DOCSLIB.ORG

High Resolution Analysis of Rare Copy Number Variants in Patients With

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
High Resolution Analysis of Rare Copy Number Variants in Patients With www.nature.com/scientificreports OPEN High resolution analysis of rare copy number variants in patients with autism spectrum disorder from Received: 20 April 2017 Accepted: 4 September 2017 Taiwan Published: xx xx xxxx Chia-Hsiang Chen1,2, Hsin-I. Chen3, Wei-Hsien Chien4, Ling-Hui Li5, Yu-Yu Wu1, Yen-Nan Chiu3, Wen-Che Tsai3 & Susan Shur-Fen Gau 3,6,7 Rare genomic copy number variations (CNVs) (frequency <1%) contribute a part to the genetic underpinnings of autism spectrum disorders (ASD). The study aimed to understand the scope of rare CNV in Taiwanese patients with ASD. We conducted a genome-wide CNV screening of 335 ASD patients (299 males, 36 females) from Taiwan using Afymetrix Genome-Wide Human SNP Array 6.0 and compared the incidence of rare CNV with that of 1093 control subjects (525 males, 568 females). We found a signifcantly increased global burden of rare CNVs in the ASD group compared to the controls as a whole or when the rare CNVs were classifed by the size and types of CNV. Further analysis confrmed the presence of several rare CNVs at regions strongly associated with ASD as reported in the literature in our sample. Additionally, we detected several new private pathogenic CNVs in our samples and fve patients carrying two pathogenic CNVs. Our data indicate that rare genomic CNVs contribute a part to the genetic landscape of our ASD patients. These CNVs are highly heterogeneous, and the clinical interpretation of the pathogenic CNVs of ASD is not straightforward in consideration of the incomplete penetrance, varied expressivity, and individual genetic background. Autism spectrum disorder (ASD) represents a group of childhood-onset neurodevelopmental disorders char- acterized by abnormal social interactions, impaired verbal and nonverbal communication, and the presence of restricted interests and repetitive behaviors with long-term persistence of core features and functional impair- ment1,2. Te prevalence of ASD is various across diferent regions with an increasing trend over the years3–5 and with male excess in a male-to-female ratio of approximately 5:16–8. In the USA, the prevalence of ASD increased in the past decade according to the report of Centers for Disease Control and Prevention of USA8. It was esti- mated that around 1 in 68 persons aged eight years in the USA in 2010 was afected with ASD8. However, the increasing trend of ASD prevalence was not observed in the UK9. Te estimated prevalence of ASD in Chinese population ranged from 2.8 to 29.5 per 10,000 according to a recent review that summarized the fndings in Chinese population from several areas3. Te prevalence of ASD in Taiwan is approximately 0.3% based on the analysis of national health insurance research dataset10 and 1% based on the most recent Taiwan’s national sur- vey of child and adolescent mental disorders11 with a male: female ratio of approximately 4: 110. Due to its high prevalence, long-term impairment resulting in a great impact on individuals, families, and society12,13 and strong evidence of genetic components in its etiology14, this severe developmental disorder has been prioritized for molecular genetic studies15. Te heritability estimate of ASD is greater than 90%, attesting that genetic factors play a major role in the pathogenesis of ASD16–18. However, the genetics of ASD is very complex. Several genome-wide association stud- ies (GWAS) have identifed some common single nucleotide polymorphisms (SNPs) associated with the risk of 1Department of Psychiatry, Chang Gung Memorial Hospital-Linkou, Taoyuan, Taiwan. 2Department and Graduate Institute of Biomedical Sciences, Chang Gung University, Taoyuan, Taiwan. 3Department of Psychiatry, National Taiwan University Hospital and College of Medicine, Taipei, Taiwan. 4Department of Occupational Therapy, College of Medicine, Fu Jen Catholic University, New Taipei City, Taiwan. 5Institute of Biomedical Sciences, Academia Sinica, Taipei, Taiwan. 6Graduate Institute of Brain and Mind Sciences, National Taiwan University, Taipei, Taiwan. 7Graduate Institute of Epidemiology and Preventive Medicine, National Taiwan University, Taipei, Taiwan. Correspondence and requests for materials should be addressed to S.S.-F.G. (email: [email protected]) SCIENTIFIC REPORTS | 7: 11919 | DOI:10.1038/s41598-017-12081-4 1 www.nature.com/scientificreports/ CNV size ASD (n = 335) Controls (n = 1093) CNV rate ASD/CON Likelihood Ratio Chi-square P* <100 Kb 333 394 0.99/0.36 109.68 <0.0001 100–400 Kb 88 43 0.26/0.04 101.02 <0.0001 Deletion >400 Kb 18 14 0.05/0.01 15.41 <0.0001 Total 439 451 1.31/0.41 163.23 <0.0001 <100 Kb 263 229 0.79/0.21 146.25 <0.0001 100–400 Kb 150 144 0.45/0.13 84.17 <0.0001 Duplication >400 Kb 55 19 0.16/0.02 80.21 <0.0001 Total 468 392 1.40/0.36 224.09 <0.0001 <100 Kb 596 623 1.78/0.57 188.03 <0.0001 100–400 Kb 238 187 0.71/0.17 153.20 <0.0001 Deletion and Duplication >400 Kb 73 33 0.22/0.03 89.69 <0.0001 Total 907 843 2.71/0.77 273.33 <0.0001 Table 1. Comparisons of rare autosomal CNVs in patients with autism spectrum disorders and control subjects. P < 0.005 was considered statistically signifcant as it was corrected by 12 using Bonferroni test. ASD, such as common variants on 20p12.1, 5p14.1, 1p13.219–23. Tese common SNPs, however, have only small efects on autism ASD risk, and of note, few if any of these SNPs were replicated in diferent studies. Furthermore, accumulating evidence suggests that rare genetic and genomic mutations also contribute to the genetics of ASD24. Conventional cytogenetic studies of ASD have revealed a variety of rare chromosomal abnormalities associated with ASD25–28 indicating aberrant genomic rearrangements are part of the genetic mechanism of ASD. Notably, the recent advent of array-based comparative genomic hybridization (aCGH) technology has discovered various submicroscopic copy number variations (CNVs) of genomic DNA associated with ASD29,30, leading further sup- port to the idea that ASD is a genomic disorder in a subset of the patients. Tese ASD-associated CNVs are usu- ally individually unique and of low frequency, but together they account for approximately 5–10% of idiopathic ASD29, hence, constituting a part of the genetic architecture of ASD22,31,32. Te discovery of genomic mutations in ASD-associated CNVs not only helps decipher the genetic complexity of ASD23, but also helps shed some light on the neurobiology and pathogenesis of ASD32–37. In our previous studies, we reported four pathogenic CNVs in certain ASD patients38,39, indicating that CNVs also play a role in the genetic architecture of ASD in our patients. To have a better understanding of the scope of rare genomic CNVs in our ASD patient population, we recruited a sample of more than 300 ASD patients and conducted a genome-wide CNV screening in this sample. Results Clinical characteristics. A total of 335 (95.7%) out of 350 cases and 1093 (98.4%) out of 1111 controls passed a series of quality control of CNV experiments. We investigated the ethnicity of cases and controls by performing principle component analysis (PCA) with SNP genotype data from all the participants of this study and the individuals included in HapMap study. Te results demonstrated that the cases and controls are clustered together with the Han Chinese (Supplementary Figure 1). Terefore, the ethnicity of the participants of this study was confrmed to be the Han Chinese. Further, all the CNV data were subjected to the burden analysis. Te patient group consisted of 299 boys and 36 girls with the mean age of 9.4 ± 4.0 years, while the control group consisted of 525 males and 568 females with the mean age of 68.1 ± 10.1 years. Te ADI-R (Autism Diagnostic Interview-Revised) interviews revealed that the 335 patients scored 20.43 ± 6.12 in the “qualitative abnormal- ities in reciprocal social interaction”, 14.75 ± 4.32 in the “qualitative abnormalities in communication, verbal”, 8.19 ± 3.33 in the “qualitative abnormalities in communication, nonverbal”, and 6.95 ± 2.47 in the “restricted, repetitive and stereotyped patterns of behaviors.” All the participants with ASD were noted to have had abnormal development at or before 36 months of age. Teir current average intelligence quotients (IQ) were 94.85 ± 22.55 (range, 40 to 148) for full-scale IQ, 96.74 ± 2.04 (range, 41 to 145) for performance IQ, and 95.08 ± 23.79 (range, 44 to 148) for verbal IQ. Among the 335 ASD patients, nine had been diagnosed with epilepsy (3.04%), four had been suspected of seizure (1.35%), and 19 had ever had a febrile convulsion (6.42%). Tese data are also provided in the Supplementary Table 1. CNV fndings. Te rates of rare CNV (<1% in the patients) at autosomes and X-chromosome were exam- ined between the patient and control groups. CNV regions on autosomes were analyzed in all samples while CNV regions on sex chromosomes were analyzed in male samples only. We found a signifcant excess of the overall rate of rare CNV at autosomes in the ASD patients (2.71) compared with the control subjects (0.77). Te over-representation of rare autosomal CNV rate in ASD was still present when the rare CNVs were grouped into deletion and duplication or classifed according to the size as <100 kb, 100–400 kb, and >400 kb (Table 1). In the analysis of rare CNV at X-chromosome, we compared only the rate of rare CNV between male patients and male control subjects.
Load more

Recommended publications
  • Haplotypes of CYP1B1 and CCDC57 Genes in an Afro-Caribbean Female
    Molecular Biology Reports (2019) 46:3299–3306 https://doi.org/10.1007/s11033-019-04790-y ORIGINAL ARTICLE Haplotypes of CYP1B1 and CCDC57 genes in an Afro‑Caribbean female population with uterine leiomyoma Angela T. Alleyne1 · Virgil S. Bideau1 Received: 13 December 2018 / Accepted: 28 March 2019 / Published online: 13 April 2019 © Springer Nature B.V. 2019 Abstract Uterine leiomyomas (UL) are prevalent benign tumors, especially among women of African ancestry. The disease also has genetic liability and is infuenced by risk factors such as hormones and obesity. This study investigates the haplotypes of the Cytochrome P450 1B1 gene (CYP1B1) related to hormones and coiled-coil domain containing 57 gene (CCDC57) related to obesity in Afro-Caribbean females. Each haplotype was constructed from unphased sequence data using PHASE v.2.1 software and Haploview v.4.2 was used for linkage disequilibrium (LD) studies. There were contrasting LD observed among the single nucleotide polymorphisms of CYP1B1 and CCDC5. Accordingly, the GTA haplotype of CYP1B1 was signifcantly associated with UL risk (P = 0.02) while there was no association between CCDC57 haplotypes and UL (P = 0.2) for the ATG haplotype. As such, our fndings suggest that the Asp449Asp polymorphism and GTA haplotype of CYP1B1 may contribute to UL susceptibility in women of Afro-Caribbean ancestry in this population. Keywords SNP · Fibroids · Haplotyping · Estrogen · Linkage disequilibrium Introduction consistently having a higher risk of UL development than White women [4]. However cumulatively Black women have Globally, 20–25% of women are clinically diagnosed with an earlier onset for diagnosis than White women [2, 10].
    [Show full text]
  • Genetic Variation Across the Human Olfactory Receptor Repertoire Alters Odor Perception
    bioRxiv preprint doi: https://doi.org/10.1101/212431; this version posted November 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Genetic variation across the human olfactory receptor repertoire alters odor perception Casey Trimmer1,*, Andreas Keller2, Nicolle R. Murphy1, Lindsey L. Snyder1, Jason R. Willer3, Maira Nagai4,5, Nicholas Katsanis3, Leslie B. Vosshall2,6,7, Hiroaki Matsunami4,8, and Joel D. Mainland1,9 1Monell Chemical Senses Center, Philadelphia, Pennsylvania, USA 2Laboratory of Neurogenetics and Behavior, The Rockefeller University, New York, New York, USA 3Center for Human Disease Modeling, Duke University Medical Center, Durham, North Carolina, USA 4Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, USA 5Department of Biochemistry, University of Sao Paulo, Sao Paulo, Brazil 6Howard Hughes Medical Institute, New York, New York, USA 7Kavli Neural Systems Institute, New York, New York, USA 8Department of Neurobiology and Duke Institute for Brain Sciences, Duke University Medical Center, Durham, North Carolina, USA 9Department of Neuroscience, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA *[email protected] ABSTRACT The human olfactory receptor repertoire is characterized by an abundance of genetic variation that affects receptor response, but the perceptual effects of this variation are unclear. To address this issue, we sequenced the OR repertoire in 332 individuals and examined the relationship between genetic variation and 276 olfactory phenotypes, including the perceived intensity and pleasantness of 68 odorants at two concentrations, detection thresholds of three odorants, and general olfactory acuity.
    [Show full text]
  • 00006396 201510000 00004
    King’s Research Portal DOI: 10.1097/j.pain.0000000000000200 Document Version Publisher's PDF, also known as Version of record Link to publication record in King's Research Portal Citation for published version (APA): Livshits, G., Macgregor, A. J., Gieger, C., Malkin, I., Moayyeri, A., Grallert, H., Emeny, R. T., Spector, T., Kastenmuller, G., & Williams, F. M. K. (2015). An omics investigation into chronic widespread musculoskeletal pain reveals epiandrosterone sulfate as a potential biomarker. Pain, 156(10), 1845-1851. https://doi.org/10.1097/j.pain.0000000000000200 Citing this paper Please note that where the full-text provided on King's Research Portal is the Author Accepted Manuscript or Post-Print version this may differ from the final Published version. If citing, it is advised that you check and use the publisher's definitive version for pagination, volume/issue, and date of publication details. And where the final published version is provided on the Research Portal, if citing you are again advised to check the publisher's website for any subsequent corrections. General rights Copyright and moral rights for the publications made accessible in the Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognize and abide by the legal requirements associated with these rights. •Users may download and print one copy of any publication from the Research Portal for the purpose of private study or research. •You may not further distribute the material or use it for any profit-making activity or commercial gain •You may freely distribute the URL identifying the publication in the Research Portal Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim.
    [Show full text]
  • CCDC57 CRISPR/Cas9 KO Plasmid (M): Sc-427913
    SANTA CRUZ BIOTECHNOLOGY, INC. CCDC57 CRISPR/Cas9 KO Plasmid (m): sc-427913 BACKGROUND APPLICATIONS The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CCDC57 CRISPR/Cas9 KO Plasmid (m) is recommended for the disruption of CRISPR-associated protein (Cas9) system is an adaptive immune response gene expression in mouse cells. defense mechanism used by archea and bacteria for the degradation of foreign genetic material (4,6). This mechanism can be repurposed for other 20 nt non-coding RNA sequence: guides Cas9 functions, including genomic engineering for mammalian systems, such as to a specific target location in the genomic DNA gene knockout (KO) (1,2,3,5). CRISPR/Cas9 KO Plasmid products enable the U6 promoter: drives gRNA scaffold: helps Cas9 identification and cleavage of specific genes by utilizing guide RNA (gRNA) expression of gRNA bind to target DNA sequences derived from the Genome-scale CRISPR Knock-Out (GeCKO) v2 library developed in the Zhang Laboratory at the Broad Institute (3,5). Termination signal Green Fluorescent Protein: to visually REFERENCES verify transfection CRISPR/Cas9 Knockout Plasmid CBh (chicken β-Actin 1. Cong, L., et al. 2013. Multiplex genome engineering using CRISPR/Cas hybrid) promoter: drives systems. Science 339: 819-823. 2A peptide: expression of Cas9 allows production of both Cas9 and GFP from the 2. Mali, P., et al. 2013. RNA-guided human genome engineering via Cas9. same CBh promoter Science 339: 823-826. Nuclear localization signal 3. Ran, F.A., et al. 2013. Genome engineering using the CRISPR-Cas9 system. Nuclear localization signal SpCas9 ribonuclease Nat. Protoc. 8: 2281-2308.
    [Show full text]
  • Supplemental Information
    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
    [Show full text]
  • LETTER Doi:10.1038/Nature09515
    LETTER doi:10.1038/nature09515 Distant metastasis occurs late during the genetic evolution of pancreatic cancer Shinichi Yachida1*, Siaˆn Jones2*, Ivana Bozic3, Tibor Antal3,4, Rebecca Leary2, Baojin Fu1, Mihoko Kamiyama1, Ralph H. Hruban1,5, James R. Eshleman1, Martin A. Nowak3, Victor E. Velculescu2, Kenneth W. Kinzler2, Bert Vogelstein2 & Christine A. Iacobuzio-Donahue1,5,6 Metastasis, the dissemination and growth of neoplastic cells in an were present in the primary pancreatic tumours from which the meta- organ distinct from that in which they originated1,2, is the most stases arose. A small number of these samples of interest were cell lines common cause of death in cancer patients. This is particularly true or xenografts, similar to the index lesions, whereas the majority were for pancreatic cancers, where most patients are diagnosed with fresh-frozen tissues that contained admixed neoplastic, stromal, metastatic disease and few show a sustained response to chemo- inflammatory, endothelial and normal epithelial cells (Fig. 1a). Each therapy or radiation therapy3. Whether the dismal prognosis of tissue sample was therefore microdissected to minimize contaminat- patients with pancreatic cancer compared to patients with other ing non-neoplastic elements before purifying DNA. types of cancer is a result of late diagnosis or early dissemination of Two categories of mutations were identified (Fig. 1b). The first and disease to distant organs is not known. Here we rely on data gen- largest category corresponded to those mutations present in all samples erated by sequencing the genomes of seven pancreatic cancer meta- from a given patient (‘founder’ mutations, mean of 64%, range 48–83% stases to evaluate the clonal relationships among primary and of all mutations per patient; Fig.
    [Show full text]
  • Ccdc57 (NM 027745) Mouse Tagged ORF Clone – MG211452
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MG211452 Ccdc57 (NM_027745) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Ccdc57 (NM_027745) Mouse Tagged ORF Clone Tag: TurboGFP Symbol: Ccdc57 Synonyms: 4933434G05Rik Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MG211452 representing NM_027745 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGCCGCTATGTTCAGAGCGGGAACTGAATGAGCTTTTGGCTCGAAAGGAGGAGGAATGGCGAGTCC TCCAGGCCCACCGTGCGCAGCTGCAGGAGGCAGCTCTACAGGCTGCTCAGAACCGCCTGGAGGAGACACA GGGGAAGCTGCAACGCCTACAGGAGGACTTTGTTTACAACCTTCAGGTGCTGGAAGAGCGGGACCGGGAG CTGGAGCGCTATGATGTTGAGTTCACCCAGGCCCGCCAGCGGGAGGAGGCCCAACAAGCAGAGGCCAGTG AGCTCAAGATAGAGGTGGCCAAGCTGAAACAAGACCTCACCAGGGAGGCCAGGCGAGTGGGGGAGCTGCA GCATCAGCATCAGCTAATGCTGCAGGAGCATCGCTTGGAGTTGGAGCGCGTCCACAGTGACAAGAACAGC GAACTGGCCCACCAGCGGGAACAGAATGAGCGCCTGGAGTGGGAACTGGAGCGAAAACTGAAGGAACTCG ATGGTGAACTTGCTCTGCAGAGACAGGAGCTGCTGCTGGAGTTTGAATCTAAAATGCAGAGAAGAGAGCA TGAGTTCCAGCTGAGGGCTGACGACATGAGCAACGTAGTCCTGACACATGAGCTCAAGATAAAACTACTA AACAAAGAGCTGCAAGCTCTGAGAGACGCTGGAGCACGGGCAGCAGAGAGTCTGCAGAAGGCAGAAGCAG AACACGTGGAATTAGAGAGGAAGCTGCAGGAGCGTGCCCGGGAACTCCAGGATCTGGAGGCCGTGAAGGA CGCTCGGATAAAGGGCTTGGAGAAGAAGCTTTACTCGGCACAGCTGGCCAAGAAGAAAGCTGAGGAGACT TTCAGGAGGAAACATGAAGAGCTTGACCGTCAAGCCAGGGAGAAAGACACAGTGCTGGCGGCAGTGAAGC
    [Show full text]
  • Temporal Proteomic Analysis of HIV Infection Reveals Remodelling of The
    1 1 Temporal proteomic analysis of HIV infection reveals 2 remodelling of the host phosphoproteome 3 by lentiviral Vif variants 4 5 Edward JD Greenwood 1,2,*, Nicholas J Matheson1,2,*, Kim Wals1, Dick JH van den Boomen1, 6 Robin Antrobus1, James C Williamson1, Paul J Lehner1,* 7 1. Cambridge Institute for Medical Research, Department of Medicine, University of 8 Cambridge, Cambridge, CB2 0XY, UK. 9 2. These authors contributed equally to this work. 10 *Correspondence: [email protected]; [email protected]; [email protected] 11 12 Abstract 13 Viruses manipulate host factors to enhance their replication and evade cellular restriction. 14 We used multiplex tandem mass tag (TMT)-based whole cell proteomics to perform a 15 comprehensive time course analysis of >6,500 viral and cellular proteins during HIV 16 infection. To enable specific functional predictions, we categorized cellular proteins regulated 17 by HIV according to their patterns of temporal expression. We focussed on proteins depleted 18 with similar kinetics to APOBEC3C, and found the viral accessory protein Vif to be 19 necessary and sufficient for CUL5-dependent proteasomal degradation of all members of the 20 B56 family of regulatory subunits of the key cellular phosphatase PP2A (PPP2R5A-E). 21 Quantitative phosphoproteomic analysis of HIV-infected cells confirmed Vif-dependent 22 hyperphosphorylation of >200 cellular proteins, particularly substrates of the aurora kinases. 23 The ability of Vif to target PPP2R5 subunits is found in primate and non-primate lentiviral 2 24 lineages, and remodeling of the cellular phosphoproteome is therefore a second ancient and 25 conserved Vif function.
    [Show full text]
  • Gene Ontology Functional Annotations and Pleiotropy
    Network based analysis of genetic disease associations Sarah Gilman Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2013 Sarah Gilman All Rights Reserved ABSTRACT Network based analysis of genetic disease associations Sarah Gilman Despite extensive efforts and many promising early findings, genome-wide association studies have explained only a small fraction of the genetic factors contributing to common human diseases. There are many theories about where this “missing heritability” might lie, but increasingly the prevailing view is that common variants, the target of GWAS, are not solely responsible for susceptibility to common diseases and a substantial portion of human disease risk will be found among rare variants. Relatively new, such variants have not been subject to purifying selection, and therefore may be particularly pertinent for neuropsychiatric disorders and other diseases with greatly reduced fecundity. Recently, several researchers have made great progress towards uncovering the genetics behind autism and schizophrenia. By sequencing families, they have found hundreds of de novo variants occurring only in affected individuals, both large structural copy number variants and single nucleotide variants. Despite studying large cohorts there has been little recurrence among the genes implicated suggesting that many hundreds of genes may underlie these complex phenotypes. The question
    [Show full text]
  • Structure and Expression Analyses of SVA Elements in Relation to Functional Genes
    pISSN 1598-866X eISSN 2234-0742 Genomics Inform 2013;11(3):142-148 G&I Genomics & Informatics http://dx.doi.org/10.5808/GI.2013.11.3.142 ORIGINAL ARTICLE Structure and Expression Analyses of SVA Elements in Relation to Functional Genes Yun-Jeong Kwon, Yuri Choi, Jungwoo Eo, Yu-Na Noh, Jeong-An Gim, Yi-Deun Jung, Ja-Rang Lee, Heui-Soo Kim* Department of Biological Sciences, College of Natural Sciences, Pusan National University, Busan 609-735, Korea SINE-VNTR-Alu (SVA) elements are present in hominoid primates and are divided into 6 subfamilies (SVA-A to SVA-F) and active in the human population. Using a bioinformatic tool, 22 SVA element-associated genes are identified in the human genome. In an analysis of genomic structure, SVA elements are detected in the 5′ untranslated region (UTR) of HGSNAT (SVA-B), MRGPRX3 (SVA-D), HYAL1 (SVA-F), TCHH (SVA-F), and ATXN2L (SVA-F) genes, while some elements are observed in the 3′UTR of SPICE1 (SVA-B), TDRKH (SVA-C), GOSR1 (SVA-D), BBS5 (SVA-D), NEK5 (SVA-D), ABHD2 (SVA-F), C1QTNF7 (SVA-F), ORC6L (SVA-F), TMEM69 (SVA-F), and CCDC137 (SVA-F) genes. They could contribute to exon extension or supplying poly A signals. LEPR (SVA-C), ALOX5 (SVA-D), PDS5B (SVA-D), and ABCA10 (SVA-F) genes also showed alternative transcripts by SVA exonization events. Dominant expression of HYAL1_SVA appeared in lung tissues, while HYAL1_noSVA showed ubiquitous expression in various human tissues. Expression of both transcripts (TDRKH_SVA and TDRKH_noSVA) of the TDRKH gene appeared to be ubiquitous.
    [Show full text]
  • Misexpression of Cancer/Testis (Ct) Genes in Tumor Cells and the Potential Role of Dream Complex and the Retinoblastoma Protein Rb in Soma-To-Germline Transformation
    Michigan Technological University Digital Commons @ Michigan Tech Dissertations, Master's Theses and Master's Reports 2019 MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO-GERMLINE TRANSFORMATION SABHA M. ALHEWAT Michigan Technological University, [email protected] Copyright 2019 SABHA M. ALHEWAT Recommended Citation ALHEWAT, SABHA M., "MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO- GERMLINE TRANSFORMATION", Open Access Master's Thesis, Michigan Technological University, 2019. https://doi.org/10.37099/mtu.dc.etdr/933 Follow this and additional works at: https://digitalcommons.mtu.edu/etdr Part of the Cancer Biology Commons, and the Cell Biology Commons MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO-GERMLINE TRANSFORMATION By Sabha Salem Alhewati A THESIS Submitted in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE In Biological Sciences MICHIGAN TECHNOLOGICAL UNIVERSITY 2019 © 2019 Sabha Alhewati This thesis has been approved in partial fulfillment of the requirements for the Degree of MASTER OF SCIENCE in Biological Sciences. Department of Biological Sciences Thesis Advisor: Paul Goetsch. Committee Member: Ebenezer Tumban. Committee Member: Zhiying Shan. Department Chair: Chandrashekhar Joshi. Table of Contents List of figures .......................................................................................................................v
    [Show full text]
  • Genome-Wide Linkage and Association Analyses Implicate FASN in Predisposition to Uterine Leiomyomata
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector ARTICLE Genome-wide Linkage and Association Analyses Implicate FASN in Predisposition to Uterine Leiomyomata Stacey L. Eggert,1 Karen L. Huyck,4 Priya Somasundaram,2 Raghava Kavalla,2 Elizabeth A. Stewart,5 Ake T. Lu,6 Jodie N. Painter,7 Grant W. Montgomery,7 Sarah E. Medland,7 Dale R. Nyholt,7 Susan A. Treloar,7,8 Krina T. Zondervan,9 Andrew C. Heath,10 Pamela A.F. Madden,10 Lynda Rose,11 Julie E. Buring,11,12 Paul M. Ridker,11,12 Daniel I. Chasman,11,12 Nicholas G. Martin,7 Rita M. Cantor,6 and Cynthia C. Morton2,3,12,* Uterine leiomyomata (UL), the most prevalent pelvic tumors in women of reproductive age, pose a major public health problem given their high frequency, associated morbidities, and most common indication for hysterectomies. A genetic component to UL predisposi- tion is supported by analyses of ethnic predisposition, twin studies, and familial aggregation. A genome-wide SNP linkage panel was genotyped and analyzed in 261 white UL-affected sister-pair families from the Finding Genes for Fibroids study. Two significant linkage regions were detected in 10p11 (LOD ¼ 4.15) and 3p21 (LOD ¼ 3.73), and five additional linkage regions were identified with LOD scores > 2.00 in 2q37, 5p13, 11p15, 12q14, and 17q25. Genome-wide association studies were performed in two independent cohorts À of white women, and a meta-analysis was conducted. One SNP (rs4247357) was identified with a p value (p ¼ 3.05 3 10 8) that reached genome-wide significance (odds ratio ¼ 1.299).
    [Show full text]