DOCSLIB.ORG

32-3824: FDX1 Recombinant Protein Description Product Info

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
32-3824: FDX1 Recombinant Protein Description Product Info ABGENEX Pvt. Ltd., E-5, Infocity, KIIT Post Office, Tel : +91-674-2720712, +91-9437550560 Email : [email protected] Bhubaneswar, Odisha - 751024, INDIA 32-3824: FDX1 Recombinant Protein Alternative Name : Adrenodoxin mitochondrial,Adrenal ferredoxin,Ferredoxin-1,Hepatoredoxin,FDX1,ADX. Description Source : Escherichia Coli. FDX1 Human Recombinant fused with a 15 amino acid T7 tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 139 amino acids (61-184 a.a.) and having a molecular mass of 15.0kDa.The FDX1 is purified by proprietary chromatographic techniques. Ferredoxin-1 is a small iron-sulfur protein who transfers electrons from NADPH through ferredoxin reductase to a terminal cytochrome P450. This specific oxidation/reduction system is located in steroidogenic tissues, and is involved with the synthesis of bile acid and vitamin D. FDX1 takes part in the synthesis of thyroid hormones and transfers electrons from adrenodoxin reductase to the cholesterol side chain cleavage cytochrome P450. FDX1 supports reactions catalyzed by human microsomal P450s- full length CYP17, truncated CYP17, and truncated CYP21. In addition to the FDX1 at the 11q22chromosomal locus, there are pseudogenes located on chromosomes 20 and 21. Product Info Amount : 25 µg Purification : Greater than 90.0% as determined by SDS-PAGE. Content : The FDX1 solution contains 20mM Tris-HCl buffer (pH8.0) and 10% Glycerol. Store at 4°C if entire vial will be used within 2-4 weeks. Store, frozen at -20°C for longer periods of Storage condition : time. For long term storage it is recommended to add a carrier protein (0.1% HSA or BSA).Avoid multiple freeze-thaw cycles. Amino Acid : MASMTGGQQM GRGSMSSSED KITVHFINRD GETLTTKGKV GDSLLDVVVE NNLDIDGFGA CEGTLACSTC HLIFEDHIYE KLDAITDEEN DMLDLAYGLT DRSRLGCQIC LTKSMDNMTV RVPETVADAR QSIDVGKTS. For Research Use Only. Not for use in diagnostic/therapeutics procedures..
Load more

Recommended publications
  • Anti-FDX1 / Ferredoxin Antibody (ARG58670)
    Product datasheet [email protected] ARG58670 Package: 100 μl anti-FDX1 / Ferredoxin antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes FDX1 / Ferredoxin Tested Reactivity Hu, Ms, Rat Tested Application IHC-P, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name FDX1 / Ferredoxin Antigen Species Human Immunogen Recombinant fusion protein corresponding to aa. 1-184 of Human FDX1 (NP_004100.1). Conjugation Un-conjugated Alternate Names LOH11CR1D; Hepatoredoxin; ADX; Adrenal ferredoxin; FDX; Ferredoxin-1; Adrenodoxin, mitochondrial Application Instructions Application table Application Dilution IHC-P 1:50 - 1:200 WB 1:200 - 1:500 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control K562 Calculated Mw 19 kDa Observed Size 14 kDa Properties Form Liquid Purification Affinity purified. Buffer PBS (pH 7.3), 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. www.arigobio.com 1/2 Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation Gene Symbol FDX1 Gene Full Name ferredoxin 1 Background This gene encodes a small iron-sulfur protein that transfers electrons from NADPH through ferredoxin reductase to mitochondrial cytochrome P450, involved in steroid, vitamin D, and bile acid metabolism.
    [Show full text]
  • Bestimmung Des Interaktionsbereiches Sowie Der Struktur Des
    Bestimmung des Interaktionsbereiches sowie der Struktur des Adrenodoxins im Komplex mit der Adrenodoxin-Reduktase mit Hilfe der paramagnetischen NMR-Spektroskopie Dissertation zur Erlangung des Grades des Doktors der Naturwissenschaften der Naturwissenschaftlich-Technischen Fakultät III Chemie, Pharmazie, Bio- und Werkstoffwissenschaften der Universität des Saarlandes von Frau Dipl. Chem. Berna Mersinli Saarbrücken 2010 Tag des Kolloquiums: 12. Oktober 2010 Dekan: Prof. Dr. Stefan Diebels Berichterstatter: Prof. Dr. Rita Bernhardt Prof. Dr. Marcellus Ubbink Vorsitz: Prof. Dr. Uli Müller Akademischer Mitarbeiter: Dr. Gert-Wieland Kohring Inhaltsverzeichnis Abkürzungsverzeichnis 4 Zusammenfassung 7 Summary 8 1 Einleitung 10 1.1 Cytochrome P450 . 10 1.2 Ferredoxin-NADPH Reduktasen . 16 1.3 Ferredoxine . 19 1.4 Interaktion des Adx mit AdR und CYP11A1 . 24 1.5 NMR-Spektroskopie . 26 1.6 Ziel der Arbeit . 34 2 Material und Methoden 36 2.1 Materialien . 36 2.2 Molekularbiologische Methoden . 39 2.3 Heterologe Proteinexpression und Reinigung . 42 2.4 Biochemische und biophysikalische Methoden . 46 2.5 NMR-Untersuchungen . 52 3 Ergebnisse 60 3.1 Herstellung der AdR-Mutanten . 61 3.2 Charakterisierung der AdR-Mutanten . 72 3.3 Paramagnetische NMR-Experimente . 84 4 Diskussion und Ausblick 110 4.1 Heterologe Expression und Reinigung der AdR-Formen . 111 4.2 Charakterisierung der AdR-Mutanten . 118 4.3 Paramagnetische NMR-Messungen . 123 3 Inhaltsverzeichnis 5 Veröffentlichungen 143 Literaturverzeichnis 143 Anhang 164 4 Abkürzungsverzeichnis Abkürzungen
    [Show full text]
  • Model Name: "Jamshidi2007
    SBML Model Report Model name: “Jamshidi2007 - Genome-scale metabolic network of Mycobacterium tuberculosis (iNJ661)” 2LATEX July 28, 2015 1 General Overview This is a document in SBML Level 3 Version 1 format. Table1 shows an overview of the quantities of all components of this model. Table 1: Number of components in this model, which are described in the following sections. Element Quantity Element Quantity compartment types 0 compartments 2 species types 0 species 826 events 0 constraints 0 reactions 1025 function definitions 0 global parameters 19 unit definitions 1 rules 0 initial assignments 0 Model Notes Jamshidi2007 - Genome-scale metabolic networkof Mycobacterium tuberculosis (iNJ661) This model is described in the article:Investigating the metabolic capabilities of Mycobac- terium tuberculosis H37Rv using the in silico strain iNJ661 and proposing alternative drug tar- gets.Jamshidi N, Palsson B.BMC Syst Biol 2007; 1: 26 Abstract: Produced by SBML2LATEX 1 BACKGROUND: Mycobacterium tuberculosis continues to be a major pathogen in the third world, killing almost 2 million people a year by the most recent estimates. Even in industrialized countries, the emergence of multi-drug resistant (MDR) strains of tuberculosis hails the need to develop additional medications for treatment. Many of the drugs used for treatment of tuber- culosis target metabolic enzymes. Genome-scale models can be used for analysis, discovery, and as hypothesis generating tools, which will hopefully assist the rational drug development process. These models need to be able to assimilate data from large datasets and analyze them. RESULTS: We completed a bottom up reconstruction of the metabolic network of Mycobac- terium tuberculosis H37Rv.
    [Show full text]
  • The Biosynthesis of Adrenal C11-Oxy C21 Steroids, Implicated in 21-Hydroxylase Deficiency – 21-Desoxycortisol and 21-Desoxycortisone and Their Downstream Metabolism
    THE BIOSYNTHESIS OF ADRENAL C11-OXY C21 STEROIDS, IMPLICATED IN 21-HYDROXYLASE DEFICIENCY – 21-DESOXYCORTISOL AND 21-DESOXYCORTISONE AND THEIR DOWNSTREAM METABOLISM by Lise Barnard Thesis presented in fulfilment of the requirements for the degree of Master of Science in the Faculty of Science at Stellenbosch University Supervisor: Prof A.C. Swart March 2017 The financial assistance of the National Research Foundation (NRF) towards this research is hereby acknowledged. Opinions expressed and conclusions arrived at, are those of the author and are not necessarily to be attributed to the NRF. Stellenbosch University https://scholar.sun.ac.za DECLARATION By submitting this thesis electronically, I declare that the entirety of the work contained therein is my own, original work, that I am the sole author thereof (save to the extent explicitly otherwise stated), that reproduction and publication thereof by Stellenbosch University will not infringe any third party rights and that I have not previously in its entirety or in part submitted it for obtaining any qualification. Lise Barnard March 2017 Copyright © 2017 Stellenbosch University All rights reserved ii Stellenbosch University https://scholar.sun.ac.za ABSTRACT Adrenal C19 steroids are often implicated in numerous androgen dependent disease conditions. Androgen excess is the hallmark of 21-hydroxylase deficiency (21OHD) fuelled by an increase in the production of adrenal androgens and androgen precursors. In addition, increased levels of progesterone (P4) and 17α-hydroxyprogesterone (17OHP4), the substrates of the defective cytochrome P450 steroid 21-hydroxylase, have also been reported. Adrenal steroids are secreted into circulation, for further downstream metabolism. Conversion of adrenal steroids to active androgens in peripheral target tissue is dependent on the tissue specific expression of key enzymes, which significantly influence steroid profiles at cellular level, ultimately influencing homeostasis in androgen responsive tissue.
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2006/0053498A1 Bejanin Et Al
    US 20060053498A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2006/0053498A1 Bejanin et al. (43) Pub. Date: Mar. 9, 2006 (54) FULL-LENGTH HUMAN CDNAS ENCODING Publication Classification POTENTIALLY SECRETED PROTEINS (51) Int. Cl. (76) Inventors: Stephane Bejanin, Rochechouart (FR); AOIK 67/00 (2006.01) Jean-Baptiste Dumas Milne Edwards, C07K I4/47 (2006.01) CI2O I/68 (2006.01) Paris (FR); Jean-Yves Giordano, Paris C07H 21/04 (2006.01) (FR); Severin Jobert, Paris (FR); CI2P 21/06 (2006.01) Hiroaki Tanaka, Antony (FR) (52) U.S. Cl. ............ 800/8; 435/6; 435/69.1; 435/320.1; Correspondence Address: 435/325; 530/350, 536/23.5 SALIWANCHIK LLOYD & SALWANCHIK (57) ABSTRACT A PROFESSIONAL ASSOCATION PO BOX 142950 The invention concerns GENSET polynucleotides and GAINESVILLE, FL 32614-2950 (US) polypeptides. Such GENSET products may be used as reagents in forensic analyses, as chromosome markers, as (21) Appl. No.: 10/475,075 tissue/cell/organelle-Specific markers, in the production of expression vectors. In addition, they may be used in Screen (22) PCT Filed: Apr. 18, 2001 ing and diagnosis assays for abnormal GENSET expression and/or biological activity and for Screening compounds that (86) PCT No.: PCT/IB01/00914 may be used in the treatment of GENSET-related disorders. Patent Application Publication Mar. 9, 2006 Sheet 1 of 4 US 2006/0053498A1 D 125A 125B 125C E." 1OO COMPUTER SYSTEM PROCESSOR MEMORY 120 DATA RETRIEMNG DISPLAY DEVICE Figure 1 Patent Application Publication Mar. 9, 2006 Sheet 2 of 4 US 2006/0053498A1 2O2 STORE NEW SEQUENCE TO A MEMORY 204 OPEN DATABASE OF SEQUENCES 2O6 READ FIRST SECUENCE IN DATABASE 21 O PERFORM COMPARISON OF NEW SEQUENCE AND 224 STORED SEQUENCE GO TO NEXT 212 SEQUENCE IN DATABASE YES MORE SEQUENCESN DATABASE? Patent Application Publication Mar.
    [Show full text]
  • Microrna Modulation of Aldosterone Production in the Adrenal Gland Nur
    Ab Razak, Nur Izah (2016) MicroRNA modulation of aldosterone production in the adrenal gland. PhD thesis. https://theses.gla.ac.uk/7719/ Copyright and moral rights for this work are retained by the author A copy can be downloaded for personal non-commercial research or study, without prior permission or charge This work cannot be reproduced or quoted extensively from without first obtaining permission in writing from the author The content must not be changed in any way or sold commercially in any format or medium without the formal permission of the author When referring to this work, full bibliographic details including the author, title, awarding institution and date of the thesis must be given Enlighten: Theses https://theses.gla.ac.uk/ [email protected] MicroRNA modulation of aldosterone production in the adrenal gland Nur Izah Ab Razak (MBBS Malaya) Thesis submitted for the degree of Doctor of Philosophy to the University of Glasgow Institute of Cardiovascular and Medical Sciences College of Medical, Veterinary and Life Sciences University of Glasgow April 2016 © Nur Izah Ab Razak 2016 1 Abstract Hypertension is the major risk factor for coronary disease worldwide. Primary hypertension is idiopathic in origin but is thought to arise from multiple risk factors including genetic, lifestyle and environmental influences. Secondary hypertension has a more definite aetiology; its major single cause is primary aldosteronism (PA), the greatest proportion of which is caused by aldosterone- producing adenoma (APA), where aldosterone is synthesized at high levels by an adenoma of the adrenal gland. There is strong evidence to show that high aldosterone levels cause adverse effects on cardiovascular, cerebrovascular, renal and other systems.
    [Show full text]
  • Mirnas Documented to Play a Role in Hematopoietic Cell Lineage. Our
    Table S1: miRNAs documented to play a role in hematopoietic cell lineage. Our review of the literature summarizing miRNAs known to be involved in the development and proliferation of the hematopoietic lineage cells. miRNA Expression/function/target/regulator References miR-150 Elevated during developmental stages of B and T cell maturation. 16-19 Controls B cell differentiation, present in mature, resting T and B cells but decreased upon activation of naïve T or B cells. Plays a role in establishing lymphocyte identity. Very little is known about function in T cells. Regulators: Foxp3 Target: C-Myb miR-146a/b Upregulated in macropgahe inflammatory response. Differentially 17, 20 upregulated in murine Th1 subset but abolished in Th2 subset. Upregulated in response to TCRs stimulation, as well as by IL-1 and TNF. Highly expressed in murine T-regs and could play a role in establishing lymphocyte identity. Modulates activation induced cell death in activated T cells. Negative regulator of TLR and cytokine signaling pathway. Endotoxin tolerance. Antiviral role. Targets: IRAK1, IRAK2, TRAF6, FAF1 miR-16-1 Promote apoptosis by targeting Bcl2 expression, act as tumor 22 cluster suppressor RNAs. May block differentiation of later stage hematopoietic progenitor cells to mature cells. Downregulated in CLL. Target: BCL2. miR-155 Regulator of T and B cell maturation and innate immune response. 23-29 Expressed in primary mediastinal B-cell lymphoma, T and B cells, macrophages and DCs. Upregulated during B cell activation. Involved in T cell differentiation and indicated as a positive regulator of cytokine production. Activated by stimulating TLR3 and INFab receptors in bone derived macrophages (regulation of antimicrobial defense).
    [Show full text]
  • EUROPEAN PATENT OFFICE, VIENNA Thousand Oaks, CA 91320 (US) SUB-OFFICE
    Europäisches Patentamt *EP001033405A2* (19) European Patent Office Office européen des brevets (11) EP 1 033 405 A2 (12) EUROPEAN PATENT APPLICATION (43) Date of publication: (51) Int Cl.7: C12N 15/29, C12N 15/82, 06.09.2000 Bulletin 2000/36 C07K 14/415, C12Q 1/68, A01H 5/00 (21) Application number: 00301439.6 (22) Date of filing: 25.02.2000 (84) Designated Contracting States: • Brover, Vyacheslav AT BE CH CY DE DK ES FI FR GB GR IE IT LI LU Calabasas, CA 91302 (US) MC NL PT SE • Chen, Xianfeng Designated Extension States: Los Angeles, CA 90025 (US) AL LT LV MK RO SI • Subramanian, Gopalakrishnan Moorpark, CA 93021 (US) (30) Priority: 25.02.1999 US 121825 P • Troukhan, Maxim E. 27.07.1999 US 145918 P South Pasadena, CA 91030 (US) 28.07.1999 US 145951 P • Zheng, Liansheng 02.08.1999 US 146388 P Creve Coeur, MO 63141 (US) 02.08.1999 US 146389 P • Dumas, J. 02.08.1999 US 146386 P , (US) 03.08.1999 US 147038 P 04.08.1999 US 147302 P (74) Representative: 04.08.1999 US 147204 P Bannerman, David Gardner et al More priorities on the following pages Withers & Rogers, Goldings House, (83) Declaration under Rule 28(4) EPC (expert 2 Hays Lane solution) London SE1 2HW (GB) (71) Applicant: Ceres Incorporated Remarks: Malibu, CA 90265 (US) THE COMPLETE DOCUMENT INCLUDING REFERENCE TABLES AND THE SEQUENCE (72) Inventors: LISTING IS AVAILABLE ON CD-ROM FROM THE • Alexandrov, Nickolai EUROPEAN PATENT OFFICE, VIENNA Thousand Oaks, CA 91320 (US) SUB-OFFICE.
    [Show full text]
  • 3Na0 Lichtarge Lab 2006
    Pages 1–11 3na0 Evolutionary trace report by report maker September 13, 2010 4.3.1 Alistat 10 4.3.2 CE 10 4.3.3 DSSP 10 4.3.4 HSSP 11 4.3.5 LaTex 11 4.3.6 Muscle 11 4.3.7 Pymol 11 4.4 Note about ET Viewer 11 4.5 Citing this work 11 4.6 About report maker 11 4.7 Attachments 11 1 INTRODUCTION From the original Protein Data Bank entry (PDB id 3na0): Title: Crystal structure of human cyp11a1 in complex with 20,22- dihydroxycholesterol Compound: Mol id: 1; molecule: cholesterol side-chain cleavage enzyme, mitochond chain: a, b; fragment: unp residues 44-514; syn- onym: cytochrome p450 11a1, cypxia1, cytochrome p450(scc chole- sterol desmolase; ec: 1.14.15.6; engineered: yes; mol id: 2; molecule: CONTENTS adrenodoxin, mitochondrial; chain: c, d; fragment: unp residues 88-155; synonym: adrenal ferredoxin, ferredoxin-1, hepatoredoxin; 1 Introduction 1 engineered: yes Organism, scientific name: Homo Sapiens; 2 Chain 3na0A 1 3na0 contains a single unique chain 3na0A (470 residues long) and 2.1 Q8N1A7 overview 1 its homologue 3na0B. Not enough homologous sequences could be 2.2 Multiple sequence alignment for 3na0A 1 found to permit analysis for chain 3na0C. 2.3 Residue ranking in 3na0A 1 2.4 Top ranking residues in 3na0A and their position on the structure 2 2 CHAIN 3NA0A 2.4.1 Clustering of residues at 25% coverage. 2 2.4.2 Overlap with known functional surfaces at 2.1 Q8N1A7 overview 25% coverage. 2 From SwissProt, id Q8N1A7, 100% identical to 3na0A: 2.4.3 Possible novel functional surfaces at 25% Description: Cytochrome P450, subfamily XIA,.
    [Show full text]
  • Download Author Version (PDF)
    RSC Advances This is an Accepted Manuscript, which has been through the Royal Society of Chemistry peer review process and has been accepted for publication. Accepted Manuscripts are published online shortly after acceptance, before technical editing, formatting and proof reading. Using this free service, authors can make their results available to the community, in citable form, before we publish the edited article. This Accepted Manuscript will be replaced by the edited, formatted and paginated article as soon as this is available. You can find more information about Accepted Manuscripts in the Information for Authors. Please note that technical editing may introduce minor changes to the text and/or graphics, which may alter content. The journal’s standard Terms & Conditions and the Ethical guidelines still apply. In no event shall the Royal Society of Chemistry be held responsible for any errors or omissions in this Accepted Manuscript or any consequences arising from the use of any information it contains. www.rsc.org/advances Page 1 of 34 RSC Advances Color graphic The figure displayed the flow chart of the study. Manuscript Accepted Text Eight breath biomarkers of T2DM were discovered by a newly SPME-GC-MS based metabolic profiling tool. Advances RSC RSC Advances Page 2 of 34 Discovery of potential biomarkers in exhaled breath for diagnosis of type 2 diabetes mellitus based on GC-MS with metabolomics Yanyue Yan 1, Qihui Wang 1, Wenwen Li 1, Zhongjun Zhao 2, Xin Yuan 2, Yanping Huang 2, and Yixiang Duan 3* 1Research Center of Analytical Instrumentation, Analytical & Testing Center, Sichuan University, Chengdu, P.
    [Show full text]
  • Oxysterol Metabolism and Regulation Presented As a SBGN Diagram
    !"#$%&'()*+&%,-().$+*,/0*'&12),%.(/*3'&$&/%&0*,$*,*4567*0.,1',+* !"#$%&'(%))(& *(+(,(%$&%-&./)01/2&345(6($47&8$(+4",()2&%-&95($:#";0&345(6/<&=60%%<7&>0/$64<<%"?,&!#(<5($;7&@())<4& A"/$64&>"4,64$)7&95($:#";07&9BCD&E=!7&=6%)</$57&8FG& & & & H$&)04&I%,)&;4$%J(6&4"/7&)04&#$54",)/$5($;&%-&)04&14/<)0&%-&5/)/&I"%+(545&:2&0(;0&)0"%#;0I#)& )460$%<%;(4,&0/,&"4K#("45&/&$41&I4",I46)(+4&%$&64<<&J4)/:%<(,J7&10(60&(,&)04$&,0(-)45&-"%J&/& "45#6)(%$(,)&+(41&%-&)04&I/,)&)%&/&0%<(,)(6&/$5&K#/$)()/)(+4&/II"%/60G&H$54457&/&J/L%"&60/<<4$;4& :(%<%;(,),&/"4&-/6($;&(,&)%&($)4;"/)4&)04&</";4&5/)/,4),&/+/(</:<4G&M%&)/6N<4&()7&/&$%+4<&/"4/&%-&:(%<%;2&6/<<45& =2,)4J&!(%<%;2&0/,&:44$&,4))<45G&&A#")04"7&54,I()4&5(/;"/J,&/$5&6/")%%$,&0/+4&:44$&4O)4$,(+4<2&#,45&($& :(%<%;2&)%&4OI</($&64<<#</"&I04$%J4$%$7&)%&5/)4&)04"4&/"4&$%&,)/$5/"5&$%)/)(%$,&"46%;$(P45&:2&/<<& ,6(4$)(-(6&6%JJ#$()(4,G&Q%17&/,&)04&$464,,()2&)%&J/$/;4&)0(,&"(60$4,,&%-&5/)/&0/,&:46%J4&/,&I"4,,($;&/,& 4+4"7&/&,)/$5/"5&</$;#/;4&$445,&)%&:4&54-($45G&A%"&)0(,&I#"I%,4&)04&=2,)4J&!(%<%;2&'"/I0(6&Q%)/)(%$& R=!'QS&0/,&:44$&I"%I%,45&/,&/&;%%5&/$,14"&)%&)0(,&(,,#4G&H),&"4J/"N/:<4&,(JI<(6()2&/$5&6%$,(,)4$62& J/N4,&I%,,(:<4&)%&:4&4/,(<2&#$54",)%%5&:2&:(%<%;(,),&/$5&/<,%&)%&:4&I"%64,,45&:2&J/60($4,7&($&%"54"&)%& J/N4&,(J#</)(%$,&/$5&I"45(6)(%$,G&&>0%<4,)4"%<&(,&/&14<<T,)#5(45&,#:L46)&/,&()&(,&/$&4,,4$)(/<&6%JI%$4$)& %-&64<<#</"&J4J:"/$4,&/$5&/&,)/")($;&I%($)&-%"&)04&:(%,2$)04,(,&%-&,)4"%(5&0%"J%$4,&/$5&U()/J($&*G& V55()(%$/<<27&(),&%O(5/)(%$&<4/5,&)%&/&6</,,&%-&6%JI%#$5,&$/J45&%O2,)4"%<,&10(60&6/""2&%#)&5(+4",47& +/<#/:<4&-#$6)(%$,W&)042&%66#"&/,&:(<4&/6(5&($)4"J45(/)4,7&/,&60%<4,)4"%<&)"/$,I%")4",&/$5&)042&/"4&/<,%&
    [Show full text]