Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse) Ank 3.59 9.42 28.55 1368945_at bone morphogenetic protein 2 Bmp2 ARE 1.69 22.39 27.95 1398662_at Transcribed locus --- 8.35 12.74 26.27 1386552_at Transcribed locus --- 2.26 15.31 25.51 1368210_at interleukin 24 Il24 ARE 1.30 2.95 23.63 1388204_at matrix metallopeptidase 13 Mmp13 ARE 2.18 3.23 23.10 1398270_at bone morphogenetic protein 2 Bmp2 ARE 1.93 17.82 22.84 1383987_at Transcribed locus --- 2.63 10.44 22.11 1391083_at Rho GTPase activating protein 22 (predicted) Arhgap22 1.30 19.08 21.97 1393439_a_at progressive ankylosis homolog (mouse) Ank ARE 2.58 5.32 21.63 1384027_a_at --- --- 2.17 1.00 21.38 1382378_at cathepsin W Ctsw 6.39 -1.02 20.55 1376197_at transcription factor 7, T-cell specific (predicted) Tcf7 ARE 1.85 -1.10 20.51 1385709_x_at Progressive ankylosis homolog (mouse) Ank 2.30 5.15 20.45 1374594_at similar to RIKEN cDNA 1600029D21 LOC363060 1.40 16.93 19.30 1382603_at Similar to PD-1-ligand precursor (predicted) RGD1566211 1.13 1.95 19.09 1369081_at neuraminidase 1 Neu1 ARE 4.75 1.61 17.73 1378867_at Similar to CG32425-PA (predicted) RGD1307366 2.99 12.57 16.65 1390835_at similar to 1300013J15Rik protein RGD1311123 4.20 11.04 16.47 1368592_at interleukin 1 alpha Il1a ARE 1.08 1.46 16.17 1370047_at ectonucleotide pyrophosphatase/phosphodiesterase 1 Enpp1 7.78 5.19 15.56 1368564_at solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), member 6 Slc17a6 ARE -1.02 5.74 15.25 1367616_at natriuretic peptide precursor type B Nppb ARE 2.73 9.17 14.57 1380028_at similar to ADP-ribosylation factor-like protein 4C (ADP-ribosylation factor-like 7) LOC367311 1.58 2.77 13.95 1375684_at neuraminidase 1 Neu1 3.74 1.40 13.81 1388972_at reticulon 4 receptor Rtn4r 3.90 1.16 13.72 1387548_at hyaluronan synthase 2 Has2 ARE 1.18 1.88 13.06 1378133_at Transcribed locus --- 1.80 13.18 13.01 1384028_at --- --- 2.26 1.08 12.94 1393314_at Transcribed locus --- 3.18 1.28 12.81 1387562_at peptidyl arginine deiminase, type III Padi3 2.40 1.16 12.57 1373008_x_at reticulon 4 receptor Rtn4r 3.33 1.18 12.43 1378556_at Transcribed locus --- 6.54 4.22 12.21 1393728_at Transcribed locus --- ARE 1.65 7.90 11.60 1375815_at Progressive ankylosis homolog (mouse) Ank 1.32 2.21 11.54 1386529_at Transcribed locus --- 3.71 3.88 11.53 1393927_at wingless-related MMTV integration site 2 Wnt2 3.02 1.08 11.51 1395357_at microtubule-associated protein 1b Map1b ARE 4.30 5.96 11.10 1389467_at similar to RIKEN cDNA 1810057C19 MGC108778 ARE 1.08 1.08 10.34 1382482_at Transcribed locus --- 1.41 2.17 10.01 1379340_at lamimin, gamma 2 Lamc2 ARE 1.78 7.49 9.63 1397729_x_at similar to RIKEN cDNA 1600029D21 LOC363060 1.18 8.10 9.30 1379284_at similar to RIKEN cDNA 2810457I06 (predicted) RGD1310357 1.59 3.68 9.23 1375014_at similar to ADP-ribosylation factor-like protein 4C (ADP-ribosylation factor-like 7) LOC367311 ARE 1.45 2.14 9.05 1373363_at microtubule-associated protein 1b Map1b ARE 3.72 4.77 8.78 1385738_at Transcribed locus --- 1.26 1.75 8.53 1385925_at Transcribed locus --- 4.65 2.63 8.46 1367723_a_at linker of T-cell receptor pathways Lnk ARE 1.21 3.78 8.02 1369008_a_at olfactomedin 1 Olfm1 1.14 2.08 7.91 1382375_at Wingless-type MMTV integration site 5A Wnt5a 1.17 3.04 7.85 1397769_at Similar to RIKEN cDNA 6330512M04 gene (predicted) RGD1563319 -1.16 6.18 7.59 1373807_at vascular endothelial growth factor A Vegfa ARE 1.45 5.90 7.52 1393003_at Transcribed locus --- ARE 2.43 2.99 7.28 1370427_at platelet derived growth factor, alpha Pdgfa ARE 1.31 2.28 7.17 1377365_at similar to hypothetical protein DKFZp434H2010 (predicted) RGD1311019 1.01 2.25 7.04 1370387_at cytochrome P450, family 3, subfamily a, polypeptide Cyp3a13 ARE 1.08 5.26 7.04 1368374_a_at gamma-glutamyltransferase 1 Ggt1 1.27 1.07 7.01 1369263_at wingless-type MMTV integration site 5A Wnt5a ARE 1.02 2.91 6.96 1373298_at Transcribed locus --- 1.16 2.56 6.90 1370336_at pregnancy-induced growth inhibitor Okl38 1.94 2.48 6.86 1392791_at Early growth response 3 Egr3 ARE 1.16 3.84 6.81 1388596_at coactosin-like 1 (Dictyostelium) (predicted) Cotl1 1.64 1.40 6.78 1373759_at Transcribed locus --- 1.14 5.17 6.76 1369012_at inhibin beta-A Inhba 1.57 2.87 6.76 1399032_at excision repair cross-complementing rodent repair deficiency, complementation group 1 Ercc1 1.32 4.16 6.70 (predicted) 1378522_at Transcribed locus --- 2.72 2.89 6.64 1375986_at Similar to BTEB3 protein (predicted) RGD1565099 2.29 2.95 6.59 1368804_at leukemia inhibitory factor Lif 1.16 4.56 6.53 1368009_at glucosamine Gne ARE 1.77 4.11 6.52 1389463_at protein kinase, cAMP dependent regulatory, type I, beta Prkar1b 1.59 1.12 6.47 1392820_at Fibroblast growth factor 1 Fgf1 2.25 1.33 6.46 1370023_at gap junction membrane channel protein alpha 4 Gja4 1.29 4.14 6.39 1379598_at Transcribed locus --- 1.16 1.36 6.34 1379375_at Platelet derived growth factor, alpha Pdgfa 1.29 2.21 6.31 1374817_at Transcribed locus --- ARE -1.28 2.09 6.25 1387843_at follistatin Fst 2.83 2.69 6.16 1368350_at protein tyrosine phosphatase, receptor-type, Z polypeptide 1 Ptprz1 ARE -1.18 1.78 6.05 1369625_at aquaporin 1 Aqp1 1.08 1.34 5.95 1395715_at Transcribed locus --- 1.48 2.00 5.89 1368259_at prostaglandin-endoperoxide synthase 1 Ptgs1 ARE 1.15 4.07 5.81 1375320_at Similar to hypothetical protein DKFZp434H2010 (predicted) RGD1311019 1.30 2.12 5.81 1396208_at gamma-glutamyltransferase-like activity 1 Ggtla1 1.61 1.09 5.68 1376498_at similar to 2900002H16Rik protein (predicted) RGD1307973 ARE 1.26 1.70 5.62 1380410_at Similar to GLI pathogenesis-related 2 LOC679819 2.97 2.08 5.58 1385805_at --- --- 1.49 1.19 5.52 1393494_at Transcribed locus --- 1.22 1.88 5.48 1381243_at Transcribed locus --- ARE 1.24 3.69 5.45 1383096_at amyloid beta (A4) precursor-like protein 2 Aplp2 ARE 1.02 2.51 5.43 1388785_at dynein, axonemal, light chain 4 Dnalc4 ARE 1.34 3.05 5.35 1373751_at Transcribed locus --- ARE 1.81 2.01 5.31 1391563_at similar to melanoma associated antigen (mutated) 1-like 1 (predicted) RGD1565148 ARE 1.37 1.62 5.23 1390983_at Transcribed locus --- ARE 1.06 3.02 5.19 1385181_at Transcribed locus --- 1.05 2.39 5.16 1371211_a_at neuregulin 1 Nrg1 1.10 3.72 5.08 1380895_at Amyloid beta (A4) precursor-like protein 2 Aplp2 1.14 1.77 5.05 1368545_at CASP8 and FADD-like apoptosis regulator Cflar ARE 1.49 3.16 5.00 1385926_at Transcribed locus --- 2.76 1.79 5.00 1369683_at BH3 interacting domain death agonist Bid 1.23 1.62 4.93 1368254_a_at sphingosine kinase 1 Sphk1 1.78 2.19 4.83 1383883_at similar to Hypothetical protein KIAA0469 (predicted) RGD1309644 1.70 2.48 4.78 1370082_at transforming growth factor, beta 1 Tgfb1 1.73 2.35 4.78 1374920_at Transcribed locus --- 1.55 2.61 4.73 1378241_at --- --- 1.97 1.00 4.71 1385235_at bol, boule-like (Drosophila) (predicted) Boll ARE -1.42 3.09 4.71 1374537_at carbohydrate (chondroitin) synthase 1 (predicted) Chsy1 ARE 1.65 2.23 4.67 1390429_at Transcribed locus --- ARE 1.55 2.66 4.61 1377759_at Transcribed locus --- ARE 1.21 1.59 4.57 1375377_at Transcribed locus --- 1.43 2.25 4.56 1384238_at similar to Tweety homolog 2 (predicted) RGD1562969 ARE 1.10 2.40 4.45 1388121_at amyloid beta (A4) precursor-like protein 2 Aplp2 1.01 2.36 4.44 1393344_at Transcribed locus --- ARE 1.70 2.15 4.31 1387206_at UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 6 B4galt6 ARE 1.80 1.96 4.31 1387184_at axin2 Axin2 ARE 1.42 2.26 4.26 1378032_at nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta (predicted) Nfkbiz ARE 1.35 2.46 4.23 1382442_at similar to Septin-6 LOC682750 ARE 1.22 2.14 4.23 1391121_at similar to DNA segment, Chr 8, ERATO Doi 82, expressed (predicted) RGD1311793 ARE 1.35 1.94 4.19 1383257_at Transcribed locus --- ARE -1.81 2.79 4.14 1368713_at matrix metallopeptidase 10 Mmp10 ARE 1.24 2.71 4.10 1394361_a_at wingless-related MMTV integration site 2 Wnt2 ARE 1.97 1.24 4.07 1385706_at Transcribed locus --- 1.50 1.77 4.01 1368681_at parathyroid hormone-like peptide Pthlh ARE 1.12 1.95 4.00 1387301_at fibroblast growth factor 1 Fgf1 1.84 1.25 3.99 1372569_at four and a half LIM domains 3 (predicted) Fhl3 1.59 2.25 3.93 1369293_at reticulon 4 receptor Rtn4r 1.65 1.06 3.84 1387975_at UDP-glucose ceramide glucosyltransferase Ugcg ARE 1.27 2.47 3.81 1390249_at similar to DKFZP434H132 protein RGD1305464 1.06 1.48 3.80 1373970_at similar to RIKEN cDNA 9230117N10 RGD1311155 -1.12 3.64 3.72 1369783_a_at neuregulin 1 Nrg1 ARE -1.15 2.58 3.69 1393252_at Transcribed locus --- ARE 1.44 1.04 3.65 1370948_a_at myristoylated alanine rich protein kinase C substrate Marcks ARE 1.09 1.48 3.65 1378480_at Transcribed locus --- 1.01 1.86 3.64 1370817_at Sec11-like 3 (S.