. 2004; Karlsen et al. 2006; Kovacs et al. 2008).

III.3. Acquired cholestasis

III.3.1. Drug-induced cholestasis

Cholestasis and its associated hepatotoxicity are the most common and severe manifestations of drug-induced liver injury (Bohan and Boyer 2002). According to epidemiological reports, cholestasis constitutes up to 50% of all cases of liver toxicity caused by drugs (Benichou 1990). In the United States, drugs are responsible for 20% of cases of jaundice observed in the elderly (Lewis 2000). It is important to note that the reported cases represent only a small fraction of all cholestatic problems; since cholestasis is often asymptomatic as the only clinical manifestation is elevated

71 levels of liver enzymes, and this elevation is not always detectable (Pauli-Magnus and Meier 2006; Yang et al. 2013). Drug-induced cholestasis may occur as an acute disease with or without jaundice that disappears quickly after stopping the drug. However, hepatocellular damage which sometimes accompanies cholestasis can cause non-specific symptoms such as nausea, malaise, anorexia, and fatigue (Padda et al. 2011). Certain biochemical tests related to liver function allow diagnosing drug-induced cholestasis. The Council for International Organization of Medical Sciences (CIOMS) defines drug-induced cholestatic injury as an elevation of serum alkaline phosphatase (AP) higher than 2 times of upper limit of the normal range. That is associated with elevated GGT and with a normal value of alanine transaminase (ALT). However, an increase in ALT can be also observed in case of drug-induced cholestasis. In this case it is accompanied by a rise of AP level, with the ratio of ALT/AP less than 2 (ALT/AP < 2). The level of conjugated bilirubin in the serum may also increase during cholestasis (Padda et al. 2011). A typical example of drugs that induce cholestatic injuries in human, animal, and in vitro systems is cyclosporine A, which is demonstrated that drugs known to be leading to cholestatic liver injury through competitive inhibition of BSEP (Arias 1993), we will come back in details to mechanisms of cyclosporine A-induced cholestasis in Chapter IV. Another typical example of cholestatic drugs is the endothilin receptors antagonist, bosentan. In clinical trials, it was found that bosentan caused asymptomatic, reversible transaminase elevations in some patients (Fattinger et al. 2001); this indicated that bosentan induced liver injury (Krum et al. 1998). No liver biospies were performed in these studies, and all signs of hepatotoxicity disappeared after the cessation of bosentan administration. Although increases in serum transaminases signal hepatocellular damage, they do not explain the underlying mechanisms of bosentan-induced liver injury, which could include a direct hepatotoxic effect of bosentan or its metabolites, microvesicular steatosis caused by inhibition of mitochondrial function, immune-mediated hepatitis, or even hepatocyte damage caused by the intracellular accumulation of cytotoxic cholephilic compounds, or induction of cholestatic or mixed hepatitis. Bosentan and its metabolite enter hepatocytes by OATP1B1- and OATP1B3- mediated transport (Treiber et al. 2007). The incidence of bosentan-induced liver

72 injury was dose-dependent and increases in plasma bile salt levels of affected individuals correlated with the administered dose of bosentan. Furthermore, individuals, who were taking glyburide together with bosentan, showed a higher incidence of liver injury than patients with bosentan therapy alone. Experiments with rat and human BSEP expressed in Sf9 cell vesicles identified bosentan as a competitive inhibitor of BSEP (Fattinger et al. 2001; Noe et al. 2002). Rats treated with bosentan displayed an elevation of plasma bile salt levels, which further increases upon co-administration of glibenclamide (Fattinger et al. 2001). Interestingly, contrary to the expectations bosentan was found to stimulate bile flow (Fouassier et al. 2002). The increased bile flow was not caused by an increased bile salt efflux, but was associated with an increased glutathione and bicarbonate secretion. This stimulation of bile flow was not observed in rats which lack functional Mrp2. Therefore, bosentan not only directly affects the function of BSEP as a competitive inhibitor, but also exerts indirect effects, which depend on Mrp2 and increase of bile salt-independent bile flow. Several mechanisms are implicated in drug-induced cholestasis, where these mechanisms are often due to either inhibition of apical transport of bile constituents resulting in intrahepatic cholestasis and/or alteration of bile canaliculi that may progress to biliary cirrhosis (Pauli-Magnus and Meier 2006).

A. Drug-induced alteration of bile acid transporters

Cholestatic drug or its metabolites can reduce the gene expression of hepatic transporters or inhibit directly their activity. Drug-induced inhibition of canalicular efflux of BAs may occur directly by cis-inhibition (such as the case with CsA, rifampicin and glibenclamide) or indirectly by trans-inhibition (such as with estradiol- 17β -glucuronide) of BSEP (Stieger et al. 2000) and/or via inhibition of MRP2 (such as with fusidate) (Bode et al. 2002). Similarly, drugs such as verapamil, vinblastine and CsA may interfere with the secretory function of hepatocytes by altering secretion of phospholipids by MDR3 (Smith et al. 2000). Additionally, impairment of vascular trafficking of transport proteins or a change of localization at the appropriate cellular pole (internalization of transporters) represents another mechanisms by which certain drugs can exert their cholestatic effects (Trauner et al. 1998b).

73 B. Drug-induced alteration of bile canaliculi motility and bile flow

In addition to changes in the level of transporters expression, significant alterations of the different components of the cytoskeleton of the hepatocytes were observed during cholestasis. Indeed, impaired microtubule system, increases in intermediate filaments, and accumulation of disorganized bundles of actin microfilaments in the pericanalicular domain interfere with process of transcellular transport of bile components, and altering the contractility of bile canaliculi (Trauner et al. 1998b). In fact, alteration of the cytoskeleton can modify the permeability of the tight junctions resulting in increased paracellular permeability and leakage of bile constituents in the plasma, and a reduction in osmotic gradients in bile canaliculi which is normally required to the secretion of bile acids (Trauner et al. 1998b). As mentioned in chapter I, actin filaments and myosin and other contractile proteins are prominent in pericanalicular areas of the liver cell. This network controls a rhythmic contraction of bile canalicular spaces to facilitate unidirectional flow of bile toward the bile ducts. In addition, BAs increase the frequency of contractions observed by time-lapse cinephotomicrography, suggesting a close association between stimulation of bile flow and these dynamic processes of the bile canaliculi (Broschat et al. 1983). Furthermore, it has been shown that interference in actomyosin interactions by phalloidin or cytochalasin B or D, and actin polymerization/depolymerisation inhibitors, decrease the rate of spontaneous contractions of the bile canaliculi and result in cholestatic features (Adelstein et al. 1982; Arikawa et al. 1990). Lithocholic acid, a hydrophobic secondary bile acid, is well known to cause intrahepatic cholestasis (Javitt 1966). It has been demonstrated that taurolithocholic acid interferes directly with the canalicular membranes and impairs bile canalicular contractions and consequently canalicular bile secretion as shown in isolated rat hepatocyte couplets (Watanabe et al. 2006). Several studies, had reported that CsA and CPZ alter the cytoskeletal pericanalicular F-actin microfilaments leading to persistent constriction of the bile canaliculi. However the mechanism underlying these prompt events is not illustrated and the reports that address these changes are poorly evidenced.

74 Further studies of the physiology and molecular biology of the secretory events involved in reduction of canalicular dynamic systems should lead to deeper insights of the bile secretion and better prediction of drug-induced cholestasis.

III.3.2. Inflammatory cholestasis

Inflammation is the body’s response to infection, tissue injury, or any stress in order to eliminate the cause of the disturbance and restore homeostasis. It is a complicated situation involving major metabolic changes primarily mediated by pro-inflammatory cytokines, including tumor necrosis factor (TNF) α , interleukin-1β (IL-1β ), interleukin 6 (IL-6) and interferons (Teng and Piquette-Miller 2008). Numerous studies have shown that cholestasis can frequently arise as a complication of sepsis, bacterial infection and alcoholic hepatitis (Fuchs and Sanyal 2008; Moseley 1997; Trauner et al. 1999). The pro-inflammatory cytokines (TNFα , IL-1β , IL-6 ...), which are mainly secreted by Kupffer cells but also by hepatocytes (Luster et al. 1994), activate membrane receptors on hepatocytes and cholangiocytes that transduce intracellular signaling pathways leading to alteration of expression and function of BAs transporters (Geier et al. 2006; Mulder et al. 2009; Trauner et al. 1999). In hepatocytes, down-regulation of transporters involved in BAs uptake and excretion, as well as down-regulation of phase I and phase II detoxification enzymes, result in impairment in bile formation, and accumulation of BAs and toxins in liver and serum have been reported in an inflammatory context (Bolder et al. 1997; Le Vee et al. 2008; Le Vee et al. 2009; Wagner et al. 2009). For instance, administration of lipopolysaccharide (LPS), TNFα or IL-1β significantly inhibits the expression of NTCP/Ntcp in rats, mice and in primary human hepatocytes (Denson et al. 2000; Green et al. 1996; Le Vee et al. 2008). A reduction in mRNA expression of NTCP and OATP2 (OATP1B1), and a reduction in the membrane immunolocalization of NTCP, were observed in liver biopsies of patients with cholestasis of inflammatory origin (Zollner et al. 2001). The mechanisms involved in inhibition of BA uptake mediated by NTCP and Oatps during inflammatory cholestasis are complex, and involve many nuclear receptors, in particular Hepatic nuclear factor 1α (HNF1α ) and RXRα . RARα is one of the most transcription factors involved in the regulation of NTCP (Denson et al. 2000; Trauner et al. 1998a). Canalicular efflux of BAs and other organic anions is also inhibited

75 during endotoxemia, or after exposure to pro-inflammatory cytokines following a reduction in mRNA and/or protein of Mrp2 and Bsep (Elferink et al. 2004; Zollner et al. 2001). Human liver biopsies of patients with inflammatory cholestasis show a slight reduction in mRNA expression of BSEP whereas MRP2, MRP3, MDR1, MDR3 and FIC-1 remain constant. By contrary, immunohistochemistry of such carriers in these biopsies showed a reduction of MRP2 and BSEP density at the canalicular membrane (Zollner et al. 2001). The mechanisms of transcriptional regulation of BSEP/Bsep and MRP2/Mrp2 are not fully understood although some elements involved in these mechanisms have been identified. In fact, transcription of these genes in rodents is largely controlled by Fxr, Rar, Pxr and Car (Wagner et al. 2009). Studies have shown that LPS, TNFα and IL-1β significantly reduced mRNA expression of FXR and its binding activity to the BSEP promoter in humans and rats (Ananthanarayanan et al. 2001; Gerloff et al. 2002). Moreover, IL-1 inhibits MRP2 gene expression by disabling the binding of interferon regulatory factor 3 (IRF-3) to its responsive element located in the promoter sequence of MRP2 gene in humans (Hisaeda et al. 2004). Additionally, the rapid internalization of canalicular transporters by LPS represents a rapid and reversible post-transcriptional regulation mechanism in conditions of endotoxemia (Elferink et al. 2004; Kubitz et al. 1999). It is interesting to note that most drug-induced hepatic reactions have an inflammatory component, and therefore share common features with cholestasis- induced inflammation (Wagner et al. 2009).

III.3.3. Intrahepatic cholestasis of pregnancy (ICP)

ICP is a reversible type of hormonally influenced cholestasis. It frequently develops in late pregnancy in individuals who are genetically predisposed. ICP is observed in 0.4–1% of pregnancies in most areas of Central and Western Europe and North America, while in Chile and Bolivia as well as Scandinavia and the Baltic states roughly 5–15% and 1–2%, respectively, of pregnancies are associated with ICP. Genetic and hormonal factors, but also environmental factors may contribute to the pathogenesis of ICP (Pusl and Beuers 2007). The hormonal changes that accompany pregnancy are responsible for significant changes in gene expression of hepatobiliary transporters. To simulate the changes induced by elevated concentrations of estrogen and progesterone during pregnancy,

76 animal models were exposed to estradiol. Estradiol inhibits mRNA expression of rat Ntcp (Simon et al. 1996) in accordance with what was actually observed during pregnancy (Arrese et al. 2003). In contrast, another study showed that the expression of Ntcp remains constant during pregnancy probably because of the contradictory effect exerted by prolactin (Cao et al. 2001). Oatps are weakly or not affected during pregnancy; hence mRNA and protein expression of Oatp1 remains constant while that of Oatp2 is inhibited (Cao et al. 2001). Mrp2 protein levels decreased to 50% in pregnant rat liver (Cao et al. 2002) or following exposure to ethinyl estradiol (Trauner et al. 1997), resulting in a reduction of the activity of this transporter. This reduction in Mrp2 protein is likely due to post- transcriptional regulation of Mrp2, since the mRNA levels remain constant during pregnancy (Cao et al. 2001). Unlike Mrp2, Bsep mRNA and protein expression remains relatively constant after administration of ethinylestradiol in rats (Lee et al. 2000). Regarding basolateral efflux, mRNA and protein levels of Mrp3 were observed to decrease to 50% during pregnancy in rats (Cao et al. 2002).

III.4. Molecular regulation of hepatobiliary transporters expression during cholestasis

As mentioned above, cholestasis is characterized by numerous alterations in the expression of hepatobiliary transporters. However, these molecular changes do not necessarily contribute to the aggravation of the cholestatic insult. Accordingly, alterations in gene expression observed during cholestasis can be classified as pro- cholestatic (considered as causing and/or aggravating factors of cholestasis) and anti-cholestatic compensatory mechanisms, which protect against cholestatic complications (Wagner et al. 2009; Zollner et al. 2006a). Indeed, in cholestatic conditions where serum and intracellular levels of BAs are elevated, activates a set of so-called compensatory mechanisms to restore homeostasis of BAs. FXR is the most nuclear receptor involved in the regulation of genes controlling BA synthesis, metabolism, and (Ananthanarayanan et al. 2001; Jung et al. 2002; Kullak-Ublick et al. 2001). This nuclear receptor acts to reduce any intrahepatic cholestatic effect, by decreasing BA influx and increasing their basolateral efflux, promoting their excretion via urine (Trauner et al. 2005). These

77 compensatory mechanisms are not exclusively restricted to the liver but also activated in bile ducts, intestine and kidney (Zollner et al. 2006a). However, it is worthy to note that adaptation mechanisms described in cholestasis were mainly observed in experimental animal models trying to simulate different forms of acquired cholestasis. Bile duct ligation (CBDL, common bile duct ligation), exposure to endotoxin or pro-inflammatory cytokines and administration of ethinylestradiol have been conducted in animals to simulate an obstruction in bile ducts, inflammatory hepatocellular cholestasis or cholestasis of pregnancy, respectively (Trauner et al. 2005). The adaptation mechanisms of cholestasis that have been identified cannot be easily generalized and extrapolated to humans because of interspecies variations in transcriptional and post-transcriptional regulation of BA transporters genes. In the following, we discuss the different mechanisms of adaptation observed in BAs transport, synthesis and metabolism systems in response to acquired cholestasis.

III.5. Adaptive feedback mechanisms

III.5.1. Uptake inhibition

In hepatic cholestasis both sodium dependent and non-dependent uptake are inhibited due to a decrease of the expression of NTCP and OATP1B1 in humans (Keitel et al. 2005). Inhibition of these two influx systems is probably mediated by FXR, which activates a downstream cascade of regulation genes involving SHP, HNF4α and HNF1α (which is a potent activator of OATP1B1) (Zollner et al. 2006a). Intracellular accumulation of BAs during cholestasis, results in activation of a negative feedback inhibition of their uptake involving the nuclear receptors HNF1α , HNF4α and RXRα . RARα acts via mechanisms dependent and non-dependent of FXR/SHP complex depending on the origin of cholestasis (inflammatory, obstructive or drug-induced) (Zollner et al. 2006a). Although genes involved in BA uptake are inhibited during cholestasis, OATP8 (OATP1B3), implicated in the influx of organic anions, peptides and xenobiotics is induced by FXR (Jung et al. 2002). Such induction aims at maintaining the capacity of hepatocytes to eliminate xenobiotics and peptides circulating in the blood, and therefore to maintain the metabolic functions of the liver during cholestasis (Figur 10).

78 III.5.2. Increasing hydroxylation and conjugation of bile acids

Hydroxylation and conjugation are important detoxification mechanisms of BAs. They increase their polarity making them less toxic, water soluble and thus easily excreted through urine. CYP3A4 plays a major role in the detoxification of BAs, drugs and various xenobiotics. It represents a major route of elimination of toxic compounds. The expression of this cytochrome is largely controlled by various nuclear receptors, primarily PXR, CAR, VDR and FXR. Some of the physiological BAs are ligands of these receptors; CA, CDCA, LCA and DCA are FXR ligands (Parks et al. 1999). PXR can be activated by LCA, while CAR is activated by bilirubin and would probably have a role in detection of BAs (Zollner and Trauner 2009). Thus, the presence of certain BAs which are ligands for these receptors can induce the expression of CYP3A4 promoting their own detoxification in order to minimize the damage induced by hepatic intracellular accumulation (Gnerre et al. 2004). The role of hydroxylation catalyzed CYP3A4 is confirmed by the presence of high concentrations of hydroxylated BAs in the urine of patients suffering from cholestasis (Bremmelgaard and Sjovall 1980; Shoda et al. 1990). In parallel, sulfo- and glucuro-conjugation plays an important role in BAs detoxification. The presence of the sulfoconjugated BAs in the serum and urine of patients with cholestatic disease demonstrates the role of sulfoconjugation during cholestasis (Thomassen 1979; van Berge Henegouwen et al. 1976). SULT2A1/Sult2a1, which is responsible for the sulfoconjugation of BAs and other endogenous substrates, can be induced by FXR (Song et al. 2001). In addition, BA glucuronidation catalyzed by UDP-glucuronosyltransferases UGT2B4 and UGT2B7 represents another detoxification pathway which is activated during cholestasis (King et al. 2000). In parallel to CYP3A4 induction, BAs can induce UGT2B4 directly via activation of FXR (Barbier et al. 2003), or indirectly through activation of PPARα by FXR (Pineda Torra et al. 2003). Thus, glucuronidated BAs reach up to 5% (in plasma) and 35% (in urine) of total BAs pool in patients suffering from obstructive intrahepatic cholestasis (Frohling and Stiehl 1976; Takikawa et al. 1983). The presence of glucuronidated BAs in urine can be explained by their excretion via the

79 basolateral transporter MRP3, which becomes possible after addition of negative charges by glucuronidation (Zelcer et al. 2006). Therefore, BAs may induce their own detoxification by inducing their detoxifying enzymes of Phases I and II via activation of various nuclear receptors including PXR, FXR and VDR (Figure 10).

III.5.3. Inhibition of bile acid synthesis

Inhibition of BA synthesis is part of the adaptive response to cholestasis aiming at reducing their intracellular accumulation. BAs accumulated during cholestasis suppress their synthesis by reducing the expression of the implicated cytochromes. CYP7A1 expression is largely controlled by BAs since its promoter contains at least two BAs responsive elements capable of binding to LRH-1, LXR and HNF4α (Crestani et al. 1998; Lu et al. 2000; Stroup et al. 1997). Activation of FXR by BAs induces the expression of SHP-1 which, by inhibiting the activity of LRH-1, represses expression of CYP7A1. A study on rat hepatocytes showed that only LRH-1 binding site, but neither that of LXR nor that of HNF4α are essential for the inhibition of CYP7A1 by bile acids (Goodwin et al. 2000). Furthermore, the promoter regions of CYP27A1 and CYP8B1 contain HNF4α binding site (Chen and Chiang 2003; Zhang and Chiang 2001), while that of CYP8B1 has also a binding site for FTF (Zhang and Chiang 2001). Thus, BAs can suppress CYP8B1 via FXR/SHP while they are less efficient in inhibiting CYP27A1 (Zollner et al. 2006a). Unlike the inhibition of BA synthesis in an intrahepatic cholestasis, CYP7A1 activity is contradictory induced in rats in case of obstructive cholestasis contributing to further accumulation of BAs due to continuous production of endogenous BAs (Dueland et al. 1991). This induction can be explained by the signaling axis established between the intestine and the liver to regulate bile acid synthesis in hepatocytes. Indeed, in the ileum, BAs bind to Fxr inducing Fgf15 (fibroblast growth factor 15), which by interacting with Shp, inhibits CYP7A1 and consequently BAs synthesis (Figure 10). In obstructive cholestasis, where the amount of BAs in the intestine is relatively low and thus Fgf15 is not induced, it causes an inappropriate increase in CYP7A1 expression (Inagaki et al. 2005).

80 III.5.4. Induction of the expression of canalicular transporters

At the canalicular domain, excretion of BAs is mediated mainly by BSEP and MRP2 and disruption of their expression and activity could have drastic consequences. Accumulating BAs are capable of inducing BSEP directly via FXR (Plass et al. 2002; Schuetz et al. 2001). By contrast, the regulation of the expression of MRP2 by BAs is more complicated, and involves several nuclear receptors such as PXR and CAR as shown by studies on rat and mouse hepatocytes (Figure 10) (Kast et al. 2002).

III.5.5. Increase in basolateral excretion of bile acids

Under normal physiological conditions, BAs are excreted in the bile; however their excretion into the blood circulation is an alternative pathway in case of cholestasis. The basolateral transporters (MRP3, MRP4 and OSTα /OSTβ ) which are normally weakly expressed, were found to be strongly induced in rodents after a BAs rich diet and in humans suffering of cholestatic diseases (Donner and Keppler 2001; Soroka et al. 2001; Zollner et al. 2003). Indeed, an increase of MRP3 protein level and its localization on the basolateral domain were observed in the liver of patients with primary biliary cirrhosis (Zollner et al. 2003). Similarly, in patients with PFIC, mRNA and protein expression of MRP4 are significantly induced (Keitel et al. 2005). Exposure of HepG2 and HuH7 cells to PXR activators, induces MRP3 mRNA expression, suggesting that intracellular accumulation of BAs, certain are activators of PXR, could activate expression of MRP3 (Teng et al. 2003). A study on the human intestinal cell line Caco-2, showed that exposure of cells to CDCA leads to induction of MRP3 mRNA expression in a dose- and time- dependent manner (Inokuchi et al. 2001). A BA putative responsive element has been identified in the promoter region of the MRP3 gene isolated from Caco-2 cells (Figure 10). In parallel, to the induction of MRP3, mRNA expression levels of OSTα and OSTβ increased significantly in patients with primary biliary cirrhosis (Boyer et al. 2006). Similarly, exposure of HepG2 cells to CDCA, a selective FXR ligand, induces OSTα and OSTβ mRNA and protein expression (Boyer et al. 2006). Such induction of basolateral transporters represents a compensatory mechanism preventing intracellular accumulation of BAs, and facilitating their elimination in the urine, in cholestatic conditions when canalicular excretion of BAs is altered.

81 Figure 10: Ligand-activated regulation of gene expression that determines the hepatic clearance of bile salts, bilirubin and xenobiotics (Boyer 2013).

82 III.6. Major considerations beyond direct inhibition of BSEP while investigating drug-induced cholestasis

In the last decades interest in bile salt export pump BSEP has grown since it plays a major role in the excretion of the majority of BAs. Studies on drug-induced cholestasis have been extensively focused on inhibition of BSEP as a cause of drug- induced cholestasis and that leads to drug-induced liver injury (DILI) (Bjornsson and Jonasson 2013; Kubitz et al. 2012; Stepan et al. 2011; Yang et al. 2013). Strong effort has been done attempting to predict drug-induced cholestasis based on direct BSEP inhibition (Dawson et al. 2012; Morgan et al. 2010; Pedersen et al. 2013; Warner et al. 2012). Unfortunately, such trials did not provide deductive results, and were not sufficient to predict cholestatic drugs (Dawson et al. 2012; Morgan et al. 2010). There is no uncertainty for the role of BSEP in clearance of BAs, but is it the major cause of drug-induced cholestasis? Is the simple and direct inhibition of BSEP sufficient to induce accumulation of BA and perturbation of the BA pool, triggering the adaptive mechanisms and the alternative pathways? Apart of the role of BSEP several complex factors should be took into account while screening for drug-induced cholestasis: i) The complex PK-ADME-TOX profiles of each individual BA and the multiple participant transporters and enzymes that are implicated in the synthesis, conjugation, and transport of these BAs during enterohepatic circulation. ii) The complex regulation process initiated by BAs and involving the various nuclear receptors in normal and cholestatic conditions as discussed in chapters 2 and 3. iii) The complicated of intracellular trafficking of transporters which are dependent on various cellular components such as microtubules, actin, MLC2, PI3K and vesicles- binding proteins mainly Rab11, and their ability to mediate the vectorial transport of BAs. iv) The intricate regulation of the structure and contractility of bile canaliculi and the tight junction that appear to be very important in controlling bile flow. Likely, a cholestatic drug could alter all these complex process at various levels. Thus a drug can alter the BA pool balance, BA-metabolizing enzymes, kinases, NHR-mediated (adaptive) responses, ABC transporter intracellular trafficking, and/or

83 the contractility of bile canaliculi by alternative combinations of mechanisms, in addition to inducing a direct inhibition of BSEP, rather than inhibition of BSEP alone. Even though investigators are moving beyond BSEP modulation alone by cholestatic drugs, this concept has not received yet as much awareness while investigating drug-induced cholestatic liver injury. Consequently, when screening for drug-induced cholestasis, beside direct inhibition of multiple BA transporters, investigators should consider the disruption of vectorial BA transport, BAs synthesis and conjugation, NHRs, kinases, and phase II (conjugation) enzymes, cytoskeleton components, trafficking of BA transport and bile canaliculi motility, induced by the parent drug and/or its metabolites that lead to disruption BA pool profile signatures (Figure 11) leading to cholestasis and instating the complex alternative mechanisms.

Figure 11: Summary of the potential mechanism(s) by which a drug or metabolite can impact the hepatobiliary disposition of BAs (Rodrigues et al. 2014).

84 As discussed in Chapter I, drug-induced toxicity can be classified into intrinsic (predictable) or idiosyncratic (non-predictable) toxicity. While some drugs such as CsA are responsible for intrinsic hepatotoxicity, inducing dose-dependent cholestatic features, others such as CPZ, troglitazone and trovafloxacin induce intrahepatic cholestasis in an non predictable (idiosyncratic) manner (Deng et al. 2009). We selected CsA to study intrinsic hepatotoxicity in vitro using mainly the human cell line HepaRG. The features and the known effects of this drug are described in the following chapter.

85 IV. Cyclosporine A: An intrinsic cholestatic drug

IV.1. History and structure of cyclosporine A

With the discovery of cyclosporine A (CsA) in 1970s, as an immunosuppressive agent, a new era in immunopharmacology have commenced, which made an important and great advance in the history of clinical transplantation. CsA is a cyclic undecapeptide with a wide variety of biological activities including immunosuppressive, anti-inflammatory, antifungal and antiparasitic properties (Survase et al. 2011). Recently, it has been shown that CsA has anti-hepatitis virus C protective effect (Nakajima et al. 2013). In 1976, Borel et al ., first reported by studies in rodents the immunosuppressive activity of CsA (Borel et al. 1976). In 1979, Calne and his coworkers reported the first major clinical experience with this drug (Calne 1979). CsA was approved by the USFDA for clinical use in 1983 to prevent graft rejection in transplantation, it took 12 years for CsA to be developed into the drug Sandimmune® and it is now widely used as an immunosuppressant and anti- rejection drug in solid organ transplantation. CsA was initially isolated from the fungus Tolypocladium inflatum (Borel et al. 1976). Later in 1984, synthetic CsA was produced (Survase et al. 2011). CsA is a cyclic hydrophobic undecapeptide containing 11 amino acids; this unusual structure of CsA confers a very low aqueous solubility. It has molecular weight of 1202.61 g.mol-1 and the molecular formula C62H111N11O12 (Figure 12) (Laupacis et al. 1982; Wenger 1990).

Figure 12: Molecular structure of cyclosporin A (CsA) (Peel and Scribner 2015).

86 IV.2. Therapeutic use of CsA

CsA was first registered as Sandimmune™ as an immunosuppressant to be used in sold organ transplantation and was approved by the FDA to prevent graft rejection. Prior to CsA development, the used immunosuppressant agents (methotrexate, azothioprine and corticosteroids) were myelotoxic, where they are reported to inhibit cell division and proliferation non-specifically (Borel et al. 1976; von Wartburg and Traber 1986). In contrast, CsA is reported to inhibit T-cell specifically and with low levels of myelotoxicity (Survase et al. 2011). CsA significantly reduces rejection rates and improves patient and graft survival in solid organ that include skeletal muscles, lung, small bowel, cornea, skin, heart and liver. In addition for being the most prescribed immunosuppressant drug, CsA has a wide range of pharmacological activities to treat autoimmune diseases, chronic inflammatory reactions, as well as fungicidal and antiparasitic and anti-HIV virus activities.

IV.3. Mechanisms of action

In therapy, the most important effect of CsA is to inhibit T-cells activity and consequently their immune response. In activated T-cells, activation of the T-cell receptor normally leads to an increase in intracellular calcium, which acts via calmodulin to activate calcineurin (Ca2+-dependent serine-threonine phosphatase). Then after, calcineurin dephosphorylates the transcription nuclear factor of activated T-cells (NFAT), promoting its translocation to the nucleus of the T-cell and increases the transcription of IL-2 and related cytokines. After entering the cell, CsA binds to the cytosolic protein cyclophilin (immunophilin) of lymphocytes, especially T cells (Handschumacher et al. 1984; Harding et al. 1989; Marks 1996). Cyclophilin A binds with high affinity to CsA, forming the CsA- cyclophilin complex (Harding and Handschumacher 1988). This complex inhibits the phosphatase activity of calcium-activated calcineurin, preventing dephosphorylation and subsequent translocation of NFAT from the cytosol to the nucleus that is required for the transcription of the IL-2 gene leads to a reduced function of effector T-cells (Barshes et al. 2004).

87 In addition to the effect of CsA on the inhibition of Ca2+-calcineurin/NFAT-dependent immune response, studies provided evidence that CsA blocks T-cell activation by inhibiting both JNK and p38 signaling pathways (Matsuda and Koyasu 2000). Some of the immunosuppressive effects of CsA have also been attributed to the ability to induce the production of the potent immunosuppressive cytokine TGF-β (Khanna et al. 1997; Shin et al. 1997). TGF-β is a powerful immunosuppressive molecule considered to be at least 10,000 times more potent than CsA. CsA binds to the cyclophilin D protein (CypD) that constitutes part of the mitochondrial permeability transition pore (MPTP), preventing it from opening, thus inhibiting cytochrome c release, a potent apoptotic stimulation factor. This is not the primary mechanism of action for clinical use, but is an important effect for research on apoptosis (Matsuda and Koyasu 2000).

IV.4. Metabolism of CsA

Gastrointestinal metabolism can contribute up the half of CsA metabolism. CsA is metabolized in enterocytes by CYP3A isozymes, predominantly CYP3A4 and CYP3A5 (Crettol et al. 2008). Studies have shown that CsA is primarily metabolized by CYP3A4 (Dai et al. 2004). The involvement of other members of CYP3A family, CYP3A7 and CYP3A43, in CsA metabolism is unclear (Crettol et al. 2008). The parent drug molecule that escapes intestinal metabolism enters the liver, where it undergoes metabolism by CYP3A4 and CYP3A5 in the hepatocytes (Kolars et al. 1991; Lampen et al. 1995). About 25 CsA metabolites are formed. The major CsA metabolites found in blood are AM1 and AM9, which are hydroxylated products, and AM4N, which is N-demethylated (Akhlaghi et al. 2012). CYP3A4 transforms CsA into AM1, AM9, and AM4N, whereas CYP3A5 only transforms it into AM9 (Dai et al. 2004). Reported immunosuppressive activity of these metabolites varies between studies, but all metabolites less active than the parent molecule. It is controversial to conclude if the parent molecule or the metabolites of CsA are more toxic. Although CsA metabolites have been proved to be relatively less toxic than the mother compound in rat models (Donatsch et al. 1990), or in a renal epithelial cell line (LLC-PK1) (Copeland et al. 1990b), several clinical studies and reports showed an association between plasma concentrations of CsA metabolites

88 and neuro- or nephro-toxicity (Kohlhaw et al. 1989; Wonigeit et al. 1990). This is attributed to generation of cyclized second CsA metabolites such as cyclized AM1 (AM1c9), which is shown to induce nephrotoxicity (Christians et al. 1991). Indeed when the activity of CYP3A4 is low (due interindividual variation), alternative pathways of CsA metabolism will be activated leading to the generation of cyclized metabolites (Christians and Sewing 1995). CsA is extensively metabolized (Copeland et al. 1990b) and less than 1% of the parent drug appearing unchanged in urine and feces. CsA and its metabolites are mainly excreted in the bile, with only around 3% of the drug undergoing renal elimination (Copeland et al. 1990a; Venkataramanan et al. 1985). In addition to CYP3A4 and CYP3A5, the efflux transporter P-glycoprotein also plays a major role in the pharmacokinetics of CsA. Variation in intestinal P-glycoprotein was found to account for an approximately 17% of the variability in oral clearance of CsA. A study showed that 75% of inter-patient variability in CsA clearance could be explained by variation of both CYP3A4 activity in the liver, and expression of P- glycoprotein in enterocytes (Barbarino et al. 2013).

IV.5. CsA-induced adverse effects

Immunosuppressive activity of CsA is hindered by its adverse reactions that cannot be disregarded. CsA treatment induces adverse effects that are characterized by occurrence of considerably wide and serious complications including nephrotoxicity, hepatotoxicity, neurotoxicity, hyperkalemia, hypertension, dyslipidemia, gingival hyperplasia, hypertrichosis, malignancies, and an increased risk of cardiovascular disorders (de Mattos et al. 2000; Herrero et al. 2000; Stallone et al. 2004). Acute toxic effects are often reversible whereas chronic symptoms may persist even after ceasing of the treatment. CsA can induce increased serum bilirubin and transaminases, which usually appear in the first 2 months of treatment and disappear on stopping of the drug (Pickrell et al. 1988; Racusen et al. 1987; Shen et al. 1987). In addition to these CsA specific side effects, CsA produces significant inhibitory effects on immune defense mechanisms that generally increase the risks of infections and malignancies (Lee 2010). Several viral, bacterial, and fungal, infections as well as an increased frequency of cancers are observed among

89 transplant recipients treated with CsA (Josephine et al. 2008; Kumar et al. 2005; Pascual et al. 2002).

III.5.1. CsA-induced hepatotoxicity

It has been shown that CsA causes hepatotoxicity in some transplant recipients (LeBel et al. 1992; Lowry et al. 1951; Marklund and Marklund 1974; Park et al. 2005b), and in some animal models (Josephine et al. 2008; Rezzani 2004). A previous study showed that about 25% of hepatic dysfunction following liver transplantation was caused by CsA toxicity (Muraca et al. 1993). Study performed by Lorber et al. reported that 228 (49%) patients from a total of 466 receiving renal allografts under treatment with CsA, were documented to develop at least one episode of post-transplant hepatotoxicity (Lorber et al. 1987). Another study reported that 38 patients (58%) of total 59 patients with endogenous uveitis who received CsA, developed at least one liver abnormality (Kassianides et al. 1990). Hepatotoxic episodes usually were self-limited and generally occurred during the very early post-transplantation period. Reduction in CsA was found to be effective in normalizing the liver function abnormalities (Durak et al. 2004). The histopathological changes and functional abnormalities occurring in the liver comprise sinusoidal dilatation, cytoplasmic vacuolization of hepatocytes and hepatocytes ballooning, cell infiltration especially in the periportal areas, parenchymal mitosis and moderate focal hepatocellular necrosis, cholestasis, biliary calculous disease, cholelithiasis, hyperbilirubinemia, hypoproteinemis, increased alkaline phosphatase (AP), elevated transaminases (AST and ALT), lactate dehydrogenase (LDH) and bile salts in the blood, inhibition of protein synthesis, disturbed lipid secretion and pathological changes such as dilatation of the endoplasmic reticulum, loss of ribosomes, in both human and experimental animals (Bohmer et al. 2011; Durak et al. 2004; Hillebrands et al. 1999; Lorber et al. 1987; Rezzani 2004; Ryffel et al. 1983; Szalowska et al. 2013; Zhong et al. 2001). Alterations in bile formation, the capacity of the liver to excrete organic anions and xenobiotics and changes in the hepatic content of glutathione (GSH) are also important in CsA-provoked liver damage (Josephine et al. 2008; Moran et al. 1998). The liver tissue can be damaged and hepatic function disturbed even when CsA blood levels are in the therapeutic range (Kahan 1989). In fact, it is reasonable that

90 impaired liver cell function may result in marked derangement of CsA metabolism because the uptake of this drug by the liver is higher than by any other organ and that the liver represents the major site of metabolism of CsA (Maurer and Lemaire 1986; Wonigeit et al. 1990). The precise molecular mechanism of CsA-induced hepatic injury remains a matter of debate, although various mechanisms have been proposed. Some researchers suggested that this side effect of CsA might be mainly attributed to the interactions of other factors such as hepatitis C virus infection (Horina et al. 1993). Nevertheless, with numerous current findings, it is believed that the excessive production of reactive oxygen species (ROS) which depletes hepatic antioxidant system, glutathione, catalase, glutathione peroxidase and superoxide dismutase and ultimately causing oxidative stress could be a possible mechanisms of CsA-induced hepatotoxicity (Bohmer et al. 2011; Durak et al. 2004; Josephine et al. 2008). This CsA-generated oxidative stress is associated with membrane lipid peroxidation, (Galan et al. 1999; Kehrer 1993) and alteration of hepatocellular membrane integrity. That is indicated by elevated serum enzymes in CsA-treated patients (Hillebrands et al. 1999; Rezzani 2004), and in rat models treated with CsA (Josephine et al. 2008). It has also been reported that increased oxidized glutathione concentrations can modulate the activity of various regulatory enzymes, and it might be a cause of the impaired hepatocellular functions induced by CsA (Durak et al. 2004). Other researchers reported that acute CsA treatment also inhibits respiration of isolated mitochondria. In contrary, chronic CsA exposure causes a hypermetabolic state leading to hypoxia in the liver, which may be responsible at least for a part of its hepatotoxicity (Zhong et al. 2001).

IV.5.1.1. CsA-induced cholestasis

The most common abnormalities related to CsA hepatotoxicity are increases of serum BA levels, hyperbilirubinemia, cholestasis and cholelithiasis, i.e., disturbances of bile formation. Cholestatic features have been repeatedly observed in patients on CsA therapy (Arias 1993; Dandel et al. 2010; Day et al. 2006; Hulzebos et al. 2003; Kahan 1989; Kassianides et al. 1990; Roman and Coleman 1994), in experiments on rats and mice (Deters et al. 2002; Kienhuis et al. 2013; Le Thai et al. 1988;

91 Szalowska et al. 2013), and in vitro (Ansede et al. 2010; Jemnitz et al. 2012; Roman and Coleman 1994; Roman et al. 1996). The mechanisms underlying CsA-induced cholestasis have been extensively investigated, and several mechanisms related to CsA-induced cholestatic effects have been evolved. In the following paragraph we will discuss the most frequently proposed mechanisms.

A. Reduction of bile acid-dependent bile flow (BADF)

Several studies provided compelling evidences that CsA reduces bile acid-dependent bile flow (BADF), due to its inhibitory effects on uptake, synthesis and ATP- dependent canalicular transport of BAs in the liver (Ballantyne et al. 1989; Roman and Coleman 1994; Rotolo et al. 1986; Ziegler and Frimmer 1986). CsA interacts with various steps of bile salts synthesis, metabolism and detoxification.

a) Reduction of bile acid synthesis by CsA

Decrease in bile flow due to a decrease in bile salt synthesis has been reported after CsA treatment. CsA acutely inhibits bile salt synthesis in cultured rat and human hepatocytes, and the hepatoma liver cell line (HepG2), as well as in pediatric patients receiving CsA therapy (Chan and Shaffer 1997; Hulzebos et al. 2003; Le Thai et al. 1988; Princen et al. 1991). Inhibition of BA synthesis by CsA is attributed to inhibition of cholesterol 7α - hydroxylase (CYP7A1), the rate-limiting enzyme in bile salt synthesis, and of mitochondrial sterol-27α -hydroxylase (Cyp27A1), resulting in decreased synthesis rates of cholate and particularly chenodeoxy cholate (Axelson et al. 2000; Hulzebos et al. 2003; Levy et al. 1994; Princen et al. 1991; Vaziri et al. 2000). Impairment of the synthesis of cholesterol into bile salts by CsA treatment results in a saturation with unconjugated cholesterol leading to the formation of gallstones (cholelithiasis) in patients receiving CsA therapy (Cao et al. 1997; Chanussot et al. 1992; Ericzon et al. 1997).

b) Reduction of bile acid uptake by CsA

As mentioned above, adequate bile flow is maintained partly by the efficient enterohepatic recirculation of BAs. One important component of this process is the

92 uptake of BAs from the sinusoidal blood into hepatocytes by the uptake transporters, mainly NTCP. NTCP is indispensable to generate BADF bile flow, and it was found to be a possible target for cholestatic drugs (Akita et al. 2001; Bohan and Boyer 2002; Kim et al. 1999; Stieger et al. 2000). CsA has been reported to inhibit competitively and non-competitively ATP-dependent sodium-dependent uptake of radiolabeled taurocholate (TCA) (a substrate for NTCP as well as BSEP) in human, rat, and HepaRG hepatocytes (Azer and Stacey 1993a; Bohme et al. 1994a; Jemnitz et al. 2012; Szabo et al. 2013), and by liver plasma membrane vesicles (Moseley 1997). However, CsA showed no inhibitory effect on the TCA uptake in dog hepatocytes and this could be attributed to interspecies variation (Rose et al. 2006). Discrepancy has been reported on the role of NTCP in CsA-induced cholestasis. Certain studies have suggested that cholestasis caused by CsA treatment in different experimental models might be related to a competitive or non-competitive inhibition of the hepatic uptake of BAs (Le Thai et al. 1988; Roman et al. 1990; Ziegler and Frimmer 1986). This is coherent with the increases in serum BA concentrations in rat and man after CsA treatment (Roman et al. 1990). Conversely, other studies argued that the inhibition in hepatic uptake could be a secondary event, rather than a primary (causative) one, since the capacity of sinusoidal uptake has been reported to be 10- to 20-fold higher than the maximum secretory rate of BAs (Coleman 1987; Roman et al. 1990), and since CsA diffuses passively into the hepatocytes (Gong et al. 2011). Thus, other hepatic processes may equally be involved in the development of CsA-induced cholestasis (Roman et al. 1990).

c) Reduction of bile salt secretion by CsA

Bile salt secretion across the canalicular membrane is known to be the rate-limiting step of hepatocellular bile flow, and it is mediated by an ATP-binding cassette (ABC) transporter, mainly BSEP, which drives and maintains enterohepatic circulation of bile salts (Stieger 2011). The sequence of BSEP and MDR1 are closely related and substrates of MDR1 can also interfere with BSEP function (Byrne et al. 2002; Noe et al. 2002; Stieger 2011; Stieger et al. 2007). In rats, CsA, a MDR1 substrate has been demonstrated to inhibit bile flow and ATP-dependent bile salt transport into the canalicular lumen (Padda et al. 2011). Furthermore, hepatobiliary secretion of intravenously administered

93 radiolabeled TCA (a substrate of BSEP) (Jemnitz et al. 2010) was inhibited in rats that were acutely or chronically treated with CsA (Akashi et al. 2006; Kadmon et al. 1993). In canalicular liver plasma membrane vesicles from rats and humans, CsA impairs ATP-dependent transport of TCA (Bohme et al. 1994a; Kadmon et al. 1993). After cloning of Bsep from rats and human, it was possible to demonstrate that CsA is a competitive cis- inhibitor of Bsep (Stieger et al. 2000). CsA is found to inhibit human BSEP transfected LLC-PK1cells (Mita et al. 2006), and rat BSEP transfected Sf9 insect cells (Stieger 2011; Stieger et al. 2000). In addition to competitive inhibition of BSEP, CsA was also shown to inhibit the bile salt-stimulated Bsep ATPase activity (Noe et al. 2001). Roman and his coworkers proposed another mechanism of CsA-induced inhibition of BSEP activity. Immunostaining in rat hepatocyte couplets showed that CsA decreases Bsep localization at the canalicular membrane, due to an increased endocytosis of this transporter into vesicular compartments located in the cytoplasm. Therefore, both partial retrieval of Bsep from the canalicular membrane and inhibition of Bsep activity still localized to the membrane can well act in concert to induce the overall reduction of the biliary bile salt secretion by CsA (Roman et al. 2003). Finally, CsA can disrupt the homeostasis of the enterohepatic recirculation and BADF by affecting directly bile salt handling by the intestine: ileal perfusion with CsA was shown to impair intestinal bile salt absorption in rats (Sauer et al. 1995).

B. Alterations of cytoskelton and pericanalicular F-actin microfilament

Pericanalicular F-actin alteration appears to be a specific marker of hepatocellular cholestasis (Thibault et al. 1992), that could result in impairment of contractility, which is necessary for propulsion of bile within the biliary tree (Watanabe et al. 1991a). Phalloidin-FITC staining of F-actin in rat hepatocyte couplets treated with CsA showed alteration in the distribution of pericanalicular F-actin microfilaments (Roman et al. 2003; Roman et al. 1996). Additionally to its necessity for the motility of the bile canaliculi, F-actin cytoskeletal integrity is required for normal localization of transporters at the canalicular membrane domain (Roma et al. 2000; Rost et al. 1999). Accordingly, alteration of cytosketal F-actin caused by CsA may explain the disturbance in Bsep cellular

94 localization induced by CsA. In addition, a study on rat hepatocytes showed that CsA interferes with the hepatocellular vesicle-mediated transport processes, that could be related to alteration of the microfilament and microtubular system by CsA (Roman et al. 1990). Thus CsA-induced cholestasis and hyperbilirubinemia may be in part as a consequence of F-actin disruption at the canalicular domain that leads to Bsep endocytosis from the canalicular membrane level, and vesicle-mediated transport processes (Roman et al. 2003; Roman et al. 1990).

C. Reduction of bile acid-independent bile flow (BAIF)

GSH has several functions in the liver cell. It is the most important antioxidant in the cytosol. Many compounds are conjugated with GSH during detoxification. Its ATP- dependent excretion to the bile via Mrp2 is an important driving force for bile acid- independent bile flow (BAIF). Several studies showed that cholestasis could be associated with alterations in the secretion of biliary thiols, mainly GSH (Bouchard et al. 2000). Contradictory, results were obtained on the implication of cellular GSH and BAIF in CsA-induced cholestatic effects (Roman et al. 1990). A study on rats showed that CsA had a negligible influence on BAIF (Yasumiba et al. 2001). However several other investigations demonstrated that rats treated with CsA have reduced GSH secretion into bile, and accordingly reduced BAIF (Moran et al. 1998) and conjugated hyperbilirubinemia (Galan et al. 1995), and increased lipid peroxidation (Galan et al. 1999). GSH-related enzymes, gamma-glutamylcysteine synthetase light (GCSlc) and heavy (GCShc) chain subunits and glutathione-S-transferase mRNAs were down- regulated after CsA treatment. These enzymes are both rate- and capacity-limiting for GSH production. In addition to reduction of intracellular GSH, CsA down-regulates Mrp2 mRNA and thus exaggerating the reduction of GSH excretion into bile and therefore reducing BAIF. As a consequence, these alterations in GSH metabolism and excretion into bile may be implicated in the cholestatic reactions seen after CsA treatment (Bramow et al. 2001).

D. Decreased cellular membrane fluidity

Several investigations showed that the inhibition of biliary flow by CsA is partly due to its membrane-rigidifying effect (Bohme et al. 1994a; Bohme et al. 1994b; Kadmon et al. 1993; Roman and Coleman 1994). Studies have shown that canalicular and

95 basolateral liver plasma-membrane vesicles prepared from CsA-treated rats exhibit (i) a decrease in membrane fluidity, (ii) an increase in cholesterol/phospholipid molar ratio and (iii) a decrease in Vmax of TCA transport (Rossaro et al. 1988; Rossaro et al. 1991; Yasumiba et al. 2001). Moreover, it has been reported that molecules that increase membrane fluidity, such as S-adenosyl-L-methionine, 2-(2-methoxyethoxy) ethyl-8-(cis-2-n-octylcyclopropyl) octanoate, and benzyl alcohol, have a beneficial counteracting effect against CsA-induced cholestasis (Fernandez et al. 1995; Sinicrope et al. 1992). The increase in membrane rigidity induced by CsA was associated with enrichment of membrane cholesterol, and a consequent increase of the cholesterol/phospholipid ratio. The mechanism by which CsA decreases membrane fluidity was not clearly elucidated. At the basolateral membranes, although studies of Azer and Stacey showed that CsA interferes directly with BA uptake transporters (Azer and Stacey 1993a; Azer and Stacey 1993b). Some investigators suggested that passive influx of CsA could induce damage of hepatocytes at the basolateral membrane due to its strong hydrophobicity, and increase the cholesterol/phospholipid ratio as well as reduce the membrane fluidity, and consequently alter BA uptake (Reichen and Paumgartner 1976). However at the canalicular membrane other mechanisms are proposed for CsA- induced impairment of membrane fluidity and accordingly BA efflux: (a) alteration of intracellular lipid transport, (b) selective inhibition of the membrane lipid transporter MDR2 (Mdr2 in mouse) and (c) reduction of BAs micelle formation capacity to induce biliary lipid secretion (Yasumiba et al. 2001). Hence cholestasis induced by CsA may involve one or more mechanisms from those described above, but it can also involve new mechanisms that have not yet been described, and require further investigations to elucidate the mode of action of this immunosuppressant drug in the liver.

96 97 Results

98 99 Results In our work we aimed to establish and characterize an in vitro model that could help to predict drug-induced cholestasis and analyze the underlying mechanism of such a hepatic lesion. Our work is based mainly on the hepatic cell line, HepaRG cells. The culture protocol of these cells is shown in Figure 13.

Figure 13: Seeding and culture of HepaRG cells. HepaRG cells were cultured at low density (LD) or highdensity HD. At LD seeding, HepaRG cells transdifferentiated into bipotent progenitors and actively divided until confluence (15 days); then, they differentiated into both hepatocyte-like and biliary-like cells (approximately 50% each). Maximal liver-specific activities were attained after 2 weeks in the growth medium supplemented with 2% DMSO (28 days). When seeded at HD, HepaRG cells were directly incubated in the DMSO- containing medium; they did not transdifferentiate and retained their morphological and functional characteristics. For induction studies, HepaRG cells were seeded either at LD and cultured for up to 56 days or at HD and cultured for up to 28 days (Antherieu et al. 2010).

As a first step our objective was to validate differentiated HepaRG hepatocytes as a convenient in vitro human liver cell model to obtain drug-induced cholestasis by analysing the distribution and activity of canalicular and basolateral transporters in these cells, by comparison with fresh primary human hepatocytes in a conventional or sandwich configuration. Comparable results were obtained in the 3 cell models. The results were published in:

100 • Comparative Localization and Functional Activity of the Main Hepatobiliary Transporters in HepaRG Cells and Primary Human Hepatocytes. Ahmad Sharanek*, Pamela Bachour-El Azzi., * et al., Toxicological Sciences 2015. *Co-first author. In a second step, to better predict drug-induced cholestasis we set out conditions for inducing cholestasis with various drugs in HepaRG cells and we investigated mechanisms implicated in early cholestatic effects of cyclosporine A (CsA). Deregulation of the cPKC pathway and induction of an endoplasmic reticulum stress preceding generation of an oxidative stress were identified to be involved in CsA- induced cholestatic lesions. This work is published in: • Different dose-dependent mechanisms are involved in early cyclosporine A- induced cholestatic effects in HepaRG cells. Ahmad Sharanek et al., Toxicological Sciences 2014. Then, we analysed bile acid profiles in control and CsA-treated HepaRG cells. We found that these cells had the capacity to synthesize and excrete BAs as well as to accumulate them intracellularly following treatment with the cholestatic drug. This work is submitted for publication: • Dose-dependent accumulation of bile acids and involvement of compensatory mechanisms in cyclosporine A-treated HepaRG hepatocytes. Ahmad Sharanek et al., manuscript submitted. Finally, we extent our investigations to a series of cholestatic drugs. Alterations of bile canalicular dynamics were identified as important biomarkers for drug-induced cholestasis where Rho-kinase and myosin-II ATPase were found to play a critical role. This work is under preparation for submission: The Rho-kinase pathway plays a key role in bile canaliculi deformation and bile acid impairment induced by cholestatic drugs. Ahmad Sharanek et al., manuscript under preparation.

101 Chapter 1

102 103 TOXICOLOGICAL SCIENCES, 145(1), 2015, 157–168

doi: 10.1093/toxsci/kfv041 Advance Access Publication Date: February 17, 2015

Comparative Localization and Functional Activity of the Main Hepatobiliary Transporters in HepaRG Cells and Primary Human Hepatocytes Pamela Bachour-El Azzi*,†,‡,1, Ahmad Sharanek*,†,1, Audrey Burban*,†, Ruoya Li§,Re´my Le Gue´vel¶, Ziad Abdel-Razzak‡, Bruno Stiegerjj, Downloaded from Christiane Guguen-Guillouzo†, and Andre´Guillouzo*,†,2

*Inserm UMR991, Foie, Me´tabolismes et Cancer, Rennes, France; †Universite´de Rennes 1, Rennes, France, ‡ §

Universite´Libanaise, EDST-PRASE and EDST-AZM-center-LBA3B, Beirut, Lebanon, Biopredic International, http://toxsci.oxfordjournals.org/ Saint Gre´goire, France, ¶ImPACcell, SFR Biosit, Universite´de Rennes 1, Rennes, France and jjDepartment of Clinical Pharmacology and Toxicology, University Hospital, Zurich, Switzerland

1These authors contributed equally to this work. 2To whom correspondence should be addressed at Inserm UMR 991, Faculte´des Sciences Pharmaceutiques et Biologiques, 35043 Rennes Cedex, France. Fax: þ33 223235385. E-mail: [email protected].

ABSTRACT at INSERM on April 25, 2015 The role of hepatobiliary transporters in drug-induced liver injury remains poorly understood. Various in vivo and in vitro biological approaches are currently used for studying hepatic transporters; however, appropriate localization and functional activity of these transporters are essential for normal biliary flow and drug transport. Human hepatocytes (HHs) are considered as the most suitable in vitro cell model but erratic availability and inter-donor functional variations limit their use. In this work, we aimed to compare localization of influx and efflux transporters and their functional activity in differentiated human HepaRG hepatocytes with fresh HHs in conventional (CCHH) and sandwich (SCHH) cultures. All tested influx and efflux transporters were correctly localized to canalicular [bile salt export pump (BSEP), multidrug resistance- associated protein 2 (MRP2), multidrug resistance protein 1 (MDR1), and MDR3] or basolateral [Naþ-taurocholate co- transporting polypeptide (NTCP) and MRP3] membrane domains and were functional in all models. Contrary to other transporters, NTCP and BSEP were less abundant and active in HepaRG cells, cellular uptake of taurocholate was 2.2- and 1.4-fold and bile excretion index 2.8- and 2.6-fold lower, than in SCHHs and CCHHs, respectively. However, when taurocholate canalicular efflux was evaluated in standard and divalent cation-free conditions in buffers or cell lysates, the difference between the three models did not exceed 9.3%. Interestingly, cell imaging showed higher bile canaliculi contraction/relaxation activity in HepaRG hepatocytes and larger bile canaliculi networks in SCHHs. Altogether, our results bring new insights in mechanisms involved in bile acids accumulation and excretion in HHs and suggest that HepaRG cells represent a suitable model for studying hepatobiliary transporters and drug-induced cholestasis.

Key words: hepatobiliary transporters; membrane localization; transporter activity; HepaRG hepatocytes; human hepatocytes

ABBREVIATIONS CDFDA 5(6)-carboxy-20,70-dichlorofluorescein diacetate BEI bile excretion index CCHH conventional cultured human hepatocyte BSEP bile salt export pump HH human hepatocyte

VC The Author 2015. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: [email protected]

157 158 | TOXICOLOGICAL SCIENCES, 2015, Vol. 145, No. 1

JC-1 5,50,6,60-Tetrachloro-1,10,3,30-tetraethylbenzimida- cholestasis are acquired forms of cholestasis (Pauli-Magnus zolo carbocyanine iodide et al., 2010). Drug-induced cholestasis may lead to drug-induced MDR multidrug resistance protein liver injury in humans. In many cases of acquired forms of cho- MK571 5 -(3-(2-(7-Chloroquinolin-2-yl)ethenyl)phenyl)-8- lestasis, activity and cellular distribution of hepatobiliary trans- dimethylcarbamyl-4,6-dithiaoctanoic acid sodium porters are altered. Other mechanisms, such as altered cell salt hydrate polarity as a consequence of mistargeting of intracellular trans- MRP multidrug resistance-associated protein port vesicles, cytoskeletal modification, disrupted cell–cell junc- NTCP Naþ-taurocholate co-transporting polypeptide tions, or deregulated signaling pathways may be involved in OATP organic anion transporting polypeptide acquired cholestasis (Trauner and Boyer, 2003). Finally, oxidative PBS phosphate buffered saline stress as a primary causative agent and/or as an aggravating fac- SCHH sandwich-cultured human hepatocyte tor has been linked to cholestatic liver injury (Antherieu et al., TCA taurocholic acid. 2013; Copple et al.,2010; Perez et al.,2006; Roma and Sanchez Pozzi, 2008). Although major progress has been made in the knowledge of Hepatocytes are highly polarized cells exhibiting specialized transporters, their regulation and interactions with drugs apical (canalicular) and sinusoidal (basolateral) domains. They and substrates, their role in drug-induced liver injury, in partic- import and export a variety of exogenous and endogenous sub- ular drug-induced cholestasis, requires further investigations strates largely via membrane transporters that are divided into (Corsini and Bortolini, 2013; Liu et al., 2014). Various in vivo and two major groups: influx transporters mediating cellular uptake in vitro biological approaches are currently used for studying he- Downloaded from of appropriate substrates and efflux transporters responsible for patic transporters. Sandwich-cultured primary hepatocytes are their excretion into bile canaliculi or blood (Giacomini et al., considered as the most appropriate cell model to mimic the 2010). Bile acids and drugs are their main substrates; 95% of bile hepatobiliary secretory process (De Bruyn et al., 2013); because acids secreted into bile are reabsorbed in the ileum, diffused major species differences have been reported in this process, across the enterocyte to the basolateral membrane, exported the use of sandwich-cultured primary human hepatocytes (SCHHs) is desirable (Guguen-Guillouzo and Guillouzo, 2010; into portal blood circulation, extracted at the hepatocyte http://toxsci.oxfordjournals.org/ sinusoidal membrane, and re-secreted into bile contributing Swift et al., 2010). therefore to bile formation through the so-called entero-hepatic Recent studies have shown that cholestasis can be induced circulation (Hofmann, 1999). by drugs in human HepaRG cells, a human liver cell line ex- Hepatic uptake of biliary constituents at the sinusoidal do- pressing features of mature hepatocytes and exhibiting typical main of hepatocytes is mediated by both sodium-dependent bile canaliculi. These findings suggest that HepaRG cells may be and independent mechanisms (Nathanson and Boyer, 1991). useful to mechanistically better understand drug-induced alter- Although sodium-independent uptake of bile salts is carried by ations of bile acids influx and efflux (Antherieu et al., 2013; members of the organic anion transporting polypeptide family Sharanek et al., 2014). Whether the transport process in this cell (OATPs/SLCOs), sodium-dependent uptake is mediated by the model compares well with that in primary HHs in conventional þ Na -taurocholate co-transporting polypeptide (NTCP/SLC10A1) or sandwich configuration remains currently unanswered. In at INSERM on April 25, 2015 that represents the most relevant uptake system. It accounts for this work, we showed that cellular localization and functional the uptake of the major part of conjugated bile acids and less activity of the main hepatobiliary transporters were comparable than half of unconjugated bile acids (Kullak-Ublick et al., 2000; in HepaRG cells and primary HHs. Meier and Stieger, 2002). Bile salts are then carried across the hepatocyte and secreted into bile via canalicular transporters. MATERIALS AND METHODS Canalicular transport of bile constituents is mainly mediated by ABC superfamily transporters: bile salt export pump (BSEP/ Reagents. Phalloidin fluoprobe was purchased from Interchim ABCB11), multidrug resistance-associated protein 2 (MRP2/ (Montluc¸on, France), [3H]-taurocholic acid ([3H]-TCA) was pur- ABCC2), P-glycoprotein [multidrug resistance protein 1 (MDR1)/ chased from Perkin Elmer (Boston, Massachusetts), verapamil, ABCB1], phospholipid flippase (MDR3/ABCB4), and breast cancer 5 -(3-(2-(7-Chloroquinolin-2-yl)ethenyl)phenyl)-8-dimethylcar- resistance protein (BCRP/ABCG2). Although BSEP exports bamyl-4,6-dithiaoctanoic acid sodium salt hydrate (MK571) and monovalent bile salts and is responsible for bile salt-depen- 5(6)-carboxy-20,70-dichlorofluorescein diacetate (CDFDA) were dent flow, MRP2 excretes divalent bile salts, glutathione and purchased from Sigma (St Quentin Fallavier, France). its conjugates, generating therefore the major part of bile salt 5,50,6,60-Tetrachloro-1,10,3,30-tetraethylbenzimidazolo carbocya- independent bile flow (Kullak-Ublick et al., 2000). MDR1 has nine iodide (JC-1 dye) was obtained from Invitrogen-Molecular been shown to transport amphipathic organic cations, probes (Saint Aubin, France). Hoechst dye was obtained whereas MDR3 translocates phosphatidylcholine from the in- from Promega (Madison, Wisconsin). All primary antibodies, ner to the outer leaflet of the canalicular membrane except BSEP and NTCP antibodies (from Dr B. Stieger laboratory), (Lefebvre et al., 2009). An alternative efflux system belong- were obtained from Abcam (Cambridge, United Kingdom). ing to the MDR subfamily, represented by MRP3 and MRP4, Secondary antibodies were obtained from Santa Cruz is localized to the basolateral membrane domain and pro- Biotechnology (Santa Cruz). All other reagents were obtained vides an alternative excretory route for bile constituents from Sigma. when their canalicular excretion is impaired (Trauner and Boyer, 2003). Cell cultures. HepaRG cells were seeded at a density of Impairment of bile flow is called cholestasis and may be 2.6 Â 104 cells/cm2 in Williams’ E medium supplemented with caused by a functional impairment of canalicular secretory pro- 10% fetal bovine serum, 100 U/ml penicillin, 100 mg/ml strepto- cesses, which in turn results in an intracellular accumulation of mycin, 5 mg/ml insulin, 2 mM glutamine, and 50 mM hydrocorti- cholephilic compounds, such as bile salts (Trauner et al., 1998). sone hemisuccinate. After 2 weeks, HepaRG cells were shifted to Intrahepatic cholestasis of pregnancy and drug-induced the same medium supplemented with 1.7% dimethyl sulfoxide BACHOUR-EL AZZI ET AL. | 159

for 2 additional weeks to obtain confluent differentiated NTCP activity. Activity of the NTCP transporter was measured cultures. At that time, cultures contained equal proportions through determination of radiolabeled TCA in cellular layers of hepatocyte-like and progenitors/primitive biliary-like cells (cells plus bile canaliculi) (Antherieu et al., 2013). Briefly, HepaRG (Cerec et al., 2007). cells and 4–5 days CCHHs and SCHHs were washed twice with HHs were obtained from Biopredic International (St Gregoire, PBS and then incubated with [3H]-TCA for 30 min in a buffer France). They were isolated by collagenase perfusion of histo- containing or not sodium ions. Cells were then washed twice logically normal liver fragments from 8 adult donors undergoing with PBS and lysed with 0.1 N NaOH. Accumulation of the radio- resection for primary and secondary tumors (Guguen-Guillouzo labeled substrate in cellular layers was determined through et al., 1982). Primary cultures were obtained by hepatocyte seed- scintillation counting. ing at a density of 1.5 Â 105 cells/cm2 onto collagen-precoated plates in Williams’ E medium supplemented with 10% fetal Efflux of TCA. HepaRG cells and 4–5 days CCHHs and SCHHs were bovine serum, 100 units/ml penicillin, 100 mg/ml streptomycin, exposed to [3H]-TCA for 30 min, and then washed with PBS. 1 mg/ml insulin, 2 mM glutamine, and 1 mg/ml bovine serum Efflux of radiolabeled TCA was assessed for 30 min in either albumin. The medium was discarded 12 h after cell seeding, and standard or Ca2þ- and Mg2þ-free buffer. Cells were then scraped cultures were thereafter either maintained in the same medium in 0.1 N NaOH and accumulation of radiolabeled substrate into as for HepaRG cells and designated as conventional cultured cells þ bile canaliculi (in the presence of Ca2þ- and Mg2þ-ions) human hepatocytes (CCHHs), or after 24–48 h washed with cold and into cells only (in the absence of Ca2þ- and Mg2þ-ions) was medium and overlaid with matrigel at a concentration of measured through scintillation counting to evaluate TCA efflux. 0.25 mg/ml in ice-cold Williams’ E medium for the preparation Absence of divalent cations promotes disruption of tight junc- Downloaded from of SCHHs. The medium of both CCHHs and SCHHs was renewed tions and induces bile canaliculi opening (Liu et al., 1999). This every day. CCHHs and SCHHs were prepared from the same technology, called B-CLEAR technology, is patented and exclu- donors and analyzed in parallel. SCHHs were used after at least sively licensed to the Qualist Transporter Solutions Company, 3-day matrigel overlay. Durham, North Carolina. To determine the contribution of passive diffusion to TCA Immunolabeling. Cells were washed with warm phosphate buf- efflux, cells were incubated in parallel in either standard or http://toxsci.oxfordjournals.org/ fered saline (PBS), fixed with either methanol for 15 min at À20C Ca2þ- and Mg2þ-free buffer for 30 min at 37C or in standard buf- or with 4% paraformaldehyde for 20 min at 4C, and then washed fer at 4C after TCA uptake. Radiolabeled TCA was measured in three times with cold PBS. After paraformaldehyde fixation, cells all buffers and cells to calculate the relative contribution of dif- were permeabilized for 20 min with 0.3% Triton in PBS followed by fusion and basolateral and canalicular efflux of TCA (Jemnitz 1-h incubation in PBS containing 1% bovine serum albumin and et al., 2010; Liu et al., 1999; Marion et al., 2012). Three different 5% normal donkey serum. Cells were then incubated overnight methods were used for calculation of efflux activity. with primary antibodies directed against NTCP (Kullak-Ublick First, biliary excretion index (BEI) (method I), which et al., 1997) and BSEP (Noe et al.,2002) diluted at 1/200 and 1/50, represents the percentage of [3H]-TCA that is excreted into respectively, MRP2 (M2III-6, Abcam) diluted at 1/100, MRP3 (M3II-9, bile canaliculi, was calculated using the following equation: Abcam), MDR1 (JSB-1, Abcam), or MDR3 (P3II-26, Abcam) diluted at INSERM on April 25, 2015 BEI ¼ [(Accumulation À Accumulation )/ at 1/50 in PBS containing 1% bovine serum albumin and 5% nor- Cells þ Bile canaliculi Cells Accumulation ] Â 100% (Liu et al., 1999). mal donkey serum. After washing with cold PBS cells were incu- Cells þ Bile canaliculi The second method (method II) was based on the accumula- bated for 2 h with goat or rabbit Alexa fluor 488 labeled secondary tion of TCA, after a 30-min efflux period, in cell lysates in the antibodies in the same buffer as described earlier. Finally, cells presence and absence of divalent cations (Liu et al., 1999). Using were again washed with cold PBS and incubated with Hoechst TCA accumulation in cell lysates, diffusion, and basolateral and and phalloidin in PBS for 20 min for F-actin and nuclei labeling, canalicular efflux were calculated using the following respectively. Immunofluorescence images were detected by equations: Cellomics ArrayScan VTI HCS Reader (ThermoScientific, New

Hampshire). T0¼Total TCA uptake into the cell layer after 30 min incubation in standard buffer.

F-actin distribution. After fixation of cells as described earlier, Total efflux ¼ T0 À AccumulationCells at 37C. cytoskeletal F-actin was localized using phalloidin fluoprobe Diffusion ¼ (T0 À AccumulationCells þ Bile canaliculi at 4C) Â 100%/ SR101 (200 U/ml) diluted at 1/100 for 20 min as described previ- Total efflux. ously (Pernelle et al., 2011). Nuclei were labeled with 5 ng/ml The value “T0 À AccumulationCells þ Bile canaliculi at 4 C” represents Hoechst dye in parallel to F-actin labeling. the radiolabeled TCA that diffused out of cell layer.

Basolateral efflux ¼ [(T0 À AccumulationCells þ Bile canaliculi at

Functional activity of MDRs. The JC-1 metachromatic dye is 37C) Â 100%/Total efflux] À Diffusion. translocated across the canalicular membrane via MDRs, The value “T0 À AccumulationCells þ Bile canaliculi at 37 C” represents particularly MDR1 (Legrand et al., 2001). It does not the radiolabeled TCA that is excreted in the medium either by accumulate in differentiated HepaRG hepatocytes without pre- basolateral transporters or by passive permeability. incubation with verapamil, an inhibitor of MDRs (Pernelle et al., Canalicular efflux ¼ 100% À (Basolateral Efflux þ diffusion). 2011). Briefly, cells were incubated in the presence or absence The third method (method III) was based on radiolabeled TCA of 50 lM verapamil (an inhibitor of MDRs) for 30 min, and measured after a 30-min efflux period in standard and Ca2þ- then verapamil was washed out with warm PBS before 30 min and Mg2þ-free buffer (Jemnitz et al., 2010). Radioactivity in incubation with 7 lM JC-1 at 37C. Imaging was done standard buffer at 37C represented basolateral efflux and pas- by Cellomics ArrayScan VTI HCS Reader. Above a critical intra- sive diffusion of TCA, whereas that in Ca2þ- and Mg2þ-free cellular concentration, JC-1 forms dimers that display a buffer corresponded to canalicular efflux in addition to baso- specific red emission, whereas the monomers display a green lateral efflux and passive diffusion. emission. Total efflux ¼ Radioactivity in Ca2þ and Mg2þ-free buffer at 37C. 160 | TOXICOLOGICAL SCIENCES, 2015, Vol. 145, No. 1

Diffusion ¼ Radioactivity in standard buffer at 4C Â 100%/Total Axiovert 200 M was equipped with a thermostatic chamber (37C

efflux. and 5% CO2) to maintain the cells under normal culture condi- Basolateral efflux ¼ (Radioactivity in standard buffer at tions. Images were captured by AxioCam MRm camera with a 37C À Radioactivity in standard buffer at 4C) Â 100%/Total Â20 objective and the mosaic tool of the microscope, which efflux. enabled the automated acquisition of multi-image mosaics at the Canalicular efflux ¼ (Radioactivity in Ca2þ- and Mg2þ-free buffer defined positions. at 37C À Radioactivity in standard buffer at 37C) Â 100%/Total efflux. Statistical analysis. One-way ANOVA with Bonferroni’s multiple comparison test (GraphPad Prism 6.00) was performed to com- CDF excretion. Cells were washed with warm PBS, pre-incubated pare data between the three cell models. Each value corre- for 20 min in the presence or absence of 30 lM MK571, an inhibi- sponded to the mean 6 standard deviation (SD) of at least three tor of MRP2, before addition of 2 lM CDFDA for 30 min at 37Cin independent experiments. Data were considered significantly either standard or Ca2þ-andMg2þ-free buffer. Upon hydrolysis different when P < 0.05. of CDFDA by intracellular esterases, CDF is secreted into the bile canaliculi by membrane transporters, particularly MRP2 (Zamek-Gliszczynski et al., 2003). Cells were then washed with RESULTS PBS, and imaging was done using inverted microscope Zeiss Axiovert 200 M and AxioCam MRm. HepaRG Cell and HH Polarity Under phase-contrast microscopy, HepaRG hepatocytes and

Time-lapse imaging. Phase-contrast images of HepaRG cells, HHs either in conventional culture or in a sandwich configura- Downloaded from CCHHs, and SCHHs were captured each minute, using time-lapse tion formed clusters with well-defined intercellular structures phase-contrast videomicroscopy. The inverted microscope Zeiss resembling characteristic bile canaliculi (Fig. 1A). http://toxsci.oxfordjournals.org/ at INSERM on April 25, 2015

FIG. 1. Bile canaliculi networks in HepaRG cell and HH cultures. A, Bile canaliculi structures (arrows) in differentiated HepaRG cells and 4–5 days HHs cultured in sand- wich (SCHH) and conventional (CCHH) configuration were observed under phase-contrast microscopy (Â20 magnification). B, Pericanalicular F-actin microfilament net- work after labeling with phalloidin-fluoprobe in HepaRG cells (nuclei stained in using Hoechst dye) and 4–5 days HHs cultured in sandwich and conventional configuration. Imaging was done using Cellomics ArrayScan VTI HCS Reader (ThermoScientific). C, Electron microscopic micrograph of tight junctions surrounding bile canaliculus structures in HepaRG cells (arrows), original magnification  3000 (bar ¼ 2 lm). H, hepatocyte; BC, bile canaliculus. BACHOUR-EL AZZI ET AL. | 161

Polarity of the different hepatocyte models was analyzed of sodium ions. Accumulation of radiolabeled TCA in cellular by phalloidin fluoprobe labeling of cytoskeletal F-actin. layers was then measured. Uptake of TCA by HepaRG cells was Labeling was particularly abundant in the pericanalicular areas more than 42-fold greater in the presence of sodium demon- which defined multiple shapes of bile canaliculi in primary hep- strating that NTCP displayed a sodium-dependent activity as in atocytes. In SCHHs, these structures showed a time-dependent the in vivo situation (Fig. 5A). It was 33 and 15 times greater in progression in the formation of a branched bile canalicular presence of sodium in SCHHs and CCHHs, respectively. When network and were more elongated than in corresponding measured per hepatocyte NTCP activity was around 2.2 - and CCHHs, especially after 4–5 days (Fig. 1B). HepaRG cells also 1.4-fold higher in SCHHs and CCHHs than in HepaRG cells, showed abundant pericanalicular cytoskeletal F-actin and respectively (Fig. 5B). sparse network of microfilaments beneath the plasma mem- brane defining the cell shape. At the electron microscopic level, Activity of efflux transporters. Efflux of CDF and [3H]-TCA, sub- bile canaliculi appeared to be surrounded by large tight junc- strates of MRP2 and BSEP, respectively, was assessed in stand- tional complexes in HepaRG hepatocytes (Fig. 1C). Accordingly, ard and Ca2þ- and Mg2þ-free buffer. After 30 min incubation the mean surface of bile canaliculi networks was estimated with CDFDA in standard buffer, fluorescent CDF was visualized by measuring CDF-labeled lumen surfaces using vHCS.scan in bile canaliculi of both HepaRG cells and 4–5 days SCHHs and (V6.2.0) cellomics software and found to be 1.7 - and 1.3-fold CCHHs (Figs. 2 and 6). In contrast, absence of sharp canalicular higher in SCHHs than in HepaRG cells and CCHHs, respectively labeling was noticed in Ca2þ- and Mg2þ-free buffer, particularly (Fig. 2). in SCHHs. Although many bile canaliculi were still labeled in Moreover, dynamics of bile canaliculi was assessed by HepaRG cells despite the depletion in divalent cations, the total Downloaded from time-lapse imaging, which allowed to analyze living cells number of fluorescent canaliculi was clearly reduced. No well- directly over time. Some bile canaliculi showed contractions defined canalicular labeling was observed when incubation was and relaxations in HepaRG cells, indicating that they were performed in the presence of MK571, an inhibitor of MRP2 and active and periodically clearing accumulated products. No the two other major ABC transporters MDR1 and BCRP (Matsson synchronism was observed, even within a hepatocyte cluster et al., 2009). (Fig. 3A). Such contractions and relaxations were slower in Canalicular excretion of taurocholate was first quantified http://toxsci.oxfordjournals.org/ CCHHs (Fig. 3B) and difficult to visualize in SCHHs, likely due to using BEI values (method I). BEI of TCA represented 26.6, 70.9, the elongated shape of bile canaliculi and the upper matrigel and 74.2% in HepaRG cells, CCHHs, and SCHHs, respectively layer. (Table 1). To determine the relative contribution of diffusion, and basolateral and canalicular efflux of TCA, two other modes of calculation of TCA efflux were also used based on measure- Cellular Localization of Bile Acid Transporters ment of radiolabeled TCA in cell lysates and buffers (after incu- Localization of several main hepatobiliary transporters was bation in buffer containing or not Ca2þ and Mg2þ) at 4 and 37C. assessed by immunofluorescence staining in HepaRG cells as well Incubation of cells at 4C blocked all active transport systems, as in 4–5 days SCHHs and CCHHs. Importantly, in HepaRG cell cul- thereby allowing determination of the percentage of TCA tures transporter immunolabeling was restricted to hepatocyte-

released by diffusion (passive permeability). When calculation at INSERM on April 25, 2015 like cells; no transporter was visualized in primitive biliary cells. was based on the accumulation of radiolabeled TCA in cell lysates (method II) after incubation in a buffer containing or not Influx Transporter divalent cations, canalicular efflux, basolateral efflux and diffu- NTCP was localized to the sinusoidal membrane domain in sion were found to contribute nearly equally to TCA release in CCHHs and SCHHs. However, immunolabeling was weaker in HepaRG cells and CCHHs, whereas in SCHHs canalicular and the former. Similarly to SCHHs, HepaRG cells showed a faint basolateral efflux were around 6–8% higher and diffusion was sinusoidal membrane staining and in addition a diffuse intracy- 12–16% lower compared with the two other cell models (Table 1). toplasmic labeling for NTCP (Fig. 4). When radiolabeled TCA was quantified in incubation buffers (method III) containing or not Ca2þ and Mg2þ a higher contribu- Efflux Transporters tion of basolateral efflux was observed; it became the major Basolateral domain. MRP3 was exclusively localized to the sinus- route of TCA excretion in HepaRG cells, SCHHs and CCHHs, ie oidal plasma membrane domain in all the liver cell models with 57.6, 43, and 35%, respectively, compared with the canalicular a more intense labeling in HepaRG cells (Fig. 4). efflux that represented 28.5, 37.9, and 26.3%, respectively. The contribution of passive permeability to total TCA excretion was Canalicular domain. Four canalicular transporters, BSEP, MRP2, clearly lower in HepaRG cells and SCHHs (13.9 and 19.1%, MDR1, and MDR3, were immunolocalized in HHs and HepaRG respectively), whereas it remained the major route in CCHHs cells (Fig. 4). In HHs, BSEP co-localized with cytoskeletal F-actin (38.8%). Noteworthy, when basolateral efflux and diffusion val- and was detected on canalicular membranes. It displayed a faint ues obtained from measurements in cell lysates (method II) canalicular immunolabeling in HepaRG cells with in addition, a were summed, their percentages represented 68.7, 61.5, and slight heterogeneous intracytoplasmic labeling (Supplementary 69.2% of total TCA efflux in HepaRG, SCHHs, and CCHHs, respec- Fig. 1). The other canalicular transporters, MRP2, MDR1, and MDR3, tively; those summed from measurements in buffers (method were well visualized, exclusively on canalicular membranes in the III) gave comparable percentages representing 76.1, 62.1, and three liver cell models, with a more intense labeling of MRP2 73.7%, respectively. and MDR1 in HepaRG cells (Fig. 4). MDRs activity. Incubating HepaRG cells with JC-1 dye resulted Transporter Activities in red and green cell areas in the same microscopic field (Fig. 7). Sodium-dependent activity of NTCP. To assess whether the influx The red cell areas corresponded to primitive biliary cells, of TCA was sodium-dependent, HepaRG cells and HHs were which did not express MDRs, whereas green ones represented the incubated for 30 min with [3H]-TCA in the presence or absence hepatocytes, which displayed MDRs proteins across their 162 | TOXICOLOGICAL SCIENCES, 2015, Vol. 145, No. 1 Downloaded from http://toxsci.oxfordjournals.org/

FIG. 2. Bile canaliculi networks in HepaRG cells and primary HHs. Bile canaliculi were labeled using CDFDA, a MRP2 substrate in A, HepaRG cells, SCHHs, and CCHHs. B, The mean surface areas of bile canaliculi networks in HepaRG cells and 4–5 days HHs cultured in sandwich and conventional configuration were estimated by quantify- ing CDFDA-labeled lumen surfaces using vHCS.scan (V6.2.0) cellomics software (ThermoScientific). Data represent the means 6 SD of at least three independent experi- ments. Data with P < 0.05 is considered significant (*). at INSERM on April 25, 2015

FIG. 3. Bile canaliculi dynamics in HepaRG cells and HHs. Time-lapse imaging of HepaRG cells and 4–5 days HHs cultured in conventional configuration (CCHH). Time- dependent contraction/relaxation activity of bile canaliculi (arrows). Imaging was done using inverted microscope Zeiss Axiovert 200 M and AxioCam MRm. BACHOUR-EL AZZI ET AL. | 163 Downloaded from http://toxsci.oxfordjournals.org/ at INSERM on April 25, 2015

FIG. 4. Distribution of main bile acid transporters in HepaRG cells and HHs. Differentiated HepaRG cells and 4–5 days HHs in sandwich (SCHH) and conventional (CCHH) cultures were fixed and incubated with primary antibodies against each of the following hepatobiliary transporters: NTCP, MRP3, BSEP, MRP2, MDR1, and MDR3. Nuclei were labeled using Hoechst. Immunofluorescence images were obtained with a Cellomics ArrayScan VTI HCS Reader (ThermoScientific).

DISCUSSION canalicular plasma membrane. By transporting JC-1 out of the cells, MDRs did not allow the dye to reach critical concentration Although previous studies have demonstrated that the majority to form dimers. Only pre-incubation with verapamil, an inhibitor of hepatobiliary transporters (organic cation transporter 1, of MDRs, before JC-1 exposure resulted in dimer fluorescence in OATP1B1, OATP2B1, NTCP, MRP2, MRP3, BSEP, and MDR1) are both cell types. expressed in differentiated HepaRG cells, their distribution and 164 | TOXICOLOGICAL SCIENCES, 2015, Vol. 145, No. 1

FIG. 5. Sodium-dependent activity of NTCP in HepaRG cells and HHs. HepaRG cells and 4–5 days HHs in sandwich (SCHH) and conventional (CCHH) cultures were incu- bated with [3H]-TCA for 30 min in the presence and absence of sodium ions. A, NTCP activity was evaluated through measurement of the radiolabeled substrate TCA accumulated in cellular layers (cells plus bile canaliculi). Uptake of [3H]-TCA in each cell model was expressed relative to the levels found in cells incubated with Naþ- free buffer, arbitrarily set at a value of 1. B, NTCP activity was evaluated in the presence of Naþ as the ratio of total radioactivity measured in cell lysates to total number of hepatocytes in each cell model. Calculations were based on 800 000 hepatocytes in the two primary hepatocyte models and 280 000 HepaRG hepatocytes per well. Results are expressed relative to NTCP activity found in HepaRG hepatocytes, arbitrarily set at a value of 1. Data represent the means 6 SD of at least three independent experiments. Data with P < 0.05 are considered significant (*). Downloaded from http://toxsci.oxfordjournals.org/ at INSERM on April 25, 2015

FIG. 6. Functional activity of MRP2 in HepaRG cells and HHs. MRP2 activity was estimated using CDFDA in HepaRG cells and 4–5 days SCHHs and CCHHs. Efflux of fluo- rescent CDF, a substrate of MRP2, characterized by accumulation of fluorescence into bile canaliculi, was evaluated in standard and Ca2þ- and Mg2þ-free buffer in the presence and absence of MK571, an inhibitor of MRP2. Imaging was done using inverted microscope Zeiss Axiovert 200 M and AxioCam MRm.

activity are still poorly documented (Antherieu et al., 2010; SCHHs, HepaRG cells showed weaker labeling and activity of Kotani et al., 2012; Le Vee et al., 2013; Szabo et al., 2013). In this NTCP which is in agreement with lower corresponding mRNA study, we compared the localization and functional activity of levels as previously measured in these cells compared with the main membrane transporters in HepaRG cells and HHs in freshly isolated or 1-day HHs (Antherieu et al., 2012; Le Vee et al., conventional and sandwich configuration. The major hepato- 2013). In contrast, other authors found that NTCP transcripts biliary transporters including BSEP and NTCP, were visualized and protein levels were more than 2-fold higher in HepaRG cells by immunolabeling and found to be correctly distributed on than in cryopreserved primary HHs (Kotani et al., 2012). This dis- canalicular and basolateral membrane domains, respectively, crepancy likely resulted from the use of cryopreserved HHs in and to be functional in the three liver cell models. Noteworthy, the latter study. Indeed, a marked reduction of protein content primitive biliary HepaRG cells did not express detectable mRNA and activity of NTCP and other influx transporters has recently and protein of any tested transporter and accordingly, did not been reported in HHs associated with the freeze/thaw process accumulate TCA (Sharanek et al., 2014). (Lundquist et al., 2014). A basolateral NTCP localization together with a sodium- Immunolabeling of BSEP showed canalicular distribution of dependent activity (Kotani et al., 2012) has been evidenced in this transporter in HHs whatever their mode of culture, in both HepaRG cells and primary HHs. Compared to CCHHs and agreement with its apical localization in human liver biopsies BACHOUR-EL AZZI ET AL. | 165

and rat hepatocyte couplets (Boaglio et al., 2010; Zollner et al., in HepaRG cells than in HHs, in agreement with previous stud- 2001). Although much weaker than in HHs, in accordance with ies showing overexpression of these genes at the transcriptional lower corresponding mRNA levels (Antherieu et al., 2012; Le Vee level in the former (Antherieu et al., 2012; Le Vee et al., 2013). et al., 2013), BSEP was also detected on canalicular membranes This study provided clear evidence that the canalicular efflux of HepaRG cells. Moreover, noticeably, intracellular labeling was transporters BSEP, MRP2, and MDRs were functional and that in addition observed in HepaRG cells as previously reported for cholephilic substances could accumulate in bile canaliculi. rat hepatocytes in situ and for the WIF-B cell line (Gerloff et al., BSEP and MRP2 substrates were demonstrated inside bile canal- 1998; Gradilone et al., 2005; Soroka et al., 1999). It has been iculi of the three hepatocyte models and functional activity of emphasized that intracellular BSEP is capable of trafficking MDR1 was evidenced in HepaRG hepatocytes using the JC-1 within minutes to the canalicular membrane when the demand metachromatic dye of which continuous excretion by MDR1 for BSEP increased (Kipp and Arias, 2002). To our best knowl- was prevented following pre-incubation with the MDR1 inhibi- edge, this study is the first immunolocalization of BSEP in tor verapamil. HepaRG cells and primary HH cultures. BEI values (method I) were higher in SCHHs and CCHHs than Localization of MRP2, MDR1, and MDR3 was restricted to in HepaRG cells, ie 74.2, 70.9, and 26.6%, respectively. Using canalicular membranes, whereas MRP3 was exclusively local- other modes of calculation based on radioactivity measured in ized to the basolateral membrane domain in both HepaRG cells cell lysates (method II) and incubation buffers (method III) and HHs. Although no quantification was performed, immuno- (Jemnitz et al., 2010; Liu et al., 1999), contribution of canalicular labeling of MRP2, MDR1, and MRP3 appeared to be more intense efflux to total excretion of TCA was found to be comparable to the BEI in HepaRG cells, representing 31.3 and 28.5%, respec- Downloaded from TABLE 1. Different Modes of Calculation of TCA Efflux in the Three tively. The BEI found in this study is close to that previously Human Liver Cell Models reported by others (Le Vee et al., 2013). Similarly, the highest values found in SCHHs were comparable to those previously HepaRG SCHH CCHH obtained by Marion et al. (2007). However, in another study, Marion et al. (2012) found much lower BEI values in SCHHs. Such BEI (%) 26.58 6 7.26 74.15 6 8.67* 70.94 6 13.38* large differences (41.7% vs 73.2%) could reflect the well-known Cell lysates http://toxsci.oxfordjournals.org/ interindividual variations of functional activities in HHs. It has Canalicular efflux (%) 31.26 6 9.75 38.53 6 15.75 30.77 6 9.10 Basolateral efflux (%) 32.73 6 7.34 38.05 6 18.88 30.06 6 1.11 been previously reported that efflux of taurocholate was around Diffusion (%) 36.02 6 6.98 23.42 6 14.57 39.17 6 8.37 40–50% greater in SCHHs than in CCHHs (Kostrubsky et al., Basolateral þ diffusion (%) 68.75 6 9.75 61.47 6 15.75 69.23 6 9.10 2003). The comparable BEI values found in the two primary hep- Buffers atocyte models in this study could be explained by the use of Canalicular efflux (%) 28.52 6 4.77 37.86 6 24.63 26.27 6 9.22 fresh cells and our experimental conditions, including the type Basolateral efflux (%) 57.58 6 6.36 43.00 6 24.16 34.95 6 5.69 of culture medium and the choice of 4–5 days of culture before Diffusion (%) 13.89 6 3.47 19.14 6 11.76 38.77 6 14.91 analysis of bile acid excretion. At that time, primary HHs Basolateral þ diffusion (%) 71.47 6 6.27 62.14 6 24.63 73.72 6 9.22 express high levels of drug metabolizing enzymes activities and

other functions (Abdel-Razzak et al., 1993). at INSERM on April 25, 2015 HepaRG cells and 4–5 days SCHHs and CCHHs were exposed to [3H]-TCA for 30 min The lower BEI in HepaRG cells compared with SCHHs and 2þ 2þ to induce uptake of TCA. After 30 min incubation in standard and Ca -andMg - CCHHs could have several nonexclusive explanations. First, an free buffer at 4 and 37C, TCA efflux was determined by measuring radioactivity in attenuated NTCP and BSEP activity in comparison to HHs regard- cell lysates and buffers. The values measured in HepaRG cells (HepaRG), and SCHHs and CCHHs are expressed as BEI or as percentages of total efflux 6 SD less their mode of culture. In accordance, when the amount of (n  3) and were calculated as described in ‘Materials and methods’ section. accumulated TCA in cell layers was calculated per hepatocyte, it Conventional and sandwich cultures of fresh HHs were prepared from the same was 2.2 - and 1.4-fold higher in sandwich and standard cultured donors and analyzed in parallel. Data with P < 0.05 is considered significant (*). HHs than in HepaRG hepatocytes, respectively. Such attenuated

FIG. 7. MDRs activity in HepaRG cells. HepaRG cells were incubated for 30 min in the presence or absence of 50 lM verapamil, an inhibitor of MDRs, before 30 min incu- bation with 7 lM JC-1. A significant intracellular accumulation resulting in the formation of JC-1 dimers characterized by heterogeneous intracytoplasmic staining was observed in HepaRG hepatocytes (þ verapamil). Imaging was done using Cellomics ArrayScan VTI HCS Reader (ThermoScientific). 166 | TOXICOLOGICAL SCIENCES, 2015, Vol. 145, No. 1

NTCP and BSEP activity is supported by low corresponding mRNA shown their unique interest for analyzing bile canaliculi func- levels (Antherieu et al.,2012; Le Vee et al., 2013) and results in tion and response to cholestatic agents (Antherieu et al., 2013; reduced TCA uptake and canalicular excretion. These low NTCP Bachour-El Azzi et al., 2014; Sharanek et al., 2014). The data and BSEP activities could explain the 2.8-fold lower BEI values reported in this study bring further information on mechanisms compared with SCHHs. Second, the overexpression of MRP3 by which bile acids can accumulate and be excreted in either mRNA in HepaRG cells (Antherieu et al., 2012; Le Vee et al.,2013) HepaRG cells or primary hepatocytes. Altogether our data sup- could explain the higher contribution of this route to total excre- port the conclusion that with the advantages to be a reproduci- tion of TCA. Third, the smaller size of the bile canaliculi network ble and easy to handle cell model, HepaRG hepatocytes and the higher contraction/relaxation activity promoting a con- represent a unique model for investigating hepatobiliary trans- tinuous discharge of their content. Forth, an incomplete opening port and xenobiotic effects on canalicular efflux and cholesta- of HepaRG bile canaliculi in cation-free buffer, because of the sis-induced features. large size of tight junctions as observed under electron micro- scopy. This hypothesis is based on the sharp CDF-fluorescent labeling in many bile canaliculi in the absence of divalent cations SUPPLEMENTARY DATA in HepaRG cells, whereas such labeling was nearly completely Supplementary data are available online at http://toxsci. absent in SCHHs. Noticeably, a 10–15% increase in canalicular oxfordjournals.org/. TCA and CDF efflux was measured by using higher concentra- tions of the divalent cation chelator EGTA (data not shown). As a consequence, total and canalicular efflux were likely slightly FUNDING Downloaded from underestimated in HepaRG cells. The Lebanese University, Lebanese National Council for Noteworthy, when canalicular efflux was estimated from measurement of radioactivity in either cell lysates (method II) Scientific Research (to P.B.E.); Philippe Jabre association (to or buffers (method III) the difference between HepaRG cells and P.B.E.); the Doctorate School vie-agro-sante´ Rennes (to SCHHs did not exceed 9.3% and comparable values were found P.B.E.); Lebanese Association for Scientific Research (to A.S.); the French-Lebanon Ce`dre program 11 S F47/L2 (2011–2012);

in HepaRG cells and CCHHs. These limited differences between http://toxsci.oxfordjournals.org/ the three cell models compared with the differences in BEI and the European Community (Contracts Predict-IV-202222 values could probably be explained by the fact that the values and MIP-DILI-115336). The MIP-DILI project has received obtained from cell lysates and buffers are based on total TCA support from the Innovative Medicines Initiative Joint efflux and not on TCA intracellular and bile canaliculi content Undertaking, resources of which are composed of financial (Liu et al., 1999). contribution from the European Union’s Seventh The contribution of passive membrane permeability was Framework Programme (FP7/20072013) and EFPIA compa- also estimated by measuring radioactivity in either cell lysates nies’ in kind contribution. http://www.imi.europa.eu/. or buffers after a 30-min incubation at 4C(Jemnitz et al., 2010). High values of passive permeability reaching nearly 40% were obtained with CCHHs (in both lysates and buffers) and REFERENCES at INSERM on April 25, 2015 with HepaRG cells (cell lysates), whereas these values were Abdel-Razzak, Z., Loyer, P., Fautrel, A., Gautier, J. C., Corcos, L., much lower in SCHHs (in both lysates and buffers representing Turlin, B., Beaune, P., and Guillouzo, A. (1993). Cytokines 19.1 and 23.4%, respectively) and in HepaRG cells (in buffers rep- down-regulate expression of major cytochrome P-450 en- resenting 19.1%). Moreover, large interassay variations were zymes in adult human hepatocytes in primary culture. Mol. apparent in the two HH models. Noticeably, around 30% diffu- Pharmacol. 44, 707–715. sion was also reported with rat hepatocytes which have a Antherieu, S., Bachour-El Azzi, P., Dumont, J., Abdel-Razzak, Z., higher basolateral efflux activity than HHs (Jemnitz et al., 2010). Guguen-Guillouzo, C., Fromenty, B., Robin, M. A., and All these data lead to the conclusion that the experimental Guillouzo, A. (2013). Oxidative stress plays a major role in conditions used to evaluate passive permeability may result chlorpromazine-induced cholestasis in human HepaRG in its overestimation. This could at least partly be due to exces- cells. Hepatology 57, 1518–1529. sive release of TCA, for instance during cell detachment Antherieu, S., Chesne, C., Li, R., Camus, S., Lahoz, A., Picazo, L., from the culture dishes. Obviously, analysis of passive perme- Turpeinen, M., Tolonen, A., Uusitalo, J., Guguen-Guillouzo, ability in the three liver cell models deserves further C., et al. (2010). Stable expression, activity, and inducibility of investigations. cytochromes P450 in differentiated HepaRG cells. Drug Metab. In conclusion, this study demonstrated that HepaRG hepato- Dispos. 38, 516–525. cytes displayed a set of main hepatobiliary transporter proteins Antherieu, S., Chesne, C., Li, R., Guguen-Guillouzo, C., and (NTCP, MRP3, BSEP, MRP2, MDR1, and MDR3) at the appropriate Guillouzo, A. (2012). Optimization of the HepaRG cell model membrane domains and all the tested ones (NTCP, BSEP, and for drug metabolism and toxicity studies. Toxicol. In Vitro 26, MDRs) were functional as in primary HHs. To our best knowl- 1278–1285. edge, this work is the first comparative localization and func- Bachour-El Azzi, P., Sharanek, A., Abdel-Razzak, Z., Antherieu, tional activity evaluation of the main membrane transporters in S., Al-Attrache, H., Savary, C. C., Lepage, S., Morel, I., Labbe, HepaRG cells and primary HHs. Analysis of basolateral and G., Guguen-Guillouzo, C., et al. (2014). Impact of inflam- canalicular TCA efflux showed that the excretion mode of TCA mation on chlorpromazine-induced cytotoxicity and chole- was comparable in both cell models. However, some quantita- static features in HepaRG cells. Drug Metab. Dispos. 42, tive differences in relative canalicular and basolateral efflux 1556–1566. were observed; they could be explained not only by variations Boaglio, A. C., Zucchetti, A. E., Sanchez Pozzi, E. J., Pellegrino, in the levels of NTCP, BSEP, and basolateral efflux transporters J. M., Ochoa, J. E., Mottino, A. D., Vore, M., Crocenzi, F. A., and but also by the size of the bile canaliculi network and its con- Roma, M. G. (2010). Phosphoinositide 3-kinase/protein striction/relaxation activity. HepaRG hepatocytes have already kinase B signaling pathway is involved in estradiol BACHOUR-EL AZZI ET AL. | 167

17beta-D-glucuronide-induced cholestasis: Comple- acid carriers expressed in human hepatocellular carcinomas. mentarity with classical protein kinase C. Hepatology 52, Gastroenterology 113, 1295–1305. 1465–1476. Kullak-Ublick, G. A., Stieger, B., Hagenbuch, B., and Meier, P. J. Cerec, V., Glaise, D., Garnier, D., Morosan, S., Turlin, B., Drenou, (2000). Hepatic transport of bile salts. Semin. Liver Dis. 20, B., Gripon, P., Kremsdorf, D., Guguen-Guillouzo, C., and 273–292. Corlu, A. (2007). Transdifferentiation of hepatocyte-like cells Le Vee, M., Noel, G., Jouan, E., Stieger, B., and Fardel, O. (2013). from the human hepatoma HepaRG cell line through bipo- Polarized expression of drug transporters in differentiated tent progenitor. Hepatology 45, 957–967. human hepatoma HepaRG cells. Toxicol. In Vitro 27, Copple, B. L., Jaeschke, H., and Klaassen, C. D. (2010). Oxidative 1979–1986. stress and the pathogenesis of cholestasis. Semin. Liver Dis. Lefebvre, P., Cariou, B., Lien, F., Kuipers, F., and Staels, B. (2009). 30, 195–204. Role of bile acids and bile acid receptors in metabolic regula- Corsini, A., and Bortolini, M. (2013). Drug-induced liver injury: tion. Physiol. Rev. 89, 147–191. The role of drug metabolism and transport. J. Clin. Pharmacol. Legrand, O., Perrot, J. Y., Simonin, G., Baudard, M., and Marie, J. P. 53, 463–474. (2001). JC-1: A very sensitive fluorescent probe to test Pgp ac- De Bruyn, T., Chatterjee, S., Fattah, S., Keemink, J., Nicolai, J., tivity in adult acute myeloid leukemia. Blood 97, 502–508. Augustijns, P., and Annaert, P. (2013). Sandwich-cultured he- Liu, J., Lu, H., Lu, Y. F., Lei, X., Cui, J. Y., Ellis, E., Strom, S. C., and patocytes: Utility for in vitro exploration of hepatobiliary Klaassen, C. D. (2014). Potency of individual bile acids to regu- drug disposition and drug-induced hepatotoxicity. Expert late bile acid synthesis and transport genes in primary hu- Opin. Drug Metab. Toxicol. 9, 589–616. man hepatocyte cultures. Toxicol. Sci. 141, 538–546. Downloaded from Gerloff, T., Stieger, B., Hagenbuch, B., Madon, J., Landmann, L., Liu, X., LeCluyse, E. L., Brouwer, K. R., Gan, L. S., Lemasters, J. J., Roth, J., Hofmann, A. F., and Meier, P. J. (1998). The sister of P- Stieger, B., Meier, P. J., and Brouwer, K. L. (1999). Biliary excre- glycoprotein represents the canalicular bile salt export pump tion in primary rat hepatocytes cultured in a collagen-sand- of mammalian liver. J. Biol. Chem. 273, 10046–10050. wich configuration. Am. J. Physiol. 277, 12–21. Gradilone, S. A., Tietz, P. S., Splinter, P. L., Marinelli, R. A., and Lundquist, P., Loof, J., Sohlenius-Sternbeck, A. K., Floby, E., LaRusso, N. F. (2005). Expression and subcellular localization Johansson, J., Bylund, J., Hoogstraate, J., Afzelius, L., and http://toxsci.oxfordjournals.org/ of aquaporin water channels in the polarized hepatocyte cell Andersson, T. B. (2014). The impact of solute carrier (SLC) line, WIF-B. BMC Physiol. 5, 13. drug uptake transporter loss in human and rat cryopreserved Guguen-Guillouzo, C., and Guillouzo, A. (2010). General review hepatocytes on clearance predictions. Drug Metab. Dispos. 42, on in vitro hepatocyte models and their applications. 469–480. Methods Mol. Biol. 640, 1–40. Marion, T. L., Leslie, E. M., and Brouwer, K. L. (2007). Use of Giacomini, K. M., Huang, S. M., Tweedie, D. J., Benet, L. Z., sandwich-cultured hepatocytes to evaluate impaired bile Brouwer, K. L., Chu, X., Dahlin, A., Evers, R., Fischer, V., acid transport as a mechanism of drug-induced hepatotoxic- Hillgren, K. M., Hoffmaster, K. A., Ishikawa, T., Keppler, D., ity. Mol. Pharm. 4, 911–918. Kim, R. B., Lee, C. A., Niemi, M., Polli, J. W., Sugiyama, Y., Marion, T. L., Perry, C. H., St Claire, R. L., 3rd, and Brouwer, K. L.

Swaan, P. W., Ware, J. A., Wright, S. H., Yee, S. W., Zamek- (2012). Endogenous bile acid disposition in rat and human at INSERM on April 25, 2015 Gliszczynski, M. J., and Zhang, L. (2010). International sandwich-cultured hepatocytes. Toxicol. Appl. Pharmacol. 261, Transporter Consortium. Membrane transporters in drug 1–9. development. Nat. Rev. Drug Discov. 9, 215–236. Matsson, P., Pedersen, J. M., Norinder, U., Bergstrom, C. A., and Guguen-Guillouzo, C., Campion, J. P., Brissot, P., Glaise, D., Artursson, P. (2009). Identification of novel specific and gen- Launois, B., Bourel, M., and Guillouzo, A. (1982). eral inhibitors of the three major human ATP-binding cas- High yield preparation of isolated human adult hepatocytes sette transporters P-gp, BCRP and MRP2 among registered by enzymatic perfusion of the liver. Cell Biol. Int. Rep. 6, drugs. Pharm. Res. 26, 1816–1831. 625–628. Meier, P. J., and Stieger, B. (2002). Bile salt transporters. Annu. Rev. Hofmann, A. F. (1999). Bile acids: The good, the bad, and the ugly. Physiol. 64, 635–661. News Physiol. Sci. 14, 24–29. Nathanson, M. H., and Boyer, J. L. (1991). Mechanisms and regu- Jemnitz, K., Veres, Z., and Vereczkey, L. (2010). Contribution of lation of bile secretion. Hepatology 14, 551–566. high basolateral bile salt efflux to the lack of hepatotoxicity Noe, J., Stieger, B., and Meier, P. J. (2002). Functional expression of in rat in response to drugs inducing cholestasis in human. the canalicular bile salt export pump of human liver. Toxicol. Sci. 115, 80–88. Gastroenterology 123, 1659–1666. Kipp, H., and Arias, I. M. (2002). Trafficking of canalicular Pauli-Magnus, C., Meier, P. J., and Stieger, B. (2010). Genetic deter- ABC transporters in hepatocytes. Annu. Rev. Physiol. 64, minants of drug-induced cholestasis and intrahepatic chole- 595–608. stasis of pregnancy. Semin. Liver Dis. 30, 147–159. Kostrubsky, V. E., Strom, S. C., Hanson, J., Urda, E., Rose, K., Perez, L. M., Milkiewicz, P., Elias, E., Coleman, R., Sanchez Pozzi, Burliegh, J., Zocharski, P., Cai, H., Sinclair, J. F., and Sahi, J. E. J., and Roma, M. G. (2006). Oxidative stress induces inter- (2003). Evaluation of hepatotoxic potential of drugs by inhibi- nalization of the bile salt export pump, Bsep, and bile salt se- tion of bile-acid transport in cultured primary human hepa- cretory failure in isolated rat hepatocyte couplets: A role for tocytes and intact rats. Toxicol. Sci. 76, 220–228. protein kinase C and prevention by protein kinase A. Toxicol. Kotani, N., Maeda, K., Debori, Y., Camus, S., Li, R., Chesne, C., and Sci. 91, 150–158. Sugiyama, Y. (2012). Expression and transport function of Pernelle, K., Le Guevel, R., Glaise, D., Stasio, C. G., Le Charpentier, drug uptake transporters in differentiated HepaRG cells. Mol. T., Bouaita, B., Corlu, A., and Guguen-Guillouzo, C. (2011). Pharm. 9, 3434–3441. Automated detection of hepatotoxic compounds in human Kullak-Ublick, G. A., Glasa, J., Boker, C., Oswald, M., Grutzner, U., hepatocytes using HepaRG cells and image-based analysis of Hagenbuch, B., Stieger, B., Meier, P. J., Beuers, U., Kramer, W., mitochondrial dysfunction with JC-1 dye. Toxicol. Appl. et al. (1997). Chlorambucil-taurocholate is transported by bile Pharmacol. 254, 256–266. 168 | TOXICOLOGICAL SCIENCES, 2015, Vol. 145, No. 1

Roma, M. G., and Sanchez Pozzi, E. J. (2008). Oxidative stress: A and rat hepatocytes in uptake transport assays in order to pre- radical way to stop making bile. Ann. Hepatol. 7, 16–33. dict a risk of drug induced hepatotoxicity. PLoS One 8, e59432. Sharanek, A., Azzi, P. B., Al-Attrache, H., Savary, C. C., Humbert, Trauner, M., and Boyer, J. L. (2003). Bile salt transporters: L., Rainteau, D., Guguen-Guillouzo, C., and Guillouzo, A. Molecular characterization, function, and regulation. Physiol. (2014). Different dose-dependent mechanisms are involved Rev. 83, 633–671. in early cyclosporine a-induced cholestatic effects in hepaRG Trauner, M., Meier, P. J., and Boyer, J. L. (1998). Molecular patho- cells. Toxicol. Sci. 141, 244–253. genesis of cholestasis. N. Engl. J. Med. 339, 1217–1227. Soroka, C. J., Pate, M. K., and Boyer, J. L. (1999). Canalicular export Zamek-Gliszczynski, M. J., Xiong, H., Patel, N. J., Turncliff, R. Z., pumps traffic with polymeric immunoglobulin A receptor on Pollack, G. M., and Brouwer, K. L. (2003). Pharmacokinetics the same microtubule-associated vesicle in rat liver. J. Biol. of 5 (and 6)-carboxy-2’,7’-dichlorofluorescein and its diace- Chem. 274, 26416–26424. tate promoiety in the liver. J. Pharmacol. Exp. Ther. 304, Swift, B., Pfeifer, N. D., and Brouwer, K. L. (2010). Sandwich-cul- 801–809. tured hepatocytes: An in vitro model to evaluate hepatobili- Zollner, G., Fickert, P., Zenz, R., Fuchsbichler, A., Stumptner, C., ary transporter-based drug interactions and hepatotoxicity. Kenner, L., Ferenci, P., Stauber, R. E., Krejs, G. J., Denk, H., et al. Drug Metab. Rev. 42, 446–471. (2001). Hepatobiliary transporter expression in percutaneous Szabo, M., Veres, Z., Baranyai, Z., Jakab, F., and Jemnitz, K. (2013). liver biopsies of patients with cholestatic liver diseases. Comparison of human hepatoma HepaRG cells with human Hepatology 33, 633–646. Downloaded from http://toxsci.oxfordjournals.org/ at INSERM on April 25, 2015 Chapter 2

104 105 TOXICOLOGICAL SCIENCES, 141(1), 2014, 244–253

doi: 10.1093/toxsci/kfu122 Advance Access Publication Date: June 27, 2014

Different Dose-Dependent Mechanisms Are Involved in Early Cyclosporine A-Induced Cholestatic Effects in HepaRG Cells Ahmad Sharanek*,†, Pamela Bachour-El Azzi*,†, Houssein Al-Attrache*,†, ,† ‡ ‡

Camille C. Savary* , Lydie Humbert , Dominique Rainteau , Downloaded from Christiane Guguen-Guillouzo*,†,andAndre´ Guillouzo*,†,1

*Inserm UMR991, Foie, Metabolisme´ et Cancer, Rennes, France, †Universite´ de Rennes 1, Rennes, France and ‡ERL Inserm U1157/UMR7203, Faculte´ de Medecine Pierre et Marie Curie, Site Saint Antoine, Paris, France http://toxsci.oxfordjournals.org/ 1To whom correspondence should be addressed. Fax: +33223235385. E-mail: [email protected].

ABSTRACT

Mechanisms involved in drug-induced cholestasis in humans remain poorly understood. Although cyclosporine A (CsA) and tacrolimus (FK506) share similar immunosuppressive properties, only CsA is known to cause dose-dependent cholestasis. Here, we have investigated the mechanisms implicated in early cholestatic effects of CsA using the differentiated human HepaRG cell line. Inhibition of eflux and uptake of taurocholate was evidenced as early as 15 min and 1 h respectively after addition of 10␮M CsA; it peaked at around 2 h and was reversible. These early effects were associated with generation of at INSERM on April 26, 2015 oxidative stress and deregulation of cPKC pathway. At higher CsA concentrations (≥50␮M) alterations of eflux and uptake activities were enhanced and became irreversible, pericanalicular F-actin microilaments were disorganized and bile canaliculi were constricted. These changes were associated with induction of endoplasmic reticulum stress that preceded generation of oxidative stress. Concentration-dependent changes were observed on total bile acid disposition, which were characterized by an increase and a decrease in culture medium and cells, respectively, after a 24-h treatment with CsA. Accordingly, genes encoding hepatobiliary transporters and bile acid synthesis enzymes were differently deregulated depending on CsA concentration. By contrast, FK506 induced limited effects only at 25–50␮M and did not alter bile canaliculi. Our data demonstrate involvement of different concentration-dependent mechanisms in CsA-induced cholestasis and point out a critical role of endoplasmic reticulum stress in the occurrence of the major cholestatic features.

Key words: oxidative stress; endoplasmic reticulum stress; cPKC signaling; hepatocytes; bile acids; transporters; tacrolimus

ABBREVIATIONS ER endoplasmic reticulum MTT methylthiazoletetrazolium CsA cyclosporine A DMSO dimethyl sulfoxide FK506 tacrolimus RNA ribonucleic acid cPKC classical protein kinase c RT-qPCR real-time quantitative polymerase chain reaction ADR adverse drug reaction NTCP Na+-dependent taurocholate cotransporting DILI drug-induced liver injury polypeptide BSEP bile salt export pump TA taurocholic acid E17G estradiol 17ß-D-glucuronide ROS reactive oxygen species MRP2 multidrug resistance-associated protein 2 H2-DCFDA 2’,7’-dichlorodihydroluorescein MDR1 multidrug resistance 1 NAC N-acetyl-cysteine

C The Author 2014. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For permissions, please email: [email protected]

244 SHARANEK ET AL. 245

Nrf2 NF-E2-related factor 2 trations in humans. The reasons why the liver is so differently HO1 heme oxygenase 1 sensitive to the two immunosuppressant agents remain unclear. MnSOD manganese superoxide dismutase In the present study, we have investigated early effects of ATF4 activating transcription factor 4 CsA and FK506 in the metabolically competent human HepaRG ATF6 activating transcription factor 6 cells. In addition to phases I and II metabolizing enzymes (An- GRP78 glucose regulated protein,78KD inat et al., 2006), these cells exhibit functional sinusoidal and CHOP C/Ebp-homologous protein canalicular transporters and are now largely used for studying PBA 4-phenyl butyric acid both acute and chronic effects of xenobiotics in human liver CDF 5(6)-carboxy-2′,7′-dichloroluorescein diacetate (Antherieu´ et al., 2012; Guguen-Guillouzo and Guillouzo, 2010). BA bile acids Our data show that unlike FK506, CsA induced early cholestatic H7 1-(5-isoquinolinylsulfonyl)-2-methyl-piperazine effects, involving different dose-dependent mechanisms in Hep- CAR constitutive androstane receptor aRG cells. PXR pregnane X receptor FXR farnesoid X receptor MATERIALS AND METHODS BCRP breast cancer resistance protein MDR3 multidrug resistance 3 Chemicals. Cyclosporine A (CsA), methylthiazoletetrazolium MRP3 multidrug resistance-associated protein 3 (MTT), N-acetyl-cysteine (NAC), 4-phenyl butyric acid (PBA), MRP4 multidrug resistance-associated protein 4 1-(5-isoquinolinylsulfonyl)-2-methyl-piperazine (H7), and CYP7A1 cytochrome P450 7A1 5(6)-carboxy-2′,7′-dichloroluorescein diacetate (CDF) were pur-

CYP8B1 cytochrome P450 8B1 chased from Sigma (St. Quentin Fallavier, France). Tacrolimus Downloaded from CYP27A1 cytochrome P450 27A1 (FK506) was provided by Tocris Bioscience (Bristol, UK), 2’,7’- CYP3A4 cytochrome P450 3A4 dichlorodihydroluorescein (H2- DCFDA) was obtained from In- vitrogen Molecular Probe (Saint Aubin, France). [3H]-Taurocholic acid ([3H]-TA) was from Perkin Elmer (Boston, MA). The speciic Adverse drug reactions (ADRs) are usually classiied as either antibodies against phospho-p38 MAP kinase and p38 MAP dose-dependent and reproducible (intrinsic) or unpredictable kinase were purchased from Cell Signaling Technology (Beverly, http://toxsci.oxfordjournals.org/ (idiosyncratic) occurring only in certain susceptible patients and MA). Go¨6976 and SB203580 were from Calbiochem (San Diego, being not overtly dose-dependent (Park et al., 2005). Many differ- CA). BAPTA/AM was obtained from Alexis Co. (Nottingham, ent classes of marketed drugs and herbals have been reported UK). Phalloidin luoprobe SR101 (200 U/ml) was purchased from to cause drug-induced liver injury (DILI) in humans, accounting Interchim (Montluc¸on France). Hoechst dye was from Promega for more than 50% of cases of acute liver failure in the United (Madison, Wisconsin). Other chemicals were of reagent grade. States (Lee, 2003). DILI encompasses a large spectrum of lesions, including apoptosis/necrosis, phospholipidosis, steatosis, and Cell cultures. HepaRG cells were seeded at a density of 2.6 × cholestasis. 104 cells/cm2 in Williams E medium supplemented with 10% Intra-hepatic cholestasis represents a frequent manifesta- fetal bovine serum, 100 IU/ml penicillin, 100 mg/ml strepto- at INSERM on April 26, 2015 tion of DILI in humans (Lee, 2003). In many cases, it results from mycin, 5 mg/ml insulin, 2mM glutamine, and 50mM hydrocorti- alterations of the hepatobiliary transporter system, in particu- sone hemisuccinate. After 2 weeks, HepaRG cells were shifted lar the bile salt export pump (BSEP), which is the most physi- to the same medium supplemented with 2% dimethyl sul- ologically important canalicular bile transporter (Stieger et al., foxide (DMSO) for further 2 weeks in order to obtain conlu- 2007). Other disturbances, such as altered cell polarity, disrup- ent differentiated cultures with maximum functional activi- tion of cell-to-cell junctions, and cytoskeleton disorganization, ties. At this time, these cultures contained hepatocyte-like and can also participate in cholestasis. The mechanisms by which progenitors/primitive biliary-like cells (Cerec et al., 2007). drugs induce cholestasis are diverse and remain poorly under- stood (Antherieu´ et al., 2013). Intracellular signaling has emerged Cell viability. Cytotoxicity was evaluated by the MTT colorimet- as a fundamental mechanism to explain the development of ric assay. Briely, cells were seeded in 24-well plates and treated different models of cholestasis (Crocenzi et al., 2004); thus, the with various concentrations of CsA and FK506. After medium Ca2+-dependent PKC isoforms (cPKC) have been demonstrated removal, 500 ␮l serum-free media containing MTT (0.5 mg/ml) to be involved in estradiol 17ß-D-glucuronide (E17G)- and tert- were added to each well and incubated for 2 h at 37◦C. The butylhydroperoxide-induced cholestasis (Barosso et al., 2012; water-insoluble formazan was dissolved in 500 ␮lDMSOandab- Perez´ et al., 2006). A role for oxidative stress as a primary causal sorbance was measured at 550 nm (Aninat et al., 2006). agent and/or an aggravating factor has been evidenced in extra- hepatic and intrahepatic cholestasis (Antherieu´ et al., 2013;Perez´ Measurement of reactive oxygen species. Reactive oxygen species et al., 2006; Roma and Pozzi, 2008). (ROS) generation was determined by the H2-DCFDA assay. Cells Cyclosporine A (CsA) is well recognized as a dose-dependent were incubated for 2 h at 37◦Cwith2␮M H2-DCFDA; then they cholestatic inducing agent. It has been shown to alter bile secre- were washed with cold phosphate buffered saline (PBS) and tion in in vitro (Princen et al., 1991) and short-term in vivo stud- scraped in phosphate buffer (10mM, pH 7.4)/methanol (vol/vol) ies (Mizuta et al., 1999). CsA also acts as a competitive inhibitor supplemented with Triton X-100 (0.1%). Fluorescence inten- of BSEP, MRP2, and MDR1 and caused disorganization of per- sity of cell extracts was determined by spectroluorimetry us- icanalicular F-actin cytoskeleton (Roman´ and Coleman, 1994). ing excitation/emission wavelengths of 498/520 nm (Antherieu´ CsA disturbs the endoplasmic reticulum (ER)-Golgi transport by et al., 2013). altering vesicle-mediated transport (Sarro´ et al., 2012). By con- trast, tacrolimus (FK506), another immunosuppressant that pos- Real-time quantitative polymerase chain reaction analysis. Total RNA sesses similar immunosuppressive properties as CsA (Tocci et al., was extracted from 106 HepaRG cells with the SV total RNA isola- 1989), has usually no effect even at supra-therapeutic concen- tion system (Promega). RNAs were reverse transcribed into cDNA 246 TOXICOLOGICAL SCIENCES, 2014, Vol. 141, No. 1

and real-time quantitative polymerase chain reaction (RT-qPCR) g for 20 min. The supernatant was collected and extracted us- was performed using a SYBR Green mix. Primer sequences are ing a solid phase extraction cartridge (SPE). High pressure liq- listed in Supporting table 1. uid chromatography coupled with tandem mass spectrometry (HPLC–MS/MS) was used to measure bile acid (BA) content in the Eflux of taurocholate acid. Cells were irst exposed to 43.3nM [3H]- samples. The chromatographic separation of BAs was carried TA for 30 min to induce intracellular accumulation of [3H]-TA, out on a Zorbax eclipse XDB-C18 (Agilent Technology, Garches, then washed with PBS and incubated with or without CsA or France) itted on an Agilent 1100 HPLC system (Massy, France). FK506 at different time points (from 0 to 6 h) in a standard buffer The column was thermostated at 35◦C. The mobile phases con- with Ca2+ and Mg2+. After the incubation time, cells were washed sisted of (A) (ammonium acetate 15 mmol/l, pH 5.3) and (B) with PBS and incubated for 5 min with Ca2+-andMg2+-free buffer (methanol) at 65:35 (vol/vol). BAs were eluted by increasing B in in order to disrupt canalicular tight junctions. Then, they were Afrom65to95(vol/vol) for 30 min. Separation was achieved at scraped in 0.1 N NaOH and the remaining radiolabeled substrate a low rate varying between 0.3 and 0.5 ml/min for 30 min. Mass was measured through scintillation counting to determinate TA spectra were obtained using an API 2000 Q-Trap (AB-Sciex, Con- eflux. To discriminate between basolateral and canalicular ef- cord, Ontario, Canada) equipped with a TurboIon electrospray lux, cells were incubated in parallel in either standard or Ca2+- interface set in the negative mode (needle voltage—4500 V) with and Mg2+-free buffer for 30 min after TA uptake before measur- nitrogen as the nebulizer set at 40 (arbitrary pressure unit given ing the remaining radiolabeled TA. Canalicular eflux was cal- by the equipment provider). Curtain and heater pressures were culated using this equation: Canalicular eflux = Radioactivity set at 20 and 40, respectively (arbitrary units), and the ion source in eflux medium Ca2+-andMg2+-free buffer - Radioactivity in temperature was set at 400◦C. Declustering and entrance poten- eflux medium standard buffer (Marion et al., 2012). tials were set at −60 V and −10 V, respectively. The MS/MS detec- Downloaded from tion was operated at unit/unit resolution. The acquisition dwell CDF excretion. After 2 h of exposure to CsA or FK506, cells were time for each transition monitored was 70 ms. Data were ac- incubated with 3␮M CDFDA, which is hydrolyzed by intracellular quired by the Analyst software (version 1.4.2, AB-Sciex) in the esterases to CDF, a substrate of multidrug resistance-associated Multiple Reaction Monitoring mode (Humbert et al., 2012). protein 2 (MRP2) for 20 min at 37◦C and then washed with PBS. Imaging was done using inverted microscope Zeiss Axiovert Western blot analysis of MAPK phosphorylation. Activation of p38- http://toxsci.oxfordjournals.org/ 200M and AxioCam MRm. MAPK was assessed by evaluating its phosphorylation status in cell lysates by Western blotting. Briely, HepaRG cells were incu- Na+-dependent taurocholic cotransporting polypeptide activity. Activ- bated with medium alone or with CsA, FK506, and CsA plus in- ity of the Na+-dependent taurocholic cotransporting polypep- hibitors for 15 or 120 min, washed with cold phosphate-buffered tide (NTCP) transporter was estimated through determination saline, and inally resuspended in cell lysis buffer and a pro- of sodium-dependent intracellular accumulation of the radio- tease inhibitor cocktail. Aliquots containing an equivalent to- labeled [3H]-TA substrate. After treatment with either drug, cells tal protein content, as determined by the Bradford procedure were incubated with 43.3nM of radio-labeled TA for 30 min. Cells with bovine serum albumin as the standard, were subjected to were then washed twice with PBS and lysed with 0.1 N NaOH. Ac- sodium dodecyl sulfate/12% polyacrylamide gel electrophore- at INSERM on April 26, 2015 cumulation of radiolabeled substrate was determined through sis, electrotransferred to Immobilon-P membranes, and probed scintillation counting. Taurocholate accumulation values in the overnight with a rabbit antiphosphorylated p38 (Cell Signal- presence of sodium minus accumulation values in the absence ing Technology, Beverly, MA). After using a mouse anti-rabbit of sodium represented NTCP activity (Antherieu´ et al., 2013). IgG secondary antibody (1:5000, 1 h; ThermoFisher Scientiic, Waltham, MA), a chemiluminescence reagent, and Hyperilm F-actin distribution. After cell exposure to CsA or FK506, cells ECL, phosphorylated and total MAPK bands were quantiied by were washed twice with warm PBS, ixed with 4% paraformalde- densitometry with Fusion-Capt software (Vilber Lourmat, Fu- hyde for 20 min at 4◦C and permeabilized with 0.3% Triton in PBS sion FX7, France) (Boaglio et al., 2012). for 30 min. F-actin and nuclei were labeled simultaneously using a phalloidin luoprobe diluted at 1/100 and 5 ng/ml Hoechst dye, Statistical analysis. The student’s t-test was applied to compare respectively, for 20 min. Imaging was done using the Cellomics data between treated and corresponding control cultures. Data ArrayScan VTI HCS Reader (Thermo Scientiic) (Antherieu´ et al., were considered as signiicantly different when *p Ͻ 0.05, **p Ͻ 2013). 0.01, and ***p Ͻ 0.001.

Time-lapse imaging. Phase-contrast images were taken each RESULTS minute after exposure of HepaRG cells to both immuno- suppressant agents, using time-lapse phase-contrast videomi- Cytotoxicity Effects of CsA and FK506 croscopy (Zeiss Axiovert 200M and AxioCam MRm). The inverted Cytotoxicity of both CsA and FK506 was evaluated in HepaRG microscope was equipped with a thermostatic chamber (tem- cells using the MTT test. CsA did not cause any signiicant cyto- perature and CO2) to maintain the cells under physiological con- toxicity after 24 h at concentrations up to 100␮M. By contrast, ditions. Images were captured with a 20× objectiveandthemo- FK506 was highly toxic at 100␮M causing 94% cell death (p Ͻ saic tool of the microscope which enabled the automated acqui- 0.001; Fig. 1A). Based on these data, non-toxic concentrations sition of multi-image mosaics at the deined positions. from0to50␮M of both drugs were selected for further studies.

Measurement of endogenous bile acid content. After treatment of Induction of ROS and ER Stress by CsA HepaRG cells with CsA for 4 and 24 h both cells and media were Because deregulation of the cellular redox status is a potent collected, lyophilized and stored at −80◦C. Ten ␮l of water was mechanism in DILI, generation of oxidative and ER stress was added to 100 mg dried samples, homogenized using a Polytron analyzed after exposure to the two immunosuppressant agents. homogenizer for 30 s, and clariied by centrifugation at 20,000 × Signiicant production of ROS was observed in HepaRG cells SHARANEK ET AL. 247 Downloaded from http://toxsci.oxfordjournals.org/ at INSERM on April 26, 2015

FIG. 1. Cytotoxicity and intracellular generation of ROS in CsA- and FK506-treated HepaRG cells. (A) Cells were incubated for different time points (0–24 h) with different concentrations of either CsA or FK506 (0–100␮M). Cytotoxicity was measured by the MTT colorimetric assay. (B) Cells were treated with different concentrations of either CsA or FK506, or co-treated with 50␮M CsA + 15mM NAC or 5mM PBA for 2 h. H2O2 at 25mM was used as a positive control. ROS generation was detected by the DCFDA speciic substrate. (C and D) Cells were treated with CsA or FK506 or co-treated with 50␮M CsA + (15mM NAC or 5mM PBA) for 6 h, then mRNA levels of ROS markers (HO-1, MnSOD, and Nrf2) and ER stress markers (CHOP, GRP78, ATF4, and ATF6) were estimated by RT-qPCR. Data represent the means ± SD of three independent experiments. All results are expressed relative to the levels found in untreated cells, arbitrarily set at 1 or 100% *p Ͻ 0.05, **p Ͻ 0.01, ***p Ͻ 0.001 compared with non-treated cells, #p Ͻ 0.05, ##p Ͻ 0.01, ###p Ͻ 0.001 compared with 50␮MCsA. starting at 10␮M (twofold; p Ͻ 0.05) after 2 h (Fig. 1B). ROS for- generation and induction of ROS-related genes, suggesting a link mation occurred within the irst 15 min after CsA addition (data between ER stress and ROS triggered by CsA. However, NAC re- not shown), peaked after 2 h (3.8-fold; p Ͻ 0.01) and was totally duced induction of ROS markers without affecting ER stress- prevented by co-incubation with 15mM of the antioxidant NAC. related genes.

Only a slight ROS production was obtained with 50␮M FK506 af- In addition, PBA failed to lower ROS induced by H2O2 and ter 2 h (Fig. 1B). Moreover, transcript levels of three ROS mark- the cholestatic drug chlorpromazine where no ER stress was ob- ers (Nrf2, HO-1, and MnSOD) were also measured and found to be served (Supplementary data 1), indicating that PBA was able to signiicantly up-regulated as early as 6 h after CsA exposure (Fig. decrease ROS by reducing ER stress, as is the case with high CsA 1C). Overexpression of Nrf2 was lower with FK506 and occurring concentrations. only at 50␮M. Moreover, four ER stress-related genes (ATF4, ATF6, GRP78, and CHOP) were strongly up-regulated after 6 h treatment with Effects of CsA and FK506 on Inlux and Eflux Transporters 50␮M CsA, whereas only a slight increase of CHOP transcripts CDF and TA substrates were used to evaluate MRP2 and BSEP ac- was observed with 50␮M FK506 (Fig. 1D). Co-treatment with PBA, tivity, respectively. To estimate BSEP activity, HepaRG cells were an ER stress inhibitor, prevented induction of ER stress-related incubated with [3H]-TA for 30 min and then treated for 2 h with genes. Interestingly, co-treatment with PBA also reduced ROS either drug in standard buffer containing Ca2+/Mg2+. 248 TOXICOLOGICAL SCIENCES, 2014, Vol. 141, No. 1

A 5-min incubation with Ca2+/Mg2+-free buffer was used to centrations indicating a role of ROS in CsA-induced cholestasis disrupt Ca2+/Mg2+-dependent canalicular tight junctions and whatever the drug concentration (Fig. 3B). eventually evacuate bile canaliculi content; thus only intracel- The downstream effector of cPKC, p38, was previously shown lular accumulation of [3H]-TA, which correlated to the effect on to be involved in E17G-cPKC-dependent induced cholestasis canalicular eflux, was measured. In treated cells, CsA inhibited (Boaglio et al., 2012). Its speciic inhibitor, SB203580, signiicantly [3H]-TA canalicular eflux in a dose-dependent manner with a reduced inhibition of [3H]-TA by 10␮M CsA to 47.5% (p Ͻ 0.01) 33% (p Ͻ 0.05) signiicant inhibition starting at 5␮M and reaching instead of 21.9% (p Ͻ 0.001) (Fig. 3B). Accordingly, Western blot- 90% (p Ͻ 0.001) at 50␮M(Fig.2A). On the other hand, 50␮M FK506 ting analysis of phospho (p)-p38 showed that CsA increased the decreased [3H]-TA canalicular eflux to 58.2% (p Ͻ 0.05) without amount of p-p38 in a time-dependent manner with increment any inhibition observed at 10␮M(Fig.2A). To better characterize becoming apparent as soon as 5 min after CsA administration. CsA effects on TA eflux, a time-dependent study was carried Co-treatment with either the cPKC inhibitor Go¨6976 or NAC se- out between 0 and 6 h after treatment with 10 and 50␮M. Eflux lectively prevented p-p38 increase, indicating that p38 activation inhibition was evidenced as early as 15 min after CsA addition, was dependent on cPKC induction and ROS generation by CsA whereas its maximum occurred after 2 h. At low CsA concentra- (Figs. 3Cand3D). tions, inhibition was partially restored after 6 h. At higher CsA concentrations inhibition of TA eflux was totally maintained af- Effects of CsA on BA Disposition ter 6 h (Fig. 2B). In order to determine whether CsA altered disposition of en- To estimate MRP2 activity, HepaRG cells were exposed to both dogenous BAs, total BA content was quantitated in both media drugs for 2 h followed by incubation with CDF, an MRP2-speciic and cells after 4 and 24 h exposure to 10 and 50␮M CsA using Downloaded from substrate. CsA inhibited canalicular excretion of CDF at both 10 HPLC–MS/MS. Although no changes were evidenced after 4 h, a ␮ and 50 M concentrations; no effect was observed with FK506 concentration-dependent increase of BA content in the medium ␮ even at 50 M(Fig.2C). and decrease in cells was observed after 24 h of CsA treatment. + The effect of the two immunosuppressant agents on Na - The sum of total BAs content (media + cells) appeared to be dependent BA uptake was estimated through measurement of nearly unchanged between 4 and 24 h (Fig. 4). intracellular accumulation of [3H]-TA after a 30-min incubation. CsA-induced inhibition of NTCP activity started after 30 min http://toxsci.oxfordjournals.org/ with 50␮M and 1 h with low doses (≤10␮M); it reached a max- Induction of Cytoskeletal F-Actin Disruption and Bile Canaliculi Con- imum after 2 h and started to be restored after 4 h exposure striction by High CsA Concentrations at low doses, whereas inhibition of [3H]-TA uptake was main- F-actin cytoskeleton is one of the primary targets of oxida- tained with 50␮M(Fig.2D). Only a slight inhibition of [3H]-TA up- tive stress. To determine whether CsA and FK506 disrupted cy- take was observed with 50␮M FK506 after 24 h treatment. Both toskeletal F-actin distribution, HepaRG cells were exposed to drugs had no signiicant effect on Na+-independent [3H]-TA up- both drugs at different time points and then cytoskeletal F-actin take measured using Na+-free buffer (data not shown). Further was visualized by phalloidin luoprobe labeling. Untreated cells experiments were carried out on progenitors/primitive biliary- showed typical pericanalicular distribution of F-actin and large ␮ like cells after selective enzymatic detachment of hepatocyte- bile canaliculi with an open lumen (Fig. 5A). At 10 M CsA did at INSERM on April 26, 2015 like cells (Cerec et al., 2007) to determine the contribution of not affect actin distribution in the pericanalicular area (Fig. 5B) ␮ these cells in CsA effects. No [3H]-TA uptake was detected (Sup- whereas at 50 M it disrupted its distribution, lowered its label- plementary data 2), indicating it was exclusively performed by ing intensity, and caused constriction of bile canaliculi after 2- hepatocyte-like cells. h exposure (Fig. 5D). These effects were conirmed by phase- contrast time-lapse imaging. Retraction and disappearance of ␮ Role of cPKC, ER, and Oxidative Stress in CsA-Induced Effects bile canaliculi were observed in 50 M CsA-treated cells (Fig. It has been demonstrated that cPKC partly accounts for acute 5G’). FK506 did not alter cytoskeletal F-actin distribution nor bile cholestasis caused by E17G (Barosso et al., 2012) and that CsA canaliculi structures (Figs. 5C and 5F’). can activate cPKC. We analyzed whether cPKC was involved in CsA-induced cholestatic effects. [3H]-TA eflux was reduced to Effects of CsA and FK506 on Expression of Genes Related to Cholestasis 21.9% of the control by treatment of HepaRG cells with 10␮M Many genes involved in BA transport, synthesis, and metabolism CsA for 2 h and was partially restored by co-treatment with are deregulated in cholestasis. A set of target genes was an- the PKC inhibitor H7, rising to 59.4% (p Ͻ 0.05) of the control alyzed by RT-qPCR after 24-h treatment with various concen- (Fig. 3A). Because Ca2+ is required for activation of the classi- trations of CsA and FK506. These genes included nuclear re- cal PKCs, we investigated whether Ca2+-mediated activation of ceptors (CAR, PXR, FXR), eflux transporters (BCRP, BSEP, MDR1, these PKC isoenzymes was involved in CsA-induced deleterious MDR3, MRP2, MRP3,andMRP4), uptake transporter NTCP,BA effects. Both the intracellular Ca2+-chelator BAPTA/AM and the metabolism enzymes (CYP7A1, CYP8B1,andCYP27A1), and speciic inhibitor of Ca2+-dependent PKCs, Go¨6976, prevented CYP3A4, a BA detoxifying enzyme. At low concentrations up to the decrease induced by CsA in [3H]-TA eflux representing 47.4 10␮M CsA slightly induced PXR, FXR, CAR, NTCP, MRP2, MRP3, and 48.7% (p Ͻ 0.01), respectively, compared with a 21.9% (p MRP4, BCRP,andCYP3A4 expression whereas at doses Ͼ10␮Mit Ͻ 0.001) inhibition with 10␮M CsA. When administered alone, strongly inhibited most of the tested genes, i.e., FXR, PXR, CAR, none of these inhibitors had any effect on [3H]-TA eflux (data CYP3A4, BSEP, NTCP, MDR1, MDR3,andCYP8B1. By contrast, at not shown). At high CsA concentration (50␮M), none of these low concentrations, FK506 was found to induce only MRP4 and inhibitors signiicantly modulated inhibition of [3H]-TA eflux CYP3A4 whereas at high concentrations it inhibited expression (Fig. 3A). However, this inhibition was totally restored by co- of PXR, CAR, BSEP, MDR3, NTCP, CYP27A1, CYP8B1, and CYP3A4 treatment with either PBA or NAC. Interestingly at low CsA con- and induced basolateral transporters (MRP3, MRP4)aswellas centrations, co-treatment with PBA has no counteraction effect, MRP2 and BCRP to a similar extent as CsA at the same con- favoring a role of ER stress only at high CsA concentrations. By centrations (Table 1). No transporter transcripts were detected contrast, NAC was totally effective at low and high CsA con- in progenitors/primitive biliary-like cells when measurements SHARANEK ET AL. 249 Downloaded from http://toxsci.oxfordjournals.org/

3

FIG. 2. Effects of CsA and FK506 on activity of eflux transporters. (A and B) Cells were exposed to [ H]-TA in standard buffer for 30 min to induce intracellular at INSERM on April 26, 2015 accumulation of TA and then incubated with different concentrations of either CsA or FK506 for 2 h (A) or different time points (0–6 h) (B). Bile canaliculi were disrupted by additional 5-min incubation with Ca2+- and Mg2+-free buffer. TA eflux was determined by measuring intracellular TA accumulation. Eflux of TA was expressed relative to the level found in untreated cells, arbitrarily set at a value of 100%. (C) Cells were treated with either CsA or FK506 for 2 h. MRP2 activity was estimated using CDF, a speciic substrate; nuclei were stained in blue using Hoechst dye. (D) HepaRG cells were treated with either CsA or FK506 at different concentrations for different time points (0–24 h) and then incubated with [3H]-TA for 30 min. NTCP activity was evaluated by measurement of intracellular accumulation of [3H]–TA. Data represent the means ± SD of three independent experiments. *p Ͻ 0.05, **p Ͻ 0.01, ***p Ͻ 0.001 compared with untreated cells, #p Ͻ 0.05, ##p Ͻ 0.01 compared with CsA (same concentration) after 2 h.

were performed after selective detachment of hepatocyte-like cultured primary hepatocytes have well demonstrated that CsA cells (not shown). is a powerful inhibitor of BSEP (Pedersen et al., 2013). CsA also induced a concentration-dependent decrease in NTCP activity measured by Na+-dependent TA uptake starting after 1 h at low doses (10␮M) and even after 30 min at high doses, DISCUSSION thereby indicating that inhibition of uptake occurred shortly af- ter eflux inhibition. CsA has been previously shown to decrease Presently, there is no means for accurate prediction of cholesta- uptake of BA in the liver (Murray et al., 2011) but our observation sis risks in humans; many cholestatic drugs do not induce hep- represented the irst direct demonstration that inhibition of TA atotoxicity in rats. Using the metabolically competent human uptake was reversible with low CsA concentrations. HepaRG cells, we demonstrated that CsA induced dose- and Early effects on eflux and inlux of BA by CsA were associ- time-dependent characteristic features of cholestasis typiied by ated with generation of an oxidative stress and involved dereg- an early inhibition of eflux and uptake of BA and that FK506, an- ulation of the cPKC/p38 pathway. A role for oxidative stress as other immunosuppressant agent which shares similar immuno- a primary causal agent in induction of drug-induced cholestasis suppressive properties and mechanism of action with CsA, was has been reported (Antherieu´ et al., 2013;Perez´ et al., 2006). Sev- much less cholestatic, inducing some liver disturbances only at eral arguments support the involvement of an oxidative stress high concentrations. in CsA-induced cholestasis, especially ROS generation, and pre- 3 CsA strongly inhibited canalicular eflux of [ H]-TA in a dose- vention of CsA-induced BSEP activity inhibition and decrease dependent manner in HepaRG hepatocytes, becoming signii- in phospho-p38 protein in the presence of NAC. Compelling ␮ cant at concentrations as low as 5 M after 15 min treatment. evidence that ROS-mediated cholestasis can involve activation This inhibition was reversible at low doses and irreversible at of intracellular signaling cascades via cPKC has been provided concentrations of 25␮M or higher. Recent works using sandwich- 250 TOXICOLOGICAL SCIENCES, 2014, Vol. 141, No. 1 Downloaded from http://toxsci.oxfordjournals.org/ at INSERM on April 26, 2015

FIG. 3. Effect of Ca2+ chelation, cPKC, p38, ER stress, and ROS inhibition on CsA-induced effects. (A) HepaRG cells were exposed to [3H]-TA for 30 min to induce intracellular accumulation of TA and then incubated for 2 h with CsA alone or with either (A) the PKC inhibitor H7 (25␮M), cPKC inhibitor Go¨6976 (10␮M), p38 inhibitor SB203580 (10␮M), or intracellular Ca2+ chelator BAPTA/AM (20␮M) or (B): 5mM PBA or 15mM NAC. (C) Representative Western blotting of p-p38 and total p38 forms obtained from whole cellular lysates of HepaRG cells incubated with CsA ± inhibitors. (D) Phosphorylation of p38-MAPK quantiied as p-p38 to total-p38 ratio. The results are expressed as percentages of untreated cells and are shown as mean ± SD of three independent experiments. *p Ͻ 0.05, **p Ͻ 0.01, ***p Ͻ 0.001 compared with untreated cells, #p Ͻ 0.05, ##p Ͻ 0.01, ###p Ͻ 0.001 compared with CsA alone.

TABLE 1. Effects of CsA and FK506 on Expression of mRNAs Encoding Genes Related to Hepatobiliary Transporters, Nuclear Receptors, and Phase I Metabolizing Enzymes in HepaRG Cells After 24 h Exposure

CSA 1␮MCSA5␮M CsA 10␮M CsA 25␮M CsA 50␮M FK506 1␮M FK506 5␮M FK506 10␮M FK506 25␮M FK506 50␮M Nuclear receptors FXR 1.27±0.05* 1.18±0.09 1.05±0.18 0.88±0.05 0.69±0.09* 1.045±0.25 1.44±0.33 1.64±0.68 1.173±0.20 0.95±0.21 PXR 1.39±0.1 1.94±0.13*** 1.14±0.14 0.44±0.07*** 0.32±0.02*** 1.07±0.08 1.15±0.09 0.83±0.02 0.94±0.04 0.58±0.12*** CAR 1.4±0.1* 1.25±0.55 1.01±0.30 0.4±0.03*** 0.04±0.02*** 1.03±0.44 1.44±0.40 0.81±0.21 0.76±0.18** 0.30±0.18** BA transporters BSEP 1.09±0.09 1.01±0.15 0.79±0.17 0.61±0.11** 0.54±0.15** 1.17±0.03 0.76±0.22 0.77±0.14 0.72±0.11* 0.63±0.11** BCRP 1.19±0.08 2.14±0.11*** 2.51±0.50 2.76±0.09*** 3.36±0.85* 0.92±0.15 0.95±0.13 0.95±0.13 1.02±0.12 1.74±0.42 MDR3 1.26±0.34 1.161±0.11 0.93±0.17 0.34±0.09*** 0.23±0.05*** 0.95±0.13 0.89±0.21 0.6±0.15 0.39±0.09** 0.47±0.18* MRP2 0.9±0.24 1.06±0.21 1.3±0.18* 1.80±0.14*** 1.8±0.15*** 0.90±0.12 1.35±0.3 1.34±0.28 1.58±0.15* 2.04±0.41* MRP3 1.02±0.11 1.4±0.18** 1.50±0.14*** 1.57±0.07*** 1.79±0.08*** 1.18±0.13 1.371±0.41 1.41±0.43 1.6±0.23* 1.64±0.32* MRP4 0.99±0.18 1.44±0.21 1.55±0.18* 2.8±0.09*** 2.68±0.12*** 1.34±0.17 1.68±0.03*** 1.8±0.05*** 1.8±0.09* 2.60±0.51* NTCP 2.16±0.55* 2.64±0.54** 1.51±0.33 0.10±0.02*** 0.05±0.01*** 1.11±0.24 1.3±0.23 0.82±0.09 0.45±0.15*** 0.23±0.08*** BA metabolizing enzymes CYP27A1 0.88±0.04 1.04±0.07 0.86±0.03 0.53±0.05*** 0.41±0.08*** 1.00±0.16 1.16±0.35 0.86±0.11 1.3±0.46 0.47±0.06*** CYP8B1 0.84±0.27 1.15±0.14 0.73±0.24 0.26±0.08 0.05±0.01 1.5±0.25 1.62±0.71 1.03±0.35 0.77±0.08** 0.32±0.1*** CYP7A1 1.08±0.03 1.11±0.07 1.11±0.05 0.92±0.01** 0.42±0.13** 1.06±0.29 1.42±0.37 0.87±0.08 1.4±0.11 0.9±0.12* CYP3A4 1.62±0.05*** 1.51±0.28* 1.33±0.57 0.23±0.05*** 0.12±0.01*** 1.3±0.23 1.8±0.21** 1.54±0.18* 0.93±0.13 0.34±0.08***

Note: Data represent the means ± SD of three independent experiments. All results are expressed relative to the levels found in untreated cells, arbitrarily set at a value of 1. *p Ͻ 0.05, **p Ͻ 0.01, ***p Ͻ 0.001 compared with non-treated cells. SHARANEK ET AL. 251

and molecular events that lead to changes in ER Ca2+ concen- tration resulting in activation of Ca2+-dependent PKC and ROS production (Orrenius et al., 2003). Several arguments support a role of Ca2+ in ER and oxidative stress-mediated effects during CsA-induced acute cholestasis, mostly the effectiveness of the Ca2+-chelator BAPTA/AM in reducing CsA cholestatic effects at low concentrations. However, the lack of a Ca2+ chelation effect at high CsA concentrations could be explained by the severity and irreversibility of the effects induced by CsA at high doses. Our data clearly showed that CsA induced ER stress and ROS in HepaRG cells at concentrations which were not cytotoxic whereas FK506 was highly toxic in the absence of ER stress and ROS formation. Accordingly, CsA, but not FK506, was recently reported to induce ER stress in endothelial cells (Bouvier et al., FIG. 4. Effects of CsA treatment on endogenous BAs content. Total BAs were mea- sured in the medium and cells (intracellular + bile canaliculi content) from cul- 2009). There is currently no report showing induction of ER stress tures treated with 10 or 50␮M CsA for 4 and 24 h and in corresponding untreated by FK506 in vivo. HepaRG cells using LC-MS/MS as described in the Materials and Methods sec- Although no obvious change was found in the medium/cells tion. Data were normalized relative to the amount of proteins in each condition, ratio of BAs after a 4-h treatment with 10 or 50␮MCsAa and expressed in percentage relative to the total BA content (medium + cells) of concentration-dependent increase in this ratio was observed af- untreated cells at 4 h which was arbitrary set at 100. Values represent the sum of ter 24 h, indicating a cellular (intracellular + bile canaliculi) de- Downloaded from means ± SD of duplicate measurements in three independent experiments, *p Ͻ 0.05 compared with untreated cells. Total BA content (medium + cells) appeared crease and not, as it could be expected, an accumulation of BAs. to be nearly unchanged between 4 and 24 h. This decrease was not related to a diminution in the content in total BA between 4 and 24 h. These data with CsA as well as those previously obtained with chlorpromazine (Antherieu´ et al., (Perez´ et al., 2006), and its association with endocytic internal- 2013) clearly showed that cholestatic features rapidly appeared ization of BA transporters, such as Mrp2 and Bsep, has been re- in HepaRG cells after drug addition; inhibition of BSEP occurred http://toxsci.oxfordjournals.org/ ported (Barosso et al., 2012;Perez´ et al., 2006). The downstream within 1 h and only shortly preceded that of NTCP whereas bile effector p38-MAPK has been shown to be differently activated by canaliculi constriction was observed within 4 h, giving support cPKC isoforms in E17G-induced cholestasis (Boaglio et al., 2012). to a rapid adaptation of the cells to cholestatic drug effects. The If cPKC was recently reported to play a major role in CsA tox- rapid inhibition of the uptake transporter NTCP, bile canaliculi icity (Sarro´ et al., 2012), to our knowledge our work is the irst constriction associated with BA discharge, and increased baso- to link the sequential activation of cPKC-p38 as a mechanism of lateral excretion likely explained the increased medium/cells ra- CsA-induced cholestasis. tio of BAs after 24 h of CsA treatment. Accordingly, troglitazone, Ampliied and irreversible effects of high CsA concentrations another potent inhibitor of BSEP, failed to induce intracellular on eflux and inlux of TA were associated with ROS produc- accumulation of BAs in human and rat sandwich-cultured hep- at INSERM on April 26, 2015 tion and overexpression of ROS markers, Nrf2, HO-1,andMnSOD, atocytes, and this result was attributed to compensatory mech- disruption of cytoskeletal pericanalicular F-actin, and constric- anisms which help to maintain BA homeostasis and low intra- tion of bile canaliculi structures. These effects appeared to be cellular BA concentrations (Marion et al., 2012). related primarily to induction of an ER stress. Indeed, four ma- Various cholestasis-related genes were also found to be dif- jor ER stress markers, ATF4, ATF6, GRP78,andCHOP,wereover- ferently deregulated depending on CsA concentration after a expressed and addition of NAC did not prevent their induction, 24-h treatment. At low concentrations the major changes in- contrary to PBA, a speciic inhibitor of ER stress (Basseri et al., volved overexpression of PXR, CAR, CYP3A4, NTCP, and BCRP.Al- 2009; Carlisle et al., 2014). Obviously, these data support a hierar- though CsA is recognized as a direct inhibitor of CYP3A4 activity chical relationship between ER stress and ROS in CsA-induced (Amundsen et al., 2012), previous studies have reported induc- effects. Contrary to CsA both H2O2 (this study) and chlorpro- tion of CYP3A4 transcripts by CsA through activation of PXR in mazine (Antherieu´ et al., 2013) were able to induce ROS without human primary hepatocytes (Wallace et al., 2010). Because BCRP induction of an ER stress. Moreover, PBA failed to reduce ROS is known to be regulated by Nrf2, its overexpression could be re- generation by these two molecules (Supplementary data 1), indi- latedtoearlyNrf2 activation by CsA (Singh et al., 2010). cating that it cannot reduce ROS unless an ER stress is induced. Conversely, overexpression of the basolateral MRP3 and These data suggest that ER stress might precede an oxidative MRP4 transporters, and down-regulation of NTCP, CYP27A1,and stress in HepaRG cells treated with high CsA concentrations. CYP7A1, the initiator of the BAs biosynthetic pathway, with high This is supported by a recent study on renal proximal tubule CsA concentrations could represent an adaptive defense re- cells, which identiied ER stress as an early effector of CsA cy- sponse aimed at reducing BA accumulation and concomitant totoxicity, leading to ROS generation (Sarro´ et al., 2012). toxicity (Zollner and Trauner, 2008). The mechanism of CsA-induced ER stress remains poorly Compared with CsA, FK506 induced some cholestatic effects studied. A recent proteomic analysis of CsA-treated HepG2 cells only at 50␮M, a concentration close to its toxic concentration. has evidenced deregulation of some proteins related to an ER Only, NTCP, MRP3,andMRP4 were deregulated with 25␮M FK506 stress without concluding whether it was a primary event in CsA and to a much lower extent than with 25␮M CsA. Moreover, cy- action (Van Summeren et al., 2011). ER stress has been linked toskeletal pericanalicular F-actin and bile canaliculi were not al- to perturbation of cyclophilins A and B distribution in a CsA- tered. Because FK506 is used at 10- to 100-fold lower doses than treated human kidney cell line (Lamoureux et al., 2011). The CsA, the absence of hepatotoxic and cholestatic effects at con- relevance between CsA-induced ER and oxidative stress could centrationsupto25␮M fully agreed with its safety reported in be related to deregulation of ER-mitochondria Ca2+-signaling clinics (Mihatsch et al., 1998). Noteworthy, if similar in vitro obser- bridge. Indeed, ER stress often stimulates a cascade of cellular vations as with CsA were recently reported with chlorpromazine 252 TOXICOLOGICAL SCIENCES, 2014, Vol. 141, No. 1 Downloaded from

FIG. 5. Alteration of F-actin cytoskeletal distribution and bile canaliculi structures by CsA treatment. (A–D) Untreated cells (A), cells treated with 10␮M CsA (B), 50␮M FK506 (C), or 50␮M CsA (D), after 2 h treatment; F-actin was localized using phalloidin luroprobe. Nuclei were stained in blue (Hoechst). F-actin shows a predominant http://toxsci.oxfordjournals.org/ pericanalicular distribution around open bile canaliculi in untreated cells and a much less intense staining around constricted bile canaliculi in 50␮M CsA-treated cells (arrow). Time-lapse imaging of HepaRG cells treated with 10␮M CsA (E’), 50␮M FK506 (F’), and 50␮M CsA (G’) after 120 min compared with corresponding cultures at 0 min (E, F, and G), respectively. the effects of this idiosyncratic cholestatic drug were, however, ACKNOWLEDGMENT observed only at 50␮M, a concentration close to its maximum We thank Dr. Remy Le Guevel from the ImPACell platform (Biosit, nontoxic concentration (Antherieu´ et al., 2013). Accordingly, con- Rennes) for imaging analyses and Dr. Eva Klimcakova for critical sidering the Cmax values measured in patients, i.e., 1.15, 0.1–0.2, reading of the manuscript. and 0.05␮M for CsA, chlorpromazine, and FK506, respectively, cholestatic concentrations are expected to be reached only in pa- at INSERM on April 26, 2015 tients treated with CsA. These indings suggest that it might be possible to discriminate between dose-dependent and idiosyn- REFERENCES cratic cholestatic drugs using the HepaRG cell model. Amundsen, R., Asberg,˚ A., Ohm, I. K. and Christensen, H. In summary, we demonstrate that reversibility of CsA- (2012). Cyclosporine A- and tacrolimus-mediated inhibition induced cholestatic effects is concentration-dependent using of CYP3A4 and CYP3A5 In Vitro. Drug Metab. Dispos. 40, 655– HepaRG cells and that ER and oxidative stress are major causal 661. events and involved Ca2+-dependent signaling pathways. Aninat, C., Piton, A., Glaise, D., Le Charpentier, T., Langouet,¨ S., Morel, F., Guguen-Guillouzo, C. and Guillouzo, A. (2006). SUPPLEMENTARY DATA Expression of cytochromes P450, conjugating enzymes and nuclear receptors in human hepatoma HepaRG cells. Drug Supplementary data are available online at http://toxsci. Metab. Dispos. 34, 75–83. oxfordjournals.org/. Antherieu,´ S., Bachour-El Azzi, P., Dumont, J., Abdel-Razzak, Z., Guguen-Guillouzo, C., Fromenty, B., Robin, M-A. and Guillouzo, A. (2013). Oxidative stress plays a major role FUNDING in chlorpromazine-induced cholestasis in human HepaRG cells. Hepatology 57, 1518–1529. European Community [Contracts Predict-IV-202222 and MIP- Antherieu,´ S., Chesne,´ C., Li, R., Guguen-Guillouzo, C. and Guil- DILI-115336]. The MIP-DILI project has received support from the louzo, A. (2012). Optimization of the HepaRG cell model for Innovative Medicines Initiative Joint Undertaking, resources of drug metabolism and toxicity studies. Toxicol. In Vitro 26, which are composed of inancial contribution from the European 1278–1285. Union’s Seventh Framework Programme [FP7/20072013] and EF- Barosso, I. R., Zucchetti, A. E., Boaglio, A. C., Larocca, M. C., PIA companies’ in kind contribution. http://www.imi.europa. Taborda, D. R., Luquita, M. G., Roma, M. G., Crocenzi, F. A. eu/. and Pozzi, E. J. S. (2012). Sequential activation of classic Ahmad Sharanek received inancial support from the PKC and estrogen receptor ␣ is involved in estradiol 17ß-D- Lebanese Association for Scientiic Research (LASeR), Pamela glucuronide-induced cholestasis. PloS One 7, e50711. Bachour-El Azzi from Lebanese CNRS and Philippe Jabre Asso- Basseri, S., Lhotak,´ S., Sharma, A. M. and Austin, R. C. (2009). The ciation, and Houssein Al-Attrache from the Association AZM- chemical chaperone 4-phenylbutyrate inhibits adipogenesis Lebanese University. by modulating the unfolded protein response. J. Lipid Res. 50, SHARANEK ET AL. 253

2486–2501. nous expression of ntcp. Am. J. Physiol. Gastrointest. Liver Phys- Boaglio, A. C., Zucchetti, A. E., Toledo, F. D., Barosso, I. R., Pozzi, iol. 301, 60–68. E. J. S., Crocenzi, F. A. and Roma, M. G. (2012). ERK1/2and Orrenius, S., Zhivotovsky, B. and Nicotera, P. (2003). Regulation p38 MAPKs are complementarily involved in estradiol 17ß- of cell death: The calcium-apoptosis link. Nat. Rev. Mol. Cell D-glucuronide-induced cholestasis: Crosstalk with cPKC and Biol. 4, 552–565. PI3K. PloS One 7, e49255. Park, B. K., Kitteringham, N. R., Maggs, J. L., Pirmohamed, M. Bouvier, N., Flinois, J. P., Gilleron, J., Sauvage, F. L., Legendre, C., and Williams, D. P. (2005). The role of metabolic activation Beaune, P., Thervet, E., Anglicheau, D. and Pallet, N. (2009). in drug-induced hepatotoxicity. Annu. Rev. Pharmacol. Toxicol. Cyclosporine triggers endoplasmic reticulum stress in en- 45, 177–202. dothelial cells: A role for endothelial phenotypic changes and Pedersen, J. M., Matsson, P., Bergstrom,¨ C. A., Hoogstraate, J., death. Am. J. Physiol. Renal Physiol. 296, 160–169. Noren,´ A., Lecluyse, E. L. and Artursson, P. (2013). Early iden- Carlisle, R. E., Brimble, E., Werner, K. E., Cruz, G. L., Ask, K., tiication of clinically relevant drug interactions with the hu- Ingram, A. J. and Dickhout, J. G. (2014). 4-Phenylbutyrate man bile salt export pump (BSEP/ABCB11). Toxicol. Sci. 136, inhibits tunicamycin-induced acute kidney injury via 328–343. CHOP/GADD153 repression. PloS One 9, e84663. Perez,´ L. M., Milkiewicz, P., Elias, E., Coleman, R., Pozzi, E. J. S. Cerec, V., Glaise, D., Garnier, D., Morosan, S., Turlin,B., Drenou, B., and Roma, M. G. (2006). Oxidative stress induces internaliza- Gripon, P., Kremsdorf, D., Guguen-Guillouzo, C. and Corlu, A. tion of the bile salt export pump, Bsep, and bile salt secretory (2007). Transdifferentiation of hepatocyte-like cells from the failure in isolated rat hepatocyte couplets: A role for protein human hepatoma HepaRG cell line through bipotent progen- kinase C and prevention by protein kinase A. Toxicol. Sci. 91,

itor. Hepatology 45, 957–967. 150–158. Downloaded from Crocenzi, F. A., Mottino, A. D. and Roma, M. G. (2004). Regulation Princen, H. M., Meijer, P., Wolthers, B. G., Vonk, R. J. and Kuipers, of synthesis and traficking of canalicular transporters and F. (1991). Cyclosporin A blocks bile acid synthesis in cultured its alteration in acquired hepatocellular cholestasis. Exper- hepatocytes by speciic inhibition of chenodeoxycholic acid imental therapeutic strategies for its prevention. Curr. Med. synthesis. Biochem. J. 275, 501–505. Chem. 11, 501–524. Roma, M. G. and Pozzi, E. J. S. (2008). Oxidative stress: A radical Guguen-Guillouzo, C. and Guillouzo, A. (2010). General review on way to stop making bile. Ann. Hepatol. 7, 16–33. http://toxsci.oxfordjournals.org/ in vitro hepatocyte models and their applications. Methods Roman,´ I. D. and Coleman, R. (1994). Disruption of canalicular Mol. Biol. 640, 1–40. function in isolated rat hepatocyte couplets caused by cy- Humbert, L., Maubert, M. A., Wolf, C., Duboc, H., Mahe,´ M., Fara- closporin A. Biochem. Pharmacol. 48, 2181–2188. bos, D., Seksik, P., Mallet, J. M., Trugnan, G., Masliah, J. and Sarro,´ E., Jacobs-Cacha,´ C., Itarte, E. and Meseguer, A. (2012). Rainteau, D. (2012). Bile acid proiling in human biological A pharmacologically-based array to identify targets of cy- samples: Comparison of extraction procedures and applica- closporine A-induced toxicity in cultured renal proximal tion to normal and cholestatic patients. J. Chromatogr. B Ana- tubule cells. Toxicol. Appl. Pharmacol. 258, 275–287. lyt. Technol. Biomed. Life Sci. 899, 135–145. Singh, A., Wu, H., Zhang, P., Happel, C., Ma, J. and Biswal, S. Lamoureux, F., Mestre, E., Essig, M., Sauvage, F. L., Marquet, P. (2010). Expression of ABCG2 (BCRP) is regulated by Nrf2 in at INSERM on April 26, 2015 and Gastinel, L. N. (2011). Quantitative proteomic analysis cancer cells that confers side population and chemoresis- of cyclosporine-induced toxicity in a human kidney cell line tance phenotype. Mol. Cancer Ther. 9, 2365–2376. and comparison with tacrolimus. J. Proteomics 75, 677–694. Stieger, B., Meier, Y. and Meier, P. J. (2007). The bile salt export Lee, W. M. (2003). Drug-induced hepatotoxicity. N. Engl. J. Med. pump. Plugers Arch. 453, 611–620. 349, 474–485. Tocci, M. J., Matkovich, D. A., Collier, K. A., Kwok, P., Dumont, F., Marion, T. L., Perry, C. H., St Claire, R. L. and Brouwer, K. L. Lin, S., Degudicibus, S., Siekierka, J. J., Chin, J. and Hutchin- (2012). Endogenous bile acid disposition in rat and human son, N. I. (1989). The immunosuppressant FK506 selectively sandwich-cultured hepatocytes. Toxicol. Appl. Pharmacol. 261, inhibits expression of early T cell activation genes. J. Immunol. 1–9. 143, 718–726. Mihatsch, M. J., Kyo, M., Morozumi, K., Yamaguchi, Y., Nickeleit, Van Summeren, A., Renes, J., Bouwman, F. G., Noben, J. P., V. and Ryffel, B. (1998). The side-effects of ciclosporine-A and van Delft, J. H., Kleinjans, J. C. and Mariman, E. C. (2011). tacrolimus. Clin. Nephrol. 49, 356–363. Proteomics investigations of drug-induced hepatotoxicity in Mizuta, K., Kobayashi, E., Uchida, H., Fujimura, A., Kawarasaki, HepG2 cells. Toxicol. Sci. 120, 109–122. H. and Hashizume, K. (1999). Inluence of tacrolimus on bile Wallace, K., Cowie, D. E., Konstantinou, D. K., Hill, S. J., Tjelle, T. acid and lipid composition in continuously drained bile using E., Axon, A., Koruth, M., White, S. A., Carlsen, H., Mann, D. A., a rat model. Comparative study with cyclosporine. Transpl. et al. (2010). The PXR is a drug target for chronic inlammatory Int. 12, 316–322. liver disease. J. Steroid Biochem. Mol. Biol. 120, 137–148. Murray, J. W., Thosani, A. J., Wang, P. and Wolkoff, A. W. (2011). Zollner, G. and Trauner, M. (2008). Mechanisms of cholestasis. Heterogeneous accumulation of luorescent bile acids in pri- Clin. Liver Dis. 12, 1–26. mary rat hepatocytes does not correlate with their homoge- Chapter 3

106 107 Dose-dependent accumulation of bile acids and involvement of compensatory mechanisms in cyclosporine A-treated HepaRG hepatocytes

Ahmad Sharanek1,2, Audrey Burban1,2, Lydie Humbert3, Pamela Bachour-El Azzi1,2, Neuza Felix- Gomes3, Dominique Rainteau3* and Andre Guillouzo1,2*

1INSERM U991, Foie, Métabolisme et Cancer Rennes, France. 2Université de Rennes 1, Rennes, France. 3ERL Inserm U1157/UMR7203, Faculté de Médecine Pierre et Marie Curie, Site Saint Antoine, Paris, France. *Senior co-authors Abstract Alteration of bile acid (BA) profiles and secretion by cholestatic drugs represents a major clinical issue. Species differences exist in BA composition, synthesis and regulation; however presently, there is no in vitro suitable cell model to perform studies on BAs in humans. We have evaluated the capacity of the human HepaRG cell line to produce BAs and analyzed changes in BA content and profiles after cyclosporine A (CsA) treatment. Our data show that HepaRG cells synthesized, conjugated and secreted normal BAs at daily levels comparable to those measured in primary human hepatocytes. A 4h treatment with CsA led to BA accumulation and profile changes associated with occurrence of cholestatic features, while after 24h BAs were decreased in cell layers and increased in media. The latter effects resulted from inhibition of uptake and synthesis of BAs and induction of alternative basolateral transporters. Noteworthy, HepaRG cells incubated in a 2% serum-supplemented medium showed dose-dependent accumulation of the cytotoxic BA lithocholic acid in a nonsulfoconjugated form associated with early inhibition of the canalicular transporter MRP2 and sulfotransferse 2A1. In summary, our data bring the first demonstration that an in vitro human liver cell model, the HepaRG cell line, is able to produce and secrete conjugated BAs, and to accumulate endogenous BAs transiently, concomitantly to occurrence of various other cholestatic features following CsA treatment. Retention of the hydrophobic lithocholic acid supports its toxic role in drug-induced cholestasis. Overall, our results highlight new insights in the mechanisms involved in the development of the disease.

108 Keywords: Cholestasis, primary bile acids, lithocholic acid, human hepatocytes, drug-induced liver injury. Abbreviations: BA, bile acids; CA, cholic acid; CDCA, chenodeoxycholic acid; CYP7A1, cytochrome P4507A1; CYP8B1,cytochrome P4508B1; CYP27A1, cytochrome P45027A1; BSEP, bile salt export pump; MRP2,3,4, multidrug resistance-associated protein 2, 3, 4; NTCP, Na+-taurocholate cotransporting polypeptide; OATPs, organic anion transporting polypeptides; PHH, primary human hepatocytes; CsA, cyclosporine A; HPLC-MS/MS, liquid chromatography-tandem mass spectrometry; MTT, methylthiazoletetrazolium; RT-qPCR, real-time quantitative polymerase chain reaction; [3H]–TA, [3H]-taurocholic acid; CDFDA, 5(6)-carboxy-2′ ,7′ - dichlorofluorescein diacetate; HFBS, Hyclone® fetal bovine serum; DCA; deoxycholic acid; LCA, lithocholic acid; UDCA, ursodeoxycholic acid; TCA, taurocholic acid; GCA, glycocholic acid; TCDCA, taurochenodeoxycholic acid; GCDCA, glycochenodeoxycholic acid; BAAT, bile acid-CoA:amino acid N-acyltransferase; SULT2A1, sulfotransferase 2A1.

109 Introduction Bile acids (BAs) are the major organic solutes of bile. These amphiphilic molecules are involved in many different physiological processes; in particular they facilitate the intestinal absorption of fat-soluble compounds such as lipophilic vitamins and dietary lipids. Under physiological conditions, 70% of the human BA pool is composed of cholic acid (CA) and CA metabolites while 30% are constituted by chenodeoxycholic acid (CDCA) (Kullak-Ublick et al. 2004). The liver is the only organ that possesses the 14 enzymes required for de novo synthesis of these two primary BAs in humans. BAs are synthesized from cholesterol by well-differentiated and polarized hepatocytes via the two pathways: the classic pathway which involves the cytochrome P450 enzymes CYP7A1, CYP8B1, and mitochondrial CYP27A1 (Cali and Russell 1991) and the alternative pathway which involves CYP7B1 and CYP39A1 and leads to the formation of around 30% of CDCA (Schwarz et al. 1997). Subsequently, BAs are conjugated with glycine and taurine, and may also be metabolized by different liver enzymes such as cytochrome P450s, glucuronosyl-and sulfo-transferases (Boyer 2013; Chiang 2009). BAs are excreted into bile canaliculi; in the human bile they are mostly conjugated with either glycine (75%) or taurine (25%). The most physiologically important canalicular bile transporter BSEP exports monovalent BAs and is responsible for bile salt-dependent flow whereas another canalicular transporter MRP2 secretes divalent bile salts, glutathione and its conjugates, generating therefore the major part of BA- independent bile flow (Stieger et al. 2007). An alternative efflux system represented by the two multidrug resistance-related proteins (MRP), MRP3 and MRP4, is localized to the basolateral membrane domain and provides an alternative excretory route for bile constituents when their canalicular excretion is impaired (Trauner and Boyer 2003). Around 95% of BA are recirculated through the so-called entero-hepatic circulation (Dawson et al. 2009). Basolateral transporters, Na+-taurocholate cotransporting polypeptide (NTCP) and organic anion transporting polypeptides (OATPs), are primarily responsible for active hepatic uptake of BAs from blood; physiological serum concentrations represent around 3-7µM (Scherer et al. 2009). Intracellular accumulation of potentially toxic endogenous BAs can lead to intra- hepatic cholestasis that represents around 40% of drug-induced injuries in humans

110 (Lee 2003). A major problem of drug-induced cholestasis is its dramatically low accurate prediction of risk; till now, up to 40% of drug-induced cholestatic cases remain unpredictable. Because of their various physiological roles and their involvement in pathological processes BAs have been subject to increasing growing interest during the last years. Their use as natural drugs or as the basis of novel semi-synthetic drugs is also encouraging. However, since species differences exist in BA composition, synthesis and regulation it is critical to verify results from animal data on a suitable human model (Chiang 2009). Human hepatocytes in primary culture have the capacity to synthesize the normal primary BAs, CA and CDCA, and to conjugate and secrete them into the medium. However, these cells are of more and more erratic access, have a limited life-span in vitro and exhibit large inter-donor variability in various functions, including BA production (Ellis and Nilsson 2010; Guguen-Guillouzo and Guillouzo 2010). Human liver cell lines have also been evaluated. The hepatoblastoma cell line HepG2 synthesizes some BAs, but the levels are low and they are defective in oxidation of the side chain, conjugation, and transport (Everson and Polokoff 1986). The rat hepatoma–human fibroblast hybrid cell line WIF-B9 lacks the ability to further conjugate primary BAs (Monte et al. 2001). Contrary to other human liver cell lines HepaRG cells derived from a cholangio-hepatocarcinoma express features of mature hepatocytes and are considered as a surrogate to primary human hepatocytes (PHH) (Aninat et al. 2006; Antherieu et al. 2010). They are highly polarized cells with specialized apical and sinusoidal domains, are able to transport BAs (Bachour-El Azzi et al. 2015), and exhibit typical cholestatic features in response to treatment with cholestatic drugs (Antherieu et al. 2013). However, the ability of these cells to synthesize and conjugate endogenous BAs has not been precisely investigated and no information exists regarding changes in endogenous BA profiles caused by cholestatic drugs. The aims of this study were to profile and characterize endogenous BA synthesis and to analyze dose-dependent changes in BA content induced by the cholestatic drug cyclosporine A (CsA). Our data show the HepaRG cells are able to produce and following CsA treatment to accumulate BAs.

111 Materials and Methods Reagents Cyclosporine A (CsA), methylthiazoletetrazolium (MTT), and 5(6)-carboxy-2′ ,7′ - dichlorofluorescein diacetate (CDF) were purchased from Sigma (St. Quentin Fallavier, France). [3H]-Taurocholic acid ([3H]-TA) was from Perkin Elmer (Boston, MA). Specific antibodies against CYP7A1 were provided by Boster Biological Technology (Abingdon, UK), CYP27A1 and CYP8B1 from GeneTex Inc. (Alton Pkwy, USA), SULT7A1 from Santa Cruz Biotechnology, Inc. (Dallas, U.S.A) and MRP3 from Abcam (Paris, France). Secondary antibodies were purchased from Invitrogen (Saint Aubin, France). Hoechst dye was from Promega (Madison, Wisconsin). Other chemicals were of reagent grade. Cell Cultures HepaRG cells were seeded at a density of 2.6 × 104 cells/cm2 in Williams’ E medium supplemented with 10% hyclone® fetal bovine serum (HFBS) (Thermo scientific), 100 IU/mL penicillin, 100 mg/mL streptomycin, 5 mg/mL insulin, 2 mM glutamine, and 50 mM hydrocortisone hemisuccinate. After 2 weeks, HepaRG cells were shifted to the same medium supplemented with 2% dimethyl sulfoxide (DMSO) for 2 more weeks in order to obtain confluent differentiated cultures with maximum functional activities. At this time, these cultures contained around the same number of hepatocyte-like and progenitors/primitive biliary-like cells (Cerec et al. 2007) and were ready to use. Primary human hepatocytes were obtained from Biopredic International (St Gregoire, France). They were isolated by collagenase perfusion of histologically normal liver fragments from two adult donors undergoing resection for primary or secondary tumors (Guguen-Guillouzo et al. 1982). Primary cultures were obtained by hepatocyte seeding at a density of 1.5 x 105 cells/cm2 onto collagen-precoated plates in Williams’ E medium supplemented with 10% HFBS, 100 units/µl penicillin, 100 µg/ml streptomycin, 1 µg/ml insulin, 2 mM glutamine, and 1 µg/ml bovine serum albumin. The medium was discarded 12h after cell seeding, and cultures were thereafter maintained in the same serum free- medium as for HepaRG cells. Supernatants were collected and media were renewed daily.

112 Measurement of endogenous bile acid content Both cells and media were collected from HepaRG cell cultures exposed to different serum concentrations for various time points. Similarly, samples from HepaRG cell cultures treated with CsA were also prepared. Before analysis, the samples were lyophilized, and then 1 ml of water was added to the dried samples, homogenized using a Polytron® homogenizer for 30 seconds and clarified by centrifugation at 20 000 × g for 20 minutes. The supernatant was collected and extracted using a SPE cartridge. High pressure liquid chromatography coupled with tandem mass spectrometry (HPLC–MS/MS) was used to measure bile acid (BA) content in the samples. The chromatographic separation of BAs was carried out on a Zorbax eclipse XDB-C18 (Agilent Technology, Garches, France) fitted on an Agilent 1100 HPLC system (Massy, France). The column was thermostated at 35 °C. The mobile phases consisted of (A) (ammonium acetate 15 mmol/l, pH 5.3) and (B) (methanol) at 65:35 (v/v). BAs were eluted by increasing B in A from 65 to 95 (v/v) for 30 minutes. Separation was achieved at a flow rate varying between 0.3 and 0.5 ml/min for 30 minutes. Mass spectra were obtained using an API® 2000 Q-Trap (AB-Sciex, Concord, Ontario, Canada) equipped with a TurboIon electrospray (ESI) interface set in the negative mode (needle voltage – 4500 V) with nitrogen as the nebulizer set at 40 (arbitrary pressure unit given by the equipment provider). Curtain and heater pressures were set at 20 and 40, respectively (arbitrary units) and the ion source temperature was set at 400 °C. Declustering and entrance potentials were set at −60 V and −10 V, respectively. The MS/MS detection was operated at unit/unit resolution. The acquisition dwell time for each transition monitored was 70 ms. Data were acquired by the Analyst® software (version 1.4.2, AB-Sciex) in the Multiple Reaction Monitoring (MRM) mode (Humbert et al. 2012). Real-Time Quantitative Polymerase Chain Reaction (RT-qPCR) Analysis Total RNA was extracted from 106 HepaRG cells with the SV total RNA isolation system (Promega). RNAs were reverse-transcribed into cDNA and RT-qPCR was performed using a SYBR Green mix. Primer sequences are listed in Supplementary Table 3. Immunolabeling Cells were washed with warm phosphate buffered saline (PBS), fixed with 4% paraformaldehyde for 20 minutes at 4°C and then washed three times with cold PBS.

113 After paraformaldehyde fixation, cells were permeabilized for 20 minutes with 0.3% Triton in PBS followed by 1-hour incubation in PBS containing 1% bovine serum albumin and 5% normal donkey serum. Cells were then incubated overnight with primary antibodies directed against CYP7A1, CYP27A1, CYP8B1 and MRP3, and washed with cold PBS before 2-hour incubation with mouse or rabbit Alexa fluor 488 labeled secondary antibodies in the same buffer as described above. After washing with cold PBS, cells were incubated with Hoechst in PBS for 20 minutes for nuclei labeling. Immunofluorescence images were detected by Cellomics ArrayScan VTI HCS Reader (Thermo Scientific, New Hampshire, U.S.A) (Bachour-El Azzi et al. 2015). Western blotting HepaRG cells and PHH were treated with 10 or 50 µM CsA for 24 or 48h, washed with cold PBS, and finally resuspended in cell lysis buffer and a protease inhibitor cocktail (Roche, Mannheim, Germany). Aliquots containing equivalent total protein content, as determined by the Bradford procedure with bovine serum albumin as the standard, were subjected to sodium dodecyl sulfate/12% polyacrylamide gel electrophoresis, electrotransferred to Immobilon-P membranes, and incubated overnight with primary antibodies directed against CYP7A1, CYP27A1 and CYP8B1. After using a horseradish peroxidase conjugated anti-mouse/rabbit antibody (ThermoFisher Scientific, Waltham, MA), membranes were incubated with a chemiluminescence reagent (Millipore, Billerica, U.S.A) and bands were visualized. CDF excretion After 2h of exposure to CsA either in serum-free medium or 2 % serum- supplemented medium cells were incubated for 20 minutes at 37°C with 3 μ M CDFDA, which is hydrolyzed by intracellular esterases to CDF, a substrate of multidrug resistance-associated protein 2 (MRP2). After washing, imaging was done using inverted microscope Zeiss Axiovert 200M and AxioCam MRm (Sharanek et al. 2014). Na+-dependent taurocholic cotransporting polypeptide activity Activity of the Na+-dependent taurocholic cotransporting polypeptide (NTCP) transporter was estimated through determination of sodium-dependent intracellular accumulation of the radio-labeled [3H]-TA substrate. After treatment with CsA in serum-free medium or 2 % serum-supplemented medium, cells were incubated with

114 43.3nM of radio-labeled TA for 30 minutes. Cells were then washed twice with standard buffer and lysed with 0.1 N NaOH. Accumulation of radiolabeled substrate was determined through scintillation counting (Antherieu et al. 2013). Statistical analysis One-way ANOVA with Bonferroni’s multiple comparison test (GraphPad Prism 6.00) was performed to compare data. Each value corresponded to the mean ± standard error of mean (SEM) of at least three independent experiments. Data were considered significantly different when p < 0.05.

Results Time-dependent BA production by HepaRG cells in serum-supplemented medium Previous studies on BA production by liver cells in vitro have frequently been carried out using a serum-supplemented medium. Since bovine serum contains BAs, we first analyzed their quantity and profiles in culture media before any incubation with the cells. BA profiles were determined in culture media supplemented with either 2% (S2) or 8% (S8) Hyclone® fetal bovine serum (HFBS) or without serum (S0) used as a control. While BAs were undetectable in S0 medium they reached 294±17 nM and 1247±108 nM in S2 and S8 media respectively. Since total and individual BA levels were around 4-fold higher in S8 than in S2 medium only the values found in S2 medium are described (Supplementary Figure 1). Both primary and secondary BAs were identified and found to represent 58 and 40% of total BAs, respectively. Chenodeoxycholic acid (CDCA) was the predominant primary BA; it formed 48% of total BAs (190±34 nM). Cholic acid (CA), the other primary BA, constituted 10% (21.9±4 nM). Deoxycholic acid (DCA) and its conjugates were the predominant secondary BA, reaching 34% of total BAs (159±30 nM) while lithocholic acid (LCA) represented 5% (16.8±3 nM). Ursodeoxycholic acid (UDCA) was barely detected, not exceeding 2%. About 70-80% BAs were conjugated; tauro-and glyco-conjugates were predominant and accounted for 40 and 32% of total BAs respectively. Sulfo- conjugates were undetectable (Supplementary Figure 1). In a series of experiments HepaRG cells were incubated in S2 medium for varying periods of time from 0 to 48h and BA content was analyzed in cell extracts (cells + bile canaliculi) and media (supernatants). BA content was first measured at T0

115 (differentiated HepaRG cultures at day 30) in cell extracts from HepaRG cells previously incubated in S8 medium and rapidly washed with PBS; they represented 40±3 pmoles/mg of proteins (Figure 1A). These intracellular BAs likely corresponded to both exogenous (bovine origin) and endogenous BAs (neosynthesis). Noticeably, total amounts of BAs [(cell layer + supernatant ≈ 3000 pmoles) (measured per well)] remained relatively unchanged between 0 and 48h of incubation in S2 medium (Figure 1A and B). Moreover, disposition of total BAs between cell layers and supernatants were also stable between 0 and 48h. HepaRG cell cultures (cells + bile canaliculi) retained a constant amount of BAs in the range ≈ 56±10 pmol/mg of proteins (Figure 1B) representing 5-13% of total BAs (cell layer + supernatant) between 0 and 48h in S2 cultures (Figure 1C). Even though total BA content in cells and medium did not change, important variations in BA profiles were evidenced with time in culture. Indeed, secondary BAs decreased gradually to 89±12 nM, 75±14 nM and traces in the medium after 2, 4, and 24h of incubation respectively compared to 179±33 nM in unexposed S2 medium (Figure 1D). This decrease was due to a rapid decrease in both DCA and LCA content (Figure 2E and F). In the cells only traces of bovine DCA and LCA representing 8±1 and 0.3±0.1 pmol/mg proteins respectively were observed after 2h, and these secondary BAs became undetectable after 4h of incubation (Figure 2E and F). In parallel, CA increased in the supernatant to 53.6±8, 63.6±14, 98.5±10 and 205±4 nM after 2, 4, 24, and 48h, respectively compared to 21.9±4 nM in non-incubated S2 medium (Figure 2A). Interestingly, the rate of CA synthesis, calculated after subtracting the amount initially present in the cells and unexposed media at T0, was high during the first 4h, reaching 39.6±10 and 26±9 pmol/106 hepatocytes/hour after 2 and 4h respectively whereas it decreased and became relatively stable after 24 and 48h, representing 7.9±1 and 9.5±0.2 pmoles/106 hepatocytes/hour respectively (Figure 2B). At T0 taurocholic acid (TCA) was undetectable in S2 medium and present in low amounts in the cells (15±1.3 pmol/ mg of proteins). A fast and gradual increase of TCA to 39±5, 88±6 and 149±5 nM occurred after 2, 24 and 48h, respectively. Glycocholic acid (GCA) was not detected in cell layers and only barely in unexposed S2 medium (1.7±0.6 nM), while it increased in supernatants to 10.6±4 and 52±4 nM after 24 and 48h, respectively (Figure 2C). No accumulation of TCA

116 and GCA was detected in cell layers, indicating a rapid clearance of these BAs after synthesis. CDCA was predominant at T0 in both media and cells reaching 190±34 nM and 29±9.5 pmol/mg of proteins, respectively; it did not show any significant quantitative change in either cell layers or supernatants between 0 and 48h (Figure 2D). The increase in CA with no change in CDCA reflected a gradual increase in the CA/CDCA ratio; i.e. 0.3, 0.4, 0.6 and 1.4 after 2, 4, 24 and 48h, respectively compared to a very low ratio (0.09) in non-exposed S2 medium (Figure 2E). Importantly, exogenous bovine BAs present in S2 medium underwent de novo tauro- and glyco-amidation after exposure to HepaRG cells. Indeed, 100% BAs was found to be conjugated after a 4h exposure to HepaRG cells compared to 72% of total BAs in non-exposed medium (Figure 2F). In addition, sulfo-conjugates which were not detectable in S2 medium before incubation became detectable after 4h of incubation.

Time-dependent BA production by HepaRG cells in serum-free medium To characterize their capacity to synthesize and conjugate BAs in the absence of serum, HepaRG cells were incubated in S0 medium for various periods of time from 0 to 72h without medium renewal, and BA content was analyzed in both cellular extracts and supernatants. Total BA amounts remained relatively unchanged in cell layers, representing 40±4.6 pmol/mg of proteins between 0 and 48h while it increased to 117±3 pmol/mg of proteins after 72h. Interestingly, BA content increased cumulatively in the medium reaching 54±8, 80±13, 106±20, 276±40, and 410±1.5 nM after 2, 4, 24, 48 and 72h, respectively, thereby reflecting the capacity of HepaRG cells to synthesize and secrete BAs (Figure 3A). Only primary BAs were identified. CA gradually increased in the medium from 28.5±3 nM after 2h to 150±1.2 nM after 72h (Figure 3B). CDCA increased to 25±8 nM after 2h and then remained relatively unchanged up to 24h. However, later on an important increase was observed, reaching 162±3 and 271±1.8 nM after 48 and 72h, respectively (Figure 3C). During the first 24h CA synthesis was slightly higher than CDCA with a CA/CDCA ratio =1.5. CA, CDCA and total BAs synthesis rates were calculated per 106 HepaRG hepatocytes per hour. CA synthesis rate was high after 2h (57±7 pmol/106 hepatocytes/hour) and started to decrease after 4h (42±5pmol/106 hepatocytes/hour) to become stable after 24, 48 and 72h at 9±2 pmol/106 hepatocytes/hour. Similarly

117 CDCA synthesis rate was high during the first 4h (42±13.7 pmol/106 hepatocytes/hour) and become relatively stable between 24, 48 and 72h (8±2.8, 13.5±0.2 and 15±1 pmol/106 hepatocytes/hour respectively) (Figure 3E). Interestingly, all the newly synthesized BAs were found in their conjugated form: TCA and GCA for CA and GCDCA and TCDCA for CDCA. The prominent form of CA was TCA (70-90% of total CA), while TCDCA and GCDCA were synthesized in equal percentages after the first 24h. Then, the latter was the prominent form (70-80% of total CDCA) after 48 and 72h (Figure 3D and F).

Comparative time-dependent BA production by HepaRG cells and primary human hepatocytes To analyze the synthetic capacity of BAs in HepaRG cells compared to PHH obtained from two donors; both cellular models were incubated in S0 medium. BA profiles were analyzed every 24h for 3-4 days and normalized per million hepatocytes. Three-fold differences were observed in total BAs produced by the two human hepatocyte populations, representing 167 and 456 pmol/106 PHH for donors 1 and 2 respectively at day 1 (Figure 4A). Interestingly, total BA production by HepaRG hepatocytes showed high inter-assay reproducibility and was in the same range as in PHH cultures with 316±32 pmoles/106 hepatocytes/day. No major variation in the amount of synthesized BAs/106 hepatocytes was then observed between days 1 and 3 or 4 of culture in the two models (Figure 4 A and B). However, some differences in BA profiles were observed. CDCA represented 65% versus 35% for CA in HepaRG cell cultures while, by contrast CA was the prominent BA produced by PHH representing 60-80% versus 20-40% for CDCA (Figure 4C and D). Moreover, tauro-and glyco-conjugates represented 80 and 20% of total BAs respectively in HepaRG cells at day 1, and became in equal proportion at day 3. In PHH tauro-conjugates that constituted 16% (donor 1) or 32% (donor 2) of total conjugates at day 1 were nearly undetectable at day 2; glyco-conjugates became paramount representing around 95% of the BA pool. Sulfo-conjugates did not exceed 5% (Figure 4E and F).

118 Effect of CsA on BA profiles in HepaRG cells BA profiles were also analyzed after treatment of HepaRG cells with 10 and 50 µM CsA for 4 and 24h in S0 and S2 media. Interestingly, a dose-dependent accumulation of total BAs in cell layers peaking at 44±3 and 98±15 pmol/mg of proteins was observed after 4h of treatment in S0 medium with 10 and 50 µM CsA respectively, compared to 10±1.8 pmol/mg of proteins in untreated HepaRG cells (Figure 5A). These BAs corresponded to a dose-dependent accumulation of conjugates of primary BAs, i.e 5.8- and 16-fold for TCA, 2.25- and 2.5-fold for TCDCA and 3.2- and 5.7-fold GCDCA after treatment with 10 and 50 µM CsA, respectively. A parallel dose-dependent decrease in these individual BAs was found in the medium. Importantly, total BA amounts (supernatant + cells) remained nearly unchanged whatever the concentration of CsA after 4h (Figure 5A). By contrast, intracellular BA accumulation was no longer observed after a 24h CsA treatment; even more a dose-dependent decrease of total BAs in cell layers and a parallel increase in the supernatants were found. Indeed, after 24h CsA at 50 µM caused a decrease in the total amount of BAs, particularly CA (TCA) and GCDA (TCDCA in media and GCDCA in cells), reflecting an inhibition of synthesis of these primary BAs by CsA at high concentration (Figure 5). We further looked for whether bovine serum affected BA profiles in CsA-treated HepaRG cells. Surprisingly, unlike in cultures incubated in S0 medium a 4h treatment did not cause BA intracellular accumulation in HepaRG cells cultured in S2 medium (Figure 6A). However, marked changes were evidenced after a 24h treatment; as in cultures incubated in S0 medium CsA caused a dose-dependent intracellular reduction and supernatant increase in total BA content. In addition, the proportion of primary/secondary BAs was modulated. At 50 µM CsA prevented decrease of secondary BAs and increase of primary BAs as observed in corresponding untreated cultures between 0 and 24h (Figure 6B). Similarly, as observed in S0 cultures, neosynthesis of CA was inhibited by a 24-hour treatment with 50 µM CsA (Figure 6C). Importantly, in 24-hour CsA-treated cells DCA accumulated in the medium, reaching 28±7.5 and 61±9 nM with 10 and 50 µM CsA, respectively compared to 16±4 nM in corresponding untreated cultures (Figure 6D). LCA was only found in its unsulfated form after CsA treatment and accumulated in cell layers after 4h (3±1.8 and 10±2 pmoles/mg of proteins), and after 24h (6.3±0.8 and 20±2.5 pmoles/mg of

119 proteins) with 10 and 50 µM of CsA treatment respectively compared to undetectable amount in untreated cells either at 4 or 24h (Figure 6E).

Effect of CsA on metabolism, conjugation and transport of BAs mRNA expression of genes responsible for BA synthesis by the classic (CYP7A1 and CYP8B1) and alternative (CYP27A1) pathways was investigated after treatment of HepaRG cells with 10 and 50 µM CsA for 4 and 24h using RT-qPCR analysis. While after 4h, CsA treatment had no significant effect on the expression of any of these enzymes, a 24-hour treatment with 50 µM CsA inhibited CYP7A1 and CYP27A1 expression by 62 and 63%, respectively and dramatically CYP8B1 expression by 96% (Supplementary Table 1). Western blotting showed that CsA induced a dose-dependent decrease in CYP7A1, CYP27A1 and CYP8B1 protein content in HepaRG cells, slightly after 24h and more intensely after 48h (Supplementary Figure 2). The two basolateral BA transporters, MRP3 and MRP4, were found to be deregulated after CsA treatment. At either concentration CsA treatment did not show any significant change in gene expression of MRP3 and MRP4 after 4h. However, after 24h, 10 and 50 µM CsA induced mRNA expression of MRP3 to 1.56±0.06- and 1. 9±0.13-fold, respectively, and MRP4 to 1.71±0.14- and 2.9±0.2-fold, respectively. Interestingly, immunolocalisation of MRP3 showed very intense labelling to the basolateral membrane of HepaRG cells after 4 and 24h treatment with 10 and 50 µM CsA compared to the low intensity in their untreated counterparts (Figure 7A). In addition, using CDFDA, MRP2 activity was analyzed after 10 and 50 µM CsA treatment in S0 and S2 media. Fluorescent CDF was visualized in bile canaliculi of untreated HepaRG cells. However, 10 and 50 µM CsA inhibited canalicular excretion of CDF as early as 30 minutes, in both S0 and S2 media (Figure 7B). Gene expression of the two phase II conjugating enzymes, bile acid-CoA:amino acid N-acyltransferase (BAAT) and sulfotransferase 2A1 (SULT2A1), was also analyzed. After 4h only 50 µM CsA significantly inhibited expression of BAAT and SULT2A1 by 36 and 31%, respectively (Supplementary Table1). A 24-hour treatment with 10 and 50 µM CsA decreased BAAT expression by 42 and 84%, and SULT2A1 by 34 and 39% respectively. Noticeably, none of these tested genes was expressed in primitive biliary-like HepaRG cells at either mRNA or protein levels (Figure 7C).

120 Cytotoxicity of bile acids in HepaRG cells To better estimate the potential toxicity of BAs in CsA-treated cultures, cytotoxicity of individual BAs was evaluated using the MTT assay in the presence or absence of 10 or 50 µM CsA. A 24-hour treatment with CA elicited no toxicity at up to 1 mM either alone or combined with 10 or 50 µM CsA. Similarly, no toxicity was observed with LCA up to 100 µM in untreated cultures, while when added with CsA at 10 and 50 µM, LCA at 50 µM become highly cytotoxic causing 34 and 60% cell death respectively. DCA was less toxic than LCA causing 27% cell death only at 400 µM; however, it caused 50 and 68% cell death when added with 10 and 50 µM CsA respectively (Figure 8).

Discussion Drug-induced intrahepatic cholestasis is characterized by intracellular hepatic accumulation of endogenous BAs which can cause toxicity through their detergent effects on cellular membranes, mitochondrial dysfunction, and ultimately cellular apoptosis or necrosis (Pauli-Magnus et al. 2005). Up to now, investigations on BA metabolism and homeostasis disturbances in humans have been hampered by the lack of a reproducible and easy to use in vitro human cell model. Furthermore, in vitro intracellular accumulation of endogenous BAs following treatment with cholestatic drugs has not been demonstrated. In the current study we show that the human HepaRG cell line synthesizes normal conjugated BAs and that intracellular accumulation of BAs can be demonstrated following treatment with the cholestatic drug CsA. Contrary to HepG2 and other cell lines, PHH produce and excrete normal primary BAs but with a large up to 12-fold inter-donor variability (Axelson et al. 2000; Ellis and Nilsson 2010). In agreement, a 3-fold variation was found between the two human hepatocyte populations used in the present study. We demonstrate that HepaRG cells have a similar capacity to produce BA as PHH with a high inter-assay reproducibility. Total BA production and profiles can greatly vary with experimental culture conditions. Previous studies have frequently been performed using either serum- supplemented or serum-free medium following previous incubation of liver cells in

121 serum-supplemented medium. Although bovine serum is known to contain both primary and secondary BAs little information exists on their possible contamination of intracellular and medium pools of BAs and their influence on BA neo-synthesis by liver cells after several hours of incubation. Our data showed that secondary BAs were detectable in HepaRG cell layers during the first hours and longer in the supernatants but become only barely detectable after 24h, supporting our observation that no secondary BAs were identified in cultures incubated in serum- free medium when they were prepared from cells previously maintained for 48h in serum supplemented medium. Our data support and explain previous reports showing the presence of LCA or unidentified BAs in liver cell cultures incubated in serum-supplemented media (Axelson et al. 1991; Hoekstra et al. 2013). Differences in synthesis of individual BAs was observed in HepaRG cells incubated in serum-supplemented and serum-free medium. While both primary BAs CA and CDCA were found to be synthesized by HepaRG cells incubated in serum-free medium, only CA was increased in serum-supplemented medium; the lack of increase in CDCA could be explained by a feedback inhibition of its synthesis in the presence of high exogenous bovine CDCA. In support, CDCA was previously reported to be the strongest inhibitor of BA synthesis in PHH cultures (Ellis et al. 2003; Liu et al. 2014). Moreover, different time-dependent kinetics in total BA production was observed in HepaRG cells. While BA release in the medium was high during the first 4h after medium renewal, it showed a lower and stable rate of synthesis between 24 and 72h. Whether such a transient enhanced production of BAs during the first 4h resulted from the absence of BAs in the medium after its renewal, and consequently an absence of feedback regulation deserves further investigation. The continuous BA production during a 72h period following daily medium renewal supported in vitro maintenance of BA homeostasis and agreed with previous observations showing that differentiated HepaRG hepatocytes remain functionally relatively stable for many days at confluence (Josse et al. 2008). A similar observation was made with conventional primary hepatocytes. By contrast, a continuous time-dependent increase with PHH has been reported by other authors (Ellis et al. 1998). These discrepancies could be at least partly explained by the use of different experimental conditions. Indeed, it has been shown that addition of

122 dexamethasone and the composition of the substratum can greatly influence the levels of BA production as well as the CA/CDCA ratio in PHH cultures. Noteworthy, the CA/CDCA ratio has been shown to vary from 1 to 0.2 (Ellis and Nilsson 2010). Like PHH, HepaRG cells were found to conjugate BAs with taurine and glycine. However, while glyco-conjugates increased from 80 to 95% between days 1 and 2 they did not exceed 50% in HepaRG cells. The higher percentage of tauro- conjugates in these latter could be explained by their tumor origin and proliferative potential in vitro. Indeed, if HepaRG cells express 81 to 92% of the genes active in PHH they also express an additional set of around 2900 genes usually expressed in cancerous and stem cells or related to the cell cycle (Rogue et al. 2012). Daily production of BAs in the human liver is estimated to be around 0.35 mg/g liver, corresponding to about 6000 pmoles/106 hepatocytes. Calculation of in vitro BA daily production led to 316 pmoles/106 hepatocytes and 167 (donor 1) or 456 (donor 2) pmol/106 PHH in HepaRG and PHH cultures, respectively, indicating that BA production in human liver is around 13-36-fold higher than in hepatocyte cultures. Our data are in agreement with previous work on PHH; where about 220 and 1150 pmoles/106 hepatocytes were produced daily during the first 2 days and after 4 days, respectively (Ellis et al. 1998). This demonstrated that cells maintained in vitro retained an active BA synthesis capacity. To our best knowledge no study has reported yet intracellular accumulation of endogenous BAs in PHH cultures following treatment with a cholestatic drug. Indeed, no obvious change in total BAs was observed in PHH cultures after 24h treatment with either CsA (Einarsson et al. 2000) or troglitazone (Marion et al. 2012). Recently, we reported occurrence of cholestatic features typified by early inhibition of efflux (BSEP) and uptake (NTCP) transporters associated with disruption of pericanalicular cytoskeletal F-actin distribution and constriction of bile canaliculi structures within a 4h treatment with chlorpromazine (Antherieu et al. 2013) and CsA (Sharanek et al. 2014). Our present data clearly demonstrate that CsA cholestatic effects were associated with a dose-dependent intracellular accumulation of BAs when CsA- treated HepaRG cells were incubated in serum-free medium. However, we found that intracellular accumulation of endogenous BAs was no longer evidenced after 24h; even more a decrease in cell layers and parallel increase in the supernatant were observed. These major changes could have several nonexclusive

123 explanations: first, CsA inhibited efflux and uptake of BAs (Sharanek et al. 2014); second, CsA is known as an inhibitor of BA synthesis by repressing transcription of the key genes involved in the first steps of BA synthesis, e.g. CYP7A1 and CYP27A1 (Axelson et al. 2000; Princen et al. 1991); accordingly, our data show that these two last genes as well as others such as BAAT and SULT2A1 involved in conjugation activity, were strongly inhibited after a 24-hour CsA treatment; third, the basolateral transporters MRP3 and MRP4 were increased supporting their role in BA excretion and therefore, their compensatory activity to supply canalicular transporters as previously suggested (Wagner et al. 2009; Zollner et al. 2006a). Importantly, despite occurrence of all other cholestatic features total BAs did not accumulate in CsA-treated HepaRG cell cultures incubated in serum-supplemented medium, suggesting a fast induction of compensatory mechanisms in the presence of exogenous bovine BAs that could limit intracellular increase of BAs after CsA addition. Several non-exclusive arguments support such hypothesis. First, CsA- induced constriction of bile canaliculi occurred around 1.5h earlier in serum- supplemented than in serum-free cultures. Second, MRP3 was found to be highly localized to the basolateral membrane in the presence of serum compared to cultures deprived of serum (not shown). Third, inhibition of NTCP activity after CsA treatment occurred faster than in serum-free medium (Supplementary Figure 3). Fourth, endogenous BA synthesis was likely inhibited by exogenous BAs present in serum-supplemented cultures. Altogether, these observations support a lower BA accumulation in CsA-treated HepaRG cell cultures in serum-supplemented medium. Noteworthy, a dose-dependent accumulation of LCA present in S2 medium was demonstrated in cell layers after 4 and 24h of incubation with CsA. LCA is normally sulfoconjugated before secretion in bile canaliculi by MRP2 (Hofmann 2004). In all likelihood, rapid inhibition of MRP2 and constriction of bile canaliculi, as well as inhibition of SULT2A1 and sulfate esterification of LCA by CsA combined with the fact that LCA is a poor substrate for the basolateral transporters explained its intracellular accumulation in HepaRG cells treated with CsA, especially at 50 µM. Since, LCA was the most hepatotoxic BA and that CsA strongly aggravated its toxicity one might postulate that CsA-induced cholestasis and cytotoxicity could be, at least partly, mediated by LCA accumulation into liver cells. Noticeably, serum LCA was found to be dramatically elevated in cyclosporine-treated patients with hepatitis

124 (Myara et al. 1996) and in intrahepatic cholestasis of pregnancy (Lucangioli et al. 2009) supporting the clinical relevance of our in vitro findings. In summary, we demonstrated for the first time that a cholestatic drug could induce in vitro intracellular accumulation of BAs in human hepatocytes and that after a single treatment this effect was transient. Although CsA inhibited BA uptake and canalicular efflux as well as BA synthesis the cells remained able to evacuate accumulated intracellular BAs via their basolateral transporters. Moreover, our data favor the conclusion that HepaRG cells represent a unique reproducible cell model to analyze regulation of BAs and mechanisms involved in BA accumulation with cholestatic drugs after short and repeated treatments.

Acknowledgments This work was supported by the European Community [Contracts Predict-IV-202222 and MIP-DILI-115336]. The MIP-DILI project has received support from the Innovative Medicines Initiative Joint Undertaking, resources of which are composed of financial contribution from the European Union’s Seventh Framework Programme [FP7/20072013] and EFPIA companies’ in kind contribution. http://www.imi.europa.eu/. Ahmad Sharanek was financially supported from the Lebanese Association for Scientific Research (LASeR) and the MIP-DILI project and Audrey Burban by the MIP-DILI project.

125 References

Aninat, C., Piton, A., Glaise, D., Le Charpentier, T., Langouet, S., Morel, F., Guguen- Guillouzo, C., and Guillouzo, A. (2006). Expression of cytochromes P450, conjugating enzymes and nuclear receptors in human hepatoma HepaRG cells. Drug Metab Dispos 34(1), 75-83, 10.1124/dmd.105.006759.

Antherieu, S., Bachour-El Azzi, P., Dumont, J., Abdel-Razzak, Z., Guguen-Guillouzo, C., Fromenty, B., Robin, M. A., and Guillouzo, A. (2013). Oxidative stress plays a major role in chlorpromazine-induced cholestasis in human HepaRG cells. Hepatology 57(4), 1518-1529, 10.1002/hep.26160.

Antherieu, S., Chesne, C., Li, R., Camus, S., Lahoz, A., Picazo, L., Turpeinen, M., Tolonen, A., Uusitalo, J., Guguen-Guillouzo, C., and Guillouzo, A. (2010). Stable expression, activity, and inducibility of cytochromes P450 in differentiated HepaRG cells. Drug Metab Dispos 38(3), 516-525, 10.1124/dmd.109.030197.

Axelson, M., Ellis, E., Mork, B., Garmark, K., Abrahamsson, A., Bjorkhem, I., Ericzon, B. G., and Einarsson, C. (2000). Bile acid synthesis in cultured human hepatocytes: support for an alternative biosynthetic pathway to cholic acid. Hepatology 31(6), 1305-1312, 10.1053/jhep.2000.7877.

Axelson, M., Mork, B., and Everson, G. T. (1991). Bile acid synthesis in cultured human hepatoblastoma cells. J Biol Chem 266(27), 17770-17777.

Bachour-El Azzi, P., Sharanek, A., Burban, A., Li, R., Le Guevel, R., Abdel-Razzak, Z., Stieger, B., Guguen-Guillouzo, C., and Guillouzo, A. (2015). Comparative localization and functional activity of the main hepatobiliary transporters in HepaRG cells and primary human hepatocytes. Toxicol Sci, 10.1093/toxsci/kfv041.

Boyer, J. L. (2013). Bile formation and secretion. Compr Physiol 3(3), 1035-1078, 10.1002/cphy.c120027.

126 Cali, J. J., and Russell, D. W. (1991). Characterization of human sterol 27- hydroxylase. A mitochondrial cytochrome P-450 that catalyzes multiple oxidation reaction in bile acid biosynthesis. J Biol Chem 266(12), 7774-7778.

Cerec, V., Glaise, D., Garnier, D., Morosan, S., Turlin, B., Drenou, B., Gripon, P., Kremsdorf, D., Guguen-Guillouzo, C., and Corlu, A. (2007). Transdifferentiation of hepatocyte-like cells from the human hepatoma HepaRG cell line through bipotent progenitor. Hepatology 45(4), 957-967, 10.1002/hep.21536.

Chiang, J. Y. (2009). Bile acids: regulation of synthesis. J Lipid Res 50(10), 1955- 1966, 10.1194/jlr.R900010-JLR200.

Dawson, P. A., Lan, T., and Rao, A. (2009). Bile acid transporters. J Lipid Res 50(12), 2340-2357, 10.1194/jlr.R900012-JLR200.

Einarsson, C., Ellis, E., Abrahamsson, A., Ericzon, B. G., Bjorkhem, I., and Axelson, M. (2000). Bile acid formation in primary human hepatocytes. World J Gastroenterol 6(4), 522-525.

Ellis, E., Axelson, M., Abrahamsson, A., Eggertsen, G., Thorne, A., Nowak, G., Ericzon, B. G., Bjorkhem, I., and Einarsson, C. (2003). Feedback regulation of bile acid synthesis in primary human hepatocytes: evidence that CDCA is the strongest inhibitor. Hepatology 38(4), 930-938, 10.1053/jhep.2003.50394.

Ellis, E., Goodwin, B., Abrahamsson, A., Liddle, C., Mode, A., Rudling, M., Bjorkhem, I., and Einarsson, C. (1998). Bile acid synthesis in primary cultures of rat and human hepatocytes. Hepatology 27(2), 615-620, 10.1002/hep.510270241.

Ellis, E. C., and Nilsson, L. M. (2010). The use of human hepatocytes to investigate bile acid synthesis. Methods Mol Biol 640, 417-430, 10.1007/978-1-60761- 688-7_22.

Everson, G. T., and Polokoff, M. A. (1986). HepG2. A human hepatoblastoma cell line exhibiting defects in bile acid synthesis and conjugation. J Biol Chem 261(5), 2197-2201.

127 Guguen-Guillouzo, C., Campion, J. P., Brissot, P., Glaise, D., Launois, B., Bourel, M., and Guillouzo, A. (1982). High yield preparation of isolated human adult hepatocytes by enzymatic perfusion of the liver. Cell Biol Int Rep 6(6), 625- 628.

Guguen-Guillouzo, C., and Guillouzo, A. (2010). General review on in vitro hepatocyte models and their applications. Methods Mol Biol 640, 1-40, 10.1007/978-1-60761-688-7_1.

Hoekstra, R., Nibourg, G. A., van der Hoeven, T. V., Plomer, G., Seppen, J., Ackermans, M. T., Camus, S., Kulik, W., van Gulik, T. M., Elferink, R. P., and Chamuleau, R. A. (2013). Phase 1 and phase 2 drug metabolism and bile acid production of HepaRG cells in a bioartificial liver in absence of dimethyl sulfoxide. Drug Metab Dispos 41(3), 562-567, 10.1124/dmd.112.049098.

Hofmann, A. F. (2004). Detoxification of lithocholic acid, a toxic bile acid: relevance to drug hepatotoxicity. Drug Metab Rev 36(3-4), 703-722, 10.1081/DMR- 200033475.

Humbert, L., Maubert, M. A., Wolf, C., Duboc, H., Mahe, M., Farabos, D., Seksik, P., Mallet, J. M., Trugnan, G., Masliah, J., and Rainteau, D. (2012). Bile acid profiling in human biological samples: comparison of extraction procedures and application to normal and cholestatic patients. J Chromatogr B Analyt Technol Biomed Life Sci 899, 135-145, 10.1016/j.jchromb.2012.05.015.

Josse, R., Aninat, C., Glaise, D., Dumont, J., Fessard, V., Morel, F., Poul, J. M., Guguen-Guillouzo, C., and Guillouzo, A. (2008). Long-term functional stability of human HepaRG hepatocytes and use for chronic toxicity and genotoxicity studies. Drug Metab Dispos 36(6), 1111-1118, 10.1124/dmd.107.019901.

Kullak-Ublick, G. A., Stieger, B., and Meier, P. J. (2004). Enterohepatic bile salt transporters in normal physiology and liver disease. Gastroenterology 126(1), 322-342.

128 Lee, W. M. (2003). Drug-induced hepatotoxicity. N Engl J Med 349(5), 474-485, 10.1056/NEJMra021844.

Liu, J., Lu, H., Lu, Y. F., Lei, X., Cui, J. Y., Ellis, E., Strom, S. C., and Klaassen, C. D. (2014). Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures. Toxicol Sci 141(2), 538-546, 10.1093/toxsci/kfu151.

Lucangioli, S. E., Castano, G., Contin, M. D., and Tripodi, V. P. (2009). Lithocholic acid as a biomarker of intrahepatic cholestasis of pregnancy during ursodeoxycholic acid treatment. Ann Clin Biochem 46(Pt 1), 44-49, 10.1258/acb.2008.008130.

Marion, T. L., Perry, C. H., St Claire, R. L., 3rd, and Brouwer, K. L. (2012). Endogenous bile acid disposition in rat and human sandwich-cultured hepatocytes. Toxicol Appl Pharmacol 261(1), 1-9, 10.1016/j.taap.2012.02.002.

Monte, M. J., Badia, M. D., Serrano, M. A., Sacristan, M. P., Cassio, D., and Marin, J. J. (2001). Predominance of human versus rat phenotype in the metabolic pathways for bile acid synthesis by hybrid WIF-B9 cells. Biochim Biophys Acta 1534(1), 45-55.

Myara, A., Cadranel, J. F., Dorent, R., Lunel, F., Bouvier, E., Gerhardt, M., Bernard, B., Ghoussoub, J. J., Cabrol, A., Gandjbakhch, I., Opolon, P., and Trivin, F. (1996). Cyclosporin A-mediated cholestasis in patients with chronic hepatitis after heart transplantation. Eur J Gastroenterol Hepatol 8(3), 267-271.

Pauli-Magnus, C., Stieger, B., Meier, Y., Kullak-Ublick, G. A., and Meier, P. J. (2005). Enterohepatic transport of bile salts and genetics of cholestasis. J Hepatol 43(2), 342-357, 10.1016/j.jhep.2005.03.017.

Princen, H. M., Meijer, P., Wolthers, B. G., Vonk, R. J., and Kuipers, F. (1991). Cyclosporin A blocks bile acid synthesis in cultured hepatocytes by specific inhibition of chenodeoxycholic acid synthesis. Biochem J 275 ( Pt 2), 501-505.

129 Rogue, A., Lambert, C., Spire, C., Claude, N., and Guillouzo, A. (2012). Interindividual variability in gene expression profiles in human hepatocytes and comparison with HepaRG cells. Drug Metab Dispos 40(1), 151-158, 10.1124/dmd.111.042028.

Scherer, M., Gnewuch, C., Schmitz, G., and Liebisch, G. (2009). Rapid quantification of bile acids and their conjugates in serum by liquid chromatography-tandem mass spectrometry. J Chromatogr B Analyt Technol Biomed Life Sci 877(30), 3920-3925, 10.1016/j.jchromb.2009.09.038.

Schwarz, M., Lund, E. G., Lathe, R., Bjorkhem, I., and Russell, D. W. (1997). Identification and characterization of a mouse oxysterol 7alpha-hydroxylase cDNA. J Biol Chem 272(38), 23995-24001.

Sharanek, A., Azzi, P. B., Al-Attrache, H., Savary, C. C., Humbert, L., Rainteau, D., Guguen-Guillouzo, C., and Guillouzo, A. (2014). Different dose-dependent mechanisms are involved in early cyclosporine a-induced cholestatic effects in hepaRG cells. Toxicol Sci 141(1), 244-253, 10.1093/toxsci/kfu122.

Stieger, B., Meier, Y., and Meier, P. J. (2007). The bile salt export pump. Pflugers Arch 453(5), 611-620, 10.1007/s00424-006-0152-8.

Trauner, M., and Boyer, J. L. (2003). Bile salt transporters: molecular characterization, function, and regulation. Physiol Rev 83(2), 633-671, 10.1152/physrev.00027.2002.

Wagner, M., Zollner, G., and Trauner, M. (2009). New molecular insights into the mechanisms of cholestasis. J Hepatol 51(3), 565-580, 10.1016/j.jhep.2009.05.012.

Zollner, G., Marschall, H. U., Wagner, M., and Trauner, M. (2006). Role of nuclear receptors in the adaptive response to bile acids and cholestasis: pathogenetic and therapeutic considerations. Mol Pharm 3(3), 231-251, 10.1021/mp060010s.

130 Figure 1: BA production and profiles in HepaRG cell cultures incubated in 2% bovine serum-supplemented medium between 0-48 hours without medium renewal. A) Total BAs per well in supernatants and cell layers B) BA disposition between cells (pmol/mg of proteins) and supernatants (nM). C) Percentages of distribution of total BAs between cells and supernatants. D) Secondary BAs, E) Lithocholic acid (LCA), and F) Deoxycholic acid (DCA). Data are expressed as pmol/mg of proteins (cell layers) or nM (supernatants). Values represent the mean ± SEM of duplicate or triplicate measurements in 3 independent experiments. *p < 0.05 compared to the values at time=0 (T0).

Figure 2: BA production and profiles in HepaRG cell cultures incubated in 2% bovine serum-supplemented medium between 0-48 hours without medium renewal. A) CA production in cells and supernatants. B) CA synthesis rate calculated as pmoles/106 hepatocytes/hour. C) TCA and GCA production in cells and supernatants. D) CDCA content in cells and supernatants. E) CA/CDCA ratios between 0 and 48 hours. F) Percentages of total conjugated BAs. Values represent the mean ± SEM of duplicate or triplicate measurements in 3 independent experiments. *p < 0.05 compared to the value at time 0 (T0).

Figure 3: BA production and profiles in HepaRG cell cultures incubated in serum-free medium between 0-72 hours without medium renewal. A) Total BA production. B) CA production. C) CDCA production. D) Total BAs, CA and CDCA synthesis rates calculated as pmoles/106 hepatocytes/hour. E) TCA and GCA production. F) TCDCA and GCDCA production. Data are expressed as pmol/mg of proteins (cell layers) or nM (supernatants). Values represent the mean ± SEM of duplicate or triplicate measurements in 3 independent experiments. *p < 0.05 compared to the value at time 0 (T0) in media. #p < 0.05 compared to the value at time 0 (T0) in cells.

131 Figure 4: Comparison of total BA production and profiles in HepaRG cell and PHH cultures in serum-free medium with daily medium renewal. Total BA synthesis rate in A) PHH from two donors and B) HepaRG cells. Percentages of CA and CDCA in C) PHH and D) HepaRG cells. Percentages of tauro-, glyco-, and sulfo-conjugates in E) PHH and F) HepaRG cells. Total BA synthesis rates are calculated as pmoles/106 hepatocytes/day. Values represent the mean ± SEM of duplicate or triplicate measurements in 3 experiments in HepaRG cells. For PHH values from the two donors are presented separately. *p < 0.05 compared to the value at day 1 of HepaRG cell cultures.

Figure 5: Cyclosporine A (CsA) effects on total BA disposition and profiles in HepaRG cell cultures incubated in serum-free medium. BAs were measured in medium (nM) and cells (pmol/mg of proteins) from cultures treated with 10 or 50μ M CsA for 4 and 24 hours and in corresponding untreated HepaRG cells and represented in A) Total BAs, B) TCA, C) GCA, D) GCDCA and E) TCDCA. Data were normalized relative to the amount of proteins in each condition. Values represent the sum of mean ± SEM of duplicate measurements in 3 independent experiments, *p < 0.05 compared with values in supernatant of untreated cultures, #p < 0.05 compared to the values in cell layer of untreated cultures.

Figure 6: CsA effects on total BA disposition and profiles in HepaRG cells incubated in 2% bovine serum-supplemented medium. BAs were measured in medium (nM) and cells (pmol/mg of proteins) from cultures treated with 10 or 50μ M CsA for 4 and 24 hours and in corresponding untreated HepaRG cells and represented in A) Total BAs, B) Total secondary BAs, C) CA, D) DCA and E) LCA. Data were normalized relative to the amount of proteins in each condition. Values represent the sum of means ± SEM of duplicate measurements in 3 independent experiments, *p < 0.05 compared with values in supernatant of untreated cultures, #p < 0.05 compared to the values in cell layer of untreated cultures.

132 Figure 7: Effects of CsA on MRP3 immunolabeling and MRP2 activity in HepaRG cell cultures. A) Representative immunofluorescence images of MRP3 localization in control and 10 and 50 µM CsA-treated HepaRG cells, for 4 and 24 hours. B) HepaRG cells were treated with 10 or 50 µM CsA in S2 media for 30 and 60 minutes. MRP2 activity was estimated using CDF. C) Distribution of main BA metabolizing enzymes in HepaRG cells. Differentiated HepaRG cells were fixed and incubated with primary antibodies against SULT2A1, CYP7A1, CYP27A1 and CYP8B1. Labeling is restricted to HepaRG hepatocytes; no labeling is visible in the primitive biliary-like cell population. Nuclei were labeled using Hoechst dye. Immunofluorescence images were obtained with a Cellomics ArrayScan VTI HCS Reader (ThermoScientific).

Figure 8: Cytotoxicity evaluation of individual bile acids in CsA-treated HepaRG cells. Cells were incubated with different concentrations of individual BAs combined or not with 10 or 50 µM CsA for 24 hours; (A) CA, (B) DCA, and (C) LCA. Cytotoxicity was measured by the MTT colorimetric assay. Data represent the mean ± SEM of three independent experiments. All results are expressed relative to the levels found in untreated cells, arbitrarily set at 100%. * p <0.05, compared with non-treated cells, # p < 0.05 compared with cells treated with BAs and CsA individually.

Supplementary Figure 1: Exogenous bovine BA content and profiles in culture media before incubation with cells. A) Concentration of BAs in culture media supplemented with either 2% (S2) or 8% (S8) Hyclone® bovine serum or without serum (S0) used as control before any incubation with cells. B) Percentage of primary and secondary BAs in Hyclone® bovine serum. C) and D) Quantity and percentage of individual BAs in 2% serum- supplemented media (CA, CDCA, LCA, DCA). E) Percentages of tauro- and glyco- conjugated and unconjugated BAs in serum-supplemented media. Values represent the mean ± SEM of duplicate or triplicate measurements in 3 independent experiments.

133 Supplementary Figure 2: Effects of CsA on protein levels of BA metabolizing enzymes in HepaRG cell and PHH cultures Representative western blots of CYP7A1, CYP27A1, CYP8B1 and SULT2A1 after treatment with 10 and 50 µM CsA of HepaRG cells for 24 and 48 hours or PHH for 48 hours. HSC70 was used as a loading control.

Supplementary Figure 3: Effects of CsA on NTCP activity in the presence or absence of Hyclone® bovine serum. HepaRG cells were treated with 10 or 50 µM CsA in either serum-free (S0) or serum supplemented (S2) media at different time points (0–120 minutes) and then incubated with [3H]-Taurocholic acid ([3H]-TA) for 30 minutes. NTCP activity was evaluated by measurement of intracellular accumulation of [3H]–TA. Data represent the mean ± SEM of 3 independent experiments. Results are expressed relative to the levels found in untreated cells (either in S0 or S2 medium), arbitrarily set at 100%.*p < 0.05 compared with untreated cells in either S0 or S2 medium as control cells, #p < 0.05 significant difference between S0 and S2 medium.

134 135 136 137 138 l l l M M o M 0 ntro 0 0 1 o 5 ontrol ontr 1 Contro A C A 10 M A C C A SA 50 M Cs CSA 50 M Cs CS CsA 10 M CSA 50 M Cs C GCA accumulation GCDCA accumulation

l rol ro M 0 M 0 5 Cont Cont A 5 Control Control sA 10 M CsA 10 M CSA 50 M C CS CsA 10 M CSA 50 M CsA 10 M CSA TCDCA accumulation

l o ol M M tr r n 0 o 50 C Cont A S CsA 10 M CSA 50 M CsA 1 C

139 Figure 6 A B Supernatant (nM) Cells (pmol/mg proteins) Supernatant (nM) Cells (pmol/mg proteins) 400 100

* 80 300

60 200 * 40 Total BAs 100 # 20 # # 0 0 l l l o M M o o tr n 0 M 0 ntr ntr o 1 10 M o 50 M o C Control A C A 10 M A C A 10 M sA SA 50 s s C CSA 5 Cs C C CS C CSA 50 M 4 hours 24 hours 4 hours 24 hours

C D 100 Supernatant (nM) Cells (pmol/mg proteins)

80 *

60

40 *

CA accumulation 20 DCA accumulation

0 l l l o M o tro tr 0 M 0 M n 0 M 10 M 50 1 Con Contr A Control Co A 1 A 50 M sA 10 M S CsA CSA 50 M C CS CsA CSA 5 Cs C 4 hours 24 hours

E F CDCA accumulation Unsulfated LCA accumulation l M ol o rol trol r tr nt 0 n 50 M 0 M n 0 M Co A 5 Co A Cont A 5 Co A 1 S sA 10 M S s CsA 10 M C CsA 10 M CS C C C CSA 50 M

140 141 142 Supplementary Figure 1

A B BAs (%) Total BAs (nM) Primary and secondary

C D

60

40

20 Individual BAs (%) Individual BAs (nM) 0 CDCA CA DCA LCA

Primary BAs Secondary BAs

E Conjugated BAs (%)

143 Supplementary figure 2

144 Supplementary Table 1. Effects of CsA on expression of mRNAs encoding genes related to hepatobiliary transporters and bile acid metabolizing enzymes in HepaRG cells after 4 and 24 hours exposure.

4 hours 24 hours

CsA 10 µM CsA 50 µM CsA 10 µM CsA 50 µM

BAAT 0.87 ± 0.12 0.64 ± 0.06* 0.58 ± 0.19* 0.162 ± 0.05*

SULT2A1 0.88 ± 0.31 0.69 ± 0.09* 0.66 ± 0.02* 0.61 ± 0.08*

CYP7A1 0.9 ± 0.07 0.88 ± 0.02 0.91± 0.15 0.38 ± 0.18*

CYP8B1 0.98 ± 0.14 1.28 ± 0.45 0.65 ± 0.11* 0.04 ± 0.005*

CYP27A1 1.14 ± 0.20 0.75 ± 0.09* 0.87 ± 0.12 0.37 ± 0.1*

MRP3 1.25 ± 0.15 1.15 ± 0.08 1.56 ± 0.06* 1.9 ± 0.13*

MRP4 1.11 ± 0.21 1.13 ± 0.03 1.71 ± 0.14* 2.9 ± 0.19* Data represent the means ± SEM of three independent experiments. All results are expressed relative to the levels found in untreated cells, arbitrarily set at a value of 1. *p<0.05 compared with non-treated cells.

Supplementary Table 2: Primers sequences for RT-qPCR analysis.

Gene Name Forward Primer Reverse Primer

BAAT bile acid-amino acid transferase AGCCAGTGCATATCCGAGCT TTCATCTTCCAGTGATGCCTGA

CYP27A1 cytochrome P450 27A1 GGCCCTAAGTAGGACATCCA AGCTGCGCTTCTTCTTTCAG

CYP7A1 cytochrome P450 7A1 CTGTGGCAAACACTATTCCAACTA TTGACCTGTTGACTGCAGCAA

CYP8B1 cytochrome P450 8B1 TGGAGAAAGCTGGCAAAGTT TGGTTCCCCTTTGACTTCAC

MRP3 multidrug resistance-associated protein 3 GTCCGCAGAATGGACTTGAT TCACCACTTGGGGATCATTT

MRP4 multidrug resistance-associated protein 4 GCTCAGGTTGCCTATGTGCT CGGTTACATTTCCTCCTCCA SULT2A1 sulfotransferase 2A1 GAGAACAGATAAAGACTGTGTGG AGGGGTCATCTGAGCTTGCG

145 Chapter 4

146 147 The Rho-kinase pathway plays a key role in bile canaliculi deformation and bile acid impairment induced by cholestatic drugs

A. Sharanek 1*, A. Burban1*, Burbank M1, R. Le Guevel2, Ruoya LI3, A. Guillouzo 1 and C. Guguen-Guillouzo† 1, 3 1Inserm UMR 991, Rennes 1 University, France, 2ImPACcell, Rennes 1 University 2ImPACcell platform, Biosit, Rennes1 University, France 3Biopredic International, St Grégoire, France. * Both authors contributed equally to this work

Running title: Bile canaliculi deformation implicates Rho-kinase pathway

Corresponding author: †to whom correspondence should be addressed. Inserm UMR 991, Université de Rennes 1, Faculté de Pharmacie, F-35043 Rennes cedex, France. Tel.: (33).2.23.23.53.51; [email protected](C. Guguen-Guillouzo).

Abbreviations BC, bile canaliculi; CPZ chlorpromazine; CsA cyclosporine A; DCA, deoxycholic acid; ROCK, Rho kinase; DILI, drug-induced liver injuries; BSEP, bile salt export pump; MLC,myosin-light-chain-phosphatase; BDL bile ductular ligation; ERM, Ezrin-Radixin- Moesin complex; ANIT, 1α -naphthyl isothiocyanate; CDFDA, 6 -carboxy-2,7- dichlorofluorescein diacetate; UDCA-NBD, Ursodeoxycholyl-lysyl-NBD; [3H]-TA, [3H]- Taurocholic acid); P-gP, P-glycoprotein; HH, human hepatocytes; CCHH, conventional cultured human hepatocytes; SCHH, sandwich cultured human hepatocytes; S-BC, saccular bile canaliculi; T-BC, tubular lumen;TCA, taurocholic acid; MLCK, myosin light chain kinase; BA, bile acid.

148 Abstract The physiology of bile excretion and the mechanisms of drug-induced cholestasis remain poorly understood. In this work, using time-lapse microscopy, we firstly described the rhythmic dynamics of bile canaliculi (BCs) in differentiated HepaRG cells and primary human hepatocytes. In both cell models, this dynamic process was accompanied by repeated unidirectional opening and closing of BCs which appeared to be essential for clearance of bile acids. Then, we examined the effects of a set of compounds i.e chlorpromazine (CPZ), cyclosporine A (CsA), bosentan, and deoxycholic acid (DCA) on: i) morphology and dynamics of BCs, ii) bile efflux and clearance and iii) cytoskeleton disorganization-associated signalling pathways. Our results allowed distinguishing for the first time between two types of drug-induced in vitro: one typical to CsA and CPZ and characterized by constriction of BCs, and the other typical to bosentan ANIT as well as fasudil, and DCA, and characterized by dilatation of BCs. Interestingly, despite these opposite morphological effects, a common disruption in the rhythmic dynamics of BC was observed with all compounds. These alterations were associated with impairment of trafficking and efflux of bile acids as shown by abnormal intracellular accumulation of radio-labelled taurocholic acid, fluorescent ursodeoxycholic acid, and 5(6)-carboxy-2′ ,7′ - dichlorofluorescein diacetate, except with fasudil where accumulation was observed in saccular lumens. To further analyse the molecular mechanisms underlying such cytoskeleton disorganization and cholestatic features we investigated the implication of the Rho-kinase (ROCK) pathway. Our data provided several evidences for hierarchical events: i) modulation of ROCK activity, either induction with CPZ and CsA or inhibition with fasudil, bosentan, ANIT and DCA; ii) followed by increase of myosin light chain-2 phosphorylation with CPZ and CsA or decrease with fasudil, bosentan and DCA, correlating with lumen constriction and dilatation respectively ; iii) and ending with alteration of acto-myosin contractile signal transmission to the canalicular membrane via disruption of the ezrin/radixin/moesin complex accompanied with perturbation of the localization of canalicular transporters such as MRP2 and P-gP. This current study highlights deeper insights in the mechanisms implicated in the disruption of bile acid secretion during cholestasis and tool up several biomarkers that could be of great help to better predict cholestatic drugs.

149 Introduction Intrahepatic cholestasis represents a frequent manifestation of drug-induced liver injuries (DILIs) in humans. It is assumed that DILIs are responsible for more than 50% of acute fulminant hepatic failure cases (Padda et al. 2011). Around 40% of DILIs lead to intrahepatic cholestatic diseases. Mortality rate in patients is estimated to represent 7.8% of cases in some reported studies although it can be lower (2.5%) in groups of patients with mixed hepatocellular and cholestatic dysfunctions (Bjornsson and Jonasson 2013). However, the main problem with cholestasis is that its accurate prediction of risk is dramatically low. Till now, up to 40% of drug-induced cholestatic cases remain unpredictable. The frequent reported causal mechanism of the cholestatic disease has been connected to alteration of the hepatobiliary transporter system, in particular the bile salt export pump (BSEP, or ABCB11), which is the most physiologically important canalicular bile transporter (Stieger 2010). Bile acid (BA) transport and secretion can also be impaired by inhibition of their uptake and efflux across the sinusoidal membrane. If many cholestatic drugs are known to inhibit BSEP several others are ineffective (Welch et al. 2015). Therefore, the very low prediction rate of the disease suggests that drug-adverse effects leading to cholestasis should have to be linked to other prior intracellular events involving one or more signalling pathway(s) that remain to be identified. Membrane transporter efficiency, intracellular trafficking and efflux dynamics are necessarily inter-dependent in the biliary function. Control mechanisms supporting coordination of these events are complex and include trafficking factors, cytoskeleton and junctional complexes formation and disruption (Bryant and Mostov 2008; Rodriguez-Boulan et al. 2005; Rodriguez-Boulan and Salas 1989; Wakabayashi et al. 2005). All of them converge to create dynamic movements supporting efflux of bile salts up to the canalicular lumen and clearance up to bile ductules. Rab proteins and Rho GTPases play a critical role in the actin distribution for cytoskeleton organization and cell motility (Wakabayashi et al. 2005). The RhoA/ROCK pathway has a major role in vasocontraction and regulation of vascular tone (Nossaman and Kadowitz 2009). Activation of the RhoA/ROCK pathway is also essential for contraction of vascular smooth muscle (Lee et al. 2004). The first step of this pathway involves contractile agonists through G protein coupled vasopressor

150 receptors. Then, these receptors activate the small monomeric GTPase RhoA which itself activates ROCK; subsequently, this enzyme inhibits myosin-light-chain- phosphatase (MLC-phosphatase), resulting in enhanced phosphorylation of MLCs and contraction. RhoA/ROCK mediates regulation of the intrahepatic vascular tone in human cirrhotic liver and in rats with bile ductular ligation (Zhou et al. 2006) but a direct contribution of the Rho pathway to intrahepatic bile canaliculi disorders has never been demonstrated. Herein, we hypothesize that the ROCK signalling pathway may play a critical role in cholestasis through occurrence of canalicular dynamic and bile salt trafficking disorders. Moreover, transmission of the actomyosin-dependent signal to bile canaliculi membranes for conditioning opening and closing dynamic of the bile canalicular lumen, involves a complex of small proteins located beneath the biliary membrane named ERM and consisting of three closely related proteins, Ezrin, Radixin, and Moesin (Sato et al. 1992; Tsukita and Tsukita 1989). ERM proteins crosslink actin filaments directly to various cell-adhesion molecules (Tsukita et al. 1994; Yonemura et al. 1998) or indirectly to membrane transporters (Reczek et al. 1997) and these crosslinking activities are regulated by the Rho protein (Hirao et al. 1996). ERM proteins are thought to be essential for cell motility, cortical actin organization, cell adhesion and proliferation in general, but our knowledge of their role in bile canaliculi dynamics is still poorly understood (Bretscher et al. 2000; Mangeat et al. 1999; Tsukita and Yonemura 1999). Highlighting mechanisms supporting adverse outcome pathway(s) as responsible for intrahepatic cholestasis is crucial. However, experimental attempts require cell models reproducing conditions mimicking morphogenesis and functional dynamics of bile canalicular vesicles as in vivo normal human hepatocytes. A major difficulty is the lack of a cell culture system that exhibits the canalicular network structure defining hepatocyte architecture. Primary human hepatocyte cultures represent the gold standard model. Particularly, collagen sandwich cultures of primary hepatocytes form a multicellular canalicular network composed of non-dividing cells, as seen in vivo (Decaens et al. 2008; LeCluyse et al. 1994), and maintain this functional organization for about 2 weeks (Dunn et al. 1989; Musat et al. 1993). However, the limited availability of fresh human hepatocytes had led to use human liver cell lines. Previous studies used WIFB9 or HepG2 cells, but these cells form only small

151 canalicular spheres between adjacent cells rather than canalicular networks that are characteristic of hepatocytes within the liver (Gallin 1997; Wakabayashi et al. 2005). In addition, HepG2 cells express only few functions of mature hepatocyte detoxification metabolism, including transport function (activity). In contrast, differentiated human HepaRG cells that express phases 1 and 2 drug metabolizing enzymes and transporters, and form functional bile canaliculi, were successfully used to mimic features of intrahepatic cholestasis induced by CPZ and CsA treatment and to characterize mechanisms involved in the initiation of lesions. An oxidative stress and bile canaliculi constriction were mainly evidenced (Antherieu et al. 2013; Sharanek et al. 2014). In this work, we set out experimental conditions for inducing cholestasis in HepaRG cells in order to investigate whether a critical role is played by the ROCK and myosin II pathway in cytoskeleton rearrangement and apical deformations induced by cholestatic agents. Our data strongly argue for a direct contribution of this pathway in controlling apical membrane polarity of hepatocytes, repeated constriction/relaxation movements of apical bile canaliculi lumen and their alteration by cholestatic compounds.

Materials and Methods Reagents Cyclosporine A (CsA), chlorpromazine (CPZ), deoxycholic acid (DCA), 2,3-Butanedione monoxime, 1α -naphthyl isothiocyanate (ANIT) and 5(6)-carboxy-2,7-dichlorofluorescein diacetate (CDFDA) were purchased from Sigma (St. Quentin Fallavier, France). Ursodeoxycholyl-lysyl-NBD (UDCA-NBD) (gift from Pr A. F. Hoffmann, San Diego); Fasudil (HA-1077) was purchased from BPS Bioscience (Le Perray En Yvelines, France). Bosentan was obtained from Sequoia Research Products (Pangbourne,U.K). Phalloidin fluoprobe was purchased from Interchim (Montluçon, France). [3H]-Taurocholic acid ([3H]-TA) was from Perkin Elmer (Boston, MA). Specific antibodies against phospho MLC2, total MLC2 and phospho ERM were purchased from Cell Signaling Technology (Schuttersveld, Netherlands). Anti P-Glycoprotein antibodies (P-gP) were obtained from Calbiochem (Saint Aubin, France). Anti-ZO-1 antibody was obtained from BD Biosciences (Le Pont de Claix France). Anti-Rab11a and anti-MRP2 antibodies were from Abcam (Cambridge, UK). Secondary antibodies were purchased from Invitrogen

152 (Saint Aubin, France). Hoechst dye was from Promega (Madison, Wisconsin). Other chemicals were of reagent grade. Cell cultures and treatments HepaRG cells were seeded at a density of 2.6×104 cells/cm2 in Williams’ E medium supplemented with 10% fetal bovine serum, 100 U/mL penicillin, 100 mg/mL streptomycin, 5 mg/mL insulin, 2 mM glutamine, and 50 mM hydrocortisone hemisuccinate. After 2 weeks, HepaRG cells were shifted to the same medium supplemented with 1.7 % dimethyl sulfoxide for 2 additional weeks in order to obtain confluent differentiated cultures. At that time, cultures contained equal proportions of hepatocyte-like and progenitors/primitive biliary-like cells (Cerec et al. 2007). Human hepatocytes (HH) were obtained from Biopredic International (St Gregoire, France). They were isolated by collagenase perfusion of histologically normal liver fragments from 8 adult donors undergoing resection for primary and secondary tumors (Guguen-Guillouzo et al. 1982). Primary cultures were obtained by hepatocyte seeding at a density of 1.5 x 105 cells/cm2 onto collagen-precoated plates in Williams’ E medium supplemented with 10% Hyclone fetal bovine serum, 100 units/µl penicillin, 100 µg/ml streptomycin, 1 µg/ml insulin, 2 mM glutamine, and 1 µg/ml bovine serum albumin. The medium was discarded 12h after cell seeding, and cultures were thereafter either maintained in the same medium as for HepaRG cells and designated as conventional cultured HH (CCHH), or after 24 to 48h washed with cold medium and overlaid with matrigel at a concentration of 0.25 mg/mL in ice-cold Williams’ E medium for the preparation of sandwich cultured HH (SCHH). The medium of both CCHH and SCHH was renewed every day. CCHH and SCHH were prepared from the same donors and analysed in parallel. SCHH cultures were used after at least 3 day-matrigel overlay. Both HepaRG cells and primary human hepatocytes were exposed to 6 compounds; the 3 well known cholestatic drugs, CPZ, CsA and bosentan; α –naphtyl isothiocyanate (ANIT), an hepatotoxicant largely used in rodents to model human intrahepatic cholestasis; fasudil, a ROCK inhibitor used in combination with bosentan for the treament of pulmonary arterial hypertension and the secondary BA, deoxycholate (DCA). Previous study DCA infusion in rats resulted in canalicular membrane structural alterations accompanied by reduced excretory function of the liver (Barnwell et al. 1987). In addition, previous cytotoxicity studies of DCA had evidenced alteration of BC structures in HepaRG cells (Sharanek et al., unpublished data). Non cytotoxic concentrations of each

153 compound were used; they were obtained from preliminary cytotoxicity experiments using the MTT assay (Supplementary data). Immunolabeling Cells were washed with warm phosphate buffered saline (PBS), fixed with either methanol for 15 min at -20°C or with 4% paraformaldehyde for 20 min at 4°C and then washed three times with cold PBS. After paraformaldehyde fixation, cells were permeabilized for 20 min with 0.3% Triton in PBS followed by 1h incubation in PBS containing 1% bovine serum albumin and 5% normal donkey serum. Cells were then incubated overnight with primary antibodies directed against P-gP, MRP2, ZO-1, Rab11a and P-ERM diluted in PBS containing 1% bovine serum albumin and 5% normal donkey serum. After washing with cold PBS cells were incubated for 2h with mouse- or rabbit Alexa fluor 647 labeled secondary antibodies. Finally, cells were again washed with cold PBS and incubated with Hoechst dye and phalloidin in PBS for 20 min for F-actin and nuclei labeling respectively. Immunofluorescence images were detected by Cellomics ArrayScan VTI HCS Reader (Thermo Scientific, New Hampshire, USA). F-actin distribution After cell fixation as described above, cytoskeletal F-actin was localized using phalloidin fluoprobe SR101 (200 U/ml) diluted at 1/100 for 20 min as described previously (Pernelle et al. 2011). Nuclei were labeled with 5 ng/ml Hoechst dye in parallel to F-actin labeling. Western blot analysis of MLC2 phosphorylation HepaRG cells were treated with the 6 compounds, washed with cold PBS, and finally resuspended in cell lysis buffer supplemented with protease and phosphatase inhibitors (Roche, Mannheim, Germany). Aliquots containing equivalent total protein content, as determined by the Bradford procedure with bovine serum albumin as the standard, were subjected to sodium dodecyl sulfate/12% polyacrylamide gel electrophoresis, electrotransferred to Immobilon-P membranes, and incubated overnight with primary antibodies directed against p-MLC2 and total MLC2. After using a horseradish peroxidase conjugated anti-mouse/rabbit antibody (ThermoFisher Scientific, Waltham, MA), membranes were incubated with a chemiluminescence reagent (Millipore, Billerica, U.S.A) and bands were visualized and quantified by densitometry with Fusion-Capt software (Vilber Lourmat, Fusion FX7, France).

154 CDF excretion Cells were washed with warm Williams’ E medium without phenol red, then incubated in 3 μ M CDFDA for 30 min at 37°C in Williams’ E medium without phenol red. Upon hydrolysis of CDFDA by intracellular esterases, CDF is secreted into bile canaliculi by membrane transporters, particularly MRP2 (Zamek-Gliszczynski et al. 2003). After washing, cells were treated with the 6 compounds for various time points and imaging was performed by Cellomics ArrayScan VTI HCS Reader (Thermo Scientific, New Hampshire, USA). Ursodeoxycholyl-lysyl-NBD (UDCA-NBD) excretion Cells were washed with warm Williams’ E medium without phenol red, and then incubated in 5 μ M Ursodeoxycholyl-lysyl-NBD (UDCA-NBD) for 30 min at 37°C in Williams’ E medium without phenol red. UDCA-NBD is secreted into bile canaliculi by membrane transporters, mainly BSEP (Wang et al. 2013). After washing, cells were treated with the 6 compounds for various time points and imaging was performed using inverted microscope Zeiss Axiovert 200M and AxioCam MRm. Accumulation of taurocholate acid Cells were first exposed to 43.3nM [3H]-TA for 30 min to induce its intracellular accumulation, then washed with standard buffer and incubated with the 6 compounds for 2h in a standard buffer with Ca2+ and Mg2+. After the incubation time, cells were washed and scraped in 0.1 N NaOH and the remaining radiolabeled substrate was measured through scintillation counting to determinate [3H]-TA accumulation. In a series of experiments, cells were treated first with tested compounds and then exposed to [3H]-TA for 30 min to induce its intracellular accumulation. To eliminate the influence of the treatments on the uptake of [3H]-TA, an uptake control was taken at T0 (after the 30 min exposure to [3H]-TA) for each treatment condition. Time-lapse imaging Phase-contrast images of HepaRG cells and CCHH were captured each minute, using time-lapse phase-contrast videomicroscopy. The inverted microscope Zeiss Axiovert 200M was equipped with a thermostatic chamber (37°C and 5% CO2) to maintain the cells under normal culture conditions. Images were captured by AxioCam MRm camera with a 20x objective. The contraction activity was quantified by the software Video analysis and modeling tool Tracker 4.87. ROCK activity

155 ROCK activity was measured with the Rho-associated kinase (ROCK) activity assay Kit (MILLIPORE) according to the manufacturer with some modifications. Briefly, HepaRG cells were treated with the tested compounds. After 1h, cells were lysed with a lysis buffer supplemented with anti-protease, and then 50 µL of the lysate was deposited in 96-well multistrip plate pre-coated with MYPT1 supplied with 10 mM

DTT, 2 mM MgCl2 and 10 mM ATP for 60 min at 30 ºC. An anti-phospho- MYPT1(Thr696) antibody was added for 1h, then goat anti-rabbit IgG HRP secondary antibody was added for another 1h followed by addition of chromogenic substrate tetra-methylbenzidine (TMB) for 15 min. Reading the absorbance signal at 450 nm reflected the relative amount of ROCK activity in the sample. ROCK activity was evaluated relative to the amount of total proteins content of each sample. Statistical analysis One-way ANOVA with Bonferroni’s multiple comparison test (GraphPad Prism 6.00) was performed to compare data. Each value corresponded to the mean ± standard error (SEM) of at least three independent experiments. Data were considered significantly different when p < 0.05.

Results HepaRG cell polarity and dynamics of canalicular poles The relevance of HepaRG cells as a model of liver polarized phenotype was established by showing the organization of BC polarity using phase-contrast imaging and phalloidin fluoprobe labeling of cytoskeletal F-actin. Phase-contrast imaging showed that HepaRG cells, like CCHH, exhibits large biliary pockets (Saccular lumen: S-BC) that were branched to a smaller ductule (tubular lumen; T-BC), generally at one extremity. However, SCHH exhibited mostly ductules in a tubular form (T-BC) that configured a network of connections (Figure 1A). Accumulation of F-actin fibers forming a ring around BC and a sparse network of microfilaments beneath basolateral plasma membrane domains defined the shape and polarity of HepaRG hepatocytes and CCHH, while a network of more elongated BCs was observed in SCHH (Figure 1B). Canalicular transporters, e.g. and P-gP MRP2, were co-localized with cytoskeletal F- actin and displayed correct distribution on the canalicular membranes (Figure 1C and D).The integrity of BC as a closed compartment delimited by tight junctions at its extremities was visualized by electron microscopy (Figure 1G) as well as

156 immunolocalization of the ZO-1 junctional protein (Figure 1E). Accumulation of 5(6)- carboxy-2,7-dichlorofluorescein diacetate (CDFDA, a MRP2 substrate, into bile canalicular lumen confirmed not only the integrity, but also the trafficking activity up to canalicular poles (Figure 1F). These characteristics were similar as those observed in 4- 5 days CCHH and SCHH. Using time-lapse microscopy, BCs of HepaRG cells revealed spontaneous rhythmic motility characterized by repeated opening and closing cycles; a dynamic process accompanied by expelling of a bolus of bile from S-BC through T-BC. Contraction intervals were analyzed over a 4h period (Figure 1H; video in supplementary data, S1). A cycle of contraction/relaxation of S-BC with duration of 90-100 min was observed. Indeed, the saccular lumen of individual BCs gradually contracted to a certain size (mean of 10 µM) and then swelled up to a mean size of around 20 µM before starting to contract again (Figure 1I). Interestingly, during this cycle of S-BC, a series of unidirectional rhythmic openings (spikes, each lasts about 10 min) separated by short closings (20-30 min) were detected at the connection between S-BC and T-BC. Each spike allowed dynamic evacuation of products from S-BC into T-BC leading to reduction of S-BC lumen (Figure 1H). Comparison with normal CCHH showed similar rhythmic movements although with spikes of lower amplitude (Figure1H and J). Noteworthy, due to the tubular nature of BC (T-BC) and lack of S-BC in SCHH, T-BCs underwent very slow contraction/relaxation cycles with no clear spikes contrary to what observed in HepaRG cells and CCHH (not shown).

Dysfunction of BC dynamic movements caused by tested compounds Since BC motility appeared to be critical for bile flow, we hypothesized a relationship should exist between cholestatic insult and dysfunction in BC contractility. We examined 4 compounds known to induce cholestasis by various mechanisms (CPZ, CsA, bosentan and ANIT) as well as fasudil and DCA. Early after exposure to the three cell models (HepaRG cells, CCHH and SCHH) the 6 compounds caused deformation of most BC structures (Figure 2A). Indeed, phase-contrast imaging showed that exposure of the three cell models to 50 µM CPZ or 50 µM CsA resulted in gradual constriction of BCs while exposure to the other 4 compounds i.e 50 µM fasudil, 50 µM ANIT, 200 µM DCA and 100 µM bosentan, resulted in spectacular

157 dilatation of BCs. BC deformations were confirmed by phalloidin staining of pericanalicular F-actin (Figure 2A). Because morphological changes could be associated with disorganized biliary polarity structures, the major junctional protein ZO-1 was immunolocalized in both control and treated cells. Since this protein was regularly localized around the BC lumen; its distribution was used for measuring BC volumes by imaging analysis (Figure 2B). We further analyzed the rhythm of spikes occurrence in the presence of these different compounds by using time-lapse cinephotomicrography performed over a 4h period onto BC from 3 independent experiments (Figure 3, video Supplementary data S2). Representative contraction/relaxation dynamics in CPZ- and fasudil-treated cells over a 4h period are displayed in figures 3A and 3B. Treatment of HepaRG cells with CPZ or fasudil led to a static state of BC characterized by total disappearance of the spikes, loss of connection between S-BC and T-BC, and permanent constriction of S- BC with CPZ (Figure 3A and C), and oppositely strong dilatation with fasudil, which gradually formed huge inert cisternae (Figure 3B and D).

Alteration of bile flow as a consequence of contractile/relaxation dynamic disorders Cholestasis is defined as bile secretory failure. In order to get evidence that contractile dynamic disorders had serious consequences for bile flow activity in HepaRG cells treated with the tested compounds we used two labeled BAs, radiolabelled taurocholic acid ([3H]-TA) and the fluorescent ursodeoxycholate derivative (UDCA-NBD) as well as CDFDA. Strong inhibition of [3H]-TA clearance and accumulation in cell layers was observed after a 2h exposure to CPZ and CsA as well as to fasudil, bosentan and DCA compared to control counterparts. Importantly, no accumulation was detected after ANIT treatment (Figure 4A). In addition, exposure of control and treated cells with UDCA-NBD allowed detecting outcome effects of the compounds on BA addressing and efflux to the canalicular lumen. After 30 min incubation, fluorescent UDCA was found in S-BC and in small adjacent tubular canaliculi, T-BC, in control cells while it could not be detected in constricted BCs in CPZ- and CsA-treated cells. By contrast, it accumulated in S-BC cisternae of fasudil-treated cells but not in large cisternae induced by bosentan, ANIT

158 and DCA which were devoid of fluorescent labeling. Similar observation was made with CDF efflux (Figure 4E). Even though, efflux of CDF into BCs was observed in fasudil-treated cells, interestingly a delay in the clearance from BC was evidenced compared to un-treated cells. Indeed, 2.7- fold higher of CDF-positive BC was observed in 4h fasudil-treated than control cells (Figure 4E and F). These results showed a major failure in bile flow and correlated with abnormal morphology of BCs and loss of their dynamic movements induced by the cholestatic compounds. Feedback regulation processes are known to occur when BAs accumulated into the cells leading to modifying trafficking signaling (Wagner et al. 2009). Experiments were designed in order to evaluate the capacity of control and treated cells to react to increasing concentrations of taurocholic acid (TCA) for a 30 min exposure period by measuring both influx and efflux transport activities. Figure 4B showed a dose- dependent decrease of [3H]-TA uptake by HepaRG cells when these cells were pre- loaded by increasing concentrations of unlabeled TCA (from 0.1 to 200 µM) for 30 min, suggesting a negative feedback control of influx at the basolateral membrane. Then we analyzed the effect of TCA loading on efflux capacity in HepaRG cells, using pulse-chase analysis of radiolabeled [3H]-TA. TCA loading was found to drastically increase the frequency of contractions of BCs compared to unloaded cells (not shown). In parallel to increased dynamics of BCs, TCA loading increased clearance of [3H]-TA in a dose-dependent manner (Figure 4C). Noteworthy, treatment with the two drugs, CPZ or fasudil, prevented TCA-induced increase in [3H]-TA efflux (Figure 4D). This result emphasized occurrence of alterations in dynamic trafficking with cholestatic compounds and provided evidence that these drug-induced alterations were able to overcome TCA-dependent feedback control effects.

Drug-induced bile flow failure is associated with modulation of the ROCK/ Myosin II ATPase pathway ROCK has pleiotropic functions, mainly in the regulation of cellular contraction, motility, morphology and polarity. We examined possible link between disorders of BC dynamics induced by the tested compounds and the ROCK pathway. ROCK activity was determined in control and treated HepaRG cells (Figure 5A). Both CPZ and CsA were found to induce ROCK activity at doses that caused constriction of BCs and modulation of the cytoskeleton. At lower concentrations CPZ and CsA

159 modulated neither ROCK activity, nor BC motility. By contrast, fasudil which induced strong dilatation of BCs, were found to inhibit ROCK activity while no inhibition was observed with ANIT, bosentan and DCA. The motor protein Myosin II is predominant in the pericanalicular region, and myosin light chain subunit-2 (MLC2), the regulatory subunit of myosin II, is known as a target of ROCK while its phosphorylation at serine-19 results in increased myosin ATPAse activity (Watanabe et al. 2007). We therefore, postulated that modulation of ROCK activity by the tested compounds could be followed by alteration of MLC2 phosphorylation and end to disorganisation of BC contractility. Sequential analysis of MLC2 phosphorylation in control cells showed alternates of regular phases of phosphorylation and dephosphorylation of MLC2 every 30 min (Figure 5D). In contrast, CPZ (50 µM) and CsA (50 µM) induced permanent phosphorylation of MLC2 within 30 min while the direct ROCK inhibitor fasudil permanently inhibited phosphorylation of MLC2 (Figure 5C and D). Interestingly, bosentan and DCA which induced dilatation of BCs, without inhibiting ROCK activity, was found to inhbit MLC2 phosphorylation. No significant inhbition of MLC2 phosphorylation was observed with ANIT (Figure 5C). Then, different chemicals known to interfere at distinct steps of the ROCK pathway axis, were used to further investigate the role of ROCK and MLC pathway onto BC activity. Treatment with the myosin heavy chain ATPase inhibitor BDM (10mM), downstream of ROCK and MLC2, clearly reproduced ANIT effects by inducing dilatation and decrease in dynamics of BCs without inhibiting ROCK activity and MLC2 phosphorylation. Since the ROCK and myosin light chain kinase (MLCK) share MLC2 as a common substrate we also checked whether MLCK participated to morphological changes of BC lumens. In the presence of ML9 (20 µM) a specific inhibtor of MLCK dilatation of BCs, but to a lesser extent than with fasudil, was observed indicating an implication of MLCK in controling BC dynamics, where it interacted with the ROCK pathway at the level of MLC2 regulation (not shwon).

160 Abnormal ROCK/MLC2 pathway activity is associated with ERM disorganisation Ezrin/radixin/moesin (ERM) is a major substrate of ROCK that was previously shown to link cytoskeletal actin to the plasma membrane. We examined whether ERM phosphorylation and localization was affected by the ROCK-dependent alteration of BC dynamics initiated by the tested compounds. In untreated HepaRG cells ERM was imunolocalized to the apical pericanalicular domain; it co-localized with F-actin and the canalicular transporters P-gP and MRP2 (Figure 5E). In contrast, the tested compounds induced differential effects on ERM localisation: ROCK activators such as CPZ and CsA, induced a remarkable decrease in apical localisation of ERM while fasudil had no effect on its localization and phosphorylation; lower labelling at the canalicular domain was detected with DCA, bosentan and ANIT. Because Rab11 was previously described to control localization of apical BA transporters, we also performed its localization after treatment with the 6 molecules. In control cells, Rab11 was localized to a subapical compartment, whereas in cells treated with all the compounds its canalicular localization was altered. Rab11-containing intracytoplasmic endosomes were observed (Figure 5E).

Discussion BSEP is the major canalicular bile acid transporter and plays an important role in biliary clearance of numerous BAs. Many authors have attempted to predict drug- induced cholestasis based on direct BSEP inhibition (Dawson et al. 2012; Morgan et al. 2010; Pedersen et al. 2013; Warner et al. 2012). Unfortunately, this approach has revealed to be poorly predictive, it failed to prognosticate the main targets responsible for the disease, and was restricted only to screening compounds which can compete with BAs for transport across the canalicular membrane, thus causing bile secretory failure (Dawson et al. 2012; Morgan et al. 2010). In the current work, we have taken advantage of the metabolically competent human HepaRG cells and primary human hepatocytes to demonstrate that drug-induced cholestasis was associated with deformation of BCs and failure in their motility. If drug-induced cholestasis was reported before to be associated with BC constriction in HepaRG cells (Antherieu et al. 2013; Bachour-El Azzi et al. 2014; Sharanek et al. 2014) and rat couplets (Roman and Coleman 1994), the present study demonstrated for the first

161 time that it could be also associated with dilatation of BCs with some cholestatic drugs. It also provided for the first time strong evidence for a critical role of the ROCK and myosin II pathway in cytoskeleton rearrangement and in disorders of apical lumen activity induced by cholestatic agents. As reported in liver in vivo (Wood 1965), both biliary saccular lumen and tubular canaliculi structures were formed in cultured hepatocyte monolayers used in this work, the first ones occurring at the bifurcations in the bile canalicular structures mainly in HepaRG cells whereas tubular canaliculi were more frequent in primary hepatocytes maintained in sandwich conditions. Moreover, accumulation of F-actin fibers and specific localization of transporters and of junctional proteins were all contributing to qualify these characteristic polarized bile canalicular structures formed in these in vitro systems (Bachour-El Azzi et al. 2015; Fu et al. 2010). Biliary secretion is a complex process involving several steps that include translocation of BAs across the basolateral membrane, trafficking through cytoplasm and transport across the canalicular membrane, then efflux out of the canalicular lumen. Motility of BCs mainly demonstrated in isolated hepatocyte couplets (Oda et al. 1974; Oshio and Phillips 1981; Phillips et al. 1975) has been reported to play a role in bile flow in rat hepatocytes in vitro and in vivo (Watanabe et al. 1991b). Herein, using time-lapse microscopy on organized human hepatocyte monolayers, we succeeded characterizing contractions of human BCs which appeared to be associated with repeatedly opening and closing dynamic processes and we evidenced unidirectional expelling of what we may expect to be bile bolus, from saccular lumen (S-BC) to a proximal small canaliculi (T-BC). These contractions were found to be spontaneous but highly ordered for each BC. Moreover, coordination of contractions and dilatations from one canalicular lumen to the other was strongly suggested within the cell layer although it remains open to debate due to limited number of analyses available today (Smith et al. 1985; Sudo et al. 2005). More importantly, contractions appeared to be essential for clearance of BAs. In agreement, taurocholate treatment known to be choleretic (Watanabe et al. 2006), resulted in increased frequency of BC dynamics which was associated with increased efflux activity of TCA and the fluorescent UDCA derivative, giving a strong evidence for the role of these contractions in bile flow.

162 One main observation in this work was to show that this motile activity was rapidly altered by cell exposure to various cholestatic compounds. Taking advantage of comparative analysis of 6 compounds our study allowed to show that BCs were immediately deformed after addition of either compound. It also allowed to assert that cholestatic effects could lead to opposite deformations, either constriction or dilatation of canalicular lumen according to the drugs despite they were all inducing a common marked impairment of the contractile movements. Many studies on cholestatic drugs have been reported but no one has proposed a general description of major cellular disorders associated with the drug-induced disease. Confused situation came from difficulty in comparing results from either different experimental conditions with only one or few different compounds, or oppositely, from systematical use of the same referent cholestatic compound model, such as ANIT in vivo (Rodriguez-Garay 2003). Thus, for the first time two classes of cholestatic drugs could be distinguished, one including CPZ and CsA which induced canalicular lumen constriction, in agreement with previous reports (Antherieu et al. 2013; Sharanek et al. 2014), and another including ANIT, and bosentan which induced canalicular lumen dilatation. Noteworthy both classes shared in common strong impairment of the contractile movements. Failure of bile secretion associated with these morphological and contractile disorders was also evidenced. Indeed, our data showed abnormal intracellular accumulation of [3H]-TA in presence of CPZ and CsA as well as fasudil. This accumulation was dose-dependent regardless of whether these drugs constricted or dilated canalicular lumens. Similar results have already been reported with CPZ and CsA (Antherieu et al. 2013; Sharanek et al. 2014) whereas it is the first description of the adverse outcome effects induced by the widely used fasudil, often associated with bosentan, as therapeutics for hypertension diseases (Elias-Al-Mamun et al. 2014). Contrary to CPZ, CsA, bosentan and ANIT, both fasudil and DCA have never been reported to induce cholestatic features in vivo. The in vivo differences between the adverse effects of fasudil and bosentan, could be related to their concentrations used, metabolism or to some differences in their mechanisms of action as observed in this study. The in vitro cholestatic effects of the secondary BA DCA likely resulted

163 from the much higher concentration used than those found in vivo, even in cholestatic patients. BA accumulation could explain direct cellular toxicity reaction occurring during cholestasis. Abnormal BA accumulation could also account for impairment of the transport system, mainly NTCP and BSEP transporters, mediated either by negative feedback control of synthesis as described, or alternatively, by alteration of BSEP endosomal trafficking due to loss of motile activity (Hayashi and Sugiyama 2013). Abnormal BA accumulation could also contribute to impairment of biliary excretion of substrates susceptible of using an endogenous transport system, assuming that this latter impairment would represent a consequence of altered BA trafficking and not a primary event causing the disease as often claimed in the literature (Rodrigues et al. 2014). Concomitantly, clearance efficiency markedly diminished as evidenced by fluorescent UDCA efflux, in presence of CPZ and fasudil for instance. This would be expected with CPZ and CsA which induced blockage of extremely constricted bile canalicular and saccular structures. It was more surprising with fasudil which induced dramatic overdistension of sacculations. However, these deformed BC have lost their ability to perform their dynamic movement contrary to the untreated cells that relaxed and opened in a rhythmic manner to discharge their content. This leads to postulate that impairment of contractile movements of canalicular lumens was critical for clearance efficiency. In addition, both deformations required extensive remodeling of the cellular areas surrounding the lumens, probably contributing to the observed disruption and isolation of the saccular lumens from their proximal canaliculi and making difficult or impossible efflux out of the lumens. Noteworthy, no evidence of leakage could be seen, at least during the exposure time used. The marked accumulation of F-actin filaments deposited around the lumen, particularly with those drugs inducing dilatation could play a role in maintaining the distended architecture of the closed saccular lumens. This is an important difference from isolated hepatocyte couplets in which passage of bile between the cells through presumably leaky tight junctions was described in support to the rupture and “collapse” theory of canalicular motion. This collapse has never been seen in vivo (Watanabe et al. 1991b). It is of major interest that the effects of cholestatic drugs were all impairing contractile movements, which would be expected if it is assumed that the functional basis of

164 canaliculi contraction is mediated by actin filaments. This led us to look for molecular mechanisms and signaling pathways controlling actin activity which could be targeted by the different cholestatic drugs. In the current work we provided the first demonstration that ROCK/myosin II pathway and its sequential effectors are major targets of cholestatic compounds inducing deformations of apical lumens and impairment of contractile movements. Several arguments supported the involvement of ROCK pathway in the observed cholestatic features; (i) the dose-dependent activation of ROCK activity as early as 1h after exposure of HepaRG cells to either CsA or CPZ, followed by increased phosphorylation of MLC2. (ii) the ROCK inhibitor (Y27632) preventing CsA- and CPZ-induced activation of ROCK, lowered CsA- and CPZ- increased phosphorylation of MLC2 and reduced constriction of BCs. On the contrary, fasudil, a stable and potent inhibitor of ROCK, was found to act oppositely to CPZ and CsA, in inducing extreme dilatation of the apical lumen, reducing ROCK activity and strongly inhibiting phosphorylation of MLC2, thus leading to actin relaxation. DCA and bosentan were found to reproduce the effects of fasudil without inhibition of ROCK activity, but inhibition of MLC2 phosphorylation. Thus both DCA- and bosentan-induced decrease of MLC2 phosphorylation is independent of direct inhibition. Additional argument on the contribution of the myosin-II heavy chain ATPase to actin regulation was provided by the BDM inhibitor which clearly reproduced the effects of ROCK inhibitors such as Y27632 and fasudil, by inducing lumen dilatation and decrease in dynamics of BCs. Like BDM, ANIT did not exert any effects on ROCK activity and MLC2 phosphorylation (not shwon), but induced dilatation of BCs, showing that this compound could interact with the ROCK pathway at levels downstream ROCK activity and MLC2. A second group of arguments came from data showing that the ROCK pathway controlled normal contractile movements of BCs and clearance of BAs. Thus, the time-dependent alternate MLC2 phosphorylation/dephosphorylation states of untreated cells were coordinated with the contraction frequency of BCs. Furthermore, TCA treatment increased the frequency of BC contractions and MLC2 phosphorylation/dephosphorylation, and the clearance of radiolabeled [3H]-TA. Meanwhile, impairment of the ROCK pathway by cholestatic agents resulted in loss of alternate phosphorylation states and BC contractions. It is therefore very interesting but not surprising that bosentan and fasudil, two drugs designed to

165 antagonize hypertension in coronary and pulmonary diseases by inducing ROCK inhibition (Mouchaers et al. 2010), could cause adverse cholestatic effects. Altogether, our data strongly suggest that drug-induced cholestatic effects are mediated by a sequence of hierarchical events initiated by modulation of ROCK activity, followed by change of the phosphorylation status of MLC2 and consequently modification of the myosin-II heavy chain ATPase that alters actomyosin-based contractility of BCs and consequently clearance of [3H]-TA. This provides a breakthrough for deciphering adverse outcomes associated with cholestatic drugs. This current study provides further knowledge in the physiology and molecular biology of the secretory events implicating canalicular dynamic systems and highlights deeper insights of the interruption of bile secretion and tool up several biomarkers that could be of great help better prediction of drug-induced cholestasis.

Acknowledgments This work was supported by the European Community [Contracts Predict-IV-202222 and MIP-DILI-115336]. The MIP-DILI project has received support from the Innovative Medicines Initiative Joint Undertaking, resources of which are composed of financial contribution from the European Union’s Seventh Framework Programme [FP7/20072013] and EFPIA companies’ in kind contribution. http://www.imi.europa.eu/. Ahmad Sharanek was financially supported from the Lebanese Association for Scientific Research (LASeR) and the MIP-DILI project; Audrey Burban by the MIP- DILI project and Matthew Burbank by CIFRE contract with Servier.

166 References

Padda MS, Sanchez M, Akhtar AJ, Boyer JL. Drug-induced cholestasis. Hepatology 2011;53:1377-1387.

Bjornsson ES, Jonasson JG. Drug-induced cholestasis. Clin Liver Dis 2013;17:191- 209.

Stieger B. Role of the bile salt export pump, BSEP, in acquired forms of cholestasis. Drug Metab Rev 2010;42:437-445.

Welch MA, Kock K, Urban TJ, Brouwer KL, Swaan PW. Toward predicting drug- induced liver injury: parallel computational approaches to identify multidrug resistance protein 4 and bile salt export pump inhibitors. Drug Metab Dispos 2015;43:725-734.

Bryant DM, Mostov KE. From cells to organs: building polarized tissue. Nat Rev Mol Cell Biol 2008;9:887-901.

Rodriguez-Boulan E, Kreitzer G, Musch A. Organization of vesicular trafficking in epithelia. Nat Rev Mol Cell Biol 2005;6:233-247.

Wakabayashi Y, Dutt P, Lippincott-Schwartz J, Arias IM. Rab11a and myosin Vb are required for bile canalicular formation in WIF-B9 cells. Proc Natl Acad Sci U S A 2005;102:15087-15092.

Rodriguez-Boulan E, Salas PJ. External and internal signals for epithelial cell surface polarization. Annu Rev Physiol 1989;51:741-754.

Nossaman BD, Kadowitz PJ. The role of the RhoA/rho-kinase pathway in pulmonary hypertension. Curr Drug Discov Technol 2009;6:59-71.

Lee DL, Webb RC, Jin L. Hypertension and RhoA/Rho-kinase signaling in the vasculature: highlights from the recent literature. Hypertension 2004;44:796- 799.

167 Zhou Q, Hennenberg M, Trebicka J, Jochem K, Leifeld L, Biecker E, Sauerbruch T, et al. Intrahepatic upregulation of RhoA and Rho-kinase signalling contributes to increased hepatic vascular resistance in rats with secondary biliary cirrhosis. Gut 2006;55:1296-1305.

Tsukita S, Tsukita S. Isolation of cell-to-cell adherens junctions from rat liver. J Cell Biol 1989;108:31-41.

Sato N, Funayama N, Nagafuchi A, Yonemura S, Tsukita S, Tsukita S. A gene family consisting of ezrin, radixin and moesin. Its specific localization at actin filament/plasma membrane association sites. J Cell Sci 1992;103 ( Pt 1):131- 143.

Tsukita S, Oishi K, Sato N, Sagara J, Kawai A, Tsukita S. ERM family members as molecular linkers between the cell surface glycoprotein CD44 and actin-based cytoskeletons. J Cell Biol 1994;126:391-401.

Yonemura S, Hirao M, Doi Y, Takahashi N, Kondo T, Tsukita S, Tsukita S. Ezrin/radixin/moesin (ERM) proteins bind to a positively charged amino acid cluster in the juxta-membrane cytoplasmic domain of CD44, CD43, and ICAM- 2. J Cell Biol 1998;140:885-895.

Reczek D, Berryman M, Bretscher A. Identification of EBP50: A PDZ-containing phosphoprotein that associates with members of the ezrin-radixin-moesin family. J Cell Biol 1997;139:169-179.

Hirao M, Sato N, Kondo T, Yonemura S, Monden M, Sasaki T, Takai Y, et al. Regulation mechanism of ERM (ezrin/radixin/moesin) protein/plasma membrane association: possible involvement of phosphatidylinositol turnover and Rho-dependent signaling pathway. J Cell Biol 1996;135:37-51.

Bretscher A, Chambers D, Nguyen R, Reczek D. ERM-Merlin and EBP50 protein families in plasma membrane organization and function. Annu Rev Cell Dev Biol 2000;16:113-143.

168 Mangeat P, Roy C, Martin M. ERM proteins in cell adhesion and membrane dynamics. Trends Cell Biol 1999;9:187-192.

Tsukita S, Yonemura S. Cortical actin organization: lessons from ERM (ezrin/radixin/moesin) proteins. J Biol Chem 1999;274:34507-34510.

Decaens C, Durand M, Grosse B, Cassio D. Which in vitro models could be best used to study hepatocyte polarity? Biol Cell 2008;100:387-398.

LeCluyse EL, Audus KL, Hochman JH. Formation of extensive canalicular networks by rat hepatocytes cultured in collagen-sandwich configuration. Am J Physiol 1994;266:C1764-1774.

Dunn JC, Yarmush ML, Koebe HG, Tompkins RG. Hepatocyte function and extracellular matrix geometry: long-term culture in a sandwich configuration. FASEB J 1989;3:174-177.

Musat AI, Sattler CA, Sattler GL, Pitot HC. Reestablishment of cell polarity of rat hepatocytes in primary culture. Hepatology 1993;18:198-205.

Gallin WJ. Development and maintenance of bile canaliculi in vitro and in vivo. Microsc Res Tech 1997;39:406-412.

Antherieu S, Bachour-El Azzi P, Dumont J, Abdel-Razzak Z, Guguen-Guillouzo C, Fromenty B, Robin MA, et al. Oxidative stress plays a major role in chlorpromazine-induced cholestasis in human HepaRG cells. Hepatology 2013;57:1518-1529.

Sharanek A, Azzi PB, Al-Attrache H, Savary CC, Humbert L, Rainteau D, Guguen- Guillouzo C, et al. Different dose-dependent mechanisms are involved in early cyclosporine a-induced cholestatic effects in hepaRG cells. Toxicol Sci 2014;141:244-253.

Cerec V, Glaise D, Garnier D, Morosan S, Turlin B, Drenou B, Gripon P, et al. Transdifferentiation of hepatocyte-like cells from the human hepatoma HepaRG cell line through bipotent progenitor. Hepatology 2007;45:957-967.

169 Guguen-Guillouzo C, Campion JP, Brissot P, Glaise D, Launois B, Bourel M, Guillouzo A. High yield preparation of isolated human adult hepatocytes by enzymatic perfusion of the liver. Cell Biol Int Rep 1982;6:625-628.

Barnwell SG, Tuchweber B, Yousef IM. Biliary lipid secretion in the rat during infusion of increasing doses of unconjugated bile acids. Biochim Biophys Acta 1987;922:221-233.

Pernelle K, Le Guevel R, Glaise D, Stasio CG, Le Charpentier T, Bouaita B, Corlu A, et al. Automated detection of hepatotoxic compounds in human hepatocytes using HepaRG cells and image-based analysis of mitochondrial dysfunction with JC-1 dye. Toxicol Appl Pharmacol 2011;254:256-266.

Zamek-Gliszczynski MJ, Xiong H, Patel NJ, Turncliff RZ, Pollack GM, Brouwer KL. Pharmacokinetics of 5 (and 6)-carboxy-2’,7’-dichlorofluorescein and its diacetate promoiety in the liver. J Pharmacol Exp Ther 2003;304:801-809.

Wang R, Liu L, Sheps JA, Forrest D, Hofmann AF, Hagey LR, Ling V. Defective canalicular transport and toxicity of dietary ursodeoxycholic acid in the abcb11- /- mouse: transport and gene expression studies. Am J Physiol Gastrointest Liver Physiol 2013;305:G286-294.

Wagner M, Zollner G, Trauner M. New molecular insights into the mechanisms of cholestasis. J Hepatol 2009;51:565-580.

Watanabe T, Hosoya H, Yonemura S. Regulation of myosin II dynamics by phosphorylation and dephosphorylation of its light chain in epithelial cells. Mol Biol Cell 2007;18:605-616.

Morgan RE, Trauner M, van Staden CJ, Lee PH, Ramachandran B, Eschenberg M, Afshari CA, et al. Interference with bile salt export pump function is a susceptibility factor for human liver injury in drug development. Toxicol Sci 2010;118:485-500.

170 Dawson S, Stahl S, Paul N, Barber J, Kenna JG. In vitro inhibition of the bile salt export pump correlates with risk of cholestatic drug-induced liver injury in humans. Drug Metab Dispos 2012;40:130-138.

Warner DJ, Chen H, Cantin LD, Kenna JG, Stahl S, Walker CL, Noeske T. Mitigating the inhibition of human bile salt export pump by drugs: opportunities provided by physicochemical property modulation, in silico modeling, and structural modification. Drug Metab Dispos 2012;40:2332-2341.

Pedersen JM, Matsson P, Bergstrom CA, Hoogstraate J, Noren A, LeCluyse EL, Artursson P. Early identification of clinically relevant drug interactions with the human bile salt export pump (BSEP/ABCB11). Toxicol Sci 2013;136:328-343.

Bachour-El Azzi P, Sharanek A, Abdel-Razzak Z, Antherieu S, Al-Attrache H, Savary CC, Lepage S, et al. Impact of inflammation on chlorpromazine-induced cytotoxicity and cholestatic features in HepaRG cells. Drug Metab Dispos 2014;42:1556-1566.

Roman ID, Coleman R. Disruption of canalicular function in isolated rat hepatocyte couplets caused by cyclosporin A. Biochem Pharmacol 1994;48:2181-2188.

Wood RL. An Electron Microscope Study of Developing Bile Canaliculi in the Rat. Anat Rec 1965;151:507-529.

Fu D, Wakabayashi Y, Ido Y, Lippincott-Schwartz J, Arias IM. Regulation of bile canalicular network formation and maintenance by AMP-activated protein kinase and LKB1. J Cell Sci 2010;123:3294-3302.

Bachour-El Azzi P, Sharanek A, Burban A, Li R, Le Guevel R, Abdel-Razzak Z, Stieger B, et al. Comparative localization and functional activity of the main hepatobiliary transporters in HepaRG cells and primary human hepatocytes. Toxicol Sci 2015.

Oda M, Price VM, Fisher MM, Phillips MJ. Ultrastructure of bile canaliculi, with special reference to the surface coat and the pericanalicular web. Lab Invest 1974;31:314-323.

171 Oshio C, Phillips MJ. Contractility of bile canaliculi: implications for liver function. Science 1981;212:1041-1042.

Phillips MJ, Oda M, Mak E, Fisher MM, Jeejeebhoy KN. Microfilament dysfunction as a possible cause of intrahepatic cholestasis. Gastroenterology 1975;69:48-58.

Watanabe N, Tsukada N, Smith CR, Phillips MJ. Motility of bile canaliculi in the living animal: implications for bile flow. J Cell Biol 1991;113:1069-1080.

Sudo R, Kohara H, Mitaka T, Ikeda M, Tanishita K. Coordinated movement of bile canalicular networks reconstructed by rat small hepatocytes. Ann Biomed Eng 2005;33:696-708.

Smith CR, Oshio C, Miyairi M, Katz H, Phillips MJ. Coordination of the contractile activity of bile canaliculi. Evidence from spontaneous contractions in vitro. Lab Invest 1985;53:270-274.

Watanabe N, Kagawa T, Kojima S, Takashimizu S, Nagata N, Nishizaki Y, Mine T. Taurolithocholate impairs bile canalicular motility and canalicular bile secretion in isolated rat hepatocyte couplets. World J Gastroenterol 2006;12:5320-5325.

Rodriguez-Garay EA. Cholestasis: human disease and experimental animal models. Ann Hepatol 2003;2:150-158.

Elias-Al-Mamun M, Satoh K, Tanaka S, Shimizu T, Nergui S, Miyata S, Fukumoto Y, et al. Combination therapy with fasudil and sildenafil ameliorates monocrotaline-induced pulmonary hypertension and survival in rats. Circ J 2014;78:967-976.

Hayashi H, Sugiyama Y. Bile salt export pump (BSEP/ABCB11): trafficking and sorting disturbances. Curr Mol Pharmacol 2013;6:95-103.

Rodrigues AD, Lai Y, Cvijic ME, Elkin LL, Zvyaga T, Soars MG. Drug-induced perturbations of the bile acid pool, cholestasis, and hepatotoxicity: mechanistic considerations beyond the direct inhibition of the bile salt export pump. Drug Metab Dispos 2014;42:566-574.

172 Mouchaers KT, Schalij I, de Boer MA, Postmus PE, van Hinsbergh VW, van Nieuw Amerongen GP, Vonk Noordegraaf A, et al. Fasudil reduces monocrotaline- induced pulmonary arterial hypertension: comparison with bosentan and sildenafil. Eur Respir J 2010;36:800-807.

173 Figure legends

Figure 1. Polarity and dynamics of bile canaliculi in HepaRG cell and human hepatocyte cultures. Bile canaliculi structures in differentiated HepaRG cells and 4- 5 days human hepatocytes cultured in sandwich (SCHH) and conventional (CCHH) configuration were observed under phase-contrast microscopy (×20 magnification) (A). Differentiated HepaRG cells and 4-5 days SCHH and CCHH were fixed, then pericanalicular F-actin microfilament networks were labeled with phalloidin-fluoprobe (B) or incubated with primary antibodies against either the hepatobiliary transporters P-gP (C) and MRP2 (D) or the junctional protein ZO-1 (E). Bile canaliculi labeled using CDFDA, a MRP2 substrate, in HepaRG cells, SCHH and CCHH (F). Nuclei (blue) labeled using Hoechst dye. Immunofluorescence images were obtained with a Cellomics ArrayScan VTI HCS Reader (Thermo Scientific). Electron microscopic micrograph of tight junctions delimiting bile canaliculus structures in HepaRG cells (arrows), original magnification: ×3000 (bar = 10μ m) (G). Representative time-lapse imaging of HepaRG cells and 4-5 days CCHH during 4h. Unidirectional and rhythmic opening (green arrow) and closing spikes (red arrow) occurred between saccular (S- BC) and tubular lumen (T-BC) of individual bile canaliculus accompanied by a contraction/relaxation of S-BC (grey arrow) in HepaRG cells and CCHH (H). Imaging was done using inverted microscope Zeiss Axiovert 200M and AxioCam MRm. Graphic representation of quantification of S-BC volume and the canalicular contractions (spikes) during 4h in HepaRG cells (I) and CCHH (J).

Figure 2: Alteration of F-actin cytoskeletal distribution and bile canaliculi structures by tested compounds in HepaRG cells, 4-5 days SCHH and CCHH. (A) From left to the right side of the figure: Untreated cells (control), cells treated with 50 µM CPZ, 50 µM CsA, 50 µM fasudil, 50 µM ANIT, 200 µM DCA, and 100 µM bosentan. Phase-contrast images were captured after 4h treatment then F-actin was localized using phalloidin fluroprobe (red) in HepaRG cells 5 days SCHH and CCHH. (B) Immunolabeling of the junctional protein ZO-1 (green) in HepaRG cells treated or not with the tested compounds. Nuclei were stained in blue (Hoechst dye). Images were obtained with a Cellomics ArrayScan VTI HCS Reader (Thermo Scientific)

174 Figure 3: Disruption of bile canaliculi rhythmic dynamic movements after CPZ and fasudil treatment in HepaRG cells. Representative time-lapse imaging of HepaRG cells treated with 50 µM CPZ or 50 µM fasudil for 4h. A decrease in rhythmic spikes (red/green arrow) was observed with both drugs. Constriction of S- BC with CPZ (grey arrow) (A) and oppositely, dilatation with fasudil (grey arrow) (B). Imaging was done using inverted microscope Zeiss Axiovert 200M and AxioCam MRm. Graphic representation of quantification of S-BC volume and the canalicular contractions (spikes) in HepaRG cells treated with CPZ (C) or fasudil (D).

Figure 4: Effects of tested compounds on clearance activity in HepaRG cells. (A) Cells were exposed to [3H]-TA in standard buffer for 30 min to induce intracellular accumulation of [3H]-TA and then treated for 2h with 50 µM CPZ, 50 µM CsA, 50 µM fasudil, 50 µM ANIT, 200 µM DCA, and 100 µM bosentan. [3H]-TA clearance was determined by measuring accumulation in cell layers. (B) HepaRG cells were preloaded with different concentrations (0.1 to 200 µM) of unlabeled taurocholic acid (TCA) for 30 min followed by 30 min loading with [3H]-TA. Influx activity was determined by measuring accumulation [3H]-TA in cell layers. (C) HepaRG cells were exposed to [3H]-TA in standard buffer for 30 min to induce intracellular accumulation of [3H]-TA and then treated for 2h with different concentrations of unlabeled TCA (0.1 to 200 µM). [3H]-TA clearance was determined by measuring accumulation in cell layers. (D) HepaRG cells were treated with either CPZ or fasudil for 30 min, then co- treated with TCA for another 30 min, then were exposed to [3H]-TA in standard buffer for 30 min to induce intracellular accumulation of [3H]-TA and then treated for 2h with the same conditions. [3H]-TA clearance was determined by measuring accumulation in cell layers. Data were expressed relative to the level found in untreated cells, arbitrarily set at a value of 100%. (E) Cells were exposed to either ursodeoxycholyl- lysyl-NBD or CDFDA for 30 min, then washed and treated with the different compounds for 2h. Fluorescent images were captured using inverted microscope Zeiss Axiovert 200M and AxioCam MRm. (F) Quantification of CDF accumulation in BC of fasudil-treated HepaRG cells after 2 and 4h. Data were expressed relative to the level found in untreated cells, arbitrarily set at a value of 100%. Data represent

175 the means ± SEM of three independent experiments *P< 0.05 compared with untreated cells.

Figure 5: Modulation of the Rhokinase pathway with the tested compounds in HepaRG cells. (A) Rho-kinase activity was measured using a ROCK activity assay kit after a 1h treatment of HepaRG cells with 50 µM CPZ, 50 µM CsA, 50 µM fasudil, 50 µM ANIT, 200 µM DCA, and 100 µM bosentan. (B) Quantification of MLC2 phosphorylation, results are represented as a ratio of p-MLC2 to total-MLC2 and they are expressed as percentages of untreated cells and are shown as mean ± SEM of three independent experiments. *P< 0.05 compared with untreated cells. (C) Representative western blots of p-MLC2 and total MLC2 forms obtained from whole cellular lysates of HepaRG cells after 2h of treatment with the different tested compounds. (D) Representative western blots of p-MLC2 and total MLC2 forms obtained from whole cellular lysates of HepaRG cells at different time points (30-3.45 min) of treatment with TCA, CPZ and fasudil compared to untreated cells. (E) Differentiated HepaRG cells were treated with the different tested compounds then fixed and incubated with primary antibodies against p-ERM and Rab11 (green fluorescence). Nuclei were stained in blue (Hoechst dye). Images were obtained with a Cellomics ArrayScan VTI HCS Reader (Thermo Scientific).

176 177 178 179 180 181 General Conclusion & Perspectives

182 183 General conclusion and perspectives Intrahepatic cholestasis represents a frequent manifestation of drug-induced liver injuries (DILIs) in humans. It is assumed that DILIs are responsible for more than 50% of cases of liver failure. Around 40% of DILIs lead to intrahepatic cholestatic diseases which can develop into severe injuries leading to mortality. Mechanisms underlying drug-induced cholestasis remains poorly understood; till now, up to 40% of drug-induced cholestatic cases remain unpredictable. Therefore, accurate prediction of drug-induced cholestasis represents a major challenge. Various in vivo and in vitro biological approaches are currently available for studying hepatic transporters and drug-induced cholestasis. Animal models are widely used but they are not always appropriate models because of interspecies variation. Primary human hepatocytes represent the golden model for such studies allowing researchers to avoid the problem of interspecies variability. However, this model has many limitations, in particular, its access is becoming more and more difficult, hepatocyte quality is quite variable, the cells are not functionally stable with time in culture, inter-donor variability in various functions can be very large and when used in a sandwich configuration that allows improvement of viability and functions, possible interactions between matrigel or collagen matrix components and chemical molecules can occur. Our results showed that the metabolically competent human HepaRG cell line can be a surrogate to primary human hepatocytes for investigations on bile acids (BAs) transporters and drug-induced cholestasis. Indeed, HepaRG cells showed the characteristics of mature human hepatocytes with well-defined functional apical bile canaliculi. Canalicular and basolateral transporters are correctly localized and they are functional assuring their role in the uptake and efflux of BAs. Some transporters are, however, expressed in lower amounts than in primary hepatocytes. It would be of interest to determine whether some modifications of culture conditions would increase their expression. Using time lapse microscopy we provide for the first time a strong evidence for the motility of BC in HepaRG cells and primary human hepatocytes. BC open and close repeatedly; this dynamic process is accompanied by an unidirectional expelling of bile bolus. In addition, active movements of small particles, which might represent cytoplasmic vesicles and vacuoles in the pericanalicular regions of the cytoplasm are

184 observed. Moreover, using fluorescent BAs derivatives dynamic contractions of BC appear to be essential for clearance of bile acids. BC of HepaRG cells are more active than those of primary human hepatocytes. Previous studies have shown that other human liver cell lines, including HepG2 cells, did not exhibit normal metabolism of BAs and that BA production in primary human hepatocytes was quite variable. A 12-fold inter-donor variation has been reported by some authors (Ellis and Nilsson 2010). Our work brings the first demonstration HepaRG cells are able to produce, conjugate and secrete BAs at a relatively constant rate for several days and at levels comparable to those produced by primary human hepatocytes, with a high inter-assay reproducibility. However some differences are observed in the proportion of taurine and glycine conjugates between the two cell models. Whether the higher proportion of taurine conjugates is related to the tumoral origin of the HepaRG cells and whether changes in cultures conditions will modify the ratio deserves further investigations. Noteworthy, studies on primary human hepatocytes have shown that culture conditions such as composition of the medium and the substratum could greatly alter the level of total BA production and the ratio of the two primary BA CA/CDCA (Ellis et al. 1998). Only few in vitro studies had dealt with analysis of morphological and functional alterations including changes in BA content and profile following treatment with cholestatic drugs. Using differentiated human HepaRG cells, we show that CsA induces dose- and time-dependent characteristic features of cholestasis. These cholestatic effects are reversible at low CsA concentrations (less than 10µM) and irreversible at higher concentrations (25-50 µM). CsA strongly inhibits canalicular efflux of [3H]-TA in a dose-dependent manner starting as early as 15 minutes after treatment. Delayed over efflux inhibition, after 1 hour, CsA induces a concentration- dependent decrease in NTCP uptake activity. These early effects on efflux and influx of BAs appear to be related to induction of an ER stress, generation of an oxidative stress and deregulation of the cPKC/p38 pathway. In addition, these cholestatic effects are associated with a disruption of cytoskeletal pericanalicular F-actin and constriction of bile canaliculi structures. Early disruption of cytoskeletal pericanalicular F-actin and constriction of bile canaliculi structures confirm morphological changes previously observed with chlorpromazine, another cholestatic drug (Antherieu et al. 2013). Noticeably, by contrast tacrolimus (FK506), a 10- to

185 100-fold more potent immunosuppressant than CsA, is much less toxic, inducing limited liver disturbances only at high concentrations. Accordingly, this agent is not classified as a cholestatic compound. To our best knowledge no study has evidenced intracellular BA accumulation in vitro following treatment with a cholestatic drug as observed in vivo in cholestatic livers. We show that in addition, a 4-hour treatment with CsA in serum-free medium resulted in a concentration-dependent intracellular accumulation and changes in the profiles of endogenous BAs. However such accumulation is transient; after 24h the amount of intracellular endogenous primary BAs is strongly decreased; this likely results from inhibition of BA uptake (NTCP activity), inhibition of BA synthesizing enzymes ( i.e; CYP7A1, CYP8B1 and CYP27A1) and enhanced expression of the basolateral transporters MRP3 and MRP4 that has been interpreted as a compensatory mechanism. Interestingly, when HepaRG cells are treated with CsA in a serum- supplemented medium a dose-dependent intracellular accumulation of bovine serum lithocholic acid (LCA) in a nonsulfoconjugated form is observed. This toxic secondary BA is known to be excreted after sulfoconjugation mainly via MRP2 in bile canaliculi. Consequently, this intracellular accumulation likely results from inhibition of SULT2A1 and sulfate esterification and MRP2 activity by CsA. This original finding deserves further investigations. Indeed, it would be of interest, to determine whether a similar intracellular accumulation of LCA can be caused by other cholestatic drugs and what is the composition of intracellular BAs after repeat daily treatments with CSA and other treatments. Recently, a new study identifies the lysine-specific histone demethylase1 (LSD1) as a new epigenetic regulator of BA hemeostasis in FXR/Shp- dependent manner, where the authors showed a direct recruitment of LSD1 to the BA synthetic genes Cyp7a1 and Cyp8b1 and the BA uptake transporter gene Ntcp leading to their repression (Kim et al. 2014). Thus, a promising aim could be to investigate if LSD1 represents a target for cholestatic drugs and BA toxicity. In the last part of our work we question as to whether alterations of pericanalicular cytoskeletal actin filaments and constriction of bile canaliculi are general features induced by cholestatic drugs and we look for which mechanisms are involved. For this purpose, we extend our study to several other cholestatic molecules, i.e. fasudil, bosentan, ANIT, and DCA. All these cholestatic molecules also induce alterations of bile canaliculi structures. However, contrary to CPZ and CsA these four compounds

186 cause dilatation of BC associated with a decrease in the rate of their spontaneous contractions compared to BC of untreated cells that contract in a rhythmic manner to discharge their content as observed under time-lapse phase-contrast cinephotomicrography. Moreover, we provide several evidences for a critical role of the ROCK pathway in constriction and dilatation of BC, typified by modulation of its activity, followed by change of the phosphorylation status of MLC2 and consequently modification of the myosin-II heavy chain ATPase that alters actomyosin-based contractility of BC and consequently leads to blockage of BAs clearance. These data provide further knowledge in the physiology and molecular biology of the secretory events implicating canalicular dynamic systems and highlights deeper insights of the interruption of bile secretion and tool up several biomarkers that could be of great help in better prediction of drug-induced cholestasis. However, although these biomarkers appear quite promising it will be essential to analyse a large set of cholestatic and non-cholestatic molecules before concluding on the potency of the different markers we have identified. Moreover, whether these biomarkers will allow distinguishing dose-dependent and independent drug-induced cholestasis remains an open question. It has to be borne in mind that several factors are thought to be implicated in idiosyncratic drug-induced liver injury; they include genetic polymorphisms of drug metabolism-related or HLA genes, liver pathologies of various origins including viral infection, and/or environmental inflammatory stress and particularly inflammatory state and immune system that can be evaluated in vitro. We have recently shown that an inflammation state obtained by co-treatment with pro-inflammatory cytokines can increase cytotoxicity of chlorpromazine (Bachour-El Azzi*, Ahmad sharanek* et al, 2014; *Co- first author). The influence of an inflammation state and the immune system on cholestatic effects of several cholestatic drugs has been initiated by co-treatment of HepaRG cells with pro-inflammatory cytokines and co-cultivation with immune cells (dendritic cells, macrophage,…).

187 References

188 189 References Adelstein RS, Pato MD, Sellers JR, de Lanerolle P, Conti MA (1982) Regulation of actin-myosin interaction by reversible phosphorylation of myosin and myosin kinase. Cold Spring Harb Symp Quant Biol 46 Pt 2:921-8

Agellon LB, Cheema SK (1997) The 3’-untranslated region of the mouse cholesterol 7alpha-hydroxylase mRNA contains elements responsive to post- transcriptional regulation by bile acids. Biochem J 328 ( Pt 2):393-9

Agellon LB, Torchia EC (2000) Intracellular transport of bile acids. Biochimica et biophysica acta 1486:198-209

Akashi M, Tanaka A, Takikawa H (2006) Effect of cyclosporin A on the biliary excretion of cholephilic compounds in rats. Hepatol Res 34:193-8

Akhlaghi F, Dostalek M, Falck P, et al. (2012) The concentration of cyclosporine metabolites is significantly lower in kidney transplant recipients with diabetes mellitus. Ther Drug Monit 34:38-45

Akita H, Suzuki H, Ito K, et al. (2001) Characterization of bile acid transport mediated by multidrug resistance associated protein 2 and bile salt export pump. Biochimica et biophysica acta 1511:7-16

Ananthanarayanan M, Balasubramanian N, Makishima M, Mangelsdorf DJ, Suchy FJ (2001) Human bile salt export pump promoter is transactivated by the farnesoid X receptor/bile acid receptor. J Biol Chem 276:28857-65

Andersson TB, Kanebratt KP, Kenna JG (2012) The HepaRG cell line: a unique in vitro tool for understanding drug metabolism and toxicology in human. Expert opinion on drug metabolism & toxicology 8:909-20

Aninat C, Piton A, Glaise D, et al. (2006) Expression of cytochromes P450, conjugating enzymes and nuclear receptors in human hepatoma HepaRG cells. Drug metabolism and disposition: the biological fate of chemicals 34:75- 83

Ansede JH, Smith WR, Perry CH, St Claire RL, 3rd, Brouwer KR (2010) An in vitro assay to assess transporter-based cholestatic hepatotoxicity using sandwich- cultured rat hepatocytes. Drug metabolism and disposition: the biological fate of chemicals 38:276-80

Antherieu S, Bachour-El Azzi P, Dumont J, et al. (2013) Oxidative stress plays a major role in chlorpromazine-induced cholestasis in human HepaRG cells. Hepatology 57:1518-29

190 Antherieu S, Chesne C, Li R, et al. (2010) Stable expression, activity, and inducibility of cytochromes P450 in differentiated HepaRG cells. Drug metabolism and disposition: the biological fate of chemicals 38:516-25

Antherieu S, Chesne C, Li R, Guguen-Guillouzo C, Guillouzo A (2012) Optimization of the HepaRG cell model for drug metabolism and toxicity studies. Toxicology in vitro : an international journal published in association with BIBRA 26:1278- 85

Antoine DJ, Williams DP, Kipar A, et al. (2009) High-mobility group box-1 protein and keratin-18, circulating serum proteins informative of acetaminophen-induced necrosis and apoptosis in vivo. Toxicological sciences : an official journal of the Society of Toxicology 112:521-31

Anwer MS (2004) Cellular regulation of hepatic bile acid transport in health and cholestasis. Hepatology 39:581-90

Arias IM (1993) Cyclosporin, the biology of the bile canaliculus, and cholestasis. Gastroenterology 104:1558-60

Arikawa K, Hicks JL, Williams DS (1990) Identification of actin filaments in the rhabdomeral microvilli of Drosophila photoreceptors. J Cell Biol 110:1993-8

Arrese M, Trauner M (2003) Molecular aspects of bile formation and cholestasis. Trends Mol Med 9:558-64

Arrese M, Trauner M, Ananthanarayanan M, et al. (2003) Down-regulation of the Na+/taurocholate cotransporting polypeptide during pregnancy in the rat. Journal of hepatology 38:148-55

Axelson M, Ellis E, Mork B, et al. (2000) Bile acid synthesis in cultured human hepatocytes: support for an alternative biosynthetic pathway to cholic acid. Hepatology 31:1305-12

Axelson M, Mork B, Everson GT (1991) Bile acid synthesis in cultured human hepatoblastoma cells. J Biol Chem 266:17770-7

Azer SA, Stacey NH (1993a) Cyclosporine-induced interference with uptake of bile acids by human hepatocytes. Transplant Proc 25:2892-3

Azer SA, Stacey NH (1993b) Differential effects of cyclosporin A on the transport of bile acids by human hepatocytes. Biochem Pharmacol 46:813-9

Bachour-El Azzi P, Sharanek A, Abdel-Razzak Z, et al. (2014) Impact of inflammation on chlorpromazine-induced cytotoxicity and cholestatic features in HepaRG

191 cells. Drug metabolism and disposition: the biological fate of chemicals 42:1556-66

Bachour-El Azzi P, Sharanek A, Burban A, et al. (2015) Comparative localization and functional activity of the main hepatobiliary transporters in HepaRG cells and primary human hepatocytes. Toxicological sciences : an official journal of the Society of Toxicology

Bahri AK, Chiang CS, Timbrell JA (1981) Acetylhydrazine hepatotoxicity. Toxicology and applied pharmacology 60:561-9

Baker DM, Wang SL, Bell DJ, Drevon CA, Davis RA (2000) One or more labile proteins regulate the stability of chimeric mRNAs containing the 3’-untranslated region of cholesterol-7alpha -hydroxylase mRNA. J Biol Chem 275:19985-91

Ballantyne CM, Podet EJ, Patsch WP, et al. (1989) Effects of cyclosporine therapy on plasma lipoprotein levels. JAMA 262:53-6

Bananis E, Murray JW, Stockert RJ, Satir P, Wolkoff AW (2003) Regulation of early endocytic vesicle motility and fission in a reconstituted system. J Cell Sci 116:2749-61

Barbarino JM, Staatz CE, Venkataramanan R, Klein TE, Altman RB (2013) PharmGKB summary: cyclosporine and tacrolimus pathways. Pharmacogenet Genomics 23:563-85

Barbier O, Torra IP, Sirvent A, et al. (2003) FXR induces the UGT2B4 enzyme in hepatocytes: a potential mechanism of negative feedback control of FXR activity. Gastroenterology 124:1926-40

Barnwell SG, Tuchweber B, Yousef IM (1987) Biliary lipid secretion in the rat during infusion of increasing doses of unconjugated bile acids. Biochimica et biophysica acta 922:221-33

Barshes NR, Goodpastor SE, Goss JA (2004) Pharmacologic immunosuppression. Front Biosci 9:411-20

Begriche K, Massart J, Robin MA, Borgne-Sanchez A, Fromenty B (2011) Drug- induced toxicity on mitochondria and lipid metabolism: mechanistic diversity and deleterious consequences for the liver. Journal of hepatology 54:773-94

Benichou C (1990) Criteria of drug-induced liver disorders. Report of an international consensus meeting. Journal of hepatology 11:272-6

192 Beuers U, Bilzer M, Chittattu A, et al. (2001) Tauroursodeoxycholic acid inserts the apical conjugate export pump, Mrp2, into canalicular membranes and stimulates organic anion secretion by protein kinase C-dependent mechanisms in cholestatic rat liver. Hepatology 33:1206-16

Biour M, Ben Salem C, Chazouilleres O, Grange JD, Serfaty L, Poupon R (2004) [Drug-induced liver injury; fourteenth updated edition of the bibliographic database of liver injuries and related drugs]. Gastroenterologie clinique et biologique 28:720-59

Bjornsson ES, Jonasson JG (2013) Drug-induced cholestasis. Clin Liver Dis 17:191- 209

Blouin A, Bolender RP, Weibel ER (1977) Distribution of organelles and membranes between hepatocytes and nonhepatocytes in the rat liver parenchyma. A stereological study. The Journal of cell biology 72:441-55

Bode KA, Donner MG, Leier I, Keppler D (2002) Inhibition of transport across the hepatocyte canalicular membrane by the antibiotic fusidate. Biochem Pharmacol 64:151-8

Bohan A, Boyer JL (2002) Mechanisms of hepatic transport of drugs: implications for cholestatic drug reactions. Semin Liver Dis 22:123-36

Bohme M, Jedlitschky G, Leier I, Buchler M, Keppler D (1994a) ATP-dependent export pumps and their inhibition by cyclosporins. Adv Enzyme Regul 34:371- 80

Bohme M, Muller M, Leier I, Jedlitschky G, Keppler D (1994b) Cholestasis caused by inhibition of the adenosine triphosphate-dependent bile salt transport in rat liver. Gastroenterology 107:255-65

Bohmer AE, Mendes Ribeiro Correa A, de Souza DG, et al. (2011) Long-term cyclosporine treatment: evaluation of serum biochemical parameters and histopathological alterations in Wistar rats. Exp Toxicol Pathol 63:119-23

Bolder U, Ton-Nu HT, Schteingart CD, Frick E, Hofmann AF (1997) Hepatocyte transport of bile acids and organic anions in endotoxemic rats: impaired uptake and secretion. Gastroenterology 112:214-25

Borel JF, Feurer C, Gubler HU, Stahelin H (1976) Biological effects of cyclosporin A: a new antilymphocytic agent. Agents Actions 6:468-75

193 Bouchard G, Tuchweber B, Yousef IM (2000) Bile salt independent flow during bile salt-induced choleresis and cholestasis in the rat: role of biliary thiol secretion. Liver 20:27-37

Boyd EM, Bereczky GM (1966) Liver necrosis from paracetamol. British journal of pharmacology and chemotherapy 26:606-14

Boyer JL (2013) Bile formation and secretion. Compr Physiol 3:1035-78

Boyer JL, Trauner M, Mennone A, et al. (2006) Upregulation of a basolateral FXR- dependent bile acid efflux transporter OSTalpha-OSTbeta in cholestasis in humans and rodents. Am J Physiol Gastrointest Liver Physiol 290:G1124-30

Bramow S, Ott P, Thomsen Nielsen F, Bangert K, Tygstrup N, Dalhoff K (2001) Cholestasis and regulation of genes related to drug metabolism and biliary transport in rat liver following treatment with cyclosporine A and sirolimus (Rapamycin). Pharmacol Toxicol 89:133-9

Bravo P, Bender V, Cassio D (1998) Efficient in vitro vectorial transport of a fluorescent conjugated bile acid analogue by polarized hepatic hybrid WIF-B and WIF-B9 cells. Hepatology 27:576-83

Breen K, Schenker S, Heimberg M (1972) The effect of tetracycline on the hepatic secretion of triglyceride. Biochimica et biophysica acta 270:74-80

Breen KJ, Schenker S, Heimberg M (1975) Fatty liver induced by tetracycline in the rat. Dose-response relationships and effect of sex. Gastroenterology 69:714-23

Bremmelgaard A, Sjovall J (1980) Hydroxylation of cholic, chenodeoxycholic, and deoxycholic acids in patients with intrahepatic cholestasis. J Lipid Res 21:1072-81

Bretscher A, Chambers D, Nguyen R, Reczek D (2000) ERM-Merlin and EBP50 protein families in plasma membrane organization and function. Annu Rev Cell Dev Biol 16:113-43

Broschat KO, Stidwill RP, Burgess DR (1983) Phosphorylation controls brush border motility by regulating myosin structure and association with the cytoskeleton. Cell 35:561-71

Bryant DM, Mostov KE (2008) From cells to organs: building polarized tissue. Nat Rev Mol Cell Biol 9:887-901

194 Buchweitz JP, Ganey PE, Bursian SJ, Roth RA (2002) Underlying endotoxemia augments toxic responses to chlorpromazine: is there a relationship to drug idiosyncrasy? J Pharmacol Exp Ther 300:460-7

Bull LN, van Eijk MJ, Pawlikowska L, et al. (1998) A gene encoding a P-type ATPase mutated in two forms of hereditary cholestasis. Nature genetics 18:219-24

Byrne JA, Strautnieks SS, Mieli-Vergani G, Higgins CF, Linton KJ, Thompson RJ (2002) The human bile salt export pump: characterization of substrate specificity and identification of inhibitors. Gastroenterology 123:1649-58

Cali JJ, Russell DW (1991) Characterization of human sterol 27-hydroxylase. A mitochondrial cytochrome P-450 that catalyzes multiple oxidation reaction in bile acid biosynthesis. J Biol Chem 266:7774-8

Calne RY (1979) Pharmacological immunosuppression in clinical organ grafting. Observations on four agents: cyclosporin A, Asta 5122 (cytimun), lambda carrageenan and promethazine hydrochloride. Clin Exp Immunol 35:1-9

Cao J, Huang L, Liu Y, et al. (2001) Differential regulation of hepatic bile salt and organic anion transporters in pregnant and postpartum rats and the role of prolactin. Hepatology 33:140-7

Cao J, Stieger B, Meier PJ, Vore M (2002) Expression of rat hepatic multidrug resistance-associated proteins and organic anion transporters in pregnancy. Am J Physiol Gastrointest Liver Physiol 283:G757-66

Cao S, Cox K, So SS, et al. (1997) Potential effect of cyclosporin A in formation of cholesterol gallstones in pediatric liver transplant recipients. Digestive diseases and sciences 42:1409-15

Carey MA, van Pelt FN (2005) Immunochemical detection of flucloxacillin adduct formation in livers of treated rats. Toxicology 216:41-8

Cerec V, Glaise D, Garnier D, et al. (2007) Transdifferentiation of hepatocyte-like cells from the human hepatoma HepaRG cell line through bipotent progenitor. Hepatology 45:957-67

Chalasani NP, Hayashi PH, Bonkovsky HL, et al. (2014) ACG Clinical Guideline: the diagnosis and management of idiosyncratic drug-induced liver injury. The American journal of gastroenterology 109:950-66; quiz 967

Chan FK, Shaffer EA (1997) Cholestatic effects of cyclosporine in the rat. Transplantation 63:1574-8

195 Chan W, Calderon G, Swift AL, et al. (2005) Myosin II regulatory light chain is required for trafficking of bile salt export protein to the apical membrane in Madin-Darby canine kidney cells. J Biol Chem 280:23741-7

Chanussot F, Botta-Fridlund D, Lechene de la Porte P, et al. (1992) Effects of cyclosporine and corticosteroids on bile secretion in the rat. Transplantation 54:226-31

Chen M, Borlak J, Tong W (2013) High lipophilicity and high daily dose of oral medications are associated with significant risk for drug-induced liver injury. Hepatology 58:388-96

Chen W, Chiang JY (2003) Regulation of human sterol 27-hydroxylase gene (CYP27A1) by bile acids and hepatocyte nuclear factor 4alpha (HNF4alpha). Gene 313:71-82

Chiang JY (1998) Regulation of bile acid synthesis. Front Biosci 3:d176-93

Chiang JY (2004) Regulation of bile acid synthesis: pathways, nuclear receptors, and mechanisms. Journal of hepatology 40:539-51

Chiang JY (2009) Bile acids: regulation of synthesis. J Lipid Res 50:1955-66

Christians U, Kohlhaw K, Budniak J, et al. (1991) Ciclosporin metabolite pattern in blood and urine of liver graft recipients. I. Association of ciclosporin metabolites with nephrotoxicity. European journal of clinical pharmacology 41:285-90

Christians U, Sewing KF (1995) Alternative cyclosporine metabolic pathways and toxicity. Clin Biochem 28:547-59

Cohen D, Rodriguez-Boulan E, Musch A (2004) Par-1 promotes a hepatic mode of apical protein trafficking in MDCK cells. Proceedings of the National Academy of Sciences of the United States of America 101:13792-7

Coleman R (1987) Biochemistry of bile secretion. Biochem J 244:249-61

Copeland KR, Thliveris JA, Yatscoff RW (1990a) Toxicity of cyclosporine metabolites. Ther Drug Monit 12:525-32

Copeland KR, Yatscoff RW, McKenna RM (1990b) Immunosuppressive activity of cyclosporine metabolites compared and characterized by mass spectroscopy and nuclear magnetic resonance. Clin Chem 36:225-9

196 Crestani M, Sadeghpour A, Stroup D, Galli G, Chiang JY (1998) Transcriptional activation of the cholesterol 7alpha-hydroxylase gene (CYP7A) by nuclear hormone receptors. J Lipid Res 39:2192-200

Crettol S, Venetz JP, Fontana M, Aubert JD, Pascual M, Eap CB (2008) CYP3A7, CYP3A5, CYP3A4, and ABCB1 genetic polymorphisms, cyclosporine concentration, and dose requirement in transplant recipients. Ther Drug Monit 30:689-99

Czaja AJ (2011) Drug-induced autoimmune-like hepatitis. Digestive diseases and sciences 56:958-76

Dai Y, Iwanaga K, Lin YS, et al. (2004) In vitro metabolism of cyclosporine A by human kidney CYP3A5. Biochem Pharmacol 68:1889-902

Daly AK, Aithal GP, Leathart JB, Swainsbury RA, Dang TS, Day CP (2007) Genetic susceptibility to diclofenac-induced hepatotoxicity: contribution of UGT2B7, CYP2C8, and ABCC2 genotypes. Gastroenterology 132:272-81

Daly AK, Donaldson PT, Bhatnagar P, et al. (2009) HLA-B*5701 genotype is a major determinant of drug-induced liver injury due to flucloxacillin. Nature genetics 41:816-9

Dandel M, Lehmkuhl HB, Knosalla C, Hetzer R (2010) Impact of different long-term maintenance immunosuppressive therapy strategies on patients’ outcome after heart transplantation. Transpl Immunol 23:93-103

David Josephy P, Peter Guengerich F, Miners JO (2005) "Phase I and Phase II" drug metabolism: terminology that we should phase out? Drug Metab Rev 37:575- 80

Dawson PA, Hubbert M, Haywood J, et al. (2005) The heteromeric organic solute transporter alpha-beta, Ostalpha-Ostbeta, is an ileal basolateral bile acid transporter. J Biol Chem 280:6960-8

Dawson PA, Lan T, Rao A (2009) Bile acid transporters. J Lipid Res 50:2340-57

Dawson S, Stahl S, Paul N, Barber J, Kenna JG (2012) In vitro inhibition of the bile salt export pump correlates with risk of cholestatic drug-induced liver injury in humans. Drug metabolism and disposition: the biological fate of chemicals 40:130-8

Day C, Hewins P, Sheikh L, Kilby M, McPake D, Lipkin G (2006) Cholestasis in pregnancy associated with ciclosporin therapy in renal transplant recipients. Transpl Int 19:1026-9

197 de Mattos AM, Olyaei AJ, Bennett WM (2000) Nephrotoxicity of immunosuppressive drugs: long-term consequences and challenges for the future. Am J Kidney Dis 35:333-46

Decaens C, Durand M, Grosse B, Cassio D (2008) Which in vitro models could be best used to study hepatocyte polarity? Biol Cell 100:387-98

Decaens C, Rodriguez P, Bouchaud C, Cassio D (1996) Establishment of hepatic cell polarity in the rat hepatoma-human fibroblast hybrid WIF-B9. A biphasic phenomenon going from a simple epithelial polarized phenotype to an hepatic polarized one. J Cell Sci 109 ( Pt 6):1623-35

Deng X, Luyendyk JP, Ganey PE, Roth RA (2009) Inflammatory stress and idiosyncratic hepatotoxicity: hints from animal models. Pharmacol Rev 61:262- 82

Denson LA, Auld KL, Schiek DS, McClure MH, Mangelsdorf DJ, Karpen SJ (2000) Interleukin-1beta suppresses retinoid transactivation of two hepatic transporter genes involved in bile formation. J Biol Chem 275:8835-43

Deters M, Klabunde T, Kirchner G, Resch K, Kaever V (2002) Sirolimus/cyclosporine/tacrolimus interactions on bile flow and biliary excretion of immunosuppressants in a subchronic bile fistula rat model. Br J Pharmacol 136:604-12

Dombrowski F, Kubitz R, Chittattu A, Wettstein M, Saha N, Haussinger D (2000) Electron-microscopic demonstration of multidrug resistance protein 2 (Mrp2) retrieval from the canalicular membrane in response to hyperosmolarity and lipopolysaccharide. Biochem J 348 Pt 1:183-8

Donatsch P, Rickenbacher U, Ryffel B, Brouillard JF (1990) Sandimmun metabolites: their potential to cause adverse reactions in the rat. Transplant Proc 22:1137- 40

Donner MG, Keppler D (2001) Up-regulation of basolateral multidrug resistance protein 3 (Mrp3) in cholestatic rat liver. Hepatology 34:351-9

Dueland S, Reichen J, Everson GT, Davis RA (1991) Regulation of cholesterol and bile acid homoeostasis in bile-obstructed rats. Biochem J 280 ( Pt 2):373-7

Duez H, van der Veen JN, Duhem C, et al. (2008) Regulation of bile acid synthesis by the nuclear receptor Rev-erbalpha. Gastroenterology 135:689-98

198 Dunn JC, Yarmush ML, Koebe HG, Tompkins RG (1989) Hepatocyte function and extracellular matrix geometry: long-term culture in a sandwich configuration. FASEB J 3:174-7

Durak I, Ozbek H, Elgun S (2004) Cyclosporine reduces hepatic antioxidant capacity: protective roles of antioxidants. Int Immunopharmacol 4:469-73

Einarsson C, Ellis E, Abrahamsson A, Ericzon BG, Bjorkhem I, Axelson M (2000) Bile acid formation in primary human hepatocytes. World J Gastroenterol 6:522-525

Elferink MG, Olinga P, Draaisma AL, et al. (2004) LPS-induced downregulation of MRP2 and BSEP in human liver is due to a posttranscriptional process. Am J Physiol Gastrointest Liver Physiol 287:G1008-16

Elias-Al-Mamun M, Satoh K, Tanaka S, et al. (2014) Combination therapy with fasudil and sildenafil ameliorates monocrotaline-induced pulmonary hypertension and survival in rats. Circ J 78:967-76

Ellis E, Axelson M, Abrahamsson A, et al. (2003) Feedback regulation of bile acid synthesis in primary human hepatocytes: evidence that CDCA is the strongest inhibitor. Hepatology 38:930-8

Ellis E, Goodwin B, Abrahamsson A, et al. (1998) Bile acid synthesis in primary cultures of rat and human hepatocytes. Hepatology 27:615-20

Ellis EC, Nilsson LM (2010) The use of human hepatocytes to investigate bile acid synthesis. Methods Mol Biol 640:417-30

Ericzon BG, Eusufzai S, Soderdahl G, Duraj F, Einarsson K, Angelin B (1997) Secretion and composition of bile after human liver transplantation: studies on the effects of cyclosporine and tacrolimus. Transplantation 63:74-80

Evans WE, Relling MV (1999) Pharmacogenomics: translating functional genomics into rational therapeutics. Science 286:487-91

Everson GT, Polokoff MA (1986) HepG2. A human hepatoblastoma cell line exhibiting defects in bile acid synthesis and conjugation. J Biol Chem 261:2197-201

Fattinger K, Funk C, Pantze M, et al. (2001) The endothelin antagonist bosentan inhibits the canalicular bile salt export pump: a potential mechanism for hepatic adverse reactions. Clinical pharmacology and therapeutics 69:223-31

199 Fernandez E, Galan AI, Moran D, Gonzalez-Buitrago JM, Munoz ME, Jimenez R (1995) Reversal of cyclosporine A-induced alterations in biliary secretion by S- adenosyl-L-methionine in rats. J Pharmacol Exp Ther 275:442-9

Fouassier L, Kinnman N, Lefevre G, et al. (2002) Contribution of mrp2 in alterations of canalicular bile formation by the endothelin antagonist bosentan. Journal of hepatology 37:184-91

Frohling W, Stiehl A (1976) Bile salt glucuronides: identification and quantitative analysis in the urine of patients with cholestasis. Eur J Clin Invest 6:67-74

Fu D, Wakabayashi Y, Ido Y, Lippincott-Schwartz J, Arias IM (2010) Regulation of bile canalicular network formation and maintenance by AMP-activated protein kinase and LKB1. J Cell Sci 123:3294-302

Fuchs M, Sanyal AJ (2008) Sepsis and cholestasis. Clin Liver Dis 12:151-72, ix

Galan AI, Fernandez E, Moran D, Munoz ME, Jimenez R (1995) Cyclosporine A hepatotoxicity: effect of prolonged treatment with cyclosporine on biliary lipid secretion in the rat. Clin Exp Pharmacol Physiol 22:260-5

Galan AI, Munoz ME, Jimenez R (1999) S-Adenosylmethionine protects against cyclosporin A-induced alterations in rat liver plasma membrane fluidity and functions. J Pharmacol Exp Ther 290:774-81

Gallin WJ (1997) Development and maintenance of bile canaliculi in vitro and in vivo. Microsc Res Tech 39:406-12

Galman C, Angelin B, Rudling M (2005) Bile acid synthesis in humans has a rapid diurnal variation that is asynchronous with cholesterol synthesis. Gastroenterology 129:1445-53

Garcia-Canaveras JC, Donato MT, Castell JV, Lahoz A (2012) Targeted profiling of circulating and hepatic bile acids in human, mouse, and rat using a UPLC- MRM-MS-validated method. J Lipid Res 53:2231-41

Gatmaitan ZC, Nies AT, Arias IM (1997) Regulation and translocation of ATP- dependent apical membrane proteins in rat liver. Am J Physiol 272:G1041-9

Geier A, Fickert P, Trauner M (2006) Mechanisms of disease: mechanisms and clinical implications of cholestasis in sepsis. Nat Clin Pract Gastroenterol Hepatol 3:574-85

Gerloff T, Geier A, Roots I, Meier PJ, Gartung C (2002) Functional analysis of the rat bile salt export pump gene promoter. Eur J Biochem 269:3495-503

200 Gerloff T, Stieger B, Hagenbuch B, et al. (1998) The sister of P-glycoprotein represents the canalicular bile salt export pump of mammalian liver. J Biol Chem 273:10046-50

Gnerre C, Blattler S, Kaufmann MR, Looser R, Meyer UA (2004) Regulation of CYP3A4 by the bile acid receptor FXR: evidence for functional binding sites in the CYP3A4 gene. Pharmacogenetics 14:635-45

Goldfarb S (1976) Sex hormones and hepatic neoplasia. Cancer research 36:2584-8

Gong L, Aranibar N, Han YH, et al. (2011) Characterization of organic anion- transporting polypeptide (Oatp) 1a1 and 1a4 null mice reveals altered transport function and urinary metabolomic profiles. Toxicological sciences : an official journal of the Society of Toxicology 122:587-97

Gonzalez FJ (2012) Nuclear receptor control of enterohepatic circulation. Compr Physiol 2:2811-28

Goodwin B, Jones SA, Price RR, et al. (2000) A regulatory cascade of the nuclear receptors FXR, SHP-1, and LRH-1 represses bile acid biosynthesis. Mol Cell 6:517-26

Gordon DJ, Boyer JL, Korn ED (1977) Comparative biochemistry of non-muscle actins. J Biol Chem 252:8300-9

Green RM, Beier D, Gollan JL (1996) Regulation of hepatocyte bile salt transporters by endotoxin and inflammatory cytokines in rodents. Gastroenterology 111:193-8

Gripon P, Rumin S, Urban S, et al. (2002) Infection of a human hepatoma cell line by hepatitis B virus. Proceedings of the National Academy of Sciences of the United States of America 99:15655-60

Grober U (2012) [Mitochondrial toxicity of drugs]. Med Monatsschr Pharm 35:445-56

Grosse B, Degrouard J, Jaillard D, Cassio D (2013) Build them up and break them down: Tight junctions of cell lines expressing typical hepatocyte polarity with a varied repertoire of claudins. Tissue Barriers 1:e25210

Guguen-Guillouzo C, Campion JP, Brissot P, et al. (1982) High yield preparation of isolated human adult hepatocytes by enzymatic perfusion of the liver. Cell biology international reports 6:625-8

Guguen-Guillouzo C, Guillouzo A (2010) General review on in vitro hepatocyte models and their applications. Methods Mol Biol 640:1-40

201 Guo GL, Lambert G, Negishi M, et al. (2003) Complementary roles of farnesoid X receptor, pregnane X receptor, and constitutive androstane receptor in protection against bile acid toxicity. J Biol Chem 278:45062-71

Hadj-Rabia S, Baala L, Vabres P, et al. (2004) Claudin-1 gene mutations in neonatal sclerosing cholangitis associated with ichthyosis: a tight junction disease. Gastroenterology 127:1386-90

Hagenbuch B, Meier PJ (1996) Sinusoidal (basolateral) bile salt uptake systems of hepatocytes. Semin Liver Dis 16:129-36

Halilbasic E, Claudel T, Trauner M (2013) Bile acid transporters and regulatory nuclear receptors in the liver and beyond. Journal of hepatology 58:155-68

Han S, Chiang JY (2009) Mechanism of vitamin D receptor inhibition of cholesterol 7alpha-hydroxylase gene transcription in human hepatocytes. Drug metabolism and disposition: the biological fate of chemicals 37:469-78

Handschumacher RE, Harding MW, Rice J, Drugge RJ, Speicher DW (1984) Cyclophilin: a specific cytosolic binding protein for cyclosporin A. Science 226:544-7

Harding MW, Galat A, Uehling DE, Schreiber SL (1989) A receptor for the immunosuppressant FK506 is a cis-trans peptidyl-prolyl isomerase. Nature 341:758-60

Harding MW, Handschumacher RE (1988) Cyclophilin, a primary molecular target for cyclosporine. Structural and functional implications. Transplantation 46:29S- 35S

Hart SN, Li Y, Nakamoto K, Subileau EA, Steen D, Zhong XB (2010) A comparison of whole genome gene expression profiles of HepaRG cells and HepG2 cells to primary human hepatocytes and human liver tissues. Drug metabolism and disposition: the biological fate of chemicals 38:988-94

Hautekeete ML, Horsmans Y, Van Waeyenberge C, et al. (1999) HLA association of amoxicillin-clavulanate--induced hepatitis. Gastroenterology 117:1181-6

Hayashi H, Sugiyama Y (2013) Bile salt export pump (BSEP/ABCB11): trafficking and sorting disturbances. Curr Mol Pharmacol 6:95-103

Herrero JI, Quiroga J, Sangro B, et al. (2000) Hyperhomocysteinemia in liver transplant recipients: prevalence and multivariate analysis of predisposing factors. Liver Transpl 6:614-8

202 Hillebrands JL, Klatter FA, Raue HP, Koops RA, Hylkema MN, Rozing J (1999) An alternative model to study intrathymic tolerance induction: the neonatal heart- in-ear transplantation model in the rat. Transplant Proc 31:1563-6

Hirano M, Maeda K, Hayashi H, Kusuhara H, Sugiyama Y (2005) Bile salt export pump (BSEP/ABCB11) can transport a nonbile acid substrate, pravastatin. J Pharmacol Exp Ther 314:876-82

Hirao M, Sato N, Kondo T, et al. (1996) Regulation mechanism of ERM (ezrin/radixin/moesin) protein/plasma membrane association: possible involvement of phosphatidylinositol turnover and Rho-dependent signaling pathway. J Cell Biol 135:37-51

Hisaeda K, Inokuchi A, Nakamura T, et al. (2004) Interleukin-1beta represses MRP2 gene expression through inactivation of interferon regulatory factor 3 in HepG2 cells. Hepatology 39:1574-82

Hoekstra R, Nibourg GA, van der Hoeven TV, et al. (2013) Phase 1 and phase 2 drug metabolism and bile acid production of HepaRG cells in a bioartificial liver in absence of dimethyl sulfoxide. Drug metabolism and disposition: the biological fate of chemicals 41:562-7

Hofmann AF (1999a) Bile Acids: The Good, the Bad, and the Ugly. News Physiol Sci 14:24-29

Hofmann AF (1999b) The continuing importance of bile acids in liver and intestinal disease. Arch Intern Med 159:2647-58

Hofmann AF (2004) Detoxification of lithocholic acid, a toxic bile acid: relevance to drug hepatotoxicity. Drug Metab Rev 36:703-22

Horina JH, Wirnsberger GH, Kenner L, Holzer H, Krejs GJ (1993) Increased susceptibility for CsA-induced hepatotoxicity in kidney graft recipients with chronic viral hepatitis C. Transplantation 56:1091-4

Huang YS, Chern HD, Su WJ, et al. (2003) Cytochrome P450 2E1 genotype and the susceptibility to antituberculosis drug-induced hepatitis. Hepatology 37:924-30

Hulzebos CV, Wolters H, Plosch T, et al. (2003) Cyclosporin a and enterohepatic circulation of bile salts in rats: decreased cholate synthesis but increased intestinal reabsorption. J Pharmacol Exp Ther 304:356-63

Humbert L, Maubert MA, Wolf C, et al. (2012) Bile acid profiling in human biological samples: comparison of extraction procedures and application to normal and

203 cholestatic patients. J Chromatogr B Analyt Technol Biomed Life Sci 899:135- 45

Hunt MC, Yang YZ, Eggertsen G, et al. (2000) The peroxisome proliferator-activated receptor alpha (PPARalpha) regulates bile acid biosynthesis. J Biol Chem 275:28947-53

Inagaki T, Choi M, Moschetta A, et al. (2005) Fibroblast growth factor 15 functions as an enterohepatic signal to regulate bile acid homeostasis. Cell Metab 2:217-25

Inokuchi A, Hinoshita E, Iwamoto Y, Kohno K, Kuwano M, Uchiumi T (2001) Enhanced expression of the human multidrug resistance protein 3 by bile salt in human enterocytes. A transcriptional control of a plausible bile acid transporter. J Biol Chem 276:46822-9

Inoue Y, Yu AM, Inoue J, Gonzalez FJ (2004) Hepatocyte nuclear factor 4alpha is a central regulator of bile acid conjugation. J Biol Chem 279:2480-9

Ishii M, Washioka H, Tonosaki A, Toyota T (1991) Regional orientation of actin filaments in the pericanalicular cytoplasm of rat hepatocytes. Gastroenterology 101:1663-72

Iyanagi T (2007) Molecular mechanism of phase I and phase II drug-metabolizing enzymes: implications for detoxification. Int Rev Cytol 260:35-112

Jacquemin E, De Vree JM, Cresteil D, et al. (2001) The wide spectrum of multidrug resistance 3 deficiency: from neonatal cholestasis to cirrhosis of adulthood. Gastroenterology 120:1448-58

Javitt NB (1966) Cholestasis in rats induced by taurolithocholate. Nature 210:1262-3

Jemnitz K, Veres Z, Szabo M, Baranyai Z, Jakab F, Vereczkey L (2012) Differential inhibitory effect of cyclosporin A and bosentan on taurocholate uptake in human and rat hepatocytes as a function of culturing time. Toxicology in vitro : an international journal published in association with BIBRA 26:174-81

Jemnitz K, Veres Z, Vereczkey L (2010) Contribution of high basolateral bile salt efflux to the lack of hepatotoxicity in rat in response to drugs inducing cholestasis in human. Toxicological sciences : an official journal of the Society of Toxicology 115:80-8

Josephine A, Nithya K, Amudha G, Veena CK, Preetha SP, Varalakshmi P (2008) Role of sulphated polysaccharides from Sargassum Wightii in Cyclosporine A- induced oxidative liver injury in rats. BMC Pharmacol 8:4

204 Josse R, Aninat C, Glaise D, et al. (2008) Long-term functional stability of human HepaRG hepatocytes and use for chronic toxicity and genotoxicity studies. Drug metabolism and disposition: the biological fate of chemicals 36:1111-8

Jung D, Podvinec M, Meyer UA, et al. (2002) Human organic anion transporting polypeptide 8 promoter is transactivated by the farnesoid X receptor/bile acid receptor. Gastroenterology 122:1954-66

Kadmon M, Klunemann C, Bohme M, et al. (1993) Inhibition by cyclosporin A of adenosine triphosphate-dependent transport from the hepatocyte into bile. Gastroenterology 104:1507-14

Kahan BD (1989) Clinical problems in cyclosporine dosing with reference to clinical pharmacology: case histories and discussion. Transplant Proc 21:16-40

Kanebratt KP, Andersson TB (2008) Evaluation of HepaRG cells as an in vitro model for human drug metabolism studies. Drug metabolism and disposition: the biological fate of chemicals 36:1444-52

Kaplowitz N (2004) Drug-induced liver injury. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America 38 Suppl 2:S44-8

Kaplowitz N (2012) Dealing with stress. Hepatology 55:3-13

Karlsen TH, Lie BA, Frey Froslie K, et al. (2006) Polymorphisms in the steroid and xenobiotic receptor gene influence survival in primary sclerosing cholangitis. Gastroenterology 131:781-7

Kassianides C, Nussenblatt R, Palestine AG, Mellow SD, Hoofnagle JH (1990) Liver injury from cyclosporine A. Digestive diseases and sciences 35:693-7

Kast HR, Goodwin B, Tarr PT, et al. (2002) Regulation of multidrug resistance- associated protein 2 (ABCC2) by the nuclear receptors pregnane X receptor, farnesoid X-activated receptor, and constitutive androstane receptor. J Biol Chem 277:2908-15

Kawamoto T, Noshiro M, Furukawa M, et al. (2006) Effects of fasting and re-feeding on the expression of Dec1, Per1, and other clock-related genes. J Biochem 140:401-8

Kehrer JP (1993) Free radicals as mediators of tissue injury and disease. Crit Rev Toxicol 23:21-48

205 Keitel V, Burdelski M, Warskulat U, et al. (2005) Expression and localization of hepatobiliary transport proteins in progressive familial intrahepatic cholestasis. Hepatology 41:1160-72

Keppler D, Konig J (2000) Hepatic secretion of conjugated drugs and endogenous substances. Semin Liver Dis 20:265-72

Khanna A, Kapur S, Sharma V, Li B, Suthanthiran M (1997) In vivo hyperexpression of transforming growth factor-beta1 in mice: stimulation by cyclosporine. Transplantation 63:1037-9

Kienhuis AS, Vitins AP, Pennings JL, et al. (2013) Cyclosporine A treated in vitro models induce cholestasis response through comparison of phenotype- directed gene expression analysis of in vivo Cyclosporine A-induced cholestasis. Toxicol Lett 221:225-36

Kikuchi S, Hata M, Fukumoto K, et al. (2002) Radixin deficiency causes conjugated hyperbilirubinemia with loss of Mrp2 from bile canalicular membranes. Nature genetics 31:320-5

Kim RB, Leake B, Cvetkovic M, et al. (1999) Modulation by drugs of human hepatic sodium-dependent bile acid transporter (sodium taurocholate cotransporting polypeptide) activity. The Journal of pharmacology and experimental therapeutics 291:1204-9

Kim YC, Fang S, Byun S, Seok S, Kemper B, Kemper JK (2014) Farnesoid X receptor-induced lysine-specific histone demethylase reduces hepatic bile acid levels and protects the liver against bile acid toxicity. Hepatology

King CD, Rios GR, Green MD, Tephly TR (2000) UDP-glucuronosyltransferases. Curr Drug Metab 1:143-61

Kipp H, Arias IM (2002) Trafficking of canalicular ABC transporters in hepatocytes. Annu Rev Physiol 64:595-608

Kipp H, Pichetshote N, Arias IM (2001) Transporters on demand: intrahepatic pools of canalicular ATP binding cassette transporters in rat liver. J Biol Chem 276:7218-24

Knowles BB, Howe CC, Aden DP (1980) Human hepatocellular carcinoma cell lines secrete the major plasma proteins and hepatitis B surface antigen. Science 209:497-9

206 Kohlhaw K, Wonigeit K, Schafer O, Ringe B, Bunzendahl H, Pichlmayr R (1989) Association of very high blood levels of cyclosporin metabolites with clinical complications after liver transplantation. Transplant Proc 21:2232-3

Kojima T, Yamamoto T, Murata M, Chiba H, Kokai Y, Sawada N (2003) Regulation of the blood-biliary barrier: interaction between gap and tight junctions in hepatocytes. Med Electron Microsc 36:157-64

Kolars JC, Awni WM, Merion RM, Watkins PB (1991) First-pass metabolism of cyclosporin by the gut. Lancet 338:1488-90

Konig J, Cui Y, Nies AT, Keppler D (2000) Localization and genomic organization of a new hepatocellular organic anion transporting polypeptide. J Biol Chem 275:23161-8

Kovacs P, Kress R, Rocha J, et al. (2008) Variation of the gene encoding the nuclear bile salt receptor FXR and gallstone susceptibility in mice and humans. Journal of hepatology 48:116-24

Krum H, Cranswick N, Pellizzer AM (1998) Effect of endothelin-1 on endothelium- derived vascular responsiveness in man. Clinical science 95:151-6

Kshirsagar A , Vetal Y, Ashok P, Bhosle P, Ingawale D (2008). Drug Induced Hepatotoxicity: A Comprehensive Review. The Internet Journal of Pharmacology. 2008 Volume 7 Number 1

Kubes P, Mehal WZ (2012) Sterile inflammation in the liver. Gastroenterology 143:1158-72

Kubitz R, Droge C, Stindt J, Weissenberger K, Haussinger D (2012) The bile salt export pump (BSEP) in health and disease. Clin Res Hepatol Gastroenterol 36:536-53

Kubitz R, Huth C, Schmitt M, Horbach A, Kullak-Ublick G, Haussinger D (2001) Protein kinase C-dependent distribution of the multidrug resistance protein 2 from the canalicular to the basolateral membrane in human HepG2 cells. Hepatology 34:340-50

Kubitz R, Sutfels G, Kuhlkamp T, Kolling R, Haussinger D (2004) Trafficking of the bile salt export pump from the Golgi to the canalicular membrane is regulated by the p38 MAP kinase. Gastroenterology 126:541-53

207 Kubitz R, Wettstein M, Warskulat U, Haussinger D (1999) Regulation of the multidrug resistance protein 2 in the rat liver by lipopolysaccharide and dexamethasone. Gastroenterology 116:401-10

Kullak-Ublick GA, Beuers U, Paumgartner G (2000a) Hepatobiliary transport. Journal of hepatology 32:3-18

Kullak-Ublick GA, Ismair MG, Stieger B, et al. (2001) Organic anion-transporting polypeptide B (OATP-B) and its functional comparison with three other OATPs of human liver. Gastroenterology 120:525-33

Kullak-Ublick GA, Stieger B, Hagenbuch B, Meier PJ (2000b) Hepatic transport of bile salts. Semin Liver Dis 20:273-92

Kullak-Ublick GA, Stieger B, Meier PJ (2004) Enterohepatic bile salt transporters in normal physiology and liver disease. Gastroenterology 126:322-42

Kumar MS, Xiao SG, Fyfe B, et al. (2005) Steroid avoidance in renal transplantation using basiliximab induction, cyclosporine-based immunosuppression and protocol biopsies. Clin Transplant 19:61-9

Kurz AK, Graf D, Schmitt M, Vom Dahl S, Haussinger D (2001) Tauroursodesoxycholate-induced choleresis involves p38(MAPK) activation and translocation of the bile salt export pump in rats. Gastroenterology 121:407-19

Lam P, Wang R, Ling V (2005) Bile acid transport in sister of P-glycoprotein (ABCB11) knockout mice. Biochemistry 44:12598-605

Lamireau T, Zoltowska M, Levy E, et al. (2003) Effects of bile acids on biliary epithelial cells: proliferation, cytotoxicity, and cytokine secretion. Life Sci 72:1401-11

Lampen A, Christians U, Guengerich FP, et al. (1995) Metabolism of the immunosuppressant tacrolimus in the small intestine: cytochrome P450, drug interactions, and interindividual variability. Drug metabolism and disposition: the biological fate of chemicals 23:1315-24

Lang C, Meier Y, Stieger B, et al. (2007) Mutations and polymorphisms in the bile salt export pump and the multidrug resistance protein 3 associated with drug- induced liver injury. Pharmacogenet Genomics 17:47-60

Lang T, Haberl M, Jung D, et al. (2006) Genetic variability, haplotype structures, and ethnic diversity of hepatic transporters MDR3 (ABCB4) and bile salt export

208 pump (ABCB11). Drug metabolism and disposition: the biological fate of chemicals 34:1582-99

Laupacis A, Keown PA, Ulan RA, McKenzie N, Stiller CR (1982) Cyclosporin A: a powerful immunosuppressant. Can Med Assoc J 126:1041-6

Lavergne SN, Park BK, Naisbitt DJ (2008) The roles of drug metabolism in the pathogenesis of T-cell-mediated drug hypersensitivity. Current opinion in allergy and clinical immunology 8:299-307

Le Thai B, Dumont M, Michel A, Erlinger S, Houssin D (1988) Cholestatic effect of cyclosporine in the rat. An inhibition of bile acid secretion. Transplantation 46:510-2

Le Vee M, Gripon P, Stieger B, Fardel O (2008) Down-regulation of organic anion transporter expression in human hepatocytes exposed to the proinflammatory cytokine interleukin 1beta. Drug metabolism and disposition: the biological fate of chemicals 36:217-22

Le Vee M, Jigorel E, Glaise D, Gripon P, Guguen-Guillouzo C, Fardel O (2006) Functional expression of sinusoidal and canalicular hepatic drug transporters in the differentiated human hepatoma HepaRG cell line. Eur J Pharm Sci 28:109- 17

Le Vee M, Lecureur V, Stieger B, Fardel O (2009) Regulation of drug transporter expression in human hepatocytes exposed to the proinflammatory cytokines tumor necrosis factor-alpha or interleukin-6. Drug metabolism and disposition: the biological fate of chemicals 37:685-93

Le Vee M, Noel G, Jouan E, Stieger B, Fardel O (2013) Polarized expression of drug transporters in differentiated human hepatoma HepaRG cells. Toxicology in vitro : an international journal published in association with BIBRA 27:1979-86

LeBel CP, Ischiropoulos H, Bondy SC (1992) Evaluation of the probe 2’,7’- dichlorofluorescin as an indicator of reactive oxygen species formation and oxidative stress. Chemical research in toxicology 5:227-31

LeCluyse EL, Audus KL, Hochman JH (1994) Formation of extensive canalicular networks by rat hepatocytes cultured in collagen-sandwich configuration. Am J Physiol 266:C1764-74

Lee DL, Webb RC, Jin L (2004) Hypertension and RhoA/Rho-kinase signaling in the vasculature: highlights from the recent literature. Hypertension 44:796-9

209 Lee J (2010) Use of antioxidants to prevent cyclosporine a toxicity. Toxicol Res 26:163-70

Lee JM, Trauner M, Soroka CJ, Stieger B, Meier PJ, Boyer JL (2000) Expression of the bile salt export pump is maintained after chronic cholestasis in the rat. Gastroenterology 118:163-72

Lee NP, Luk JM (2010) Hepatic tight junctions: from viral entry to cancer metastasis. World J Gastroenterol 16:289-95

Lee WM (2003) Drug-induced hepatotoxicity. The New England journal of medicine 349:474-85

Lee WM (2004) Acetaminophen and the U.S. Acute Liver Failure Study Group: lowering the risks of hepatic failure. Hepatology 40:6-9

Lefebvre P, Cariou B, Lien F, Kuipers F, Staels B (2009) Role of bile acids and bile acid receptors in metabolic regulation. Physiol Rev 89:147-91

Leone A, Nie A, Brandon Parker J, et al. (2014) Oxidative stress/reactive metabolite gene expression signature in rat liver detects idiosyncratic hepatotoxicants. Toxicology and applied pharmacology 275:189-97

Levy J, Budai K, Javitt NB (1994) Bile acid synthesis in HepG2 cells: effect of cyclosporin. J Lipid Res 35:1795-800

Lewis JH (2000) Drug-induced liver disease. Med Clin North Am 84:1275-311, x

Li T, Chen W, Chiang JY (2007) PXR induces CYP27A1 and regulates cholesterol metabolism in the intestine. J Lipid Res 48:373-84

Li T, Chiang JY (2005) Mechanism of rifampicin and pregnane X receptor inhibition of human cholesterol 7 alpha-hydroxylase gene transcription. Am J Physiol Gastrointest Liver Physiol 288:G74-84

Li T, Chiang JY (2009) Regulation of bile acid and cholesterol metabolism by PPARs. PPAR Res 2009:501739

Li T, Chiang JY (2013) Nuclear receptors in bile acid metabolism. Drug Metab Rev 45:145-55

Li T, Jahan A, Chiang JY (2006) Bile acids and cytokines inhibit the human cholesterol 7 alpha-hydroxylase gene via the JNK/c-jun pathway in human liver cells. Hepatology 43:1202-10

210 Lima JP (1980) [Anatomy and physiology of the liver secretory apparatus]. Arq Gastroenterol 17:149-60

Lioy PJ, Fan Z, Zhang J, et al. (2011) Personal and ambient exposures to air toxics in Camden, New Jersey. Res Rep Health Eff Inst:3-127; discussion 129-51

Liu J, Lu H, Lu YF, et al. (2014) Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures. Toxicological sciences : an official journal of the Society of Toxicology 141:538- 46

Liu YP, Fang CC, Chen WJ, Ni YH (2005) Fulminant hepatic failure due to chronic acetaminophen intoxication in an infant. Am J Emerg Med 23:94-5

Lorber MI, Van Buren CT, Flechner SM, Williams C, Kahan BD (1987) Hepatobiliary and pancreatic complications of cyclosporine therapy in 466 renal transplant recipients. Transplantation 43:35-40

Lowry OH, Rosebrough NJ, Farr AL, Randall RJ (1951) Protein measurement with the Folin phenol reagent. J Biol Chem 193:265-75

Lu J, Jones AD, Harkema JR, Roth RA, Ganey PE (2012) Amiodarone exposure during modest inflammation induces idiosyncrasy-like liver injury in rats: role of tumor necrosis factor-alpha. Toxicological sciences : an official journal of the Society of Toxicology 125:126-33

Lu TT, Makishima M, Repa JJ, et al. (2000) Molecular basis for feedback regulation of bile acid synthesis by nuclear receptors. Mol Cell 6:507-15

Lucangioli SE, Castano G, Contin MD, Tripodi VP (2009) Lithocholic acid as a biomarker of intrahepatic cholestasis of pregnancy during ursodeoxycholic acid treatment. Ann Clin Biochem 46:44-9

Luster MI, Germolec DR, Yoshida T, Kayama F, Thompson M (1994) Endotoxin- induced cytokine gene expression and excretion in the liver. Hepatology 19:480-8

Madec S, Cerec V, Plee-Gautier E, et al. (2011) CYP4F3B expression is associated with differentiation of HepaRG human hepatocytes and unaffected by fatty acid overload. Drug metabolism and disposition: the biological fate of chemicals 39:1987-96

Mangeat P, Roy C, Martin M (1999) ERM proteins in cell adhesion and membrane dynamics. Trends Cell Biol 9:187-92

211 Marion TL, Perry CH, St Claire RL, 3rd, Brouwer KL (2012) Endogenous bile acid disposition in rat and human sandwich-cultured hepatocytes. Toxicology and applied pharmacology 261:1-9

Marklund S, Marklund G (1974) Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur J Biochem 47:469-74

Marks AR (1996) Cellular functions of immunophilins. Physiol Rev 76:631-49

Marrapodi M, Chiang JY (2000) Peroxisome proliferator-activated receptor alpha (PPARalpha) and agonist inhibit cholesterol 7alpha-hydroxylase gene (CYP7A1) transcription. J Lipid Res 41:514-20

Martinez-Augustin O, Sanchez de Medina F (2008) Intestinal bile acid physiology and pathophysiology. World J Gastroenterol 14:5630-40

Matsuda S, Koyasu S (2000) Mechanisms of action of cyclosporine. Immunopharmacology 47:119-25

Maurer G, Lemaire M (1986) Biotransformation and distribution in blood of cyclosporine and its metabolites. Transplant Proc 18:25-34

McGill MR, Jaeschke H (2013) Metabolism and disposition of acetaminophen: recent advances in relation to hepatotoxicity and diagnosis. Pharm Res 30:2174-87

Meier PJ (1995) Molecular mechanisms of hepatic bile salt transport from sinusoidal blood into bile. Am J Physiol 269:G801-12

Meier PJ, Eckhardt U, Schroeder A, Hagenbuch B, Stieger B (1997) Substrate specificity of sinusoidal bile acid and organic anion uptake systems in rat and human liver. Hepatology 26:1667-77

Meier PJ, Stieger B (2002) Bile salt transporters. Annu Rev Physiol 64:635-61

Meier Y, Zodan T, Lang C, et al. (2008) Increased susceptibility for intrahepatic cholestasis of pregnancy and contraceptive-induced cholestasis in carriers of the 1331T>C polymorphism in the bile salt export pump. World J Gastroenterol 14:38-45

Miao J, Fang S, Bae Y, Kemper JK (2006) Functional inhibitory cross-talk between constitutive androstane receptor and hepatic nuclear factor-4 in hepatic lipid/glucose metabolism is mediated by competition for binding to the DR1 motif and to the common coactivators, GRIP-1 and PGC-1alpha. J Biol Chem 281:14537-46

212 Misra S, Ujhazy P, Gatmaitan Z, Varticovski L, Arias IM (1998) The role of phosphoinositide 3-kinase in taurocholate-induced trafficking of ATP- dependent canalicular transporters in rat liver. J Biol Chem 273:26638-44

Misra S, Ujhazy P, Varticovski L, Arias IM (1999) Phosphoinositide 3-kinase lipid products regulate ATP-dependent transport by sister of P-glycoprotein and multidrug resistance associated protein 2 in bile canalicular membrane vesicles. Proceedings of the National Academy of Sciences of the United States of America 96:5814-9

Mita S, Suzuki H, Akita H, et al. (2006) Inhibition of bile acid transport across Na+/taurocholate cotransporting polypeptide (SLC10A1) and bile salt export pump (ABCB 11)-coexpressing LLC-PK1 cells by cholestasis-inducing drugs. Drug metabolism and disposition: the biological fate of chemicals 34:1575-81

Mochizuki K, Kagawa T, Numari A, et al. (2007) Two N-linked glycans are required to maintain the transport activity of the bile salt export pump (ABCB11) in MDCK II cells. Am J Physiol Gastrointest Liver Physiol 292:G818-28

Monshi MM, Faulkner L, Gibson A, et al. (2013) Human leukocyte antigen (HLA)- B*57:01-restricted activation of drug-specific T cells provides the immunological basis for flucloxacillin-induced liver injury. Hepatology 57:727- 39

Monte MJ, Badia MD, Serrano MA, Sacristan MP, Cassio D, Marin JJ (2001) Predominance of human versus rat phenotype in the metabolic pathways for bile acid synthesis by hybrid WIF-B9 cells. Biochimica et biophysica acta 1534:45-55

Monte MJ, Marin JJ, Antelo A, Vazquez-Tato J (2009) Bile acids: chemistry, physiology, and pathophysiology. World J Gastroenterol 15:804-16

Moran D, De Buitrago JM, Fernandez E, Galan AI, Munoz ME, Jimenez R (1998) Inhibition of biliary glutathione secretion by cyclosporine A in the rat: possible mechanisms and role in the cholestasis induced by the drug. Journal of hepatology 29:68-77

Morgan RE, Trauner M, van Staden CJ, et al. (2010) Interference with bile salt export pump function is a susceptibility factor for human liver injury in drug development. Toxicological sciences : an official journal of the Society of Toxicology 118:485-500

Moseley RH (1997) Sepsis-associated cholestasis. Gastroenterology 112:302-6

213 Mouchaers KT, Schalij I, de Boer MA, et al. (2010) Fasudil reduces monocrotaline- induced pulmonary arterial hypertension: comparison with bosentan and sildenafil. Eur Respir J 36:800-7

Mousavi T, Poormoghim H, Moradi M, Tajik N, Shahsavar F, Soofi M (2009) Phenotypic study of natural killer cell subsets in ankylosing spondylitis patients. Iranian journal of allergy, asthma, and immunology 8:193-8

Mueller CR, Maire P, Schibler U (1990) DBP, a liver-enriched transcriptional activator, is expressed late in ontogeny and its tissue specificity is determined posttranscriptionally. Cell 61:279-91

Mulder J, Karpen SJ, Tietge UJ, Kuipers F (2009) Nuclear receptors: mediators and modifiers of inflammation-induced cholestasis. Front Biosci (Landmark Ed) 14:2599-630

Muraca M, Kohlhaw K, Vilei MT, et al. (1993) Serum bile acids and esterified bilirubin in early detection and differential diagnosis of hepatic dysfunction following orthotopic liver transplantation. Journal of hepatology 17:141-5

Musat AI, Sattler CA, Sattler GL, Pitot HC (1993) Reestablishment of cell polarity of rat hepatocytes in primary culture. Hepatology 18:198-205

Myant NB, Mitropoulos KA (1977) Cholesterol 7 alpha-hydroxylase. J Lipid Res 18:135-53

Myara A, Cadranel JF, Dorent R, et al. (1996) Cyclosporin A-mediated cholestasis in patients with chronic hepatitis after heart transplantation. Eur J Gastroenterol Hepatol 8:267-71

Nakajima S, Watashi K, Kamisuki S, et al. (2013) Specific inhibition of hepatitis C virus entry into host hepatocytes by fungi-derived sulochrin and its derivatives. Biochem Biophys Res Commun 440:515-20

Nathanson MH, Boyer JL (1991) Mechanisms and regulation of bile secretion. Hepatology 14:551-66

Nattrass R, Faulkner L, Vocanson M, et al. (2015) Activation of Flucloxacillin-Specific CD8+ T-Cells With the Potential to Promote Hepatocyte Cytotoxicity in a Mouse Model. Toxicological sciences : an official journal of the Society of Toxicology

Nebert DW, Russell DW (2002) Clinical importance of the cytochromes P450. Lancet 360:1155-62

214 Noe J, Hagenbuch B, Meier PJ, St-Pierre MV (2001) Characterization of the mouse bile salt export pump overexpressed in the baculovirus system. Hepatology 33:1223-31

Noe J, Stieger B, Meier PJ (2002) Functional expression of the canalicular bile salt export pump of human liver. Gastroenterology 123:1659-66

Norlin M, Wikvall K (2007) Enzymes in the conversion of cholesterol into bile acids. Curr Mol Med 7:199-218

Northfield TC, McColl I (1973) Postprandial concentrations of free and conjugated bile acids down the length of the normal human small intestine. Gut 14:513-8

Noshiro M, Kawamoto T, Furukawa M, et al. (2004) Rhythmic expression of DEC1 and DEC2 in peripheral tissues: DEC2 is a potent suppressor for hepatic cytochrome P450s opposing DBP. Genes Cells 9:317-29

Noshiro M, Nishimoto M, Okuda K (1990) Rat liver cholesterol 7 alpha-hydroxylase. Pretranslational regulation for circadian rhythm. J Biol Chem 265:10036-41

Noshiro M, Usui E, Kawamoto T, et al. (2007) Multiple mechanisms regulate circadian expression of the gene for cholesterol 7alpha-hydroxylase (Cyp7a), a key enzyme in hepatic bile acid biosynthesis. J Biol Rhythms 22:299-311

Nossaman BD, Kadowitz PJ (2009) The role of the RhoA/rho-kinase pathway in pulmonary hypertension. Curr Drug Discov Technol 6:59-71

O’Donohue J, Oien KA, Donaldson P, et al. (2000) Co-amoxiclav jaundice: clinical and histological features and HLA class II association. Gut 47:717-20

Oda M, Price VM, Fisher MM, Phillips MJ (1974) Ultrastructure of bile canaliculi, with special reference to the surface coat and the pericanalicular web. Lab Invest 31:314-23

Ortiz DF, Moseley J, Calderon G, Swift AL, Li S, Arias IM (2004) Identification of HAX-1 as a protein that binds bile salt export protein and regulates its abundance in the apical membrane of Madin-Darby canine kidney cells. J Biol Chem 279:32761-70

Oshio C, Phillips MJ (1981) Contractility of bile canaliculi: implications for liver function. Science 212:1041-2

Ostapowicz G, Fontana RJ, Schiodt FV, et al. (2002) Results of a prospective study of acute liver failure at 17 tertiary care centers in the United States. Ann Intern Med 137:947-54

215 Oude Elferink RP, Paulusma CC, Groen AK (2006) Hepatocanalicular transport defects: pathophysiologic mechanisms of rare diseases. Gastroenterology 130:908-25

Padda MS, Sanchez M, Akhtar AJ, Boyer JL (2011) Drug-induced cholestasis. Hepatology 53:1377-87

Pandak WM, Stravitz RT, Lucas V, Heuman DM, Chiang JY (1996) Hep G2 cells: a model for studies on regulation of human cholesterol 7alpha-hydroxylase at the molecular level. Am J Physiol 270:G401-10

Park BK, Kitteringham NR, Maggs JL, Pirmohamed M, Williams DP (2005a) The role of metabolic activation in drug-induced hepatotoxicity. Annu Rev Pharmacol Toxicol 45:177-202

Park PJ, Heo SJ, Park EJ, et al. (2005b) Reactive oxygen scavenging effect of enzymatic extracts from Sargassum thunbergii. J Agric Food Chem 53:6666-72

Parks DJ, Blanchard SG, Bledsoe RK, et al. (1999) Bile acids: natural ligands for an orphan nuclear receptor. Science 284:1365-8

Pascual M, Theruvath T, Kawai T, Tolkoff-Rubin N, Cosimi AB (2002) Strategies to improve long-term outcomes after renal transplantation. The New England journal of medicine 346:580-90

Pauli-Magnus C, Meier PJ (2006) Hepatobiliary transporters and drug-induced cholestasis. Hepatology 44:778-87

Pauli-Magnus C, Stieger B, Meier Y, Kullak-Ublick GA, Meier PJ (2005) Enterohepatic transport of bile salts and genetics of cholestasis. Journal of hepatology 43:342-57

Paulusma CC, Kool M, Bosma PJ, et al. (1997) A mutation in the human canalicular multispecific organic anion transporter gene causes the Dubin-Johnson syndrome. Hepatology 25:1539-42

Paumgartner G, Beuers U (2002) Ursodeoxycholic acid in cholestatic liver disease: mechanisms of action and therapeutic use revisited. Hepatology 36:525-31

Pedersen JM, Matsson P, Bergstrom CA, et al. (2013) Early identification of clinically relevant drug interactions with the human bile salt export pump (BSEP/ABCB11). Toxicological sciences : an official journal of the Society of Toxicology 136:328-43

216 Peel M, Scribner A (2015) Semi-synthesis of cyclosporins. Biochimica et biophysica acta

Perez MJ, Briz O (2009) Bile-acid-induced cell injury and protection. World J Gastroenterol 15:1677-89

Pernelle K, Le Guevel R, Glaise D, et al. (2011) Automated detection of hepatotoxic compounds in human hepatocytes using HepaRG cells and image-based analysis of mitochondrial dysfunction with JC-1 dye. Toxicology and applied pharmacology 254:256-66

Pfeffer SR (2001) Rab GTPases: specifying and deciphering organelle identity and function. Trends Cell Biol 11:487-91

Phillips MJ, Oda M, Mak E, Fisher MM, Jeejeebhoy KN (1975) Microfilament dysfunction as a possible cause of intrahepatic cholestasis. Gastroenterology 69:48-58

Phillips MJ, Oda M, Yousef IM, Funatsu K (1981) Effects of cytochalasin B on membrane-associated microfilaments in a cell-free system. J Cell Biol 91:524- 30

Pickrell MD, Sawers R, Michael J (1988) Pregnancy after renal transplantation: severe intrauterine growth retardation during treatment with cyclosporin A. Br Med J (Clin Res Ed) 296:825

Pikuleva IA, Babiker A, Waterman MR, Bjorkhem I (1998) Activities of recombinant human cytochrome P450c27 (CYP27) which produce intermediates of alternative bile acid biosynthetic pathways. J Biol Chem 273:18153-60

Pineda Torra I, Claudel T, Duval C, Kosykh V, Fruchart JC, Staels B (2003) Bile acids induce the expression of the human peroxisome proliferator-activated receptor alpha gene via activation of the farnesoid X receptor. Mol Endocrinol 17:259-72

Plass JR, Mol O, Heegsma J, et al. (2002) Farnesoid X receptor and bile salts are involved in transcriptional regulation of the gene encoding the human bile salt export pump. Hepatology 35:589-96

Popper H (1968) Cholestasis. Annual review of medicine 19:39-56

Preitner N, Damiola F, Lopez-Molina L, et al. (2002) The orphan nuclear receptor REV-ERBalpha controls circadian transcription within the positive limb of the mammalian circadian oscillator. Cell 110:251-60

217 Prieto J, Garcia N, Marti-Climent JM, Penuelas I, Richter JA, Medina JF (1999) Assessment of biliary bicarbonate secretion in humans by positron emission tomography. Gastroenterology 117:167-72

Prieto J, Qian C, Garcia N, Diez J, Medina JF (1993) Abnormal expression of anion exchanger genes in primary biliary cirrhosis. Gastroenterology 105:572-8

Princen HM, Meijer P, Wolthers BG, Vonk RJ, Kuipers F (1991) Cyclosporin A blocks bile acid synthesis in cultured hepatocytes by specific inhibition of chenodeoxycholic acid synthesis. Biochem J 275 ( Pt 2):501-5

Pusl T, Beuers U (2007) Intrahepatic cholestasis of pregnancy. Orphanet J Rare Dis 2:26

Racusen LC, Kone BC, Solez K (1987) Early renal pathophysiology in an acute model of cyclosporine nephrotoxicity in rats. Ren Fail 10:29-37

Rappaport AM, Borowy ZJ, Lougheed WM, Lotto WN (1954) Subdivision of hexagonal liver lobules into a structural and functional unit; role in hepatic physiology and pathology. Anat Rec 119:11-33

Reczek D, Berryman M, Bretscher A (1997) Identification of EBP50: A PDZ- containing phosphoprotein that associates with members of the ezrin-radixin- moesin family. J Cell Biol 139:169-79

Reichen J, Paumgartner G (1976) Uptake of bile acids by perfused rat liver. Am J Physiol 231:734-42

Reshetnyak VI (2013) Physiological and molecular biochemical mechanisms of bile formation. World J Gastroenterol 19:7341-60

Rezzani R (2004) Cyclosporine A and adverse effects on organs: histochemical studies. Prog Histochem Cytochem 39:85-128

Ridlon JM, Kang DJ, Hylemon PB (2006) Bile salt biotransformations by human intestinal bacteria. J Lipid Res 47:241-59

Rodrigues AD, Lai Y, Cvijic ME, Elkin LL, Zvyaga T, Soars MG (2014) Drug-induced perturbations of the bile acid pool, cholestasis, and hepatotoxicity: mechanistic considerations beyond the direct inhibition of the bile salt export pump. Drug metabolism and disposition: the biological fate of chemicals 42:566-74

Rodriguez-Boulan E, Kreitzer G, Musch A (2005) Organization of vesicular trafficking in epithelia. Nat Rev Mol Cell Biol 6:233-47

218 Rodriguez-Boulan E, Salas PJ (1989) External and internal signals for epithelial cell surface polarization. Annu Rev Physiol 51:741-54

Rodriguez-Garay EA (2003) Cholestasis: human disease and experimental animal models. Ann Hepatol 2:150-8

Rogue A, Lambert C, Josse R, et al. (2011) Comparative gene expression profiles induced by PPARgamma and PPARalpha/gamma agonists in human hepatocytes. PloS one 6:e18816

Rogue A, Lambert C, Spire C, Claude N, Guillouzo A (2012) Interindividual variability in gene expression profiles in human hepatocytes and comparison with HepaRG cells. Drug metabolism and disposition: the biological fate of chemicals 40:151-8

Rolo AP, Palmeira CM, Holy JM, Wallace KB (2004) Role of mitochondrial dysfunction in combined bile acid-induced cytotoxicity: the switch between apoptosis and necrosis. Toxicological sciences : an official journal of the Society of Toxicology 79:196-204

Roma MG, Crocenzi FA, Mottino AD (2008) Dynamic localization of hepatocellular transporters in health and disease. World J Gastroenterol 14:6786-801

Roma MG, Milkiewicz P, Elias E, Coleman R (2000) Control by signaling modulators of the sorting of canalicular transporters in rat hepatocyte couplets: role of the cytoskeleton. Hepatology 32:1342-56

Roman ID, Coleman R (1994) Disruption of canalicular function in isolated rat hepatocyte couplets caused by cyclosporin A. Biochem Pharmacol 48:2181-8

Roman ID, Fernandez-Moreno MD, Fueyo JA, Roma MG, Coleman R (2003) Cyclosporin A induced internalization of the bile salt export pump in isolated rat hepatocyte couplets. Toxicological sciences : an official journal of the Society of Toxicology 71:276-81

Roman ID, Johnson GD, Coleman R (1996) S-adenosyl-L-methionine prevents disruption of canalicular function and pericanalicular cytoskeleton integrity caused by cyclosporin A in isolated rat hepatocyte couplets. Hepatology 24:134-40

Roman ID, Monte MJ, Gonzalez-Buitrago JM, Esteller A, Jimenez R (1990) Inhibition of hepatocytary vesicular transport by cyclosporin A in the rat: relationship with cholestasis and hyperbilirubinemia. Hepatology 12:83-91

219 Rose KA, Kostrubsky V, Sahi J (2006) Hepatobiliary disposition in primary cultures of dog and monkey hepatocytes. Mol Pharm 3:266-74

Rossaro L, Dowd SR, Ho C, Van Thiel DH (1988) 19F nuclear magnetic resonance studies of cyclosporine and model unilamellar vesicles: where does the drug sit within the membrane? Transplant Proc 20:41-5

Rossaro L, Mazzaferro V, Scotti-Foglieni CL, et al. (1991) Effect of cyclosporine on hepatic energy status and on fructose metabolism after portacaval shunt in dog as monitored by phosphorus-31 nuclear magnetic resonance spectroscopy in vivo. Hepatology 13:780-5

Rost D, Kartenbeck J, Keppler D (1999) Changes in the localization of the rat canalicular conjugate export pump Mrp2 in phalloidin-induced cholestasis. Hepatology 29:814-21

Rotolo FS, Branum GD, Bowers BA, Meyers WC (1986) Effect of cyclosporine on bile secretion in rats. Am J Surg 151:35-40

Russell DW (2003) The enzymes, regulation, and genetics of bile acid synthesis. Annu Rev Biochem 72:137-74

Russell DW, Setchell KD (1992) Bile acid biosynthesis. Biochemistry 31:4737-49

Ryffel B, Donatsch P, Madorin M, et al. (1983) Toxicological evaluation of cyclosporin A. Arch Toxicol 53:107-41

Sai Y, Nies AT, Arias IM (1999) Bile acid secretion and direct targeting of mdr1-green fluorescent protein from Golgi to the canalicular membrane in polarized WIF-B cells. J Cell Sci 112 ( Pt 24):4535-45

Sato N, Funayama N, Nagafuchi A, Yonemura S, Tsukita S, Tsukita S (1992) A gene family consisting of ezrin, radixin and moesin. Its specific localization at actin filament/plasma membrane association sites. J Cell Sci 103 ( Pt 1):131-43

Sauer P, Kloters-Plachky P, Stiehl A (1995) Inhibition of ileal bile acid transport by cyclosporin A in rat. Eur J Clin Invest 25:677-82

Scherer M, Gnewuch C, Schmitz G, Liebisch G (2009) Rapid quantification of bile acids and their conjugates in serum by liquid chromatography-tandem mass spectrometry. J Chromatogr B Analyt Technol Biomed Life Sci 877:3920-5

Schmitt M, Kubitz R, Lizun S, Wettstein M, Haussinger D (2001) Regulation of the dynamic localization of the rat Bsep gene-encoded bile salt export pump by anisoosmolarity. Hepatology 33:509-18

220 Schuetz EG, Strom S, Yasuda K, et al. (2001) Disrupted bile acid homeostasis reveals an unexpected interaction among nuclear hormone receptors, transporters, and cytochrome P450. J Biol Chem 276:39411-8

Schwarz M, Lund EG, Lathe R, Bjorkhem I, Russell DW (1997) Identification and characterization of a mouse oxysterol 7alpha-hydroxylase cDNA. J Biol Chem 272:23995-4001

Seward DJ, Koh AS, Boyer JL, Ballatori N (2003) Functional complementation between a novel mammalian polygenic transport complex and an evolutionarily ancient organic solute transporter, OSTalpha-OSTbeta. J Biol Chem 278:27473-82

Shaikh NA, Downar E, Butany J (1987) Amiodarone--an inhibitor of phospholipase activity: a comparative study of the inhibitory effects of amiodarone, chloroquine and chlorpromazine. Molecular and cellular biochemistry 76:163- 72

Sharanek A, Azzi PB, Al-Attrache H, et al. (2014) Different dose-dependent mechanisms are involved in early cyclosporine a-induced cholestatic effects in hepaRG cells. Toxicological sciences : an official journal of the Society of Toxicology 141:244-53

Shaw PJ, Hopfensperger MJ, Ganey PE, Roth RA (2007) Lipopolysaccharide and trovafloxacin coexposure in mice causes idiosyncrasy-like liver injury dependent on tumor necrosis factor-alpha. Toxicological sciences : an official journal of the Society of Toxicology 100:259-66

Shear NH, Spielberg SP (1988) Anticonvulsant hypersensitivity syndrome. In vitro assessment of risk. The Journal of clinical investigation 82:1826-32

Shefer S, Salen G, Nguyen L, et al. (1988) Competitive inhibition of bile acid synthesis by endogenous cholestanol and sitosterol in sitosterolemia with xanthomatosis. Effect on cholesterol 7 alpha-hydroxylase. The Journal of clinical investigation 82:1833-9

Sheff DR, Kroschewski R, Mellman I (2002) Actin dependence of polarized receptor recycling in Madin-Darby canine kidney cell endosomes. Mol Biol Cell 13:262- 75

Shen SY, Weir MR, Revie DR, Dagher FJ, Bentley FR, Chretien PB (1987) Differentiation of acute rejection from acute cyclosporine nephrotoxicity in renal transplants peripheral T cell subset counts. Transplant Proc 19:1776-9

221 Shin GT, Khanna A, Sharma VK, et al. (1997) In vivo hyperexpression of transforming growth factor-beta 1 in humans: stimulation by cyclosporine. Transplant Proc 29:284

Shoda J, Tanaka N, Osuga T, Matsuura K, Miyazaki H (1990) Altered bile acid metabolism in liver disease: concurrent occurrence of C-1 and C-6 hydroxylated bile acid metabolites and their preferential excretion into urine. J Lipid Res 31:249-59

Simon FR, Fortune J, Iwahashi M, Gartung C, Wolkoff A, Sutherland E (1996) Ethinyl estradiol cholestasis involves alterations in expression of liver sinusoidal transporters. Am J Physiol 271:G1043-52

Sinicrope FA, Dudeja PK, Bissonnette BM, Safa AR, Brasitus TA (1992) Modulation of P-glycoprotein-mediated drug transport by alterations in lipid fluidity of rat liver canalicular membrane vesicles. J Biol Chem 267:24995-5002

Smith AJ, van Helvoort A, van Meer G, et al. (2000) MDR3 P-glycoprotein, a phosphatidylcholine translocase, transports several cytotoxic drugs and directly interacts with drugs as judged by interference with nucleotide trapping. J Biol Chem 275:23530-9

Smith CR, Oshio C, Miyairi M, Katz H, Phillips MJ (1985) Coordination of the contractile activity of bile canaliculi. Evidence from spontaneous contractions in vitro. Lab Invest 53:270-4

Solaas K, Kase BF, Pham V, Bamberg K, Hunt MC, Alexson SE (2004) Differential regulation of cytosolic and peroxisomal bile acid amidation by PPAR alpha activation favors the formation of unconjugated bile acids. J Lipid Res 45:1051- 60

Song CS, Echchgadda I, Baek BS, et al. (2001) Dehydroepiandrosterone sulfotransferase gene induction by bile acid activated farnesoid X receptor. J Biol Chem 276:42549-56

Sookoian S, Castano G, Burgueno A, Gianotti TF, Pirola CJ (2008) Association of the multidrug-resistance-associated protein gene (ABCC2) variants with intrahepatic cholestasis of pregnancy. Journal of hepatology 48:125-32

Soroka CJ, Ballatori N, Boyer JL (2010) Organic solute transporter, OSTalpha- OSTbeta: its role in bile acid transport and cholestasis. Semin Liver Dis 30:178-85

222 Soroka CJ, Lee JM, Azzaroli F, Boyer JL (2001) Cellular localization and up- regulation of multidrug resistance-associated protein 3 in hepatocytes and cholangiocytes during obstructive cholestasis in rat liver. Hepatology 33:783-91

Stallone G, Infante B, Schena A, et al. (2004) [Cardiovascular risk and renal transplantation]. G Ital Nefrol 21:144-55

Staudinger J, Liu Y, Madan A, Habeebu S, Klaassen CD (2001) Coordinate regulation of xenobiotic and bile acid homeostasis by pregnane X receptor. Drug metabolism and disposition: the biological fate of chemicals 29:1467-72

Stepan AF, Walker DP, Bauman J, et al. (2011) Structural alert/reactive metabolite concept as applied in medicinal chemistry to mitigate the risk of idiosyncratic drug toxicity: a perspective based on the critical examination of trends in the top 200 drugs marketed in the United States. Chemical research in toxicology 24:1345-410

Stephens C, Lopez-Nevot MA, Ruiz-Cabello F, et al. (2013) HLA alleles influence the clinical signature of amoxicillin-clavulanate hepatotoxicity. PloS one 8:e68111

Stieger B (2010) Role of the bile salt export pump, BSEP, in acquired forms of cholestasis. Drug Metab Rev 42:437-45

Stieger B (2011) The role of the sodium-taurocholate cotransporting polypeptide (NTCP) and of the bile salt export pump (BSEP) in physiology and pathophysiology of bile formation. Handbook of experimental pharmacology:205-59

Stieger B, Fattinger K, Madon J, Kullak-Ublick GA, Meier PJ (2000) Drug- and estrogen-induced cholestasis through inhibition of the hepatocellular bile salt export pump (Bsep) of rat liver. Gastroenterology 118:422-30

Stieger B, Meier Y, Meier PJ (2007) The bile salt export pump. Pflugers Arch 453:611-20

Strautnieks SS, Bull LN, Knisely AS, et al. (1998) A gene encoding a liver-specific ABC transporter is mutated in progressive familial intrahepatic cholestasis. Nature genetics 20:233-8

Stroup D, Crestani M, Chiang JY (1997) Identification of a bile acid response element in the cholesterol 7 alpha-hydroxylase gene CYP7A. Am J Physiol 273:G508- 17

223 Sudo R, Kohara H, Mitaka T, Ikeda M, Tanishita K (2005) Coordinated movement of bile canalicular networks reconstructed by rat small hepatocytes. Ann Biomed Eng 33:696-708

Survase SA, Kagliwal LD, Annapure US, Singhal RS (2011) Cyclosporin A--a review on fermentative production, downstream processing and pharmacological applications. Biotechnol Adv 29:418-35

Swift B, Pfeifer ND, Brouwer KL (2010) Sandwich-cultured hepatocytes: an in vitro model to evaluate hepatobiliary transporter-based drug interactions and hepatotoxicity. Drug Metab Rev 42:446-71

Szabo M, Veres Z, Baranyai Z, Jakab F, Jemnitz K (2013) Comparison of human hepatoma HepaRG cells with human and rat hepatocytes in uptake transport assays in order to predict a risk of drug induced hepatotoxicity. PloS one 8:e59432

Szalowska E, Stoopen G, Groot MJ, Hendriksen PJ, Peijnenburg AA (2013) Treatment of mouse liver slices with cholestatic hepatotoxicants results in down-regulation of Fxr and its target genes. BMC Med Genomics 6:39

Takikawa H, Otsuka H, Beppu T, Seyama Y, Yamakawa T (1983) Serum concentrations of bile acid glucuronides in hepatobiliary diseases. Digestion 27:189-95

Tamai I, Nozawa T, Koshida M, Nezu J, Sai Y, Tsuji A (2001) Functional characterization of human organic anion transporting polypeptide B (OATP-B) in comparison with liver-specific OATP-C. Pharm Res 18:1262-9

Teng S, Jekerle V, Piquette-Miller M (2003) Induction of ABCC3 (MRP3) by pregnane X receptor activators. Drug metabolism and disposition: the biological fate of chemicals 31:1296-9

Teng S, Piquette-Miller M (2008) Regulation of transporters by nuclear hormone receptors: implications during inflammation. Mol Pharm 5:67-76

Testa B, Kramer SD (2008) The biochemistry of drug metabolism--an introduction: part 4. reactions of conjugation and their enzymes. Chem Biodivers 5:2171- 336

Thibault N, Claude JR, Ballet F (1992) Actin filament alteration as a potential marker for cholestasis: a study in isolated rat hepatocyte couplets. Toxicology 73:269- 79

224 Thomassen PA (1979) Urinary bile acids in late pregnancy and in recurrent cholestasis of pregnancy. Eur J Clin Invest 9:425-32

Tournel G, Houssaye C, Humbert L, et al. (2011) Acute arsenic poisoning: clinical, toxicological, histopathological, and forensic features. J Forensic Sci 56 Suppl 1:S275-9

Trauner M, Arrese M, Lee H, Boyer JL, Karpen SJ (1998a) Endotoxin downregulates rat hepatic ntcp gene expression via decreased activity of critical transcription factors. The Journal of clinical investigation 101:2092-100

Trauner M, Arrese M, Soroka CJ, et al. (1997) The rat canalicular conjugate export pump (Mrp2) is down-regulated in intrahepatic and obstructive cholestasis. Gastroenterology 113:255-64

Trauner M, Boyer JL (2003) Bile salt transporters: molecular characterization, function, and regulation. Physiol Rev 83:633-71

Trauner M, Fickert P, Halilbasic E, Moustafa T (2008) Lessons from the toxic bile concept for the pathogenesis and treatment of cholestatic liver diseases. Wien Med Wochenschr 158:542-8

Trauner M, Fickert P, Stauber RE (1999) Inflammation-induced cholestasis. J Gastroenterol Hepatol 14:946-59

Trauner M, Meier PJ, Boyer JL (1998b) Molecular pathogenesis of cholestasis. The New England journal of medicine 339:1217-27

Trauner M, Wagner M, Fickert P, Zollner G (2005) Molecular regulation of hepatobiliary transport systems: clinical implications for understanding and treating cholestasis. J Clin Gastroenterol 39:S111-24

Treiber A, Schneiter R, Hausler S, Stieger B (2007) Bosentan is a substrate of human OATP1B1 and OATP1B3: inhibition of hepatic uptake as the common mechanism of its interactions with cyclosporin A, rifampicin, and sildenafil. Drug metabolism and disposition: the biological fate of chemicals 35:1400-7

Treyer A, Musch A (2013) Hepatocyte polarity. Compr Physiol 3:243-87

Tsukada N, Azuma T, Phillips MJ (1994) Isolation of the bile canalicular actin-myosin II motor. Proceedings of the National Academy of Sciences of the United States of America 91:6919-23

225 Tsukita S, Oishi K, Sato N, Sagara J, Kawai A, Tsukita S (1994) ERM family members as molecular linkers between the cell surface glycoprotein CD44 and actin-based cytoskeletons. J Cell Biol 126:391-401

Tsukita S, Tsukita S (1989) Isolation of cell-to-cell adherens junctions from rat liver. J Cell Biol 108:31-41

Tsukita S, Yonemura S (1999) Cortical actin organization: lessons from ERM (ezrin/radixin/moesin) proteins. J Biol Chem 274:34507-10

Uetrecht JP (1999) New concepts in immunology relevant to idiosyncratic drug reactions: the "danger hypothesis" and innate immune system. Chemical research in toxicology 12:387-95 van Berge Henegouwen GP, Brandt KH, Eyssen H, Parmentier G (1976) Sulphated and unsulphated bile acids in serum, bile, and urine of patients with cholestasis. Gut 17:861-9

Vaziri ND, Liang K, Azad H (2000) Effect of cyclosporine on HMG-CoA reductase, cholesterol 7alpha-hydroxylase, LDL receptor, HDL receptor, VLDL receptor, and lipoprotein lipase expressions. J Pharmacol Exp Ther 294:778-83

Venkataramanan R, Starzl TE, Yang S, et al. (1985) Biliary Excretion of Cyclosporine in Liver Transplant Patients. Transplant Proc 17:286-289 von Wartburg A, Traber R (1986) Chemistry of the natural cyclosporin metabolites. Prog Allergy 38:28-45

Vuilleumier N, Rossier MF, Chiappe A, et al. (2006) CYP2E1 genotype and isoniazid- induced hepatotoxicity in patients treated for latent tuberculosis. European journal of clinical pharmacology 62:423-9

Wagner M, Zollner G, Trauner M (2009) New molecular insights into the mechanisms of cholestasis. Journal of hepatology 51:565-80

Wakabayashi Y, Dutt P, Lippincott-Schwartz J, Arias IM (2005) Rab11a and myosin Vb are required for bile canalicular formation in WIF-B9 cells. Proceedings of the National Academy of Sciences of the United States of America 102:15087- 92

Wang R, Liu L, Sheps JA, et al. (2013) Defective canalicular transport and toxicity of dietary ursodeoxycholic acid in the abcb11-/- mouse: transport and gene expression studies. Am J Physiol Gastrointest Liver Physiol 305:G286-94

226 Warner DJ, Chen H, Cantin LD, et al. (2012) Mitigating the inhibition of human bile salt export pump by drugs: opportunities provided by physicochemical property modulation, in silico modeling, and structural modification. Drug metabolism and disposition: the biological fate of chemicals 40:2332-41

Watanabe N, Kagawa T, Kojima S, et al. (2006) Taurolithocholate impairs bile canalicular motility and canalicular bile secretion in isolated rat hepatocyte couplets. World J Gastroenterol 12:5320-5

Watanabe N, Tsukada N, Smith CR, Edwards V, Phillips MJ (1991a) Permeabilized hepatocyte couplets. Adenosine triphosphate-dependent bile canalicular contractions and a circumferential pericanalicular microfilament belt demonstrated. Lab Invest 65:203-13

Watanabe N, Tsukada N, Smith CR, Phillips MJ (1991b) Motility of bile canaliculi in the living animal: implications for bile flow. J Cell Biol 113:1069-80

Watanabe T, Hosoya H, Yonemura S (2007) Regulation of myosin II dynamics by phosphorylation and dephosphorylation of its light chain in epithelial cells. Mol Biol Cell 18:605-16

Wehner F, Guth D (1991) Electric properties of rat liver cell cultures on gas- permeable membranes. Am J Physiol 261:G407-16

Welch MA, Kock K, Urban TJ, Brouwer KL, Swaan PW (2015) Toward predicting drug-induced liver injury: parallel computational approaches to identify multidrug resistance protein 4 and bile salt export pump inhibitors. Drug metabolism and disposition: the biological fate of chemicals 43:725-34

Wenger RM (1990) Structures of cyclosporine and its metabolites. Transplant Proc 22:1104-8

Wilkening S, Stahl F, Bader A (2003) Comparison of primary human hepatocytes and hepatoma cell line Hepg2 with regard to their biotransformation properties. Drug metabolism and disposition: the biological fate of chemicals 31:1035-42

Wilkinson GR (2005) Drug metabolism and variability among patients in drug response. The New England journal of medicine 352:2211-21

Wonigeit K, Kohlhaw K, Winkler M, Schaefer O, Pichlmayr R (1990) Cyclosporine monitoring in liver allograft recipients: two distinct patterns of blood level derangement associated with nephrotoxicity. Transplant Proc 22:1305-11

Wood RL (1965) An Electron Microscope Study of Developing Bile Canaliculi in the Rat. Anat Rec 151:507-29

227 Wuarin J, Schibler U (1990) Expression of the liver-enriched transcriptional activator protein DBP follows a stringent circadian rhythm. Cell 63:1257-66

Yang K, Kock K, Sedykh A, Tropsha A, Brouwer KL (2013) An updated review on drug-induced cholestasis: mechanisms and investigation of physicochemical properties and pharmacokinetic parameters. Journal of pharmaceutical sciences 102:3037-57

Yasumiba S, Tazuma S, Ochi H, Chayama K, Kajiyama G (2001) Cyclosporin A reduces canalicular membrane fluidity and regulates transporter function in rats. Biochem J 354:591-6

Yasuura S, Ueno T, Watanabe S, Hirose M, Namihisa T (1989) Immunocytochemical localization of myosin in normal and phalloidin-treated rat hepatocytes. Gastroenterology 97:982-9

Yin L, Lazar MA (2005) The orphan nuclear receptor Rev-erbalpha recruits the N- CoR/histone deacetylase 3 corepressor to regulate the circadian Bmal1 gene. Mol Endocrinol 19:1452-9

Yin L, Wang J, Klein PS, Lazar MA (2006) Nuclear receptor Rev-erbalpha is a critical lithium-sensitive component of the circadian clock. Science 311:1002-5

Yonemura S, Hirao M, Doi Y, et al. (1998) Ezrin/radixin/moesin (ERM) proteins bind to a positively charged amino acid cluster in the juxta-membrane cytoplasmic domain of CD44, CD43, and ICAM-2. J Cell Biol 140:885-95

Zamek-Gliszczynski MJ, Xiong H, Patel NJ, Turncliff RZ, Pollack GM, Brouwer KL (2003) Pharmacokinetics of 5 (and 6)-carboxy-2’,7’-dichlorofluorescein and its diacetate promoiety in the liver. J Pharmacol Exp Ther 304:801-9

Zelcer N, van de Wetering K, de Waart R, et al. (2006) Mice lacking Mrp3 (Abcc3) have normal bile salt transport, but altered hepatic transport of endogenous glucuronides. Journal of hepatology 44:768-75

Zhang M, Chiang JY (2001) Transcriptional regulation of the human sterol 12alpha- hydroxylase gene (CYP8B1): roles of heaptocyte nuclear factor 4alpha in mediating bile acid repression. J Biol Chem 276:41690-9

Zhong Z, Connor HD, Yin M, Wheeler MD, Mason RP, Thurman RG (2001) Viral delivery of superoxide dismutase gene reduces cyclosporine A-induced nephrotoxicity. Kidney Int 59:1397-404

228 Zhou Q, Hennenberg M, Trebicka J, et al. (2006) Intrahepatic upregulation of RhoA and Rho-kinase signalling contributes to increased hepatic vascular resistance in rats with secondary biliary cirrhosis. Gut 55:1296-305

Ziegler K, Frimmer M (1986) Cyclosporin A and a diaziridine derivative inhibit the hepatocellular uptake of cholate, phalloidin and rifampicin. Biochimica et biophysica acta 855:136-42

Zimmerman HJ (1979) Intrahepatic cholestasis. Arch Intern Med 139:1038-45

Zollner G, Fickert P, Silbert D, et al. (2003) Adaptive changes in hepatobiliary transporter expression in primary biliary cirrhosis. Journal of hepatology 38:717-27

Zollner G, Fickert P, Zenz R, et al. (2001) Hepatobiliary transporter expression in percutaneous liver biopsies of patients with cholestatic liver diseases. Hepatology 33:633-46

Zollner G, Marschall HU, Wagner M, Trauner M (2006a) Role of nuclear receptors in the adaptive response to bile acids and cholestasis: pathogenetic and therapeutic considerations. Mol Pharm 3:231-51

Zollner G, Trauner M (2006) Molecular mechanisms of cholestasis. Wien Med Wochenschr 156:380-5

Zollner G, Trauner M (2009) Nuclear receptors as therapeutic targets in cholestatic liver diseases. Br J Pharmacol 156:7-27

Zollner G, Wagner M, Moustafa T, et al. (2006b) Coordinated induction of bile acid detoxification and alternative elimination in mice: role of FXR-regulated organic solute transporter-alpha/beta in the adaptive response to bile acids. Am J Physiol Gastrointest Liver Physiol 290:G923-32

229