DOCSLIB.ORG

Prenatal Exposure to a Maternal High-Fat Diet Affects Histone Modification of Cardiometabolic Genes in Newborn Rats

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Prenatal Exposure to a Maternal High-Fat Diet Affects Histone Modification of Cardiometabolic Genes in Newborn Rats nutrients Article Prenatal Exposure to a Maternal High-Fat Diet Affects Histone Modification of Cardiometabolic Genes in Newborn Rats Bijaya Upadhyaya 1, Tricia Larsen 2, Shivon Barwari 1, Eli J. Louwagie 3, Michelle L. Baack 2,3,4,* and Moul Dey 1,* 1 Department of Health and Nutritional Sciences, Box 2203, South Dakota State University, Brookings, SD 57007, USA; [email protected] (B.U.); [email protected] (S.B.) 2 Children’s Health Research Center, Sanford Research, Sioux Falls, SD 57104, USA; [email protected] 3 Sanford School of Medicine-University of South Dakota, Sioux Falls, SD 57105, USA; [email protected] 4 Children’s Health Specialty Clinic, Sanford Children’s Hospital, Sioux Falls, SD 57117, USA * Correspondence: [email protected] (M.L.B.); [email protected] (M.D.); Tel.: +1-(605)-312-6420 (M.L.B.); +1-(605)-688-4050 (M.D.) Received: 18 March 2017; Accepted: 14 April 2017; Published: 20 April 2017 Abstract: Infants born to women with diabetes or obesity are exposed to excess circulating fuels during fetal heart development and are at higher risk of cardiac diseases. We have previously shown that late-gestation diabetes, especially in conjunction with a maternal high-fat (HF) diet, impairs cardiac functions in rat-offspring. This study investigated changes in genome-wide histone modifications in newborn hearts from rat-pups exposed to maternal diabetes and HF-diet. Chromatin-immunoprecipitation-sequencing revealed a differential peak distribution on gene promoters in exposed pups with respect to acetylation of lysines 9 and 14 and to trimethylation of lysines 4 and 27 in histone H3 (all, false discovery rate, FDR < 0.1). In the HF-diet exposed offspring, 54% of the annotated genes showed the gene-activating mark trimethylated lysine 4. Many of these genes (1) are associated with the “metabolic process” in general and particularly with “positive regulation of cholesterol biosynthesis” (FDR = 0.03); (2) overlap with 455 quantitative trait loci for blood pressure, body weight, serum cholesterol (all, FDR < 0.1); and (3) are linked to cardiac disease susceptibility/progression, based on disease ontology analyses and scientific literature. These results indicate that maternal HF-diet changes the cardiac histone signature in offspring suggesting a fuel-mediated epigenetic reprogramming of cardiac tissue in utero. Keywords: cardiometabolic disease; chromatin-immunoprecipitation sequencing; developmental programing; histone modifications; maternal high-fat diet 1. Introduction Diabetes complicates an estimated 17.8% of all pregnancies in the U.S. [1,2]. Its rising incidence parallels an increasing trend in obesity, as 34.4% of US women of childbearing age are obese [3]. Infants born to women with diabetes or obesity are at higher risk of cardiovascular disease (CVD) at birth and throughout life [4–7], purportedly through fuel-mediated influences on the developing heart. Both diabetes and hyperlipidemia influence cardiometabolic health in adults, playing a pivotal role in the pathophysiology of CVD over time [8–10]. Using a rat model, we have already demonstrated that in utero exposure to diabetes, especially in conjunction with a maternal high-fat (HF) diet, impairs cardiac function through metabolic disturbances in the developing fetal heart [11]. The objective of this Nutrients 2017, 9, 407; doi:10.3390/nu9040407 www.mdpi.com/journal/nutrients Nutrients 2017, 9, 407 2 of 21 study was to determine if exposed offspring from our model have cardiac-specific epigenetic marks that could help explain mechanisms of developmentally-programmed CVD. The influence of genetic susceptibility and nutritional environment in utero are critical in shaping the metabolic fate of offspring for the rest of their lives [12–14]. Mounting evidence demonstrates the importance of transcriptional regulation in normal heart development [15] and metabolic health into adulthood [16]. The heart is the first embryonic organ to function, already beating by three weeks of gestational age [17]. The fully developed heart beats over 100,000 times per day, thus requiring exquisite energy efficiency under a variety of workloads and metabolic circumstances (e.g., aerobic, anaerobic, rest, exercise, or starvation) [18]. For this reason, the heart is an ‘omnivore’, using all types of fuels to make up to 35 kg of adenosine triphosphate (ATP) per day to support normal circulation [19]. Cardiac metabolism changes with development. Given the relatively low levels of oxygen and the readily available fuel supply of the in utero environment, the developing heart favors glycolytic metabolism, in contrast to the adult resting heart, which favors fatty acid oxidation [18,20]. The ability to undergo cardiometabolic switching is essential to long-term heart health. In diabetic and/or obese adults, increased circulating levels of metabolic fuels and impaired insulin sensitivity may lead to changes in cardiac bioenergetics that result in diabetic cardiomyopathy [10]. We have previously shown that a maternal diet that is high in fat, especially in conjunction with maternal diabetes, induces similar lipotoxic effects in the developing offspring’s heart [11,20]. These findings underscore the critical need for research that helps to understand the underlying mechanisms involved in fuel-mediated developmental programming of cardiometabolic disease. Over-nutrition during the prenatal period can induce epigenetic changes to alter chromatin structure and influence lasting metabolic health [16]. Specifically, epigenetic processes are a central underlying mechanism in the developmental origin of type 2 diabetes and CVD [21]. Two major types of epigenetic marks, DNA methylation and posttranslational modifications (PTMs) of histone tails, crosstalk with each other and lead to gene expression changes [22]. In particular, environmentally inducible as well as inheritable PTMs may be involved in both gene activation and repression [14] by changing the chromatin state (open or closed), which directly affects the accessibility of promoter regions for the initiation of transcription [23]. The existence of a cardiac-specific, genome-wide histone signature in offspring exposed prenatally to a maternal HF diet, alone or alongside maternal diabetes, has not been established. To investigate this, we used our rat model [11] to delineate cardiac-specific histone modifications associated with genes involved in cardiometabolic functions. Specifically, we investigated the effect of in utero exposure to a maternal HF diet in conjunction with streptozotocin-induced, late-gestation diabetes on four major histone PTMs in neonatal cardiac tissue. We report genome-wide changes in gene-activation and gene-suppressive histone signatures and identify associated genes and quantitative trait loci (QTLs) that are linked to metabolic functions. 2. Materials and Methods 2.1. Animal Study and Dietary Intervention Animal work followed the guidelines set forth by the Animal Welfare Act and the National Institutes of Health Guide for the Care and Use of Laboratory Animals and was under approval from the Sanford Research Institutional Animal Care and Use Committee. The protocol titled “Cardiovascular effects of late gestation hyperglycemia and high fat diet in offspring of diabetic mothers: Are lipids the culprit?” was approved on 23 September 2014 (93-08-17B). Methods and model characteristics are reported in detail [11,24]. In short, female Sprague-Dawley rats (Harlan Laboratories, Indianapolis, IN, USA) received a control diet (CD) with 18% of calories as fat (TD2018 Teklad; Harlan Laboratories, Madison, WI, USA) or HF diet with 40% of calories as fat (TD95217 custom diet Teklad; Harlan Laboratories) for at least 28 days prior to breeding. Females were bred with normal, CD-fed males. Gestational day 0 was designated by a positive swab for spermatozoa. On gestational day 14, dams received either 0.09 M citrate buffer (CB) placebo or 65 mg/kg of intraperitoneal streptozotocin Nutrients 2017, 9, 407 3 of 21 Nutrients 2017, 9, 407 3 of 20 (STZ) (Sigma Life Sciences, St. Louis, MO, USA) to induce diabetes (Figure1). Thereafter, blood glucose levels(Figure were 1). Thereafter, kept between blood 200–400 glucose mg/dL levels andwere ketones kept between were kept 200–400 to a minimum mg/dL and through ketones monitoring were kept andto a twiceminimum daily through sliding scalemonitoring insulin and administration. twice daily sliding Offspring scale delivered insulin administration. normally on gestational Offspring daydelivered 22. Newborn normally rat on hearts gestationa were collectedl day 22. from Newborn four different rat hearts groups: were controls collected (control fromdiet four and differentcitrate buffergroups: exposed controls or (control CC), diabetes-exposed diet and citrate buffer (control expo dietsed and or CC),STZ diabetes-exposed exposed or CS), diet-exposed (control diet (andhigh STZ fat andexposedcitrate or bufferCS), diet-exposed exposed or HC), (high and fat combination-exposed and citrate buffer exposed (high fator andHC),S TZand exposed combination-exposed or HS). Hearts ◦ were(high snapfat and frozen STZ andexposed stored or atHS).−80 HearCts until were analyses. snap frozen and stored at −80 °C until analyses. Figure 1. Study timeline.timeline. FemaleFemalerats rats were were randomized randomized into into four four groups. groups. Two Two groups groups were were fed fed high high fat dietfat diet (HF) (HF) and twoand controltwo control diet (CD)
Load more

Recommended publications
  • Supplemental Table 1 Enriched Genes in Cortical Astrocytes from Aged
    Supplemental Table 1 Enriched genes in cortical astrocytes from aged and young-adult mice * Genes were present in the astrocyte module from the WGCNA analysis, and contains astrocyte enriched genes compared to microglia and oligodendrocytes # = Fold change of aged astrocyte expression over the average expression of all analyzed samples (microglia, astrocytes: young, old, with and without myelin contamination) $ ; aged = genes only present in the aged astrocyte top 1000 list (used to compare with lists from Cahoy, Lovatt, Doyle; see Fig. 4B), all = genes present in all astrocyte top 1000 lists Gene Symbol* Aged astr. (log2) Young astr.(log2) FC (aged/ aver.)# Location Ptprz1 15.37 15.02 18.76 Plasma Membrane Slc7a10 14.49 14.44 18.28 Plasma Membrane Gjb6 15.13 14.42 18.18 Plasma Membrane Dclk1 14.63 14.28 17.18 unknown Hes5 15.69 15.55 16.94 Nucleus Fgfr3 15.27 14.46 16.54 Plasma Membrane Entpd2 13.85 13.56 15.92 Cytoplasm Grin2c 14.93 14.87 15.75 Plasma Membrane Slc1a2 15.51 15.39 15.58 Plasma Membrane Fjx1 14.36 13.98 14.52 Extracellular Space Slc6a1 14.20 14.16 14.47 Plasma Membrane Kcnk1 12.93 13.49 14.43 Plasma Membrane Ppap2b 16.16 16.10 14.37 Plasma Membrane Fam20a 14.48 14.72 14.00 Extracellular Space Dbx2 13.68 13.32 13.99 Nucleus Itih3 13.93 13.93 13.94 Extracellular Space Htra1 17.12 16.91 13.92 Extracellular Space Atp1a2 14.59 14.48 13.73 Plasma Membrane Scg3 15.71 15.72 13.68 Extracellular Space F3 15.59 15.08 13.51 Plasma Membrane Mmd2 14.22 14.60 13.50 unknown Nrcam 13.73 13.88 13.47 Plasma Membrane Cldn10a 13.37 13.57 13.46
    [Show full text]
  • New Approaches to Functional Process Discovery in HPV 16-Associated Cervical Cancer Cells by Gene Ontology
    Cancer Research and Treatment 2003;35(4):304-313 New Approaches to Functional Process Discovery in HPV 16-Associated Cervical Cancer Cells by Gene Ontology Yong-Wan Kim, Ph.D.1, Min-Je Suh, M.S.1, Jin-Sik Bae, M.S.1, Su Mi Bae, M.S.1, Joo Hee Yoon, M.D.2, Soo Young Hur, M.D.2, Jae Hoon Kim, M.D.2, Duck Young Ro, M.D.2, Joon Mo Lee, M.D.2, Sung Eun Namkoong, M.D.2, Chong Kook Kim, Ph.D.3 and Woong Shick Ahn, M.D.2 1Catholic Research Institutes of Medical Science, 2Department of Obstetrics and Gynecology, College of Medicine, The Catholic University of Korea, Seoul; 3College of Pharmacy, Seoul National University, Seoul, Korea Purpose: This study utilized both mRNA differential significant genes of unknown function affected by the display and the Gene Ontology (GO) analysis to char- HPV-16-derived pathway. The GO analysis suggested that acterize the multiple interactions of a number of genes the cervical cancer cells underwent repression of the with gene expression profiles involved in the HPV-16- cancer-specific cell adhesive properties. Also, genes induced cervical carcinogenesis. belonging to DNA metabolism, such as DNA repair and Materials and Methods: mRNA differential displays, replication, were strongly down-regulated, whereas sig- with HPV-16 positive cervical cancer cell line (SiHa), and nificant increases were shown in the protein degradation normal human keratinocyte cell line (HaCaT) as a con- and synthesis. trol, were used. Each human gene has several biological Conclusion: The GO analysis can overcome the com- functions in the Gene Ontology; therefore, several func- plexity of the gene expression profile of the HPV-16- tions of each gene were chosen to establish a powerful associated pathway, identify several cancer-specific cel- cervical carcinogenesis pathway.
    [Show full text]
  • Genetic Basis of Simple and Complex Traits with Relevance to Avian Evolution
    Genetic basis of simple and complex traits with relevance to avian evolution Małgorzata Anna Gazda Doctoral Program in Biodiversity, Genetics and Evolution D Faculdade de Ciências da Universidade do Porto 2019 Supervisor Miguel Jorge Pinto Carneiro, Auxiliary Researcher, CIBIO/InBIO, Laboratório Associado, Universidade do Porto Co-supervisor Ricardo Lopes, CIBIO/InBIO Leif Andersson, Uppsala University FCUP Genetic basis of avian traits Nota Previa Na elaboração desta tese, e nos termos do número 2 do Artigo 4º do Regulamento Geral dos Terceiros Ciclos de Estudos da Universidade do Porto e do Artigo 31º do D.L.74/2006, de 24 de Março, com a nova redação introduzida pelo D.L. 230/2009, de 14 de Setembro, foi efetuado o aproveitamento total de um conjunto coerente de trabalhos de investigação já publicados ou submetidos para publicação em revistas internacionais indexadas e com arbitragem científica, os quais integram alguns dos capítulos da presente tese. Tendo em conta que os referidos trabalhos foram realizados com a colaboração de outros autores, o candidato esclarece que, em todos eles, participou ativamente na sua conceção, na obtenção, análise e discussão de resultados, bem como na elaboração da sua forma publicada. Este trabalho foi apoiado pela Fundação para a Ciência e Tecnologia (FCT) através da atribuição de uma bolsa de doutoramento (PD/BD/114042/2015) no âmbito do programa doutoral em Biodiversidade, Genética e Evolução (BIODIV). 2 FCUP Genetic basis of avian traits Acknowledgements Firstly, I would like to thank to my all supervisors Miguel Carneiro, Ricardo Lopes and Leif Andersson, for the demanding task of supervising myself last four years.
    [Show full text]
  • Nuclear Factor I/B Is an Oncogene in Small Cell Lung Cancer
    Nuclear Factor I/B is an Oncogene in Small Cell Lung Cancer The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Dooley, A. L. et al. “Nuclear factor I/B is an oncogene in small cell lung cancer.” Genes & Development 25 (2011): 1470-1475. As Published http://dx.doi.org/10.1101/gad.2046711 Publisher Cold Spring Harbor Laboratory Press in association with The Genetics Society Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/66512 Terms of Use Creative Commons Attribution-Noncommercial-Share Alike 3.0 Detailed Terms http://creativecommons.org/licenses/by-nc-sa/3.0/ Dooley 1 Nuclear Factor I/B is an Oncogene in Small Cell Lung Cancer Alison L. Dooley1, Monte M. Winslow1, Derek Y. Chiang2,3,4, Shantanu Banerji2,3, Nicolas Stransky2, Talya L. Dayton1, Eric L. Snyder1, Stephanie Senna1, Charles A. Whittaker1, Roderick T. Bronson5, Denise Crowley1, Jordi Barretina2,3, Levi Garraway2,3, Matthew Meyerson2,3, Tyler Jacks1,6 1David H. Koch Institute for Integrative Cancer Research and Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA 2The Broad Institute, Cancer Program, Cambridge, Massachusetts, USA 3Dana-Farber Cancer Institute, Department of Medical Oncology and Center for Cancer Genome Discovery, Boston, Massachusetts, USA 4Current address: Lineberger Comprehensive Cancer Center, 450 West Drive, CB #7295, Chapel Hill, North Carolina, USA 5Department of Pathology, Tufts University School of Medicine and Veterinary Medicine, North Grafton, Massachusetts, USA 6Howard Hughes Medical Institute, Massachusetts Institute of Technology, Cambridge, Massachusetts, USA Key Words: Small Cell Lung Cancer, Mouse model, Nuclear Factor I/B Dooley 2 Abstract Small cell lung cancer (SCLC) is an aggressive cancer often diagnosed after it has metastasized.
    [Show full text]
  • Original Article a Database and Functional Annotation of NF-Κb Target Genes
    Int J Clin Exp Med 2016;9(5):7986-7995 www.ijcem.com /ISSN:1940-5901/IJCEM0019172 Original Article A database and functional annotation of NF-κB target genes Yang Yang, Jian Wu, Jinke Wang The State Key Laboratory of Bioelectronics, Southeast University, Nanjing 210096, People’s Republic of China Received November 4, 2015; Accepted February 10, 2016; Epub May 15, 2016; Published May 30, 2016 Abstract: Backgrounds: The previous studies show that the transcription factor NF-κB always be induced by many inducers, and can regulate the expressions of many genes. The aim of the present study is to explore the database and functional annotation of NF-κB target genes. Methods: In this study, we manually collected the most complete listing of all NF-κB target genes identified to date, including the NF-κB microRNA target genes and built the database of NF-κB target genes with the detailed information of each target gene and annotated it by DAVID tools. Results: The NF-κB target genes database was established (http://tfdb.seu.edu.cn/nfkb/). The collected data confirmed that NF-κB maintains multitudinous biological functions and possesses the considerable complexity and diversity in regulation the expression of corresponding target genes set. The data showed that the NF-κB was a central regula- tor of the stress response, immune response and cellular metabolic processes. NF-κB involved in bone disease, immunological disease and cardiovascular disease, various cancers and nervous disease. NF-κB can modulate the expression activity of other transcriptional factors. Inhibition of IKK and IκBα phosphorylation, the decrease of nuclear translocation of p65 and the reduction of intracellular glutathione level determined the up-regulation or down-regulation of expression of NF-κB target genes.
    [Show full text]
  • Genomic Study of RNA Polymerase II and III Snapc-Bound Promoters Reveals a Gene Transcribed by Both Enzymes and a Broad Use of Common Activators
    Genomic Study of RNA Polymerase II and III SNAPc-Bound Promoters Reveals a Gene Transcribed by Both Enzymes and a Broad Use of Common Activators Nicole James Faresse1., Donatella Canella1., Viviane Praz1,2, Joe¨lle Michaud1¤, David Romascano1, Nouria Hernandez1* 1 Center for Integrative Genomics, Faculty of Biology and Medicine, University of Lausanne, Lausanne, Switzerland, 2 Swiss Institute of Bioinformatics, Lausanne, Switzerland Abstract SNAPc is one of a few basal transcription factors used by both RNA polymerase (pol) II and pol III. To define the set of active SNAPc-dependent promoters in human cells, we have localized genome-wide four SNAPc subunits, GTF2B (TFIIB), BRF2, pol II, and pol III. Among some seventy loci occupied by SNAPc and other factors, including pol II snRNA genes, pol III genes with type 3 promoters, and a few un-annotated loci, most are primarily occupied by either pol II and GTF2B, or pol III and BRF2. A notable exception is the RPPH1 gene, which is occupied by significant amounts of both polymerases. We show that the large majority of SNAPc-dependent promoters recruit POU2F1 and/or ZNF143 on their enhancer region, and a subset also recruits GABP, a factor newly implicated in SNAPc-dependent transcription. These activators associate with pol II and III promoters in G1 slightly before the polymerase, and ZNF143 is required for efficient transcription initiation complex assembly. The results characterize a set of genes with unique properties and establish that polymerase specificity is not absolute in vivo. Citation: James Faresse N, Canella D, Praz V, Michaud J, Romascano D, et al.
    [Show full text]
  • Genomic Anatomy of the Tyrp1 (Brown) Deletion Complex
    Genomic anatomy of the Tyrp1 (brown) deletion complex Ian M. Smyth*, Laurens Wilming†, Angela W. Lee*, Martin S. Taylor*, Phillipe Gautier*, Karen Barlow†, Justine Wallis†, Sancha Martin†, Rebecca Glithero†, Ben Phillimore†, Sarah Pelan†, Rob Andrew†, Karen Holt†, Ruth Taylor†, Stuart McLaren†, John Burton†, Jonathon Bailey†, Sarah Sims†, Jan Squares†, Bob Plumb†, Ann Joy†, Richard Gibson†, James Gilbert†, Elizabeth Hart†, Gavin Laird†, Jane Loveland†, Jonathan Mudge†, Charlie Steward†, David Swarbreck†, Jennifer Harrow†, Philip North‡, Nicholas Leaves‡, John Greystrong‡, Maria Coppola‡, Shilpa Manjunath‡, Mark Campbell‡, Mark Smith‡, Gregory Strachan‡, Calli Tofts‡, Esther Boal‡, Victoria Cobley‡, Giselle Hunter‡, Christopher Kimberley‡, Daniel Thomas‡, Lee Cave-Berry‡, Paul Weston‡, Marc R. M. Botcherby‡, Sharon White*, Ruth Edgar*, Sally H. Cross*, Marjan Irvani¶, Holger Hummerich¶, Eleanor H. Simpson*, Dabney Johnson§, Patricia R. Hunsicker§, Peter F. R. Little¶, Tim Hubbard†, R. Duncan Campbell‡, Jane Rogers†, and Ian J. Jackson*ʈ *Medical Research Council Human Genetics Unit, Edinburgh EH4 2XU, United Kingdom; †Wellcome Trust Sanger Institute, and ‡Medical Research Council Rosalind Franklin Centre for Genome Research, Hinxton CB10 1SA, United Kingdom; §Life Sciences Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831; and ¶Department of Biochemistry, Imperial College, London SW7 2AZ, United Kingdom Communicated by Liane B. Russell, Oak Ridge National Laboratory, Oak Ridge, TN, January 9, 2006 (received for review September 15, 2005) Chromosome deletions in the mouse have proven invaluable in the deletions also provided the means to produce physical maps of dissection of gene function. The brown deletion complex com- genetic markers. Studies of this kind have been published for prises >28 independent genome rearrangements, which have several loci, including albino (Tyr), piebald (Ednrb), pink-eyed been used to identify several functional loci on chromosome 4 dilution (p), and the brown deletion complex (2–6).
    [Show full text]
  • Genomic and Expression Profiling of Human Spermatocytic Seminomas: Primary Spermatocyte As Tumorigenic Precursor and DMRT1 As Candidate Chromosome 9 Gene
    Research Article Genomic and Expression Profiling of Human Spermatocytic Seminomas: Primary Spermatocyte as Tumorigenic Precursor and DMRT1 as Candidate Chromosome 9 Gene Leendert H.J. Looijenga,1 Remko Hersmus,1 Ad J.M. Gillis,1 Rolph Pfundt,4 Hans J. Stoop,1 Ruud J.H.L.M. van Gurp,1 Joris Veltman,1 H. Berna Beverloo,2 Ellen van Drunen,2 Ad Geurts van Kessel,4 Renee Reijo Pera,5 Dominik T. Schneider,6 Brenda Summersgill,7 Janet Shipley,7 Alan McIntyre,7 Peter van der Spek,3 Eric Schoenmakers,4 and J. Wolter Oosterhuis1 1Department of Pathology, Josephine Nefkens Institute; Departments of 2Clinical Genetics and 3Bioinformatics, Erasmus Medical Center/ University Medical Center, Rotterdam, the Netherlands; 4Department of Human Genetics, Radboud University Medical Center, Nijmegen, the Netherlands; 5Howard Hughes Medical Institute, Whitehead Institute and Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts; 6Clinic of Paediatric Oncology, Haematology and Immunology, Heinrich-Heine University, Du¨sseldorf, Germany; 7Molecular Cytogenetics, Section of Molecular Carcinogenesis, The Institute of Cancer Research, Sutton, Surrey, United Kingdom Abstract histochemistry, DMRT1 (a male-specific transcriptional regulator) was identified as a likely candidate gene for Spermatocytic seminomas are solid tumors found solely in the involvement in the development of spermatocytic seminomas. testis of predominantly elderly individuals. We investigated these tumors using a genome-wide analysis for structural and (Cancer Res 2006; 66(1): 290-302) numerical chromosomal changes through conventional kar- yotyping, spectral karyotyping, and array comparative Introduction genomic hybridization using a 32 K genomic tiling-path Spermatocytic seminomas are benign testicular tumors that resolution BAC platform (confirmed by in situ hybridization).
    [Show full text]
  • Sox2 Promotes Malignancy in Glioblastoma by Regulating
    Volume 16 Number 3 March 2014 pp. 193–206.e25 193 www.neoplasia.com Artem D. Berezovsky*, Laila M. Poisson†, Sox2 Promotes Malignancy in ‡ ‡ David Cherba , Craig P. Webb , Glioblastoma by Regulating Andrea D. Transou*, Nancy W. Lemke*, Xin Hong*, Laura A. Hasselbach*, Susan M. Irtenkauf*, Plasticity and Astrocytic Tom Mikkelsen*,§ and Ana C. deCarvalho* Differentiation1,2 *Department of Neurosurgery, Henry Ford Hospital, Detroit, MI; †Department of Public Health Sciences, Henry Ford Hospital, Detroit, MI; ‡Program of Translational Medicine, Van Andel Research Institute, Grand Rapids, MI; §Department of Neurology, Henry Ford Hospital, Detroit, MI Abstract The high-mobility group–box transcription factor sex-determining region Y–box 2 (Sox2) is essential for the maintenance of stem cells from early development to adult tissues. Sox2 can reprogram differentiated cells into pluripotent cells in concert with other factors and is overexpressed in various cancers. In glioblastoma (GBM), Sox2 is a marker of cancer stemlike cells (CSCs) in neurosphere cultures and is associated with the proneural molecular subtype. Here, we report that Sox2 expression pattern in GBM tumors and patient-derived mouse xenografts is not restricted to a small percentage of cells and is coexpressed with various lineage markers, suggesting that its expression extends beyond CSCs to encompass more differentiated neoplastic cells across molecular subtypes. Employing a CSC derived from a patient with GBM and isogenic differentiated cell model, we show that Sox2 knockdown in the differentiated state abolished dedifferentiation and acquisition of CSC phenotype. Furthermore, Sox2 deficiency specifically impaired the astrocytic component of a biphasic gliosarcoma xenograft model while allowing the formation of tumors with sarcomatous phenotype.
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • Genomic Anatomy of the Tyrp1 (Brown) Deletion Complex
    Genomic anatomy of the Tyrp1 (brown) deletion complex Ian M. Smyth*, Laurens Wilming†, Angela W. Lee*, Martin S. Taylor*, Phillipe Gautier*, Karen Barlow†, Justine Wallis†, Sancha Martin†, Rebecca Glithero†, Ben Phillimore†, Sarah Pelan†, Rob Andrew†, Karen Holt†, Ruth Taylor†, Stuart McLaren†, John Burton†, Jonathon Bailey†, Sarah Sims†, Jan Squares†, Bob Plumb†, Ann Joy†, Richard Gibson†, James Gilbert†, Elizabeth Hart†, Gavin Laird†, Jane Loveland†, Jonathan Mudge†, Charlie Steward†, David Swarbreck†, Jennifer Harrow†, Philip North‡, Nicholas Leaves‡, John Greystrong‡, Maria Coppola‡, Shilpa Manjunath‡, Mark Campbell‡, Mark Smith‡, Gregory Strachan‡, Calli Tofts‡, Esther Boal‡, Victoria Cobley‡, Giselle Hunter‡, Christopher Kimberley‡, Daniel Thomas‡, Lee Cave-Berry‡, Paul Weston‡, Marc R. M. Botcherby‡, Sharon White*, Ruth Edgar*, Sally H. Cross*, Marjan Irvani¶, Holger Hummerich¶, Eleanor H. Simpson*, Dabney Johnson§, Patricia R. Hunsicker§, Peter F. R. Little¶, Tim Hubbard†, R. Duncan Campbell‡, Jane Rogers†, and Ian J. Jackson*ʈ *Medical Research Council Human Genetics Unit, Edinburgh EH4 2XU, United Kingdom; †Wellcome Trust Sanger Institute, and ‡Medical Research Council Rosalind Franklin Centre for Genome Research, Hinxton CB10 1SA, United Kingdom; §Life Sciences Division, Oak Ridge National Laboratory, Oak Ridge, TN 37831; and ¶Department of Biochemistry, Imperial College, London SW7 2AZ, United Kingdom Communicated by Liane B. Russell, Oak Ridge National Laboratory, Oak Ridge, TN, January 9, 2006 (received for review September 15, 2005) Chromosome deletions in the mouse have proven invaluable in the deletions also provided the means to produce physical maps of dissection of gene function. The brown deletion complex com- genetic markers. Studies of this kind have been published for prises >28 independent genome rearrangements, which have several loci, including albino (Tyr), piebald (Ednrb), pink-eyed been used to identify several functional loci on chromosome 4 dilution (p), and the brown deletion complex (2–6).
    [Show full text]
  • Title Up-Regulation of Activation-Induced Cytidine
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Kyoto University Research Information Repository Up-regulation of activation-induced cytidine deaminase causes Title genetic aberrations at the CDKN2b-CDKN2a in gastric cancer. Matsumoto, Yuko; Marusawa, Hiroyuki; Kinoshita, Kazuo; Author(s) Niwa, Yoko; Sakai, Yoshiharu; Chiba, Tsutomu Citation Gastroenterology (2010), 139(6): 1984-1994 Issue Date 2010-12 URL http://hdl.handle.net/2433/134556 Right © 2010 AGA Institute Published by Elsevier Inc. Type Journal Article Textversion author Kyoto University Upregulation of activation-induced cytidine deaminase causes genetic aberrations at the CDKN2b-CDKN2a in gastric cancer Yuko Matsumoto1, Hiroyuki Marusawa1, Kazuo Kinoshita2, Yoko Niwa2, Yoshiharu Sakai3, and Tsutomu Chiba1 1Department of Gastroenterology and Hepatology, Graduate School of Medicine, Kyoto University, Kyoto, Japan. 2Evolutionary Medicine, Shiga Medical Center Research Institute, Shiga, Japan. 3Department of Gastrointestinal Surgery, Graduate School of Medicine, Kyoto University, Kyoto, Japan. Short Title: Aberration of CDKN2b-CDKN2a locus by AID activity Abbreviations used: AID, activation-induced cytidine deaminase; BCL6, B-cell CLL/lymphoma 6; CDKN2A, cyclin-dependent kinase inhibitor 2A; CDKN2B, cyclin-dependent kinase inhibitor 2B; CGH, comparative genomic hybridization; CSR, class switch recombination; DSBs, double-strand breaks; LOH, loss of heterozygosity. Address correspondence to: Hiroyuki Marusawa, M.D, Ph.D, Department of Gastroenterology and Hepatology, Graduate School of Medicine, Kyoto University, 54 Kawahara-cho, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan E-mail; [email protected] Phone; +81-75-751-4302 Fax; +81-75-751-4303 Grant support: This study was supported by Grants-in-aid for Scientific Research, 20012029, 20590774, and 21229009 from the Ministry of Education, Culture, Sports, Science, Grant-in-aid for Scientific Research from the Ministry of Health, Labor, and Welfare, Japan, and Takeda Science Foundation.
    [Show full text]