DOCSLIB.ORG

Supplementary Tables S1-S3

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse) Ank 3.59 9.42 28.55 1368945_at bone morphogenetic protein 2 Bmp2 ARE 1.69 22.39 27.95 1398662_at Transcribed locus --- 8.35 12.74 26.27 1386552_at Transcribed locus --- 2.26 15.31 25.51 1368210_at interleukin 24 Il24 ARE 1.30 2.95 23.63 1388204_at matrix metallopeptidase 13 Mmp13 ARE 2.18 3.23 23.10 1398270_at bone morphogenetic protein 2 Bmp2 ARE 1.93 17.82 22.84 1383987_at Transcribed locus --- 2.63 10.44 22.11 1391083_at Rho GTPase activating protein 22 (predicted) Arhgap22 1.30 19.08 21.97 1393439_a_at progressive ankylosis homolog (mouse) Ank ARE 2.58 5.32 21.63 1384027_a_at --- --- 2.17 1.00 21.38 1382378_at cathepsin W Ctsw 6.39 -1.02 20.55 1376197_at transcription factor 7, T-cell specific (predicted) Tcf7 ARE 1.85 -1.10 20.51 1385709_x_at Progressive ankylosis homolog (mouse) Ank 2.30 5.15 20.45 1374594_at similar to RIKEN cDNA 1600029D21 LOC363060 1.40 16.93 19.30 1382603_at Similar to PD-1-ligand precursor (predicted) RGD1566211 1.13 1.95 19.09 1369081_at neuraminidase 1 Neu1 ARE 4.75 1.61 17.73 1378867_at Similar to CG32425-PA (predicted) RGD1307366 2.99 12.57 16.65 1390835_at similar to 1300013J15Rik protein RGD1311123 4.20 11.04 16.47 1368592_at interleukin 1 alpha Il1a ARE 1.08 1.46 16.17 1370047_at ectonucleotide pyrophosphatase/phosphodiesterase 1 Enpp1 7.78 5.19 15.56 1368564_at solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6 Slc17a6 ARE -1.02 5.74 15.25 1367616_at natriuretic peptide precursor type B Nppb ARE 2.73 9.17 14.57 1380028_at similar to ADP-ribosylation factor-like protein 4C (ADP-ribosylation factor-like 7) LOC367311 1.58 2.77 13.95 1375684_at neuraminidase 1 Neu1 3.74 1.40 13.81 1388972_at reticulon 4 receptor Rtn4r 3.90 1.16 13.72 1387548_at hyaluronan synthase 2 Has2 ARE 1.18 1.88 13.06 1378133_at Transcribed locus --- 1.80 13.18 13.01 1384028_at --- --- 2.26 1.08 12.94 1393314_at Transcribed locus --- 3.18 1.28 12.81 1387562_at peptidyl arginine deiminase, type III Padi3 2.40 1.16 12.57 1373008_x_at reticulon 4 receptor Rtn4r 3.33 1.18 12.43 1378556_at Transcribed locus --- 6.54 4.22 12.21 1393728_at Transcribed locus --- ARE 1.65 7.90 11.60 1375815_at Progressive ankylosis homolog (mouse) Ank 1.32 2.21 11.54 1386529_at Transcribed locus --- 3.71 3.88 11.53 1393927_at wingless-related MMTV integration site 2 Wnt2 3.02 1.08 11.51 1395357_at microtubule-associated protein 1b Map1b ARE 4.30 5.96 11.10 1389467_at similar to RIKEN cDNA 1810057C19 MGC108778 ARE 1.08 1.08 10.34 1382482_at Transcribed locus --- 1.41 2.17 10.01 1379340_at lamimin, gamma 2 Lamc2 ARE 1.78 7.49 9.63 1397729_x_at similar to RIKEN cDNA 1600029D21 LOC363060 1.18 8.10 9.30 1379284_at similar to RIKEN cDNA 2810457I06 (predicted) RGD1310357 1.59 3.68 9.23 1375014_at similar to ADP-ribosylation factor-like protein 4C (ADP-ribosylation factor-like 7) LOC367311 ARE 1.45 2.14 9.05 1373363_at microtubule-associated protein 1b Map1b ARE 3.72 4.77 8.78 1385738_at Transcribed locus --- 1.26 1.75 8.53 1385925_at Transcribed locus --- 4.65 2.63 8.46 1367723_a_at linker of T-cell receptor pathways Lnk ARE 1.21 3.78 8.02 1369008_a_at olfactomedin 1 Olfm1 1.14 2.08 7.91 1382375_at Wingless-type MMTV integration site 5A Wnt5a 1.17 3.04 7.85 1397769_at Similar to RIKEN cDNA 6330512M04 gene (predicted) RGD1563319 -1.16 6.18 7.59 1373807_at vascular endothelial growth factor A Vegfa ARE 1.45 5.90 7.52 1393003_at Transcribed locus --- ARE 2.43 2.99 7.28 1370427_at platelet derived growth factor, alpha Pdgfa ARE 1.31 2.28 7.17 1377365_at similar to hypothetical protein DKFZp434H2010 (predicted) RGD1311019 1.01 2.25 7.04 1370387_at cytochrome P450, family 3, subfamily a, polypeptide Cyp3a13 ARE 1.08 5.26 7.04 1368374_a_at gamma-glutamyltransferase 1 Ggt1 1.27 1.07 7.01 1369263_at wingless-type MMTV integration site 5A Wnt5a ARE 1.02 2.91 6.96 1373298_at Transcribed locus --- 1.16 2.56 6.90 1370336_at pregnancy-induced growth inhibitor Okl38 1.94 2.48 6.86 1392791_at Early growth response 3 Egr3 ARE 1.16 3.84 6.81 1388596_at coactosin-like 1 (Dictyostelium) (predicted) Cotl1 1.64 1.40 6.78 1373759_at Transcribed locus --- 1.14 5.17 6.76 1369012_at inhibin beta-A Inhba 1.57 2.87 6.76 1399032_at excision repair cross-complementing rodent repair deficiency, complementation group 1 Ercc1 1.32 4.16 6.70 (predicted) 1378522_at Transcribed locus --- 2.72 2.89 6.64 1375986_at Similar to BTEB3 protein (predicted) RGD1565099 2.29 2.95 6.59 1368804_at leukemia inhibitory factor Lif 1.16 4.56 6.53 1368009_at glucosamine Gne ARE 1.77 4.11 6.52 1389463_at protein kinase, cAMP dependent regulatory, type I, beta Prkar1b 1.59 1.12 6.47 1392820_at Fibroblast growth factor 1 Fgf1 2.25 1.33 6.46 1370023_at gap junction membrane channel protein alpha 4 Gja4 1.29 4.14 6.39 1379598_at Transcribed locus --- 1.16 1.36 6.34 1379375_at Platelet derived growth factor, alpha Pdgfa 1.29 2.21 6.31 1374817_at Transcribed locus --- ARE -1.28 2.09 6.25 1387843_at follistatin Fst 2.83 2.69 6.16 1368350_at protein tyrosine phosphatase, receptor-type, Z polypeptide 1 Ptprz1 ARE -1.18 1.78 6.05 1369625_at aquaporin 1 Aqp1 1.08 1.34 5.95 1395715_at Transcribed locus --- 1.48 2.00 5.89 1368259_at prostaglandin-endoperoxide synthase 1 Ptgs1 ARE 1.15 4.07 5.81 1375320_at Similar to hypothetical protein DKFZp434H2010 (predicted) RGD1311019 1.30 2.12 5.81 1396208_at gamma-glutamyltransferase-like activity 1 Ggtla1 1.61 1.09 5.68 1376498_at similar to 2900002H16Rik protein (predicted) RGD1307973 ARE 1.26 1.70 5.62 1380410_at Similar to GLI pathogenesis-related 2 LOC679819 2.97 2.08 5.58 1385805_at --- --- 1.49 1.19 5.52 1393494_at Transcribed locus --- 1.22 1.88 5.48 1381243_at Transcribed locus --- ARE 1.24 3.69 5.45 1383096_at amyloid beta (A4) precursor-like protein 2 Aplp2 ARE 1.02 2.51 5.43 1388785_at dynein, axonemal, light chain 4 Dnalc4 ARE 1.34 3.05 5.35 1373751_at Transcribed locus --- ARE 1.81 2.01 5.31 1391563_at similar to melanoma associated antigen (mutated) 1-like 1 (predicted) RGD1565148 ARE 1.37 1.62 5.23 1390983_at Transcribed locus --- ARE 1.06 3.02 5.19 1385181_at Transcribed locus --- 1.05 2.39 5.16 1371211_a_at neuregulin 1 Nrg1 1.10 3.72 5.08 1380895_at Amyloid beta (A4) precursor-like protein 2 Aplp2 1.14 1.77 5.05 1368545_at CASP8 and FADD-like apoptosis regulator Cflar ARE 1.49 3.16 5.00 1385926_at Transcribed locus --- 2.76 1.79 5.00 1369683_at BH3 interacting domain death agonist Bid 1.23 1.62 4.93 1368254_a_at sphingosine kinase 1 Sphk1 1.78 2.19 4.83 1383883_at similar to Hypothetical protein KIAA0469 (predicted) RGD1309644 1.70 2.48 4.78 1370082_at transforming growth factor, beta 1 Tgfb1 1.73 2.35 4.78 1374920_at Transcribed locus --- 1.55 2.61 4.73 1378241_at --- --- 1.97 1.00 4.71 1385235_at bol, boule-like (Drosophila) (predicted) Boll ARE -1.42 3.09 4.71 1374537_at carbohydrate (chondroitin) synthase 1 (predicted) Chsy1 ARE 1.65 2.23 4.67 1390429_at Transcribed locus --- ARE 1.55 2.66 4.61 1377759_at Transcribed locus --- ARE 1.21 1.59 4.57 1375377_at Transcribed locus --- 1.43 2.25 4.56 1384238_at similar to Tweety homolog 2 (predicted) RGD1562969 ARE 1.10 2.40 4.45 1388121_at amyloid beta (A4) precursor-like protein 2 Aplp2 1.01 2.36 4.44 1393344_at Transcribed locus --- ARE 1.70 2.15 4.31 1387206_at UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 B4galt6 ARE 1.80 1.96 4.31 1387184_at axin2 Axin2 ARE 1.42 2.26 4.26 1378032_at nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta (predicted) Nfkbiz ARE 1.35 2.46 4.23 1382442_at similar to Septin-6 LOC682750 ARE 1.22 2.14 4.23 1391121_at similar to DNA segment, Chr 8, ERATO Doi 82, expressed (predicted) RGD1311793 ARE 1.35 1.94 4.19 1383257_at Transcribed locus --- ARE -1.81 2.79 4.14 1368713_at matrix metallopeptidase 10 Mmp10 ARE 1.24 2.71 4.10 1394361_a_at wingless-related MMTV integration site 2 Wnt2 ARE 1.97 1.24 4.07 1385706_at Transcribed locus --- 1.50 1.77 4.01 1368681_at parathyroid hormone-like peptide Pthlh ARE 1.12 1.95 4.00 1387301_at fibroblast growth factor 1 Fgf1 1.84 1.25 3.99 1372569_at four and a half LIM domains 3 (predicted) Fhl3 1.59 2.25 3.93 1369293_at reticulon 4 receptor Rtn4r 1.65 1.06 3.84 1387975_at UDP-glucose ceramide glucosyltransferase Ugcg ARE 1.27 2.47 3.81 1390249_at similar to DKFZP434H132 protein RGD1305464 1.06 1.48 3.80 1373970_at similar to RIKEN cDNA 9230117N10 RGD1311155 -1.12 3.64 3.72 1369783_a_at neuregulin 1 Nrg1 ARE -1.15 2.58 3.69 1393252_at Transcribed locus --- ARE 1.44 1.04 3.65 1370948_a_at myristoylated alanine rich protein kinase C substrate Marcks ARE 1.09 1.48 3.65 1378480_at Transcribed locus --- 1.01 1.86 3.64 1370817_at Sec11-like 3 (S.
Recommended publications
  • Haplotypes of CYP1B1 and CCDC57 Genes in an Afro-Caribbean Female

    Haplotypes of CYP1B1 and CCDC57 Genes in an Afro-Caribbean Female

    Molecular Biology Reports (2019) 46:3299–3306 https://doi.org/10.1007/s11033-019-04790-y ORIGINAL ARTICLE Haplotypes of CYP1B1 and CCDC57 genes in an Afro‑Caribbean female population with uterine leiomyoma Angela T. Alleyne1 · Virgil S. Bideau1 Received: 13 December 2018 / Accepted: 28 March 2019 / Published online: 13 April 2019 © Springer Nature B.V. 2019 Abstract Uterine leiomyomas (UL) are prevalent benign tumors, especially among women of African ancestry. The disease also has genetic liability and is infuenced by risk factors such as hormones and obesity. This study investigates the haplotypes of the Cytochrome P450 1B1 gene (CYP1B1) related to hormones and coiled-coil domain containing 57 gene (CCDC57) related to obesity in Afro-Caribbean females. Each haplotype was constructed from unphased sequence data using PHASE v.2.1 software and Haploview v.4.2 was used for linkage disequilibrium (LD) studies. There were contrasting LD observed among the single nucleotide polymorphisms of CYP1B1 and CCDC5. Accordingly, the GTA haplotype of CYP1B1 was signifcantly associated with UL risk (P = 0.02) while there was no association between CCDC57 haplotypes and UL (P = 0.2) for the ATG haplotype. As such, our fndings suggest that the Asp449Asp polymorphism and GTA haplotype of CYP1B1 may contribute to UL susceptibility in women of Afro-Caribbean ancestry in this population. Keywords SNP · Fibroids · Haplotyping · Estrogen · Linkage disequilibrium Introduction consistently having a higher risk of UL development than White women [4]. However cumulatively Black women have Globally, 20–25% of women are clinically diagnosed with an earlier onset for diagnosis than White women [2, 10].
  • 00006396 201510000 00004

    00006396 201510000 00004

    King’s Research Portal DOI: 10.1097/j.pain.0000000000000200 Document Version Publisher's PDF, also known as Version of record Link to publication record in King's Research Portal Citation for published version (APA): Livshits, G., Macgregor, A. J., Gieger, C., Malkin, I., Moayyeri, A., Grallert, H., Emeny, R. T., Spector, T., Kastenmuller, G., & Williams, F. M. K. (2015). An omics investigation into chronic widespread musculoskeletal pain reveals epiandrosterone sulfate as a potential biomarker. Pain, 156(10), 1845-1851. https://doi.org/10.1097/j.pain.0000000000000200 Citing this paper Please note that where the full-text provided on King's Research Portal is the Author Accepted Manuscript or Post-Print version this may differ from the final Published version. If citing, it is advised that you check and use the publisher's definitive version for pagination, volume/issue, and date of publication details. And where the final published version is provided on the Research Portal, if citing you are again advised to check the publisher's website for any subsequent corrections. General rights Copyright and moral rights for the publications made accessible in the Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognize and abide by the legal requirements associated with these rights. •Users may download and print one copy of any publication from the Research Portal for the purpose of private study or research. •You may not further distribute the material or use it for any profit-making activity or commercial gain •You may freely distribute the URL identifying the publication in the Research Portal Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim.
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model

    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
  • Supplemental Table S1

    Supplemental Table S1

    Entrez Gene Symbol Gene Name Affymetrix EST Glomchip SAGE Stanford Literature HPA confirmed Gene ID Profiling profiling Profiling Profiling array profiling confirmed 1 2 A2M alpha-2-macroglobulin 0 0 0 1 0 2 10347 ABCA7 ATP-binding cassette, sub-family A (ABC1), member 7 1 0 0 0 0 3 10350 ABCA9 ATP-binding cassette, sub-family A (ABC1), member 9 1 0 0 0 0 4 10057 ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1 0 0 0 0 5 10060 ABCC9 ATP-binding cassette, sub-family C (CFTR/MRP), member 9 1 0 0 0 0 6 79575 ABHD8 abhydrolase domain containing 8 1 0 0 0 0 7 51225 ABI3 ABI gene family, member 3 1 0 1 0 0 8 29 ABR active BCR-related gene 1 0 0 0 0 9 25841 ABTB2 ankyrin repeat and BTB (POZ) domain containing 2 1 0 1 0 0 10 30 ACAA1 acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl-Coenzyme A thiol 0 1 0 0 0 11 43 ACHE acetylcholinesterase (Yt blood group) 1 0 0 0 0 12 58 ACTA1 actin, alpha 1, skeletal muscle 0 1 0 0 0 13 60 ACTB actin, beta 01000 1 14 71 ACTG1 actin, gamma 1 0 1 0 0 0 15 81 ACTN4 actinin, alpha 4 0 0 1 1 1 10700177 16 10096 ACTR3 ARP3 actin-related protein 3 homolog (yeast) 0 1 0 0 0 17 94 ACVRL1 activin A receptor type II-like 1 1 0 1 0 0 18 8038 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 1 0 0 0 0 19 8751 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 1 0 0 0 0 20 8728 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 1 0 0 0 0 21 81792 ADAMTS12 ADAM metallopeptidase with thrombospondin type 1 motif, 12 1 0 0 0 0 22 9507 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1
  • Table 2. Significant

    Table 2. Significant

    Table 2. Significant (Q < 0.05 and |d | > 0.5) transcripts from the meta-analysis Gene Chr Mb Gene Name Affy ProbeSet cDNA_IDs d HAP/LAP d HAP/LAP d d IS Average d Ztest P values Q-value Symbol ID (study #5) 1 2 STS B2m 2 122 beta-2 microglobulin 1452428_a_at AI848245 1.75334941 4 3.2 4 3.2316485 1.07398E-09 5.69E-08 Man2b1 8 84.4 mannosidase 2, alpha B1 1416340_a_at H4049B01 3.75722111 3.87309653 2.1 1.6 2.84852656 5.32443E-07 1.58E-05 1110032A03Rik 9 50.9 RIKEN cDNA 1110032A03 gene 1417211_a_at H4035E05 4 1.66015788 4 1.7 2.82772795 2.94266E-05 0.000527 NA 9 48.5 --- 1456111_at 3.43701477 1.85785922 4 2 2.8237185 9.97969E-08 3.48E-06 Scn4b 9 45.3 Sodium channel, type IV, beta 1434008_at AI844796 3.79536664 1.63774235 3.3 2.3 2.75319499 1.48057E-08 6.21E-07 polypeptide Gadd45gip1 8 84.1 RIKEN cDNA 2310040G17 gene 1417619_at 4 3.38875643 1.4 2 2.69163229 8.84279E-06 0.0001904 BC056474 15 12.1 Mus musculus cDNA clone 1424117_at H3030A06 3.95752801 2.42838452 1.9 2.2 2.62132809 1.3344E-08 5.66E-07 MGC:67360 IMAGE:6823629, complete cds NA 4 153 guanine nucleotide binding protein, 1454696_at -3.46081884 -4 -1.3 -1.6 -2.6026947 8.58458E-05 0.0012617 beta 1 Gnb1 4 153 guanine nucleotide binding protein, 1417432_a_at H3094D02 -3.13334396 -4 -1.6 -1.7 -2.5946297 1.04542E-05 0.0002202 beta 1 Gadd45gip1 8 84.1 RAD23a homolog (S.
  • Seq2pathway Vignette

    Seq2pathway Vignette

    seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway.
  • Broad Poster Vivek

    Broad Poster Vivek

    A novel computational method for finding regions with copy number abnormalities in cancer cells Vivek, Manuel Garber, and Mike Zody Broad Institute of MIT and Harvard, Cambridge, MA, USA Introduction Results Cancer can result from the over expression of oncogenes, genes which control and regulate cell growth. Sometimes oncogenes increase in 1 2 3 activity due to a specific genetic mutation called a translocation (Fig 1). SMAD4 – a gene known to be deleted in pancreatic COX10 – a gene deleted in cytochrome c oxidase AK001392 – a hereditary prostate cancer protein This translocation allows the oncogene to remain as active as its paired carcinoma deficiency, known to be related to cell proliferation gene. Amplification of this mutation can occur, thereby creating the proper conditions for uncontrolled cell growth; consequently, each Results from Analysis Program Results from Analysis Program Results from Analysis Program component of the translocation will amplify in similar quantities. In this mutation, the chromosomal region containing the oncogene displaces to Region 1 Region 2 R2 Region 1 Region 2 R2 Region 1 Region 2 R2 a region on another chromosome containing a gene that is expressed Chr18:47044749-47311978 Chr17:13930739-14654741 0.499070821478475 Chr17:13930739-14654741 Chr18:26861790-27072166 0.47355172850856 Chr17:12542326-13930738 Chr8:1789292-1801984 0.406208680312004 frequently. Actual region containing gene Actual region containing gene Actual region containing gene chr18: 45,842,214 - 48,514,513 chr17: 13,966,862 - 14,068,461 chr17: 12,542,326 - 13,930,738 Fig 1. Two chromosomal regions (abcdef and ghijk) are translocating to create two new regions (abckl and ghijedf).
  • An Animal Model with a Cardiomyocyte-Specific Deletion of Estrogen Receptor Alpha: Functional, Metabolic, and Differential Netwo

    An Animal Model with a Cardiomyocyte-Specific Deletion of Estrogen Receptor Alpha: Functional, Metabolic, and Differential Netwo

    Washington University School of Medicine Digital Commons@Becker Open Access Publications 2014 An animal model with a cardiomyocyte-specific deletion of estrogen receptor alpha: Functional, metabolic, and differential network analysis Sriram Devanathan Washington University School of Medicine in St. Louis Timothy Whitehead Washington University School of Medicine in St. Louis George G. Schweitzer Washington University School of Medicine in St. Louis Nicole Fettig Washington University School of Medicine in St. Louis Attila Kovacs Washington University School of Medicine in St. Louis See next page for additional authors Follow this and additional works at: https://digitalcommons.wustl.edu/open_access_pubs Recommended Citation Devanathan, Sriram; Whitehead, Timothy; Schweitzer, George G.; Fettig, Nicole; Kovacs, Attila; Korach, Kenneth S.; Finck, Brian N.; and Shoghi, Kooresh I., ,"An animal model with a cardiomyocyte-specific deletion of estrogen receptor alpha: Functional, metabolic, and differential network analysis." PLoS One.9,7. e101900. (2014). https://digitalcommons.wustl.edu/open_access_pubs/3326 This Open Access Publication is brought to you for free and open access by Digital Commons@Becker. It has been accepted for inclusion in Open Access Publications by an authorized administrator of Digital Commons@Becker. For more information, please contact [email protected]. Authors Sriram Devanathan, Timothy Whitehead, George G. Schweitzer, Nicole Fettig, Attila Kovacs, Kenneth S. Korach, Brian N. Finck, and Kooresh I. Shoghi This open access publication is available at Digital Commons@Becker: https://digitalcommons.wustl.edu/open_access_pubs/3326 An Animal Model with a Cardiomyocyte-Specific Deletion of Estrogen Receptor Alpha: Functional, Metabolic, and Differential Network Analysis Sriram Devanathan1, Timothy Whitehead1, George G. Schweitzer2, Nicole Fettig1, Attila Kovacs3, Kenneth S.
  • 32-3824: FDX1 Recombinant Protein Description Product Info

    32-3824: FDX1 Recombinant Protein Description Product Info

    ABGENEX Pvt. Ltd., E-5, Infocity, KIIT Post Office, Tel : +91-674-2720712, +91-9437550560 Email : [email protected] Bhubaneswar, Odisha - 751024, INDIA 32-3824: FDX1 Recombinant Protein Alternative Name : Adrenodoxin mitochondrial,Adrenal ferredoxin,Ferredoxin-1,Hepatoredoxin,FDX1,ADX. Description Source : Escherichia Coli. FDX1 Human Recombinant fused with a 15 amino acid T7 tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 139 amino acids (61-184 a.a.) and having a molecular mass of 15.0kDa.The FDX1 is purified by proprietary chromatographic techniques. Ferredoxin-1 is a small iron-sulfur protein who transfers electrons from NADPH through ferredoxin reductase to a terminal cytochrome P450. This specific oxidation/reduction system is located in steroidogenic tissues, and is involved with the synthesis of bile acid and vitamin D. FDX1 takes part in the synthesis of thyroid hormones and transfers electrons from adrenodoxin reductase to the cholesterol side chain cleavage cytochrome P450. FDX1 supports reactions catalyzed by human microsomal P450s- full length CYP17, truncated CYP17, and truncated CYP21. In addition to the FDX1 at the 11q22chromosomal locus, there are pseudogenes located on chromosomes 20 and 21. Product Info Amount : 25 µg Purification : Greater than 90.0% as determined by SDS-PAGE. Content : The FDX1 solution contains 20mM Tris-HCl buffer (pH8.0) and 10% Glycerol. Store at 4°C if entire vial will be used within 2-4 weeks. Store, frozen at -20°C for longer periods of Storage condition : time. For long term storage it is recommended to add a carrier protein (0.1% HSA or BSA).Avoid multiple freeze-thaw cycles.
  • Anti-FDX1 / Ferredoxin Antibody (ARG58670)

    Anti-FDX1 / Ferredoxin Antibody (ARG58670)

    Product datasheet [email protected] ARG58670 Package: 100 μl anti-FDX1 / Ferredoxin antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes FDX1 / Ferredoxin Tested Reactivity Hu, Ms, Rat Tested Application IHC-P, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name FDX1 / Ferredoxin Antigen Species Human Immunogen Recombinant fusion protein corresponding to aa. 1-184 of Human FDX1 (NP_004100.1). Conjugation Un-conjugated Alternate Names LOH11CR1D; Hepatoredoxin; ADX; Adrenal ferredoxin; FDX; Ferredoxin-1; Adrenodoxin, mitochondrial Application Instructions Application table Application Dilution IHC-P 1:50 - 1:200 WB 1:200 - 1:500 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control K562 Calculated Mw 19 kDa Observed Size 14 kDa Properties Form Liquid Purification Affinity purified. Buffer PBS (pH 7.3), 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. www.arigobio.com 1/2 Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation Gene Symbol FDX1 Gene Full Name ferredoxin 1 Background This gene encodes a small iron-sulfur protein that transfers electrons from NADPH through ferredoxin reductase to mitochondrial cytochrome P450, involved in steroid, vitamin D, and bile acid metabolism.
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Molecular and Cellular Mechanisms of the Angiogenic Effect of Poly(Methacrylic Acid-Co-Methyl Methacrylate) Beads

    Molecular and Cellular Mechanisms of the Angiogenic Effect of Poly(Methacrylic Acid-Co-Methyl Methacrylate) Beads

    Molecular and Cellular Mechanisms of the Angiogenic Effect of Poly(methacrylic acid-co-methyl methacrylate) Beads by Lindsay Elizabeth Fitzpatrick A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Institute of Biomaterials and Biomedical Engineering University of Toronto © Copyright by Lindsay Elizabeth Fitzpatrick 2012 Molecular and Cellular Mechanisms of the Angiogenic Effect of Poly(methacrylic acid-co-methyl methacrylate) Beads Lindsay Elizabeth Fitzpatrick Doctorate of Philosophy Institute of Biomaterials and Biomedical Engineering University of Toronto 2012 Abstract Poly(methacrylic acid -co- methyl methacrylate) beads were previously shown to have a therapeutic effect on wound closure through the promotion of angiogenesis. However, it was unclear how this polymer elicited its beneficial properties. The goal of this thesis was to characterize the host response to MAA beads by identifying molecules of interest involved in MAA-mediated angiogenesis (in comparison to poly(methyl methacrylate) beads, PMMA). Using a model of diabetic wound healing and a macrophage-like cell line (dTHP-1), eight molecules of interest were identified in the host response to MAA beads. Gene and/or protein expression analysis showed that MAA beads increased the expression of Shh, IL-1β, IL-6, TNF- α and Spry2, but decreased the expression of CXCL10 and CXCL12, compared to PMMA and no beads. MAA beads also appeared to modulate the expression of OPN. In vivo, the global gene expression of OPN was increased in wounds treated with MAA beads, compared to PMMA and no beads. In contrast, dTHP-1 decreased OPN gene expression compared to PMMA and no beads, but expressed the same amount of secreted OPN, suggesting that the cells decreased the expression of the intracellular isoform of OPN.