DOCSLIB.ORG

Haplotypes of CYP1B1 and CCDC57 Genes in an Afro-Caribbean Female

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Haplotypes of CYP1B1 and CCDC57 Genes in an Afro-Caribbean Female Molecular Biology Reports (2019) 46:3299–3306 https://doi.org/10.1007/s11033-019-04790-y ORIGINAL ARTICLE Haplotypes of CYP1B1 and CCDC57 genes in an Afro‑Caribbean female population with uterine leiomyoma Angela T. Alleyne1 · Virgil S. Bideau1 Received: 13 December 2018 / Accepted: 28 March 2019 / Published online: 13 April 2019 © Springer Nature B.V. 2019 Abstract Uterine leiomyomas (UL) are prevalent benign tumors, especially among women of African ancestry. The disease also has genetic liability and is infuenced by risk factors such as hormones and obesity. This study investigates the haplotypes of the Cytochrome P450 1B1 gene (CYP1B1) related to hormones and coiled-coil domain containing 57 gene (CCDC57) related to obesity in Afro-Caribbean females. Each haplotype was constructed from unphased sequence data using PHASE v.2.1 software and Haploview v.4.2 was used for linkage disequilibrium (LD) studies. There were contrasting LD observed among the single nucleotide polymorphisms of CYP1B1 and CCDC5. Accordingly, the GTA haplotype of CYP1B1 was signifcantly associated with UL risk (P = 0.02) while there was no association between CCDC57 haplotypes and UL (P = 0.2) for the ATG haplotype. As such, our fndings suggest that the Asp449Asp polymorphism and GTA haplotype of CYP1B1 may contribute to UL susceptibility in women of Afro-Caribbean ancestry in this population. Keywords SNP · Fibroids · Haplotyping · Estrogen · Linkage disequilibrium Introduction consistently having a higher risk of UL development than White women [4]. However cumulatively Black women have Globally, 20–25% of women are clinically diagnosed with an earlier onset for diagnosis than White women [2, 10]. uterine leiomyomas (UL); yet some studies suggest that as Genomic analysis of single nucleotide polymorphisms high as 70–80% of women may develop UL within their (SNPs) has been used to identify genetic factors of UL reproductive lifetimes, making these the most commonly susceptibility [12–14]. Despite this, haplotypes of DNA occurring type of tumors in females [1–4]. Although UL are sequence variation defined by multiple SNPs [15] are benign tumors, they pose several risks to women of child- also increasingly being used in studies of human genetics, bearing ages such as abdominal distention, heavy menstrual because they contain more information than individual SNP bleeding and reproductive dysfunction [4–6]. Chromosomal loci [16]. Haplotype association tests take into consideration anomalies support the view that underlying genetic suscepti- the fact that SNPs are not independent of each other; rather, bility factors account for the growth of these non-malignant they tend to be co-inherited and are therefore in linkage dise- neoplasms that afect the female reproductive tract [7–11]. quilibrium (LD) [17]. Haplotypes therefore capture informa- Race and age are two demographic high risk factors for tion about conserved regions in ancestral chromosomes and developing UL; with women over 40 four times as likely to LD patterns which assist in successful identifcation of rare report the condition than those under 40 and Black women causative variants in single-gene disorders [18, 19]. Notably, African populations or populations with signifcant African Nucleotide sequence data reported are available in the DDBJ/ admixture such as Barbadians [20, 21] have associated hap- EMBL/GenBank databases under the accession number (s) lotype blocks which are narrower, thereby shortening the LT613647-LT613831. list of candidate SNPs to be validated in disease association studies. * Angela T. Alleyne [email protected] Evidence shows that the sex steroid hormone estrogen is an important contributor to tumor growth [22–24]. There- 1 Department of Biological and Chemical Sciences, Faculty fore, allelic variants of genes involved in steroid metabo- of Science and Technology, University of the West Indies lism may infuence a woman’s susceptibility to UL [9, 10, Cave Hill Campus, Bridgetown, Barbados Vol.:(0123456789)1 3 3300 Molecular Biology Reports (2019) 46:3299–3306 23]. Cytochrome P450 1B1 (CYP1B1) being investigated comprised of healthy women who were also being seen by in this study has been haplotyped in two other studies [25, practitioners in the same department. Each participant had 26]. Salimi et al. haplotyped four common SNPs located a medical determination of the presence or absence of UL in exons 2 and 3 of CYP1B1 (Arg368His, Leu432Val, after a medical examination and the diagnosis was confrmed Asp449Asp and Asn453Ser) in an Iranian population [26]. by the gynecologist afliated to the Gynecology Clinic. Par- Their data showed that none of these individual SNPs had ticipants were also asked to complete a brief biodata ques- an association with disease risk; however, they suggested tionnaire about race, age and fbroid status. All participants that the GTAA haplotype may have a protective function in self-identifed as black or Afro-Caribbean [27]. All partici- UL development, as opposed to a causative one. Similarly, pants gave informed consent prior to participating in the Gooden found no association with UL risk when two com- study and the study was approved by the Ethics Committee mon variants (Ala119Ser and Leu432Val) were haplotyped of the University of the West Indies Cave Hill. in women with African or European ancestries [25]. There have been no haplotype studies of the Leu432Val SNP and Primer design UL risk in a Caribbean population, although a protective role was proposed for the recessive allele [G/C] or Val432 in Primers used to generate PCR fragments for sequencing a previous study of the Leu432Val SNP in the same popula- were designed using Primer BLAST [33]. The primers tion [27]. CYP1B1F (5′-TGA AGA ACC GCT GGG TAT GG-3′) and Additional risk factors besides genetics such as diet, CYP1B1R (5′-CCA CAT TAA ACA CCA AAC AGGT-3′) for obesity, parity, and hypertension among others have also CYP1B1 (accession # NC_000002.12) were selected from been widely associated with the prevalence of UL [6, 8, a region spanning 779 bp and contained three common SNPs 10, 28]. Women of African ancestry with UL tend to have (Leu432Val, Asp449Asp and Asn453Ser). Figure 1a shows high mean BMIs (> 25 kg/m2) [28] and an increased risk of the distribution of the three SNPs in CYP1B1. UL is observed in obese women [24, 29–31]. A candidate The primers CCDC57F (5′-TTTAGC TCT TGT GGC CCC SNP rs4247357, located in a large LD block on chromo- TC-3′), and CCDC57R (5′-TCA ACT ACA AGA CTT CGA some 17q25.3, was implicated in UL susceptibility among CTTCAA C-3 ′) were generated from a 1500 bp region span- a cohort of women with European ancestry [32]. However, ning rs4247357 (Fig. 1b) as well as two other variants iden- this genetic association was not replicated in a larger genome tifed from the African-Caribbean, Barbados population in wide association study in a multiethnic group of diferent the 1000 genomes project [19]. The CCDC57 PCR primers ancestries that did not include Afro-Caribbean women amplifed a 571 bp LD region. [12]. The LD block contains three genes; FASN, Coiled- Coil Domain Containing 57 (CCDC57) and Solute Carrier PCR amplifcation and sequencing Family 16 (SLC16A3). The SNP located in CCDC57 causes a nucleotide base pair change [C/A] in the gene. There are Amplifcations were performed in a Techne Genius thermal no reported haplotype studies of rs4247357 of CCDC57 cycler (Fisher Scientifc, Suwanee, GA, USA). The total and UL risk among blacks or whites. Consequently, in this volume for each reaction mixture was 25 µL containing study we utilized experimentally determined sequence data ~ 200 ng of genomic DNA, 1 µM of primers (Bio-Synthesis to identify whether haplotypes in CYP1B1 and CCDC57 are Inc., Lewisville, TX, USA), 2 mM of dNTP mix, 2 mM linked to UL risk in an Afro-Caribbean female population MgCl2, 1 × PCR bufer and 1.25 U Amplitaq Gold 360 in Barbados. DNA polymerase (Applied Biosystems Inc., Foster City, CA, USA) and sterile distilled water. A no template control was used as a negative reaction control. Materials and methods The optimal reaction conditions for CYP1B1 amplifca- tion were as follows: initial denaturation was performed at Participant sampling 95 °C for 2 min followed by 40 cycles at 95 °C for 1 min, 60 °C for 30 s, 72 °C for 30 s and a fnal extension step at A total of 108 blood DNA samples were obtained over a 72 °C for 5 min. Visualization of amplifed fragments was 2-year period (2009–2011), from females who were part of performed on 2% ethidium bromide (EtBr) stained agarose the Barbados Fibroid Study [27]. Each was amplifed by gels. PCR and subsequently sequenced for CYP1B1 and CCDC57. Optimal reaction conditions for CCDC57 were as follows: In each analysis, the study population comprised women initial denaturation was performed at 95 °C for 45 s followed who were being treated at the Gynecological Outpatient by 35 cycles at 95 °C for 45 s, 64 °C for 30 s, 72 °C for 30 s Clinic of the Queen Elizabeth Hospital in Barbados for and a fnal extension at 72 °C for 5 min. Amplifed fragments symptomatic UL as cases, and a non-UL control group were visualized on a 2% agarose gel stained with EtBr. 1 3 Molecular Biology Reports (2019) 46:3299–3306 3301 Fig. 1 Schematic representation of the distribution of three SNPs is a region of high linkage disequilibrium that spans three genes con- in CYP1B1 and CCDC57. a The SNPs are located in exon 3 of the taining approximately 22 SNPs which have been genotyped in other gene. Leu432Val causes an amino acid change from leucine to valine, populations. Only the three shown above were polymorphic and Asp449Asp is a silent mutation of aspartate and Asn453Ser causes a therefore relevant to the current study change from asparagine to serine.
Load more

Recommended publications
  • 00006396 201510000 00004
    King’s Research Portal DOI: 10.1097/j.pain.0000000000000200 Document Version Publisher's PDF, also known as Version of record Link to publication record in King's Research Portal Citation for published version (APA): Livshits, G., Macgregor, A. J., Gieger, C., Malkin, I., Moayyeri, A., Grallert, H., Emeny, R. T., Spector, T., Kastenmuller, G., & Williams, F. M. K. (2015). An omics investigation into chronic widespread musculoskeletal pain reveals epiandrosterone sulfate as a potential biomarker. Pain, 156(10), 1845-1851. https://doi.org/10.1097/j.pain.0000000000000200 Citing this paper Please note that where the full-text provided on King's Research Portal is the Author Accepted Manuscript or Post-Print version this may differ from the final Published version. If citing, it is advised that you check and use the publisher's definitive version for pagination, volume/issue, and date of publication details. And where the final published version is provided on the Research Portal, if citing you are again advised to check the publisher's website for any subsequent corrections. General rights Copyright and moral rights for the publications made accessible in the Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognize and abide by the legal requirements associated with these rights. •Users may download and print one copy of any publication from the Research Portal for the purpose of private study or research. •You may not further distribute the material or use it for any profit-making activity or commercial gain •You may freely distribute the URL identifying the publication in the Research Portal Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim.
    [Show full text]
  • CCDC57 CRISPR/Cas9 KO Plasmid (M): Sc-427913
    SANTA CRUZ BIOTECHNOLOGY, INC. CCDC57 CRISPR/Cas9 KO Plasmid (m): sc-427913 BACKGROUND APPLICATIONS The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CCDC57 CRISPR/Cas9 KO Plasmid (m) is recommended for the disruption of CRISPR-associated protein (Cas9) system is an adaptive immune response gene expression in mouse cells. defense mechanism used by archea and bacteria for the degradation of foreign genetic material (4,6). This mechanism can be repurposed for other 20 nt non-coding RNA sequence: guides Cas9 functions, including genomic engineering for mammalian systems, such as to a specific target location in the genomic DNA gene knockout (KO) (1,2,3,5). CRISPR/Cas9 KO Plasmid products enable the U6 promoter: drives gRNA scaffold: helps Cas9 identification and cleavage of specific genes by utilizing guide RNA (gRNA) expression of gRNA bind to target DNA sequences derived from the Genome-scale CRISPR Knock-Out (GeCKO) v2 library developed in the Zhang Laboratory at the Broad Institute (3,5). Termination signal Green Fluorescent Protein: to visually REFERENCES verify transfection CRISPR/Cas9 Knockout Plasmid CBh (chicken β-Actin 1. Cong, L., et al. 2013. Multiplex genome engineering using CRISPR/Cas hybrid) promoter: drives systems. Science 339: 819-823. 2A peptide: expression of Cas9 allows production of both Cas9 and GFP from the 2. Mali, P., et al. 2013. RNA-guided human genome engineering via Cas9. same CBh promoter Science 339: 823-826. Nuclear localization signal 3. Ran, F.A., et al. 2013. Genome engineering using the CRISPR-Cas9 system. Nuclear localization signal SpCas9 ribonuclease Nat. Protoc. 8: 2281-2308.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • Ccdc57 (NM 027745) Mouse Tagged ORF Clone – MG211452
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MG211452 Ccdc57 (NM_027745) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Ccdc57 (NM_027745) Mouse Tagged ORF Clone Tag: TurboGFP Symbol: Ccdc57 Synonyms: 4933434G05Rik Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MG211452 representing NM_027745 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGCCGCTATGTTCAGAGCGGGAACTGAATGAGCTTTTGGCTCGAAAGGAGGAGGAATGGCGAGTCC TCCAGGCCCACCGTGCGCAGCTGCAGGAGGCAGCTCTACAGGCTGCTCAGAACCGCCTGGAGGAGACACA GGGGAAGCTGCAACGCCTACAGGAGGACTTTGTTTACAACCTTCAGGTGCTGGAAGAGCGGGACCGGGAG CTGGAGCGCTATGATGTTGAGTTCACCCAGGCCCGCCAGCGGGAGGAGGCCCAACAAGCAGAGGCCAGTG AGCTCAAGATAGAGGTGGCCAAGCTGAAACAAGACCTCACCAGGGAGGCCAGGCGAGTGGGGGAGCTGCA GCATCAGCATCAGCTAATGCTGCAGGAGCATCGCTTGGAGTTGGAGCGCGTCCACAGTGACAAGAACAGC GAACTGGCCCACCAGCGGGAACAGAATGAGCGCCTGGAGTGGGAACTGGAGCGAAAACTGAAGGAACTCG ATGGTGAACTTGCTCTGCAGAGACAGGAGCTGCTGCTGGAGTTTGAATCTAAAATGCAGAGAAGAGAGCA TGAGTTCCAGCTGAGGGCTGACGACATGAGCAACGTAGTCCTGACACATGAGCTCAAGATAAAACTACTA AACAAAGAGCTGCAAGCTCTGAGAGACGCTGGAGCACGGGCAGCAGAGAGTCTGCAGAAGGCAGAAGCAG AACACGTGGAATTAGAGAGGAAGCTGCAGGAGCGTGCCCGGGAACTCCAGGATCTGGAGGCCGTGAAGGA CGCTCGGATAAAGGGCTTGGAGAAGAAGCTTTACTCGGCACAGCTGGCCAAGAAGAAAGCTGAGGAGACT TTCAGGAGGAAACATGAAGAGCTTGACCGTCAAGCCAGGGAGAAAGACACAGTGCTGGCGGCAGTGAAGC
    [Show full text]
  • Genome-Wide Linkage and Association Analyses Implicate FASN in Predisposition to Uterine Leiomyomata
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector ARTICLE Genome-wide Linkage and Association Analyses Implicate FASN in Predisposition to Uterine Leiomyomata Stacey L. Eggert,1 Karen L. Huyck,4 Priya Somasundaram,2 Raghava Kavalla,2 Elizabeth A. Stewart,5 Ake T. Lu,6 Jodie N. Painter,7 Grant W. Montgomery,7 Sarah E. Medland,7 Dale R. Nyholt,7 Susan A. Treloar,7,8 Krina T. Zondervan,9 Andrew C. Heath,10 Pamela A.F. Madden,10 Lynda Rose,11 Julie E. Buring,11,12 Paul M. Ridker,11,12 Daniel I. Chasman,11,12 Nicholas G. Martin,7 Rita M. Cantor,6 and Cynthia C. Morton2,3,12,* Uterine leiomyomata (UL), the most prevalent pelvic tumors in women of reproductive age, pose a major public health problem given their high frequency, associated morbidities, and most common indication for hysterectomies. A genetic component to UL predisposi- tion is supported by analyses of ethnic predisposition, twin studies, and familial aggregation. A genome-wide SNP linkage panel was genotyped and analyzed in 261 white UL-affected sister-pair families from the Finding Genes for Fibroids study. Two significant linkage regions were detected in 10p11 (LOD ¼ 4.15) and 3p21 (LOD ¼ 3.73), and five additional linkage regions were identified with LOD scores > 2.00 in 2q37, 5p13, 11p15, 12q14, and 17q25. Genome-wide association studies were performed in two independent cohorts À of white women, and a meta-analysis was conducted. One SNP (rs4247357) was identified with a p value (p ¼ 3.05 3 10 8) that reached genome-wide significance (odds ratio ¼ 1.299).
    [Show full text]
  • Mendelian Pathway Analysis of Laboratory Traits Reveals Distinct Roles for Ciliary Subcompartments in Common Disease Pathogenesis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.08.31.275685; this version posted September 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Mendelian pathway analysis of laboratory traits reveals distinct roles for ciliary subcompartments in common disease pathogenesis Theodore George Drivas1,2, Anastasia Lucas1, Xinyuan Zhang1, Marylyn DeRiggi Ritchie1 1 Department of Genetics, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19194, USA 2 Division of Human Genetics, Children's Hospital of Philadelphia, Philadelphia, PA 19104, USA Summary: Rare monogenic disorders of the primary cilium, termed ciliopathies, are characterized By extreme presentations of otherwise-common diseases, such as diaBetes, hepatic fiBrosis, and kidney failure. However, despite a revolution in our understanding of the cilium’s role in rare disease pathogenesis, the organelle’s contriBution to common disease remains largely unknown. We hypothesized that common genetic variants affecting Mendelian ciliopathy genes might also contriBute to common complex diseases pathogenesis more generally. To address this question, we performed association studies of 16,875 common genetic variants across 122 well- characterized ciliary genes with 12 quantitative laBoratory traits characteristic of ciliopathy syndromes in 378,213 European-ancestry individuals in the UK BioBank. We incorporated tissue- specific gene expression analysis, expression quantitative trait loci (eQTL) and Mendelian disease information into our analysis, and replicated findings in meta-analysis to increase our confidence in oBserved associations Between ciliary genes and human phenotypes.
    [Show full text]
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • Unravelling Genetic Variation Underlying De Novo-Synthesis Of
    www.nature.com/scientificreports OPEN Unravelling genetic variation underlying de novo-synthesis of bovine milk fatty acids Received: 18 July 2017 Tim Martin Knutsen1, Hanne Gro Olsen1, Valeria Tafntseva2, Morten Svendsen3, Accepted: 18 January 2018 Achim Kohler2, Matthew Peter Kent1 & Sigbjørn Lien1 Published: xx xx xxxx The relative abundance of specifc fatty acids in milk can be important for consumer health and manufacturing properties of dairy products. Understanding of genes controlling milk fat synthesis may contribute to the development of dairy products with high quality and nutritional value. This study aims to identify key genes and genetic variants afecting de novo synthesis of the short- and medium- chained fatty acids C4:0 to C14:0. A genome-wide association study using 609,361 SNP markers and 1,811 animals was performed to detect genomic regions afecting fatty acid levels. These regions were further refned using sequencing data to impute millions of additional genetic variants. Results suggest associations of PAEP with the content of C4:0, AACS with the content of fatty acids C4:0-C6:0, NCOA6 or ACSS2 with the longer chain fatty acids C6:0-C14:0, and FASN mainly associated with content of C14:0. None of the top-ranking markers caused amino acid shifts but were mostly situated in putatively regulating regions and suggested a regulatory role of the QTLs. Sequencing mRNA from bovine milk confrmed the expression of all candidate genes which, combined with knowledge of their roles in fat biosynthesis, supports their potential role in de novo synthesis of bovine milk fatty acids. Bovine milk is an important source of many nutrients including proteins, fat, minerals, vitamins and bioactive lipid components.
    [Show full text]
  • Download Special Issue
    BioMed Research International Integrated Analysis of Multiscale Large-Scale Biological Data for Investigating Human Disease 2016 Guest Editors: Tao Huang, Lei Chen, Jiangning Song, Mingyue Zheng, Jialiang Yang, and Zhenguo Zhang Integrated Analysis of Multiscale Large-Scale Biological Data for Investigating Human Disease 2016 BioMed Research International Integrated Analysis of Multiscale Large-Scale Biological Data for Investigating Human Disease 2016 GuestEditors:TaoHuang,LeiChen,JiangningSong, Mingyue Zheng, Jialiang Yang, and Zhenguo Zhang Copyright © 2016 Hindawi Publishing Corporation. All rights reserved. This is a special issue published in “BioMed Research International.” All articles are open access articles distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Contents Integrated Analysis of Multiscale Large-Scale Biological Data for Investigating Human Disease 2016 Tao Huang, Lei Chen, Jiangning Song, Mingyue Zheng, Jialiang Yang, and Zhenguo Zhang Volume 2016, Article ID 6585069, 2 pages New Trends of Digital Data Storage in DNA Pavani Yashodha De Silva and Gamage Upeksha Ganegoda Volume 2016, Article ID 8072463, 14 pages Analyzing the miRNA-Gene Networks to Mine the Important miRNAs under Skin of Human and Mouse Jianghong Wu, Husile Gong, Yongsheng Bai, and Wenguang Zhang Volume 2016, Article ID 5469371, 9 pages Differential Regulatory Analysis Based on Coexpression Network in Cancer Research Junyi
    [Show full text]
  • Content Based Search in Gene Expression Databases and a Meta-Analysis of Host Responses to Infection
    Content Based Search in Gene Expression Databases and a Meta-analysis of Host Responses to Infection A Thesis Submitted to the Faculty of Drexel University by Francis X. Bell in partial fulfillment of the requirements for the degree of Doctor of Philosophy November 2015 c Copyright 2015 Francis X. Bell. All Rights Reserved. ii Acknowledgments I would like to acknowledge and thank my advisor, Dr. Ahmet Sacan. Without his advice, support, and patience I would not have been able to accomplish all that I have. I would also like to thank my committee members and the Biomed Faculty that have guided me. I would like to give a special thanks for the members of the bioinformatics lab, in particular the members of the Sacan lab: Rehman Qureshi, Daisy Heng Yang, April Chunyu Zhao, and Yiqian Zhou. Thank you for creating a pleasant and friendly environment in the lab. I give the members of my family my sincerest gratitude for all that they have done for me. I cannot begin to repay my parents for their sacrifices. I am eternally grateful for everything they have done. The support of my sisters and their encouragement gave me the strength to persevere to the end. iii Table of Contents LIST OF TABLES.......................................................................... vii LIST OF FIGURES ........................................................................ xiv ABSTRACT ................................................................................ xvii 1. A BRIEF INTRODUCTION TO GENE EXPRESSION............................. 1 1.1 Central Dogma of Molecular Biology........................................... 1 1.1.1 Basic Transfers .......................................................... 1 1.1.2 Uncommon Transfers ................................................... 3 1.2 Gene Expression ................................................................. 4 1.2.1 Estimating Gene Expression ............................................ 4 1.2.2 DNA Microarrays ......................................................
    [Show full text]
  • Discerning the Role of Foxa1 in Mammary Gland
    DISCERNING THE ROLE OF FOXA1 IN MAMMARY GLAND DEVELOPMENT AND BREAST CANCER by GINA MARIE BERNARDO Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Dissertation Adviser: Dr. Ruth A. Keri Department of Pharmacology CASE WESTERN RESERVE UNIVERSITY January, 2012 CASE WESTERN RESERVE UNIVERSITY SCHOOL OF GRADUATE STUDIES We hereby approve the thesis/dissertation of Gina M. Bernardo ______________________________________________________ Ph.D. candidate for the ________________________________degree *. Monica Montano, Ph.D. (signed)_______________________________________________ (chair of the committee) Richard Hanson, Ph.D. ________________________________________________ Mark Jackson, Ph.D. ________________________________________________ Noa Noy, Ph.D. ________________________________________________ Ruth Keri, Ph.D. ________________________________________________ ________________________________________________ July 29, 2011 (date) _______________________ *We also certify that written approval has been obtained for any proprietary material contained therein. DEDICATION To my parents, I will forever be indebted. iii TABLE OF CONTENTS Signature Page ii Dedication iii Table of Contents iv List of Tables vii List of Figures ix Acknowledgements xi List of Abbreviations xiii Abstract 1 Chapter 1 Introduction 3 1.1 The FOXA family of transcription factors 3 1.2 The nuclear receptor superfamily 6 1.2.1 The androgen receptor 1.2.2 The estrogen receptor 1.3 FOXA1 in development 13 1.3.1 Pancreas and Kidney
    [Show full text]