DOCSLIB.ORG

Microrna Modulation of Aldosterone Production in the Adrenal Gland Nur

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Microrna Modulation of Aldosterone Production in the Adrenal Gland Nur Ab Razak, Nur Izah (2016) MicroRNA modulation of aldosterone production in the adrenal gland. PhD thesis. https://theses.gla.ac.uk/7719/ Copyright and moral rights for this work are retained by the author A copy can be downloaded for personal non-commercial research or study, without prior permission or charge This work cannot be reproduced or quoted extensively from without first obtaining permission in writing from the author The content must not be changed in any way or sold commercially in any format or medium without the formal permission of the author When referring to this work, full bibliographic details including the author, title, awarding institution and date of the thesis must be given Enlighten: Theses https://theses.gla.ac.uk/ [email protected] MicroRNA modulation of aldosterone production in the adrenal gland Nur Izah Ab Razak (MBBS Malaya) Thesis submitted for the degree of Doctor of Philosophy to the University of Glasgow Institute of Cardiovascular and Medical Sciences College of Medical, Veterinary and Life Sciences University of Glasgow April 2016 © Nur Izah Ab Razak 2016 1 Abstract Hypertension is the major risk factor for coronary disease worldwide. Primary hypertension is idiopathic in origin but is thought to arise from multiple risk factors including genetic, lifestyle and environmental influences. Secondary hypertension has a more definite aetiology; its major single cause is primary aldosteronism (PA), the greatest proportion of which is caused by aldosterone- producing adenoma (APA), where aldosterone is synthesized at high levels by an adenoma of the adrenal gland. There is strong evidence to show that high aldosterone levels cause adverse effects on cardiovascular, cerebrovascular, renal and other systems. Extensive studies have been conducted to analyse the role that regulation of CYP11B2, the gene encoding the aldosterone synthase enzyme plays in determining aldosterone production and the development of hypertension. One significant regulatory factor that has only recently emerged is microRNA (miRNA). miRNAs are small non-coding RNAs, synthesized by a series of enzymatic processes, that negatively regulate gene expression at the post- transcriptional level. Detection and manipulation of miRNA is now known to be a viable method in the treatment, prevention and prognosis of certain diseases. The aim of the present study was to identify miRNAs likely to have a role in the regulation of corticosteroid biosynthesis. To achieve this, the miRNA profile of APA and normal human adrenal tissue was compared, as was the H295R adrenocortical cell line model of adrenocortical function, under both basal conditions and following stimulation of aldosterone production. Key differentially-expressed miRNAs were then identified and bioinformatic tools used to identify likely mRNA targets and pathways for these miRNAs, several of which were investigated and validated using in vitro methods. The background to this study is set out in Chapter 1 of this thesis, followed by a description of the major technical methods employed in Chapter 2. Chapter 3 presents the first of the study results, analysing differences in miRNA profile between APA and normal human adrenal tissue. Microarray was implemented to detect the expression of miRNAs in these two tissue types and several miRNAs were found to vary significantly and consistently between them. Furthermore, members of several miRNA clusters exhibited similar changes in expression pattern between the two tissues e.g. members of cluster miR-29b-1 2 (miR-29a-3p and miR-29b-3p) and of cluster miR-29b-2 (miR-29b-3p and miR-29c- 3p) are downregulated in APA, while members of cluster let-7a-1 (let-7a-5p and let-7d-5p), cluster let-7a-3 (let-7a-5p and let-7b-5p) and cluster miR-134 (miR- 134 and miR-382) are upregulated. Further bioinformatic analysis explored the possible biological function of these miRNAs using Ingenuity® Systems Pathway Analysis software. This led to the identification of validated mRNAs already known to be targeted by these miRNAs, as well as the prediction of other mRNAs that are likely targets and which are involved in processes relevant to APA pathology including cholesterol synthesis (HMGCR) and corticosteroidogenesis (CYP11B2). It was therefore hypothesised that increases in miR-125a-5p or miR- 335-5p would reduce HMGCR and CYP11B2 expression. Chapter 4 describes the characterisation of H295R cells of different strains and sources (H295R Strain 1, 2, 3 and HAC 15). Expression of CYP11B2 was assessed following application of 3 different stimulants: Angio II, dbcAMP and KCl. The most responsive strain to stimulation was Strain 1 at lower passage numbers. Furthermore, H295R proliferation increased following Angio II stimulation. In Chapter 5, the hypothesis that increases in miR-125a-5p or miR-335-5p reduces HMGCR and CYP11B2 expression was tested using realtime quantitative RT-PCR and transfection of miRNA mimics and inhibitors into the H295R cell line model of adrenocortical function. In this way, miR-125a-5p and miR-335-5p were shown to downregulate CYP11B2 and HMGCR expression, thereby validating certain of the bioinformatic predictions generated in Chapter 3. The study of miRNA profile in the H295R cell lines was conducted in Chapter 6, analysing how it changes under conditions that increase aldosterone secretion, including stimulation Angiotensin II, potassium chloride or dibutyryl cAMP (as a substitute for adrenocorticotropic hormone). miRNA profiling identified 7 miRNAs that are consistently downregulated by all three stimuli relative to basal cells: miR-106a-5p, miR-154-3p, miR-17-5p, miR-196b-5p, miR-19a-3p, miR-20b- 5p and miR-766-3p. These miRNAs include those derived from cluster miR-106a- 5p/miR-20b-5p and cluster miR-17-5p/miR-19a-3p, each producing a single polycistronic transcript. IPA bioinformatic analysis was again applied to identify experimentally validated and predicted mRNA targets of these miRNAs and the key biological pathways likely to be affected. This predicted several interactions 3 between miRNAs derived from cluster miR-17-5p/miR-19a-3p and important mRNAs involved in cholesterol biosynthesis: LDLR and ABCA1. These predictions were investigated by in vitro experiment. miR-17-5p/miR-106a-p and miR-20b-5p were found to be consistently downregulated by stimulation of aldosterone biosynthesis. Moreover, miR-766-3p was upregulation throughout. Furthermore, I was able to validate the downregulation of LDLR by miR-17 transfection, as predicted by IPA. In summary, this study identified key miRNAs that are differentially-expressed in vivo in cases of APA or in vitro following stimulation of aldosterone biosynthesis. The many possible biological actions these miRNAs could have were filtered by bioinformatic analysis and selected interactions validated in vitro. While direct actions of these miRNAs on steroidogenic enzymes were identified, cholesterol handling also emerged as an important target and may represent a useful point of intervention in future therapies designed to modulate aldosterone biosynthesis and reduce its harmful effects. 4 Table of Contents ABSTRACT ................................................................................................................................................... 1 PUBLICATIONS .......................................................................................................................................... 14 ACKNOWLEDGEMENTS ............................................................................................................................. 15 AUTHOR’S DECLARATION .......................................................................................................................... 17 DEFINITIONS/ABBREVIATIONS .................................................................................................................. 18 1 INTRODUCTION ................................................................................................................................ 24 1.1 HYPERTENSION ....................................................................................................................................... 25 1.2 THE ADRENAL CORTEX .............................................................................................................................. 27 1.2.1 Structure of the adrenal gland ................................................................................................. 27 1.2.2 The corticosteroids ................................................................................................................... 28 1.2.3 Corticosteroid effects and mechanism of action ...................................................................... 31 1.2.3.1 The steroid receptors: structure function and distribution ....................................... 31 1.3 CHOLESTEROL: ORIGIN AND TRANSPORT ...................................................................................................... 38 1.3.1 StAR .......................................................................................................................................... 42 1.3.2 SF-1 ........................................................................................................................................... 43 1.3.3 HMGCR ..................................................................................................................................... 43 1.3.4 LDLR .........................................................................................................................................
Load more

Recommended publications
  • 32-3824: FDX1 Recombinant Protein Description Product Info
    ABGENEX Pvt. Ltd., E-5, Infocity, KIIT Post Office, Tel : +91-674-2720712, +91-9437550560 Email : [email protected] Bhubaneswar, Odisha - 751024, INDIA 32-3824: FDX1 Recombinant Protein Alternative Name : Adrenodoxin mitochondrial,Adrenal ferredoxin,Ferredoxin-1,Hepatoredoxin,FDX1,ADX. Description Source : Escherichia Coli. FDX1 Human Recombinant fused with a 15 amino acid T7 tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 139 amino acids (61-184 a.a.) and having a molecular mass of 15.0kDa.The FDX1 is purified by proprietary chromatographic techniques. Ferredoxin-1 is a small iron-sulfur protein who transfers electrons from NADPH through ferredoxin reductase to a terminal cytochrome P450. This specific oxidation/reduction system is located in steroidogenic tissues, and is involved with the synthesis of bile acid and vitamin D. FDX1 takes part in the synthesis of thyroid hormones and transfers electrons from adrenodoxin reductase to the cholesterol side chain cleavage cytochrome P450. FDX1 supports reactions catalyzed by human microsomal P450s- full length CYP17, truncated CYP17, and truncated CYP21. In addition to the FDX1 at the 11q22chromosomal locus, there are pseudogenes located on chromosomes 20 and 21. Product Info Amount : 25 µg Purification : Greater than 90.0% as determined by SDS-PAGE. Content : The FDX1 solution contains 20mM Tris-HCl buffer (pH8.0) and 10% Glycerol. Store at 4°C if entire vial will be used within 2-4 weeks. Store, frozen at -20°C for longer periods of Storage condition : time. For long term storage it is recommended to add a carrier protein (0.1% HSA or BSA).Avoid multiple freeze-thaw cycles.
    [Show full text]
  • Anti-FDX1 / Ferredoxin Antibody (ARG58670)
    Product datasheet [email protected] ARG58670 Package: 100 μl anti-FDX1 / Ferredoxin antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes FDX1 / Ferredoxin Tested Reactivity Hu, Ms, Rat Tested Application IHC-P, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name FDX1 / Ferredoxin Antigen Species Human Immunogen Recombinant fusion protein corresponding to aa. 1-184 of Human FDX1 (NP_004100.1). Conjugation Un-conjugated Alternate Names LOH11CR1D; Hepatoredoxin; ADX; Adrenal ferredoxin; FDX; Ferredoxin-1; Adrenodoxin, mitochondrial Application Instructions Application table Application Dilution IHC-P 1:50 - 1:200 WB 1:200 - 1:500 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control K562 Calculated Mw 19 kDa Observed Size 14 kDa Properties Form Liquid Purification Affinity purified. Buffer PBS (pH 7.3), 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. www.arigobio.com 1/2 Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation Gene Symbol FDX1 Gene Full Name ferredoxin 1 Background This gene encodes a small iron-sulfur protein that transfers electrons from NADPH through ferredoxin reductase to mitochondrial cytochrome P450, involved in steroid, vitamin D, and bile acid metabolism.
    [Show full text]
  • Leukaemia Section
    Atlas of Genetics and Cytogenetics in Oncology and Haematology OPEN ACCESS JOURNAL INIST-CNRS Leukaemia Section Short Communication t(7;14)(q35;q32.1) TRB/TCL1A inv(14)(q11q32.1) TRA-TRD/TCL1A t(14;14)(q11;q32.1) TRA-TRD/TCL1A Tatiana Gindina Raisa Gorbacheva Memorial Institute of Children's Oncology, Hematology and Transplantation at First Pavlov St. Petersburg State Medical University, Saint-Petersburg, Russia Published in Atlas Database: June 2018 Online updated version : http://AtlasGeneticsOncology.org/Anomalies/inv14ID2049.html Printable original version : http://documents.irevues.inist.fr/bitstream/handle/2042/70184/06-2018-inv14ID2049.pdf DOI: 10.4267/2042/70184 This article is an update of : Boyer J. t(7;14)(q35;q32.1) TRB@/TCL1A. Atlas Genet Cytogenet Oncol Haematol 2001;5(3) This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 2.0 France Licence. © 2019 Atlas of Genetics and Cytogenetics in Oncology and Haematology TRD; B lymphoblastic leukaemia/lymphoma; T Abstract lymphoblastic leukaemia/lymphoma; Adult T-cell Review on t(7;14)(q35;q32), inv(14)(q11q32) and leukemia/lymphoma; T-cell prolymphocytic t(14;14)(q11;q32), with data on clinics, and the leukemia; Angioimmunoblastic T-cell lymphoma; genes involved. Chronic lymphocytic leukemia; syndrome; Mycosis Keywords fungoides; Hepatosplenic T-cell lymphoma; Acute Chromosome 7; Chromosome 14; TCL1A; TRA; myeloid leukaemia; Ataxia telangiectasia. Left: inv(14)(q11q32)and i(8q), G- banding - Courtesy Jean Luc Lai; right: inv(14)(q11q32) and t(14)(14) with i(7q), G- banding - Courtesy Tatiana Gindina. Atlas Genet Cytogenet Oncol Haematol. 2019; 23(4) 90 t(7;14)(q35;q32.1) TRB/TCL1A Gindina T inv(14)(q11q32.1) TRA-TRD/TCL1A t(14;14)(q11;q32.1) TRA-TRD/TCL1A Cytogenetics Clinics and pathology Chromosomal abnormalities are detected in most T- Disease PLL after culture with mitogens like PHA.
    [Show full text]
  • TCL1A Expression Delineates Biological and Clinical Variability in B-Cell Lymphoma
    Modern Pathology (2009) 22, 206–215 & 2009 USCAP, Inc All rights reserved 0893-3952/09 $32.00 www.modernpathology.org TCL1A expression delineates biological and clinical variability in B-cell lymphoma Mohit Aggarwal1,4, Raquel Villuendas1, Gonzalo Gomez2, Socorro M Rodriguez-Pinilla1, Margarita Sanchez-Beato1, David Alvarez1, Nerea Martinez1, Antonia Rodriguez1, Maria E Castillo1, Francisca I Camacho1, Santiago Montes-Moreno1, Jose A Garcia-Marco3, Eva Kimby4, David G Pisano2 and Miguel A Piris1 1Molecular Pathology Programme, Spanish National Cancer Research Centre (CNIO), Madrid, Spain; 2Bioinformatics Unit, Structural Biology and Biocomputing Programme, CNIO, Madrid, Spain; 3Department of Haematology, Hospital Universitario Puerta de Hierro, Madrid, Spain and 4Division of Hematology, Department of Internal Medicine at Huddinge, Karolinska Institutet, Stockholm, Sweden The assembly of a collection of gene-expression signatures of the major types of B-cell non-Hodgkin’s lymphoma has identified increased T-cell leukemia/lymphoma 1A (TCL1) expression in multiple lymphoma types and cases, and has enabled the investigation of the functional and clinical importance of TCL1 expression. Specifically, Burkitt’s lymphoma cases show a homogeneously strong expression of TCL1, whereas diffuse large B-cell lymphoma, follicular lymphoma, mantle cell lymphoma, chronic lymphocytic leukemia, nodal marginal zone lymphoma, and splenic marginal zone lymphoma display a striking variability in the intensity of TCL1 staining. This was validated in two independent series. A Gene-Set Enrichment Analysis of the genes correlated with TCL1A expression found that variation in the level of expression of TCL1A was significantly associated with some of the most important gene signatures recognizing B-cell lymphoma pathogenesis and heterogeneity, such as germinal center, B-cell receptor, NF-jB (and its target genes), death, MAP kinases, TNFR1, TOLL, and IL1R.
    [Show full text]
  • Bestimmung Des Interaktionsbereiches Sowie Der Struktur Des
    Bestimmung des Interaktionsbereiches sowie der Struktur des Adrenodoxins im Komplex mit der Adrenodoxin-Reduktase mit Hilfe der paramagnetischen NMR-Spektroskopie Dissertation zur Erlangung des Grades des Doktors der Naturwissenschaften der Naturwissenschaftlich-Technischen Fakultät III Chemie, Pharmazie, Bio- und Werkstoffwissenschaften der Universität des Saarlandes von Frau Dipl. Chem. Berna Mersinli Saarbrücken 2010 Tag des Kolloquiums: 12. Oktober 2010 Dekan: Prof. Dr. Stefan Diebels Berichterstatter: Prof. Dr. Rita Bernhardt Prof. Dr. Marcellus Ubbink Vorsitz: Prof. Dr. Uli Müller Akademischer Mitarbeiter: Dr. Gert-Wieland Kohring Inhaltsverzeichnis Abkürzungsverzeichnis 4 Zusammenfassung 7 Summary 8 1 Einleitung 10 1.1 Cytochrome P450 . 10 1.2 Ferredoxin-NADPH Reduktasen . 16 1.3 Ferredoxine . 19 1.4 Interaktion des Adx mit AdR und CYP11A1 . 24 1.5 NMR-Spektroskopie . 26 1.6 Ziel der Arbeit . 34 2 Material und Methoden 36 2.1 Materialien . 36 2.2 Molekularbiologische Methoden . 39 2.3 Heterologe Proteinexpression und Reinigung . 42 2.4 Biochemische und biophysikalische Methoden . 46 2.5 NMR-Untersuchungen . 52 3 Ergebnisse 60 3.1 Herstellung der AdR-Mutanten . 61 3.2 Charakterisierung der AdR-Mutanten . 72 3.3 Paramagnetische NMR-Experimente . 84 4 Diskussion und Ausblick 110 4.1 Heterologe Expression und Reinigung der AdR-Formen . 111 4.2 Charakterisierung der AdR-Mutanten . 118 4.3 Paramagnetische NMR-Messungen . 123 3 Inhaltsverzeichnis 5 Veröffentlichungen 143 Literaturverzeichnis 143 Anhang 164 4 Abkürzungsverzeichnis Abkürzungen
    [Show full text]
  • Model Name: "Jamshidi2007
    SBML Model Report Model name: “Jamshidi2007 - Genome-scale metabolic network of Mycobacterium tuberculosis (iNJ661)” 2LATEX July 28, 2015 1 General Overview This is a document in SBML Level 3 Version 1 format. Table1 shows an overview of the quantities of all components of this model. Table 1: Number of components in this model, which are described in the following sections. Element Quantity Element Quantity compartment types 0 compartments 2 species types 0 species 826 events 0 constraints 0 reactions 1025 function definitions 0 global parameters 19 unit definitions 1 rules 0 initial assignments 0 Model Notes Jamshidi2007 - Genome-scale metabolic networkof Mycobacterium tuberculosis (iNJ661) This model is described in the article:Investigating the metabolic capabilities of Mycobac- terium tuberculosis H37Rv using the in silico strain iNJ661 and proposing alternative drug tar- gets.Jamshidi N, Palsson B.BMC Syst Biol 2007; 1: 26 Abstract: Produced by SBML2LATEX 1 BACKGROUND: Mycobacterium tuberculosis continues to be a major pathogen in the third world, killing almost 2 million people a year by the most recent estimates. Even in industrialized countries, the emergence of multi-drug resistant (MDR) strains of tuberculosis hails the need to develop additional medications for treatment. Many of the drugs used for treatment of tuber- culosis target metabolic enzymes. Genome-scale models can be used for analysis, discovery, and as hypothesis generating tools, which will hopefully assist the rational drug development process. These models need to be able to assimilate data from large datasets and analyze them. RESULTS: We completed a bottom up reconstruction of the metabolic network of Mycobac- terium tuberculosis H37Rv.
    [Show full text]
  • The Biosynthesis of Adrenal C11-Oxy C21 Steroids, Implicated in 21-Hydroxylase Deficiency – 21-Desoxycortisol and 21-Desoxycortisone and Their Downstream Metabolism
    THE BIOSYNTHESIS OF ADRENAL C11-OXY C21 STEROIDS, IMPLICATED IN 21-HYDROXYLASE DEFICIENCY – 21-DESOXYCORTISOL AND 21-DESOXYCORTISONE AND THEIR DOWNSTREAM METABOLISM by Lise Barnard Thesis presented in fulfilment of the requirements for the degree of Master of Science in the Faculty of Science at Stellenbosch University Supervisor: Prof A.C. Swart March 2017 The financial assistance of the National Research Foundation (NRF) towards this research is hereby acknowledged. Opinions expressed and conclusions arrived at, are those of the author and are not necessarily to be attributed to the NRF. Stellenbosch University https://scholar.sun.ac.za DECLARATION By submitting this thesis electronically, I declare that the entirety of the work contained therein is my own, original work, that I am the sole author thereof (save to the extent explicitly otherwise stated), that reproduction and publication thereof by Stellenbosch University will not infringe any third party rights and that I have not previously in its entirety or in part submitted it for obtaining any qualification. Lise Barnard March 2017 Copyright © 2017 Stellenbosch University All rights reserved ii Stellenbosch University https://scholar.sun.ac.za ABSTRACT Adrenal C19 steroids are often implicated in numerous androgen dependent disease conditions. Androgen excess is the hallmark of 21-hydroxylase deficiency (21OHD) fuelled by an increase in the production of adrenal androgens and androgen precursors. In addition, increased levels of progesterone (P4) and 17α-hydroxyprogesterone (17OHP4), the substrates of the defective cytochrome P450 steroid 21-hydroxylase, have also been reported. Adrenal steroids are secreted into circulation, for further downstream metabolism. Conversion of adrenal steroids to active androgens in peripheral target tissue is dependent on the tissue specific expression of key enzymes, which significantly influence steroid profiles at cellular level, ultimately influencing homeostasis in androgen responsive tissue.
    [Show full text]
  • Biological Pathways, Candidate Genes, and Molecular Markers Associated with Quality-Of-Life Domains: an Update
    Qual Life Res (2014) 23:1997–2013 DOI 10.1007/s11136-014-0656-1 REVIEW Biological pathways, candidate genes, and molecular markers associated with quality-of-life domains: an update Mirjam A. G. Sprangers • Melissa S. Y. Thong • Meike Bartels • Andrea Barsevick • Juan Ordon˜ana • Qiuling Shi • Xin Shelley Wang • Pa˚l Klepstad • Eddy A. Wierenga • Jasvinder A. Singh • Jeff A. Sloan Accepted: 19 February 2014 / Published online: 7 March 2014 Ó Springer International Publishing Switzerland 2014 Abstract (depressed mood) and positive (well-being/happiness) Background There is compelling evidence of a genetic emotional functioning, social functioning, and overall foundation of patient-reported quality of life (QOL). Given QOL. the rapid development of substantial scientific advances in Methods We followed a purposeful search algorithm of this area of research, the current paper updates and extends existing literature to capture empirical papers investigating reviews published in 2010. the relationship between biological pathways and molecu- Objectives The objective was to provide an updated lar markers and the identified QOL domains. overview of the biological pathways, candidate genes, and Results Multiple major pathways are involved in each molecular markers involved in fatigue, pain, negative QOL domain. The inflammatory pathway has the strongest evidence as a controlling mechanism underlying fatigue. Inflammation and neurotransmission are key processes On behalf of the GeneQol Consortium. involved in pain perception, and the catechol-O-methyl- transferase (COMT) gene is associated with multiple sorts Electronic supplementary material The online version of this article (doi:10.1007/s11136-014-0656-1) contains supplementary of pain. The neurotransmitter and neuroplasticity theories material, which is available to authorized users.
    [Show full text]
  • Goat Anti-TCL1A Antibody Peptide-Affinity Purified Goat Antibody Catalog # Af2075a
    10320 Camino Santa Fe, Suite G San Diego, CA 92121 Tel: 858.875.1900 Fax: 858.622.0609 Goat Anti-TCL1A Antibody Peptide-affinity purified goat antibody Catalog # AF2075a Specification Goat Anti-TCL1A Antibody - Product Information Application WB Primary Accession P56279 Other Accession NP_068801, 8115 Reactivity Human Host Goat Clonality Polyclonal Concentration 100ug/200ul Isotype IgG Calculated MW 13460 Goat Anti-TCL1A Antibody - Additional Information AF2075a (0.1 µg/ml) staining of Jurkat Cell Gene ID 8115 lysate (35 µg protein in RIPA buffer). Primary incubation was 1 hour. Detected by Other Names chemiluminescence. T-cell leukemia/lymphoma protein 1A, Oncogene TCL-1, Oncogene TCL1, Protein p14 TCL1, TCL1A, TCL1 Goat Anti-TCL1A Antibody - Background Format Overexpression of the TCL1 gene in humans 0.5 mg IgG/ml in Tris saline (20mM Tris has been implicated in the development of pH7.3, 150mM NaCl), 0.02% sodium azide, mature T cell leukemia, in which chromosomal with 0.5% bovine serum albumin rearrangements bring the TCL1 gene in close proximity to the T-cell antigen receptor Storage (TCR)-alpha (MIM 186880) or TCR-beta (MIM Maintain refrigerated at 2-8°C for up to 6 186930) regulatory elements (summarized by months. For long term storage store at -20°C in small aliquots to prevent Virgilio et al., 1998 [PubMed 9520462]). In freeze-thaw cycles. normal T cells TCL1 is expressed in CD4-/CD8- cells, but not in cells at later stages of Precautions differentiation. TCL1 functions as a coactivator Goat Anti-TCL1A Antibody is for research of the cell survival kinase AKT (MIM 164730) use only and not for use in diagnostic or (Laine et al., 2000 [PubMed 10983986]).
    [Show full text]
  • Highly Dampened Blood Transcriptome Response in HIV Patients After Respiratory Infection Subhashini A
    www.nature.com/scientificreports OPEN Highly dampened blood transcriptome response in HIV patients after respiratory infection Subhashini A. Sellers1, William A. Fischer II1, Mark T. Heise2,3,4 & Klaus Schughart 5,6,7* Respiratory viral (RV) infections represent a major threat for human health worldwide. Persons with HIV (PWH) have a compromised immune response and are thought to be at higher risk for severe RV disease. However, very little is known about the host immune response to RV infection in PWH. Here, we investigated gene expression changes in the peripheral blood of PWH co-infected with RV. Only very few diferentially expressed genes could be detected between PWH with and without RV infection, suggesting that the immune response to RV in PWH is strongly dampened. Our data provides important insights into the host response to RV infections in HIV patients. Respiratory viral (RV) infections, including infuenza and presently SARS-CoV-2 pose major threats to pub- lic health as they are responsible for epidemics and pandemics resulting in high morbidity and mortality worldwide1,2. Te most severe infuenza human pandemic in 1918 resulted in about 30 million fatal casualties 3 and the current coronavirus pandemic has already resulted in over 700,000 deaths (WHO situation report 2020). Seasonal RV infections also represent a major health hazard causing morbidity, mortality, and enormous loss of the work force yearly1,4,5. Very little is known about the immune response in persons with HIV (PWH) afer RV infection. Symptoms of RV infection appear to be similar in PWH and non-HIV patients 6.
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • The Human Gene Connectome As a Map of Short Cuts for Morbid Allele Discovery
    The human gene connectome as a map of short cuts for morbid allele discovery Yuval Itana,1, Shen-Ying Zhanga,b, Guillaume Vogta,b, Avinash Abhyankara, Melina Hermana, Patrick Nitschkec, Dror Friedd, Lluis Quintana-Murcie, Laurent Abela,b, and Jean-Laurent Casanovaa,b,f aSt. Giles Laboratory of Human Genetics of Infectious Diseases, Rockefeller Branch, The Rockefeller University, New York, NY 10065; bLaboratory of Human Genetics of Infectious Diseases, Necker Branch, Paris Descartes University, Institut National de la Santé et de la Recherche Médicale U980, Necker Medical School, 75015 Paris, France; cPlateforme Bioinformatique, Université Paris Descartes, 75116 Paris, France; dDepartment of Computer Science, Ben-Gurion University of the Negev, Beer-Sheva 84105, Israel; eUnit of Human Evolutionary Genetics, Centre National de la Recherche Scientifique, Unité de Recherche Associée 3012, Institut Pasteur, F-75015 Paris, France; and fPediatric Immunology-Hematology Unit, Necker Hospital for Sick Children, 75015 Paris, France Edited* by Bruce Beutler, University of Texas Southwestern Medical Center, Dallas, TX, and approved February 15, 2013 (received for review October 19, 2012) High-throughput genomic data reveal thousands of gene variants to detect a single mutated gene, with the other polymorphic genes per patient, and it is often difficult to determine which of these being of less interest. This goes some way to explaining why, variants underlies disease in a given individual. However, at the despite the abundance of NGS data, the discovery of disease- population level, there may be some degree of phenotypic homo- causing alleles from such data remains somewhat limited. geneity, with alterations of specific physiological pathways under- We developed the human gene connectome (HGC) to over- come this problem.
    [Show full text]