From Mount Everest to Mount Dora The 8 Million Year Journey of Citrus to Florida
Fred G. Gmitter Jr. CREC Advanced Citriculture 2019 •From where did Citrus come?
•What are the relationships among different kinds of citrus?
•What are the connections of contemporary citrus plants to their ancestors?
•What have citrus scientists thought about such questions before, and what do genome sequences reveal?
•What has driven the processes of diversification and domestication?
•And what is the connection between Mount Everest and Mount Dora?
Questions to be Answered • Botany: characteristics of citrus plants
• Taxonomy: systems to describe relationships
• Genome Sequences: fundamental basis of the story
• Geology: our ever changing planet
• History: the recent events in the journey
Parts of the Story Botanical Diversity •Taxonomy is a scheme or a system of classification
•It is an artificial system that attempts to describe natural relationships among organisms
•Being artificial and of human design, it is inherently flawed; prone to error, misunderstanding and bias
•Despite its shortcomings, taxonomy is useful: Sweet orange = Citrus sinensis (though not a true species)
•New tools, based on unbiased data, and not influenced by human opinions or by environmental effects, help to clarify true relationships
Citrus Taxonomy •Multiple taxonomic systems have been developed
•Tanaka vs. Swingle vs. Barrett vs. Hutchison
•“Splitter” vs. “Lumpers”
•Tanaka: 157 species, including C. clementina and C. temple for Clementine mandarin & Temple orange
•Swingle: 16 species, including C. sinensis & C. paradisi
•Barrett: 3 (or 4) “true biological species”: C. reticulata, C. medica & C. maxima
•Hutchison (unpublished comment): “They should all just be called Citrus citrus because they interbreed”
Citrus Taxonomy
•Morphological characteristics •Pulp vesicles with or without oil •Segment number •Petiole wings +/- •Stamen numbers •Peel adherent or loose •Fruit size •Seed size •Etc. •Chemical characteristics •Limonoids •PMFs •Coumarins •Peel oil volatiles •Genome sequences •Unbiased, not affected by environment, or human opinions
The Bases for Classification Satsuma vs. Ponkan C. unshiu ? C. reticulata ? From Swingle and Reese, Botany of Citrus in The Citrus Industry (1967)
In regard to making the satsuma a separate species from Citrus reticulata, he [Tanaka] says: ‘Pulp qualities are…the real object of human interest… The public knows more about such specific distinctions than a few technicians…To the Japanese who eat 500,000 tons of satsuma fruit a year, they would never believe it to be a mere variety or clone of either Ponkan (C. reticulata) or Kunenbo (C. noblis)…
It is a human belief and science should endorse it.’
The Bases for Classification What is a mandarin? the complex and confusing state of citrus taxonomy
C. reticulata ~ ‘pure mandarin’ species curiositycounts.com •The blueprint: Full length sequence of the DNA making up citrus chromosomes, to make citrus what it is
•Understand kinship relationships among diverse types of citrus
•Admixture mapping in citrus “species” (alternative, more precise approach than botanically based taxonomy)
•Develop timeline of citrus evolutionary events
•A basis for modern breeding approaches
Value of Genome Sequence Information Citrus Octet & 2 Reference Genomes
Scientific Common Name Abbr. Seq. Platform Name Siamese Sweet LAP C. maxima Illum. pummelo Chandler pummelo CHP C. maxima Illum.
Ponkan mandarin PKM C. reticulata 454/4x
Willowleaf mandarin WLM C. x deliciosa Illum.
Sweet orange SWO C. x sinensis 454
Seville sour orange SSO C. x aurantium Illum. Clementine CLM C. x clementina Illum. mandarin
Haploid Clementine HCR C. x clementina Sanger
W. Murcott mandarin WMM Undefined Illum. •Derived from two ancestral species C. maxima (pummelo) and C. reticulata (mandarin)
•The two pummelos (LAP, CHP) are pure C. maxima
•The two mandarin types (PKM, WLM) are pure C. reticulata
•Both sweet and sour oranges are ancient inter-specific hybrids with unknown ancestry
•Clementine and W. Murcott mandarins are more recent hybrids
Previous Presumptions: The Octet •cpDNA maternally inherited (no inter- specific hybrids)
•C. maxima cluster: LAP, CHP, SWO, SSO
•C. reticulata cluster: PKM, WLM, CLM, WMM
cpDNA Grouping: 2 Ancestors •DNA structure: a string of nucleotides, ACTG, the order of which defines genes
•SNP = Single Nucleotide Polymorphism
•835,000 diagnostic SNPS were identified to distinguish mandarin from pummelo
•For example •ACCTGGATTAGCCAGGTTAG •ACCTGGATAAGCCAGGTTAG
SNP Markers to Distinguish Species •Sweet oranges, like people, have chromosomes that come in pairs
•We can “scan” along chromosomes to find the regions that contain either pummelo or mandarin signature sequences (the haplotype)
•If sweet orange was a direct hybrid of the two, then the entire genome would be ½ pummelo and ½ mandarin
•It is not that way, however
Sweet Orange: some type of hybrid between pummelo and mandarin Two Scales in Citrus Sequence Diversity
SWO nucleotide diversity SNP/kb
inter-specific ~ 2%
within-species ~ 0.6% The two pummelos are pure C. max PKM and WLM are NOT pure C. ret
Genome reconstruction of the ancestral species is complicated by the absence of a ‘pure mandarin’ genome Admixture Proportion in 9 Citrus Genomes
1) no pure C. ret among 8 genomes PKM has max/max segments 2) SWO is mostly max/ret, but also has ret/ret and max/max 3) SSO is an F1 cross = max x ret Dissecting the Citrus Genomes: Admixture Mapping How to make an orange?
2 models for the origin of SWO
1) SWO = (max x ret) x PKM 2) SWO = ((max x ret) x max ) x PKM model 1: SWO=(max x ret) x PKM A=ret B=max SWO=(AB) X AA+B 50% AB:50%AA model 2: SWO=((max x ret) x max) x PKM A=ret B=max SWO=((AB) X BB) X AA+B Sweet Orange Origin
Model 1) SWO = (max x ret) x PKM less than 1% prob. but still possible from 100s of selection experiments
Model 2) SWO = ((max x ret) x max ) x PKM most likely, with mean of distribution matching observed C. max, C. ret and hybrid proportions.
But, what was the seed parent represented by (max x ret) x max?
And, what parents can be used to reconstruct and improve sweet orange?
ADMIXTURE PROPORTIONS
Hybrid origin of commercial varieties
C. reticulata x C. medica) C. micrantha x C. medica C. maxima x C. sinensis
(C. limonia) C. aurantifolia, C. paradisi
C. maxima x C reticulata. C. aurantium x C. medica C. reticulata x C. sinensis
(C. aurantium) (C. sinensis) (C. limon) C. clementine
Barrett and Rhodes, 1976; Nicolosi et al. 2000; Roose et al. 2009; Li et al. 2010; Garcia-Lor et al. 2012; Ollitrault et al. 2012; Garcia-Lor et al., 2013; Penjor et al. 2013; Wu et al. 2014; EVOLUTION The Perspective of Time
• Tectonics: the collision of the Indian and Asian plates (35-55 MYA)
• Center of origin for citrus in the area currently covered by Yunnan province China, Myanmar, and NE India
• Late Miocene (~8 MYA), the region was uplifted and climate dramatically changed from persistent wet monsoon to a drier climate, with seasonal heavy rains
• Major biota changes; mammals migrated and many plants likewise were spread and diversified, mostly in a west to east direction
• Current citrus are mesophytes, with xerophytic adaptations: waxy leaves and fruit peel; individual juice sacs; low photosynthesis and transpiration rates
• Early Pliocene (~4MYA), Australian citrus progenitors moved from SE Asia into Australia
Geological Events Trigger Diversification & Evolution Citrus linczangensis fossil 8mya Int. J. Plant Sci. 174:1201–1207. 2013. Ailaoshan, Yunnan, PRC Mutations, SNPs, Simulation
Model
Coalescent simul.
Allele frequency spectrum
Wallace Line: Ice Age Glaciation Opens the Door
Domestication • Palatability: Mmmm… tastes GOOD!
• Fruit Size: Share with the family!
• Polyembryony: Let’s grow more!
Driving Forces of Domestication GWAS to Identify Genes Associated with Acidity
Wu et al. Unpublished data Pummelo Admixture and Fruit Size
Wu et al. Unpublished data Identifying Genes for Polyembryony
Wang et al. Nat. Genet. 49:765-772 •From the region of origin, citrus fruit, seeds and plants migrated
•Cultivated in China and India over 3000 years
•First wave (citrons) moved by land and sea, to Persia and the Median kingdom, by 6th century BCE, then to Mediterranean by 4th century BCE by Greeks and Romans
•Second wave (sour orange and lemon), 8th century CE by Arab traders through North Africa, Sicily, Italy and Spain
The Global Migration of Citrus •Fruit spread throughout temperate regions of Europe
•Portuguese brought sweet orange to Europe from southern China in the 15th or 16th century
•Mandarins introduced much later to England, 1805, the spread
•European sailors brought citrus to the Americas •Sour orange to St. Augustine •Sweet orange to Brazil and elsewhere •Pummelos, from SE Asia to the Carribean •Origin of grapefruit
The Global Migration of Citrus Grapefruit Origins
Walters Radiation Star Ruby Hudson 1970 Flame 1887 1930 1987
Safety Fawcett Red Harbor,FL Foster 1823 1940 1907 Rio Red Henderson 1984 ? Duncan Thompson 1840s 1913
First one Marsh Ruby Red Ray Ruby 1700 1850? 1929 1977 1880? •Genome sequence comparisons revealed the origin, evolution, and diversification of citrus •Changes in DNA sequences, plate tectonics, and prevailing climatic conditions are coincident in time and help to explain evolutionary events •Exploring the genetic content of the genome sequences provided clues to the driving factors of citrus domestication •Humankind has accelerated the movement of Citrus and will continue to shape the future of our favorite fruit tree •Genome-based tools will enhance our ability to develop improved forms of citrus Conclusions •Florida Citrus Production Research Advisory Council (FCPRAC), and the Citrus Research and Development Foundation (CRDF) on behalf of the Florida Citrus Industry •Roche Applied Science/454 Life Science •USDOE-Joint Genome Institute •International funding from agencies and programs in Brazil, France, Italy and Spain •Collaborators: Guohong (Albert) Wu and Dan Rokhsar (USDOE-JGI); Manuel Talon (IVIA, Valencia, Spain) and a long list of many others…
ACKNOWLEDGMENTS Thanks for your attention!