High Resolution Analysis of Rare Copy Number Variants in Patients With
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Haplotypes of CYP1B1 and CCDC57 Genes in an Afro-Caribbean Female
Molecular Biology Reports (2019) 46:3299–3306 https://doi.org/10.1007/s11033-019-04790-y ORIGINAL ARTICLE Haplotypes of CYP1B1 and CCDC57 genes in an Afro‑Caribbean female population with uterine leiomyoma Angela T. Alleyne1 · Virgil S. Bideau1 Received: 13 December 2018 / Accepted: 28 March 2019 / Published online: 13 April 2019 © Springer Nature B.V. 2019 Abstract Uterine leiomyomas (UL) are prevalent benign tumors, especially among women of African ancestry. The disease also has genetic liability and is infuenced by risk factors such as hormones and obesity. This study investigates the haplotypes of the Cytochrome P450 1B1 gene (CYP1B1) related to hormones and coiled-coil domain containing 57 gene (CCDC57) related to obesity in Afro-Caribbean females. Each haplotype was constructed from unphased sequence data using PHASE v.2.1 software and Haploview v.4.2 was used for linkage disequilibrium (LD) studies. There were contrasting LD observed among the single nucleotide polymorphisms of CYP1B1 and CCDC5. Accordingly, the GTA haplotype of CYP1B1 was signifcantly associated with UL risk (P = 0.02) while there was no association between CCDC57 haplotypes and UL (P = 0.2) for the ATG haplotype. As such, our fndings suggest that the Asp449Asp polymorphism and GTA haplotype of CYP1B1 may contribute to UL susceptibility in women of Afro-Caribbean ancestry in this population. Keywords SNP · Fibroids · Haplotyping · Estrogen · Linkage disequilibrium Introduction consistently having a higher risk of UL development than White women [4]. However cumulatively Black women have Globally, 20–25% of women are clinically diagnosed with an earlier onset for diagnosis than White women [2, 10]. -
Genetic Variation Across the Human Olfactory Receptor Repertoire Alters Odor Perception
bioRxiv preprint doi: https://doi.org/10.1101/212431; this version posted November 1, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Genetic variation across the human olfactory receptor repertoire alters odor perception Casey Trimmer1,*, Andreas Keller2, Nicolle R. Murphy1, Lindsey L. Snyder1, Jason R. Willer3, Maira Nagai4,5, Nicholas Katsanis3, Leslie B. Vosshall2,6,7, Hiroaki Matsunami4,8, and Joel D. Mainland1,9 1Monell Chemical Senses Center, Philadelphia, Pennsylvania, USA 2Laboratory of Neurogenetics and Behavior, The Rockefeller University, New York, New York, USA 3Center for Human Disease Modeling, Duke University Medical Center, Durham, North Carolina, USA 4Department of Molecular Genetics and Microbiology, Duke University Medical Center, Durham, North Carolina, USA 5Department of Biochemistry, University of Sao Paulo, Sao Paulo, Brazil 6Howard Hughes Medical Institute, New York, New York, USA 7Kavli Neural Systems Institute, New York, New York, USA 8Department of Neurobiology and Duke Institute for Brain Sciences, Duke University Medical Center, Durham, North Carolina, USA 9Department of Neuroscience, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania, USA *[email protected] ABSTRACT The human olfactory receptor repertoire is characterized by an abundance of genetic variation that affects receptor response, but the perceptual effects of this variation are unclear. To address this issue, we sequenced the OR repertoire in 332 individuals and examined the relationship between genetic variation and 276 olfactory phenotypes, including the perceived intensity and pleasantness of 68 odorants at two concentrations, detection thresholds of three odorants, and general olfactory acuity. -
00006396 201510000 00004
King’s Research Portal DOI: 10.1097/j.pain.0000000000000200 Document Version Publisher's PDF, also known as Version of record Link to publication record in King's Research Portal Citation for published version (APA): Livshits, G., Macgregor, A. J., Gieger, C., Malkin, I., Moayyeri, A., Grallert, H., Emeny, R. T., Spector, T., Kastenmuller, G., & Williams, F. M. K. (2015). An omics investigation into chronic widespread musculoskeletal pain reveals epiandrosterone sulfate as a potential biomarker. Pain, 156(10), 1845-1851. https://doi.org/10.1097/j.pain.0000000000000200 Citing this paper Please note that where the full-text provided on King's Research Portal is the Author Accepted Manuscript or Post-Print version this may differ from the final Published version. If citing, it is advised that you check and use the publisher's definitive version for pagination, volume/issue, and date of publication details. And where the final published version is provided on the Research Portal, if citing you are again advised to check the publisher's website for any subsequent corrections. General rights Copyright and moral rights for the publications made accessible in the Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognize and abide by the legal requirements associated with these rights. •Users may download and print one copy of any publication from the Research Portal for the purpose of private study or research. •You may not further distribute the material or use it for any profit-making activity or commercial gain •You may freely distribute the URL identifying the publication in the Research Portal Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. -
CCDC57 CRISPR/Cas9 KO Plasmid (M): Sc-427913
SANTA CRUZ BIOTECHNOLOGY, INC. CCDC57 CRISPR/Cas9 KO Plasmid (m): sc-427913 BACKGROUND APPLICATIONS The Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR) and CCDC57 CRISPR/Cas9 KO Plasmid (m) is recommended for the disruption of CRISPR-associated protein (Cas9) system is an adaptive immune response gene expression in mouse cells. defense mechanism used by archea and bacteria for the degradation of foreign genetic material (4,6). This mechanism can be repurposed for other 20 nt non-coding RNA sequence: guides Cas9 functions, including genomic engineering for mammalian systems, such as to a specific target location in the genomic DNA gene knockout (KO) (1,2,3,5). CRISPR/Cas9 KO Plasmid products enable the U6 promoter: drives gRNA scaffold: helps Cas9 identification and cleavage of specific genes by utilizing guide RNA (gRNA) expression of gRNA bind to target DNA sequences derived from the Genome-scale CRISPR Knock-Out (GeCKO) v2 library developed in the Zhang Laboratory at the Broad Institute (3,5). Termination signal Green Fluorescent Protein: to visually REFERENCES verify transfection CRISPR/Cas9 Knockout Plasmid CBh (chicken β-Actin 1. Cong, L., et al. 2013. Multiplex genome engineering using CRISPR/Cas hybrid) promoter: drives systems. Science 339: 819-823. 2A peptide: expression of Cas9 allows production of both Cas9 and GFP from the 2. Mali, P., et al. 2013. RNA-guided human genome engineering via Cas9. same CBh promoter Science 339: 823-826. Nuclear localization signal 3. Ran, F.A., et al. 2013. Genome engineering using the CRISPR-Cas9 system. Nuclear localization signal SpCas9 ribonuclease Nat. Protoc. 8: 2281-2308. -
Supplemental Information
Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig. -
LETTER Doi:10.1038/Nature09515
LETTER doi:10.1038/nature09515 Distant metastasis occurs late during the genetic evolution of pancreatic cancer Shinichi Yachida1*, Siaˆn Jones2*, Ivana Bozic3, Tibor Antal3,4, Rebecca Leary2, Baojin Fu1, Mihoko Kamiyama1, Ralph H. Hruban1,5, James R. Eshleman1, Martin A. Nowak3, Victor E. Velculescu2, Kenneth W. Kinzler2, Bert Vogelstein2 & Christine A. Iacobuzio-Donahue1,5,6 Metastasis, the dissemination and growth of neoplastic cells in an were present in the primary pancreatic tumours from which the meta- organ distinct from that in which they originated1,2, is the most stases arose. A small number of these samples of interest were cell lines common cause of death in cancer patients. This is particularly true or xenografts, similar to the index lesions, whereas the majority were for pancreatic cancers, where most patients are diagnosed with fresh-frozen tissues that contained admixed neoplastic, stromal, metastatic disease and few show a sustained response to chemo- inflammatory, endothelial and normal epithelial cells (Fig. 1a). Each therapy or radiation therapy3. Whether the dismal prognosis of tissue sample was therefore microdissected to minimize contaminat- patients with pancreatic cancer compared to patients with other ing non-neoplastic elements before purifying DNA. types of cancer is a result of late diagnosis or early dissemination of Two categories of mutations were identified (Fig. 1b). The first and disease to distant organs is not known. Here we rely on data gen- largest category corresponded to those mutations present in all samples erated by sequencing the genomes of seven pancreatic cancer meta- from a given patient (‘founder’ mutations, mean of 64%, range 48–83% stases to evaluate the clonal relationships among primary and of all mutations per patient; Fig. -
Ccdc57 (NM 027745) Mouse Tagged ORF Clone – MG211452
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MG211452 Ccdc57 (NM_027745) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Ccdc57 (NM_027745) Mouse Tagged ORF Clone Tag: TurboGFP Symbol: Ccdc57 Synonyms: 4933434G05Rik Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MG211452 representing NM_027745 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGCTGCCGCTATGTTCAGAGCGGGAACTGAATGAGCTTTTGGCTCGAAAGGAGGAGGAATGGCGAGTCC TCCAGGCCCACCGTGCGCAGCTGCAGGAGGCAGCTCTACAGGCTGCTCAGAACCGCCTGGAGGAGACACA GGGGAAGCTGCAACGCCTACAGGAGGACTTTGTTTACAACCTTCAGGTGCTGGAAGAGCGGGACCGGGAG CTGGAGCGCTATGATGTTGAGTTCACCCAGGCCCGCCAGCGGGAGGAGGCCCAACAAGCAGAGGCCAGTG AGCTCAAGATAGAGGTGGCCAAGCTGAAACAAGACCTCACCAGGGAGGCCAGGCGAGTGGGGGAGCTGCA GCATCAGCATCAGCTAATGCTGCAGGAGCATCGCTTGGAGTTGGAGCGCGTCCACAGTGACAAGAACAGC GAACTGGCCCACCAGCGGGAACAGAATGAGCGCCTGGAGTGGGAACTGGAGCGAAAACTGAAGGAACTCG ATGGTGAACTTGCTCTGCAGAGACAGGAGCTGCTGCTGGAGTTTGAATCTAAAATGCAGAGAAGAGAGCA TGAGTTCCAGCTGAGGGCTGACGACATGAGCAACGTAGTCCTGACACATGAGCTCAAGATAAAACTACTA AACAAAGAGCTGCAAGCTCTGAGAGACGCTGGAGCACGGGCAGCAGAGAGTCTGCAGAAGGCAGAAGCAG AACACGTGGAATTAGAGAGGAAGCTGCAGGAGCGTGCCCGGGAACTCCAGGATCTGGAGGCCGTGAAGGA CGCTCGGATAAAGGGCTTGGAGAAGAAGCTTTACTCGGCACAGCTGGCCAAGAAGAAAGCTGAGGAGACT TTCAGGAGGAAACATGAAGAGCTTGACCGTCAAGCCAGGGAGAAAGACACAGTGCTGGCGGCAGTGAAGC -
Temporal Proteomic Analysis of HIV Infection Reveals Remodelling of The
1 1 Temporal proteomic analysis of HIV infection reveals 2 remodelling of the host phosphoproteome 3 by lentiviral Vif variants 4 5 Edward JD Greenwood 1,2,*, Nicholas J Matheson1,2,*, Kim Wals1, Dick JH van den Boomen1, 6 Robin Antrobus1, James C Williamson1, Paul J Lehner1,* 7 1. Cambridge Institute for Medical Research, Department of Medicine, University of 8 Cambridge, Cambridge, CB2 0XY, UK. 9 2. These authors contributed equally to this work. 10 *Correspondence: [email protected]; [email protected]; [email protected] 11 12 Abstract 13 Viruses manipulate host factors to enhance their replication and evade cellular restriction. 14 We used multiplex tandem mass tag (TMT)-based whole cell proteomics to perform a 15 comprehensive time course analysis of >6,500 viral and cellular proteins during HIV 16 infection. To enable specific functional predictions, we categorized cellular proteins regulated 17 by HIV according to their patterns of temporal expression. We focussed on proteins depleted 18 with similar kinetics to APOBEC3C, and found the viral accessory protein Vif to be 19 necessary and sufficient for CUL5-dependent proteasomal degradation of all members of the 20 B56 family of regulatory subunits of the key cellular phosphatase PP2A (PPP2R5A-E). 21 Quantitative phosphoproteomic analysis of HIV-infected cells confirmed Vif-dependent 22 hyperphosphorylation of >200 cellular proteins, particularly substrates of the aurora kinases. 23 The ability of Vif to target PPP2R5 subunits is found in primate and non-primate lentiviral 2 24 lineages, and remodeling of the cellular phosphoproteome is therefore a second ancient and 25 conserved Vif function. -
Gene Ontology Functional Annotations and Pleiotropy
Network based analysis of genetic disease associations Sarah Gilman Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy under the Executive Committee of the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2014 © 2013 Sarah Gilman All Rights Reserved ABSTRACT Network based analysis of genetic disease associations Sarah Gilman Despite extensive efforts and many promising early findings, genome-wide association studies have explained only a small fraction of the genetic factors contributing to common human diseases. There are many theories about where this “missing heritability” might lie, but increasingly the prevailing view is that common variants, the target of GWAS, are not solely responsible for susceptibility to common diseases and a substantial portion of human disease risk will be found among rare variants. Relatively new, such variants have not been subject to purifying selection, and therefore may be particularly pertinent for neuropsychiatric disorders and other diseases with greatly reduced fecundity. Recently, several researchers have made great progress towards uncovering the genetics behind autism and schizophrenia. By sequencing families, they have found hundreds of de novo variants occurring only in affected individuals, both large structural copy number variants and single nucleotide variants. Despite studying large cohorts there has been little recurrence among the genes implicated suggesting that many hundreds of genes may underlie these complex phenotypes. The question -
Structure and Expression Analyses of SVA Elements in Relation to Functional Genes
pISSN 1598-866X eISSN 2234-0742 Genomics Inform 2013;11(3):142-148 G&I Genomics & Informatics http://dx.doi.org/10.5808/GI.2013.11.3.142 ORIGINAL ARTICLE Structure and Expression Analyses of SVA Elements in Relation to Functional Genes Yun-Jeong Kwon, Yuri Choi, Jungwoo Eo, Yu-Na Noh, Jeong-An Gim, Yi-Deun Jung, Ja-Rang Lee, Heui-Soo Kim* Department of Biological Sciences, College of Natural Sciences, Pusan National University, Busan 609-735, Korea SINE-VNTR-Alu (SVA) elements are present in hominoid primates and are divided into 6 subfamilies (SVA-A to SVA-F) and active in the human population. Using a bioinformatic tool, 22 SVA element-associated genes are identified in the human genome. In an analysis of genomic structure, SVA elements are detected in the 5′ untranslated region (UTR) of HGSNAT (SVA-B), MRGPRX3 (SVA-D), HYAL1 (SVA-F), TCHH (SVA-F), and ATXN2L (SVA-F) genes, while some elements are observed in the 3′UTR of SPICE1 (SVA-B), TDRKH (SVA-C), GOSR1 (SVA-D), BBS5 (SVA-D), NEK5 (SVA-D), ABHD2 (SVA-F), C1QTNF7 (SVA-F), ORC6L (SVA-F), TMEM69 (SVA-F), and CCDC137 (SVA-F) genes. They could contribute to exon extension or supplying poly A signals. LEPR (SVA-C), ALOX5 (SVA-D), PDS5B (SVA-D), and ABCA10 (SVA-F) genes also showed alternative transcripts by SVA exonization events. Dominant expression of HYAL1_SVA appeared in lung tissues, while HYAL1_noSVA showed ubiquitous expression in various human tissues. Expression of both transcripts (TDRKH_SVA and TDRKH_noSVA) of the TDRKH gene appeared to be ubiquitous. -
Misexpression of Cancer/Testis (Ct) Genes in Tumor Cells and the Potential Role of Dream Complex and the Retinoblastoma Protein Rb in Soma-To-Germline Transformation
Michigan Technological University Digital Commons @ Michigan Tech Dissertations, Master's Theses and Master's Reports 2019 MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO-GERMLINE TRANSFORMATION SABHA M. ALHEWAT Michigan Technological University, [email protected] Copyright 2019 SABHA M. ALHEWAT Recommended Citation ALHEWAT, SABHA M., "MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO- GERMLINE TRANSFORMATION", Open Access Master's Thesis, Michigan Technological University, 2019. https://doi.org/10.37099/mtu.dc.etdr/933 Follow this and additional works at: https://digitalcommons.mtu.edu/etdr Part of the Cancer Biology Commons, and the Cell Biology Commons MISEXPRESSION OF CANCER/TESTIS (CT) GENES IN TUMOR CELLS AND THE POTENTIAL ROLE OF DREAM COMPLEX AND THE RETINOBLASTOMA PROTEIN RB IN SOMA-TO-GERMLINE TRANSFORMATION By Sabha Salem Alhewati A THESIS Submitted in partial fulfillment of the requirements for the degree of MASTER OF SCIENCE In Biological Sciences MICHIGAN TECHNOLOGICAL UNIVERSITY 2019 © 2019 Sabha Alhewati This thesis has been approved in partial fulfillment of the requirements for the Degree of MASTER OF SCIENCE in Biological Sciences. Department of Biological Sciences Thesis Advisor: Paul Goetsch. Committee Member: Ebenezer Tumban. Committee Member: Zhiying Shan. Department Chair: Chandrashekhar Joshi. Table of Contents List of figures .......................................................................................................................v -
Genome-Wide Linkage and Association Analyses Implicate FASN in Predisposition to Uterine Leiomyomata
View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector ARTICLE Genome-wide Linkage and Association Analyses Implicate FASN in Predisposition to Uterine Leiomyomata Stacey L. Eggert,1 Karen L. Huyck,4 Priya Somasundaram,2 Raghava Kavalla,2 Elizabeth A. Stewart,5 Ake T. Lu,6 Jodie N. Painter,7 Grant W. Montgomery,7 Sarah E. Medland,7 Dale R. Nyholt,7 Susan A. Treloar,7,8 Krina T. Zondervan,9 Andrew C. Heath,10 Pamela A.F. Madden,10 Lynda Rose,11 Julie E. Buring,11,12 Paul M. Ridker,11,12 Daniel I. Chasman,11,12 Nicholas G. Martin,7 Rita M. Cantor,6 and Cynthia C. Morton2,3,12,* Uterine leiomyomata (UL), the most prevalent pelvic tumors in women of reproductive age, pose a major public health problem given their high frequency, associated morbidities, and most common indication for hysterectomies. A genetic component to UL predisposi- tion is supported by analyses of ethnic predisposition, twin studies, and familial aggregation. A genome-wide SNP linkage panel was genotyped and analyzed in 261 white UL-affected sister-pair families from the Finding Genes for Fibroids study. Two significant linkage regions were detected in 10p11 (LOD ¼ 4.15) and 3p21 (LOD ¼ 3.73), and five additional linkage regions were identified with LOD scores > 2.00 in 2q37, 5p13, 11p15, 12q14, and 17q25. Genome-wide association studies were performed in two independent cohorts À of white women, and a meta-analysis was conducted. One SNP (rs4247357) was identified with a p value (p ¼ 3.05 3 10 8) that reached genome-wide significance (odds ratio ¼ 1.299).