DOCSLIB.ORG

Model Name: "Jamshidi2007

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Model Name: SBML Model Report Model name: “Jamshidi2007 - Genome-scale metabolic network of Mycobacterium tuberculosis (iNJ661)” 2LATEX July 28, 2015 1 General Overview This is a document in SBML Level 3 Version 1 format. Table1 shows an overview of the quantities of all components of this model. Table 1: Number of components in this model, which are described in the following sections. Element Quantity Element Quantity compartment types 0 compartments 2 species types 0 species 826 events 0 constraints 0 reactions 1025 function definitions 0 global parameters 19 unit definitions 1 rules 0 initial assignments 0 Model Notes Jamshidi2007 - Genome-scale metabolic networkof Mycobacterium tuberculosis (iNJ661) This model is described in the article:Investigating the metabolic capabilities of Mycobac- terium tuberculosis H37Rv using the in silico strain iNJ661 and proposing alternative drug tar- gets.Jamshidi N, Palsson B.BMC Syst Biol 2007; 1: 26 Abstract: Produced by SBML2LATEX 1 BACKGROUND: Mycobacterium tuberculosis continues to be a major pathogen in the third world, killing almost 2 million people a year by the most recent estimates. Even in industrialized countries, the emergence of multi-drug resistant (MDR) strains of tuberculosis hails the need to develop additional medications for treatment. Many of the drugs used for treatment of tuber- culosis target metabolic enzymes. Genome-scale models can be used for analysis, discovery, and as hypothesis generating tools, which will hopefully assist the rational drug development process. These models need to be able to assimilate data from large datasets and analyze them. RESULTS: We completed a bottom up reconstruction of the metabolic network of Mycobac- terium tuberculosis H37Rv. This functional in silico bacterium, iNJ661, contains 661 genes and 939 reactions and can produce many of the complex compounds characteristic to tuberculosis, such as mycolic acids and mycocerosates. We grew this bacterium in silico on various media, analyzed the model in the context of multiple high-throughput data sets, and finally we ana- lyzed the network in an ’unbiased’ manner by calculating the Hard Coupled Reaction (HCR) sets, groups of reactions that are forced to operate in unison due to mass conservation and con- nectivity constraints. CONCLUSION: Although we observed growth rates comparable to ex- perimental observations (doubling times ranging from about 12 to 24 hours) in different media, comparisons of gene essentiality with experimental data were less encouraging (generally about 55%). The reasons for the often conflicting results were multi-fold, including gene expression variability under different conditions and lack of complete biological knowledge. Some of the inconsistencies between in vitro and in silico or in vivo and in silico results highlight specific loci that are worth further experimental investigations. Finally, by considering the HCR sets in the context of known drug targets for tuberculosis treatment we proposed new alternative, but equivalent drug targets. This model is hosted on BioModels Database and identified by: MODEL1507180001. To cite BioModels Database, please use: BioModels Database: An enhanced, curated and annotated resource for published quantitative kinetic models. To the extent possible under law, all copyright and related or neighbouring rights to this en- coded model have been dedicated to the public domain worldwide. Please refer to CC0 Public Domain Dedication for more information. 2 Unit Definitions This is an overview of six unit definitions of which five are predefined by SBML and not men- tioned in the model. 2.1 Unit mmol per gDW per hr −1 Definition mmol · g−1 · (3600 s) 2.2 Unit substance Notes Mole is the predefined SBML unit for substance. Definition mol 2 Produced by SBML2LATEX 2.3 Unit volume Notes Litre is the predefined SBML unit for volume. Definition l 2.4 Unit area Notes Square metre is the predefined SBML unit for area since SBML Level 2 Version 1. Definition m2 2.5 Unit length Notes Metre is the predefined SBML unit for length since SBML Level 2 Version 1. Definition m 2.6 Unit time Notes Second is the predefined SBML unit for time. Definition s 3 Compartments This model contains two compartments. Table 2: Properties of all compartments. Id Name SBO Spatial Size Unit Constant Outside Dimensions c Cytosol 3 1 litre 3 e Extraorganism 3 1 litre 3 2 2 3.1 Compartment c This is a three dimensional compartment with a constant size given in litre. Name Cytosol 3.2 Compartment e This is a three dimensional compartment with a constant size given in litre. Name Extraorganism Produced by SBML2LATEX 3 4 4 Species This model contains 826 species. Section7 provides further details and the derived rates of change of each species. Table 3: Properties of each species. Id Name Compartment Derived Unit Constant Boundary Condi- tion M 10fthf c 10-Formyltetrahydrofolate c mol · l−1 – – M 12dgr160 c 1,2-Diacyl-sn-glycerol (dihexadecanoyl, c mol · l−1 – – Produced by n-C16:0) 2 2 − 2 2 M 13dpg c 3-Phospho-D-glyceroyl phosphate c mol · l 1 – – M 1hdecg3p c 1-hexadecanoyl-sn-glycerol 3-phosphate c mol · l−1 – – − 2 2 M 1msg3p c 1-Acyl-sn-glycerol 3-phosphate (branched c mol · l 1 – – 2 2 SBML C19:0) − 2 2 M 1pyr5c c 1-Pyrroline-5-carboxylate c mol · l 1 – – 2 −1 L A M 23dhba c (2,3-Dihydroxybenzoyl)adenylate c mol · l – – T E −1 2 2 X M 23dhdp c 2,3-Dihydrodipicolinate c mol · l – – − 2 2 M 23dhmb c (R)-2,3-Dihydroxy-3-methylbutanoate c mol · l 1 – – − 2 2 M 23dhmp c (R)-2,3-Dihydroxy-3-methylpentanoate c mol · l 1 – – − 2 2 M 25aics c (S)-2-[5-Amino-1-(5-phospho- c mol · l 1 – – D-ribosyl)imidazole-4- 2 2 carboxamido]succinate 2 2 M 25dhpp c 2,5-Diamino-6-hydroxy-4-(5’- c mol · l−1 – – phosphoribosylamino)-pyrimidine − 2 2 M 25drapp c 2,5-Diamino-6-(ribosylamino)-4-(3H)- c mol · l 1 – – pyrimidinone 5’-phosphate − 2 2 M 26dap DASH LL c LL-2,6-Diaminoheptanedioate c mol · l 1 – – M 26dap DASH M c meso-2,6-Diaminoheptanedioate c mol · l−1 – – 2 2 2 2 Id Name Compartment Derived Unit Constant Boundary Condi- tion M 2agpe160 c 2-Acyl-sn-glycero-3- c mol · l−1 – – phosphoethanolamine (n-C16:0) − 2 2 M 2agpe180 c 2-Acyl-sn-glycero-3- c mol · l 1 – – phosphoethanolamine (n-C18:0) − 2 2 M 2ahbut c (S)-2-Aceto-2-hydroxybutanoate c mol · l 1 – – M 2ahhmd c 2-Amino-4-hydroxy-6-hydroxymethyl- c mol · l−1 – – 7,8-dihydropteridine diphosphate 2 2 −1 2 2 Produced by M 2ahhmp c 2-Amino-4-hydroxy-6-hydroxymethyl- c mol · l – – 7,8-dihydropteridine − 2 2 M 2c25dho c 2-Carboxy-2,5-dihydro-5-oxofuran-2- c mol · l 1 – – acetate − 2 2 M 2cpr5p c 1-(2-Carboxyphenylamino)-1-deoxy-D- c mol · l 1 – – SBML ribulose 5-phosphate −1 2 2 2 M 2dda7p c 2-Dehydro-3-deoxy-D-arabino-heptonate c mol · l – – L A T E 7-phosphate X − 2 2 M 2dglcn c 2-Deoxy-D-gluconate c mol · l 1 – – M 2dhp c 2-Dehydropantoate c mol · l−1 – – − 2 2 M 2dmmq6 c 2-Demethylmenaquinone 6 c mol · l 1 – – − 2 2 M 2dmmq8 c 2-Demethylmenaquinone 8 c mol · l 1 – – − 2 2 M 2dmmql8 c 2-Demethylmenaquinol 8 c mol · l 1 – – − 2 2 M 2dr1p c 2-Deoxy-D-ribose 1-phosphate c mol · l 1 – – − 2 2 M 2dr5p c 2-Deoxy-D-ribose 5-phosphate c mol · l 1 – – − 2 2 M 2ippm c 2-Isopropylmaleate c mol · l 1 – – − 2 2 M 2mahmp c 2-Methyl-4-amino-5- c mol · l 1 – – hydroxymethylpyrimidine diphosphate 2 2 − 2 2 M 2me4p c 2-C-methyl-D-erythritol 4-phosphate c mol · l 1 – – 5 2 2 6 Id Name Compartment Derived Unit Constant Boundary Condi- tion M 2mecdp c 2-C-methyl-D-erythritol 2,4- c mol · l−1 – – cyclodiphosphate − 2 2 M 2mop c 2-Methyl-3-oxopropanoate c mol · l 1 – – M 2obut c 2-Oxobutanoate c mol · l−1 – – − 2 2 M 2p4c2me c 2-phospho-4-(cytidine 5’-diphospho)-2- c mol · l 1 – – C-methyl-D-erythritol 2 2 − 2 2 M 2pg c D-Glycerate 2-phosphate c mol · l 1 – – −1 Produced by M 2pglyc c 2-Phosphoglycolate c mol · l – – − 2 2 M 2shchc c 2-Succinyl-6-hydroxy-2,4- c mol · l 1 – – cyclohexadiene-1-carboxylate 2 2 − 2 2 M 34hpp c 3-(4-Hydroxyphenyl)pyruvate c mol · l 1 – – M 35cgmp c 3’,5’-Cyclic GMP c mol · l−1 – – SBML − 2 2 M 3c2hmp c 3-Carboxy-2-hydroxy-4- c mol · l 1 – – 2 2 2 methylpentanoate L A − T · 1 2 2 E M 3c3hmp c 3-Carboxy-3-hydroxy-4- c mol l – – X methylpentanoate − 2 2 M 3c4mop c 3-Carboxy-4-methyl-2-oxopentanoate c mol · l 1 – – M 3ddgc c 3-Dehydro-2-deoxy-D-gluconate c mol · l−1 – – − 2 2 M 3dhq c 3-Dehydroquinate c mol · l 1 – – − 2 2 M 3dhsk c 3-Dehydroshikimate c mol · l 1 – – − 2 2 M 3ig3p c C’-(3-Indolyl)-glycerol 3-phosphate c mol · l 1 – – − 2 2 M 3mob c 3-Methyl-2-oxobutanoate c mol · l 1 – – − 2 2 M 3mop c (S)-3-Methyl-2-oxopentanoate c mol · l 1 – – − 2 2 M 3pg c 3-Phospho-D-glycerate c mol · l 1 – – − 2 2 M 3php c 3-Phosphohydroxypyruvate c mol · l 1 – – − 2 2 M 3psme c 5-O-(1-Carboxyvinyl)-3- c mol · l 1 – – 2 2 phosphoshikimate 2 2 Id Name Compartment Derived Unit Constant Boundary Condi- tion M 4abut c 4-Aminobutanoate c mol · l−1 – – M 4abz c 4-Aminobenzoate c mol · l−1 – – − 2 2 M 4adcho c 4-amino-4-deoxychorismate c mol · l 1 – – − 2 2 M 4ahmmp c 4-Amino-5-hydroxymethyl-2- c mol · l 1 – – methylpyrimidine 2 2 − 2 2 M 4ampm c 4-Amino-2-methyl-5- c mol · l 1 – – phosphomethylpyrimidine −1 2 2 Produced by M 4c2me c 4-(cytidine 5’-diphospho)-2-C-methyl-D- c mol · l – – erythritol − 2 2 M 4h2opntn c 4-Hydroxy-2-oxopentanoate c mol · l 1 – – M 4hba c 4-Hydroxy-benzyl alcohol c mol · l−1 – – − 2 2 M 4hbzACP c 4-hydroxybenzoyl ACP c mol · l 1 – – SBML − 2 2 M 4hbz c 4-Hydroxybenzoate c mol · l 1 – – −1 2 2 2 M 4hthr c 4-Hydroxy-L-threonine c mol · l – – L A − T · 1 2 2 E M 4mhetz c 4-Methyl-5-(2-hydroxyethyl)-thiazole c mol l – – X − 2 2 M 4mop c 4-Methyl-2-oxopentanoate
Load more

  1072
Copy Link
Recommended publications
  • Hyperbilirubinemia
    Porphyrins Porphyrins (Porphins) are cyclic tetrapyrol compounds formed by the linkage )). of four pyrrole rings through methenyl bridges (( HC In the reduced porphyrins (Porphyrinogens) the linkage of four pyrrole rings (tetrapyrol) through methylene bridges (( CH2 )) The characteristic property of porphyrins is the formation of complexes with the metal ion bound to nitrogen atoms of the pyrrole rings. e.g. Heme (iron porphyrin). Proteins which contain heme ((hemoproteins)) are widely distributed e.g. Hemoglobin, Myoglobin, Cytochromes, Catalase & Tryptophan pyrrolase. Natural porphyrins have substituent side chains on the eight hydrogen atoms numbered on the pyrrole rings. These side chains are: CH 1-Methyl-group (M)… (( 3 )) 2-Acetate-group (A)… (( CH2COOH )) 3-Propionate-group (P)… (( CH2CH2COOH )) 4-Vinyl-group (V)… (( CH CH2 )) Porphyrins with asymmetric arrangement of the side chains are classified as type III porphyrins while those with symmetric arrangement of the side chains are classified as type I porphyrins. Only types I & III are present in nature & type III series is more important because it includes heme. 1 Heme Biosynthesis Heme biosynthesis occurs through the following steps: 1-The starting reaction is the condensation between succinyl-CoA ((derived from citric acid cycle in the mitochondria)) & glycine, this reaction is a rate limiting reaction in the hepatic heme synthesis, it occurs in the mitochondria & is catalyzed by ALA synthase (Aminolevulinate synthase) enzyme in the presence of pyridoxal phosphate as a cofactor. The product of this reaction is α-amino-β-ketoadipate which is rapidly decarboxylated to form δ-aminolevulinate (ALA). 2-In the cytoplasm condensation reaction between two molecules of ALA is catalyzed by ALA dehydratase enzyme to form two molecules of water & one 2 molecule of porphobilinogen (PBG) which is a precursor of pyrrole.
    [Show full text]
  • 32-3824: FDX1 Recombinant Protein Description Product Info
    ABGENEX Pvt. Ltd., E-5, Infocity, KIIT Post Office, Tel : +91-674-2720712, +91-9437550560 Email : [email protected] Bhubaneswar, Odisha - 751024, INDIA 32-3824: FDX1 Recombinant Protein Alternative Name : Adrenodoxin mitochondrial,Adrenal ferredoxin,Ferredoxin-1,Hepatoredoxin,FDX1,ADX. Description Source : Escherichia Coli. FDX1 Human Recombinant fused with a 15 amino acid T7 tag at N-terminus produced in E.Coli is a single, non-glycosylated, polypeptide chain containing 139 amino acids (61-184 a.a.) and having a molecular mass of 15.0kDa.The FDX1 is purified by proprietary chromatographic techniques. Ferredoxin-1 is a small iron-sulfur protein who transfers electrons from NADPH through ferredoxin reductase to a terminal cytochrome P450. This specific oxidation/reduction system is located in steroidogenic tissues, and is involved with the synthesis of bile acid and vitamin D. FDX1 takes part in the synthesis of thyroid hormones and transfers electrons from adrenodoxin reductase to the cholesterol side chain cleavage cytochrome P450. FDX1 supports reactions catalyzed by human microsomal P450s- full length CYP17, truncated CYP17, and truncated CYP21. In addition to the FDX1 at the 11q22chromosomal locus, there are pseudogenes located on chromosomes 20 and 21. Product Info Amount : 25 µg Purification : Greater than 90.0% as determined by SDS-PAGE. Content : The FDX1 solution contains 20mM Tris-HCl buffer (pH8.0) and 10% Glycerol. Store at 4°C if entire vial will be used within 2-4 weeks. Store, frozen at -20°C for longer periods of Storage condition : time. For long term storage it is recommended to add a carrier protein (0.1% HSA or BSA).Avoid multiple freeze-thaw cycles.
    [Show full text]
  • Anti-FDX1 / Ferredoxin Antibody (ARG58670)
    Product datasheet [email protected] ARG58670 Package: 100 μl anti-FDX1 / Ferredoxin antibody Store at: -20°C Summary Product Description Rabbit Polyclonal antibody recognizes FDX1 / Ferredoxin Tested Reactivity Hu, Ms, Rat Tested Application IHC-P, WB Host Rabbit Clonality Polyclonal Isotype IgG Target Name FDX1 / Ferredoxin Antigen Species Human Immunogen Recombinant fusion protein corresponding to aa. 1-184 of Human FDX1 (NP_004100.1). Conjugation Un-conjugated Alternate Names LOH11CR1D; Hepatoredoxin; ADX; Adrenal ferredoxin; FDX; Ferredoxin-1; Adrenodoxin, mitochondrial Application Instructions Application table Application Dilution IHC-P 1:50 - 1:200 WB 1:200 - 1:500 Application Note * The dilutions indicate recommended starting dilutions and the optimal dilutions or concentrations should be determined by the scientist. Positive Control K562 Calculated Mw 19 kDa Observed Size 14 kDa Properties Form Liquid Purification Affinity purified. Buffer PBS (pH 7.3), 0.02% Sodium azide and 50% Glycerol. Preservative 0.02% Sodium azide Stabilizer 50% Glycerol Storage instruction For continuous use, store undiluted antibody at 2-8°C for up to a week. For long-term storage, aliquot and store at -20°C. Storage in frost free freezers is not recommended. Avoid repeated freeze/thaw cycles. Suggest spin the vial prior to opening. The antibody solution should be gently mixed before use. www.arigobio.com 1/2 Note For laboratory research only, not for drug, diagnostic or other use. Bioinformation Gene Symbol FDX1 Gene Full Name ferredoxin 1 Background This gene encodes a small iron-sulfur protein that transfers electrons from NADPH through ferredoxin reductase to mitochondrial cytochrome P450, involved in steroid, vitamin D, and bile acid metabolism.
    [Show full text]
  • Porphyrins & Bile Pigments
    Bio. 2. ASPU. Lectu.6. Prof. Dr. F. ALQuobaili Porphyrins & Bile Pigments • Biomedical Importance These topics are closely related, because heme is synthesized from porphyrins and iron, and the products of degradation of heme are the bile pigments and iron. Knowledge of the biochemistry of the porphyrins and of heme is basic to understanding the varied functions of hemoproteins in the body. The porphyrias are a group of diseases caused by abnormalities in the pathway of biosynthesis of the various porphyrins. A much more prevalent clinical condition is jaundice, due to elevation of bilirubin in the plasma, due to overproduction of bilirubin or to failure of its excretion and is seen in numerous diseases ranging from hemolytic anemias to viral hepatitis and to cancer of the pancreas. • Metalloporphyrins & Hemoproteins Are Important in Nature Porphyrins are cyclic compounds formed by the linkage of four pyrrole rings through methyne (==HC—) bridges. A characteristic property of the porphyrins is the formation of complexes with metal ions bound to the nitrogen atom of the pyrrole rings. Examples are the iron porphyrins such as heme of hemoglobin and the magnesium‐containing porphyrin chlorophyll, the photosynthetic pigment of plants. • Natural Porphyrins Have Substituent Side Chains on the Porphin Nucleus The porphyrins found in nature are compounds in which various side chains are substituted for the eight hydrogen atoms numbered in the porphyrin nucleus. As a simple means of showing these substitutions, Fischer proposed a shorthand formula in which the methyne bridges are omitted and a porphyrin with this type of asymmetric substitution is classified as a type III porphyrin.
    [Show full text]
  • UROPORPHYRINOGEN HII COSYNTHETASE in HUMAN Hemolysates from Five Patientswith Congenital Erythropoietic Porphyriawas Much Lower
    UROPORPHYRINOGEN HII COSYNTHETASE IN HUMAN CONGENITAL ERYTHROPOIETIC PORPHYRIA * BY GIOVANNI ROMEO AND EPHRAIM Y. LEVIN DEPARTMENT OF PEDIATRICS, THE JOHNS HOPKINS UNIVERSITY SCHOOL OF MEDICINE Communicated by William L. Straus, Jr., April 24, 1969 Abstract.-Activity of the enzyme uroporphyrinogen III cosynthetase in hemolysates from five patients with congenital erythropoietic porphyria was much lower than the activity in control samples. The low cosynthetase activity in patients was not due to the presence of a free inhibitor or some competing en- zymatic activity, because hemolysates from porphyric subjects did not interfere either with the cosynthetase activity of hemolysates from normal subjects or with cosynthetase prepared from hematopoietic mouse spleen. This partial deficiency of cosynthetase in congenital erythropoietic porphyria corresponds to that shown previously in the clinically similar erythropoietic porphyria of cattle and explains the overproduction of uroporphyrin I in the human disease. Erythropoietic porphyria is a rare congenital disorder of man and cattle, characterized by photosensitivity, erythrodontia, hemolytic anemia, and por- phyrinuria.1 Many of the clinical manifestations of the disease can be explained by the production in marrow, deposition in tissues, and excretion in the urine and feces, of large amounts of uroporphyrin I and coproporphyrin I, which are products of the spontaneous oxidation of uroporphyrinogen I and its decarboxyl- ated derivative, coproporphyrinogen I. In cattle, the condition is inherited
    [Show full text]
  • Biochemistry I Enzymes
    BIOCHEMISTRY I 3rd. Stage Lec. ENZYMES Biomedical Importance: Enzymes, which catalyze the biochemical reactions, are essential for life. They participate in the breakdown of nutrients to supply energy and chemical building blocks; the assembly of those building blocks into proteins, DNA, membranes, cells, and tissues; and the harnessing of energy to power cell motility, neural function, and muscle contraction. The vast majority of enzymes are proteins. Notable exceptions include ribosomal RNAs and a handful of RNA molecules imbued with endonuclease or nucleotide ligase activity known collectively as ribozymes. The ability to detect and to quantify the activity of specific enzymes in blood, other tissue fluids, or cell extracts provides information that complements the physician’s ability to diagnose and predict the prognosis of many diseases. Further medical applications include changes in the quantity or in the catalytic activity of key enzymes that can result from genetic defects, nutritional deficits, tissue damage, toxins, or infection by viral or bacterial pathogens (eg, Vibrio cholerae). Medical scientists address imbalances in enzyme activity by using pharmacologic agents to inhibit specific enzymes and are investigating gene therapy as a means to remedy deficits in enzyme level or function. In addition to serving as the catalysts for all metabolic processes, their impressive catalytic activity, substrate specificity, and stereospecificity enable enzymes to fulfill key roles in additional processes related to human health and well-being. Proteases and amylases augment the capacity of detergents to remove dirt and stains, and enzymes play important roles in producing or enhancing the nutrient value of food products for both humans and animals.
    [Show full text]
  • Bestimmung Des Interaktionsbereiches Sowie Der Struktur Des
    Bestimmung des Interaktionsbereiches sowie der Struktur des Adrenodoxins im Komplex mit der Adrenodoxin-Reduktase mit Hilfe der paramagnetischen NMR-Spektroskopie Dissertation zur Erlangung des Grades des Doktors der Naturwissenschaften der Naturwissenschaftlich-Technischen Fakultät III Chemie, Pharmazie, Bio- und Werkstoffwissenschaften der Universität des Saarlandes von Frau Dipl. Chem. Berna Mersinli Saarbrücken 2010 Tag des Kolloquiums: 12. Oktober 2010 Dekan: Prof. Dr. Stefan Diebels Berichterstatter: Prof. Dr. Rita Bernhardt Prof. Dr. Marcellus Ubbink Vorsitz: Prof. Dr. Uli Müller Akademischer Mitarbeiter: Dr. Gert-Wieland Kohring Inhaltsverzeichnis Abkürzungsverzeichnis 4 Zusammenfassung 7 Summary 8 1 Einleitung 10 1.1 Cytochrome P450 . 10 1.2 Ferredoxin-NADPH Reduktasen . 16 1.3 Ferredoxine . 19 1.4 Interaktion des Adx mit AdR und CYP11A1 . 24 1.5 NMR-Spektroskopie . 26 1.6 Ziel der Arbeit . 34 2 Material und Methoden 36 2.1 Materialien . 36 2.2 Molekularbiologische Methoden . 39 2.3 Heterologe Proteinexpression und Reinigung . 42 2.4 Biochemische und biophysikalische Methoden . 46 2.5 NMR-Untersuchungen . 52 3 Ergebnisse 60 3.1 Herstellung der AdR-Mutanten . 61 3.2 Charakterisierung der AdR-Mutanten . 72 3.3 Paramagnetische NMR-Experimente . 84 4 Diskussion und Ausblick 110 4.1 Heterologe Expression und Reinigung der AdR-Formen . 111 4.2 Charakterisierung der AdR-Mutanten . 118 4.3 Paramagnetische NMR-Messungen . 123 3 Inhaltsverzeichnis 5 Veröffentlichungen 143 Literaturverzeichnis 143 Anhang 164 4 Abkürzungsverzeichnis Abkürzungen
    [Show full text]
  • Michael Koch Strukturanalyse Der Mitochondrialen
    Michael Koch Strukturanalyse der mitochondrialen Protoporphyrinogen IX Oxidase aus Nicotiana tabacum und von zwei weiteren Proteinen: Blaues Cupredoxin Umecyanin aus Meerrettich (Armoracia rusticana) Lumazinsynthase-W27Y-Mutante aus Spalthefe (Schizosaccharomyces pombe) Technische Universität München Max-Planck-Institut für Biochemie Abteilung Strukturforschung Strukturanalyse der mitochondrialen Protoporphyrinogen IX Oxidase aus Nicotiana tabacum und von zwei weiteren Proteinen: Umecyanin und Lumazinsynthase-W27Y-Mutante Michael Koch Vollständiger Abdruck der von der Fakultät für Chemie der Technischen Universität München zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften (Dr. rer. nat.) genehmigten Dissertation. Vorsitzender: Univ.-Prof. Dr. W. Hiller Prüfer der Dissertation 1. apl. Prof. Dr. Dr. h. c. R. Huber 2. Univ.-Prof. Dr. Dr. A. Bacher Die Dissertation wurde am 24.02.2004 bei der Technischen Universität München eingereicht und durch die Fakultät für Chemie am 23.03.2004 angenommen. Dissertation Michael Koch Seite 3 Teile der Arbeit sind zur Veröffentlichung eingereicht bzw. wurden bereits veröffentlicht in: Koch, M., Breithaupt, C., Kiefersauer, R., Freigang, J., Huber, R., Messerschmidt, A. Crystal Structure of Protoporphyrinogen IX Oxidase: A key enzyme in heme and chlorophyll biosynthesis (EMBO J., online veröffentlicht 1. April 2004) Koch, M., Breithaupt, C., Kiefersauer, R., Freigang, J., Huber, R. and Messerschmidt, A. (2004). Crystal Structure of Protoporphyrinogen IX Oxidase. Jahrestagung der Deutschen Gesellschaft für Kristallographie 2004, Jena (Vortrag) Koch, M., Kiefersauer, R., Huber, R. (2002) Improvement of freezing protein crystals by accurately controlled humidity changes. Poster presentation at the XIX Congress and general assembly of the International Union of Crystallography, Geneva, Switzerland (Posterpräsentation) Koch, M., Velarde, M., Echt, S., Harrison, M., Dennison, C., Messerschmidt, A.
    [Show full text]
  • The Biosynthesis of Adrenal C11-Oxy C21 Steroids, Implicated in 21-Hydroxylase Deficiency – 21-Desoxycortisol and 21-Desoxycortisone and Their Downstream Metabolism
    THE BIOSYNTHESIS OF ADRENAL C11-OXY C21 STEROIDS, IMPLICATED IN 21-HYDROXYLASE DEFICIENCY – 21-DESOXYCORTISOL AND 21-DESOXYCORTISONE AND THEIR DOWNSTREAM METABOLISM by Lise Barnard Thesis presented in fulfilment of the requirements for the degree of Master of Science in the Faculty of Science at Stellenbosch University Supervisor: Prof A.C. Swart March 2017 The financial assistance of the National Research Foundation (NRF) towards this research is hereby acknowledged. Opinions expressed and conclusions arrived at, are those of the author and are not necessarily to be attributed to the NRF. Stellenbosch University https://scholar.sun.ac.za DECLARATION By submitting this thesis electronically, I declare that the entirety of the work contained therein is my own, original work, that I am the sole author thereof (save to the extent explicitly otherwise stated), that reproduction and publication thereof by Stellenbosch University will not infringe any third party rights and that I have not previously in its entirety or in part submitted it for obtaining any qualification. Lise Barnard March 2017 Copyright © 2017 Stellenbosch University All rights reserved ii Stellenbosch University https://scholar.sun.ac.za ABSTRACT Adrenal C19 steroids are often implicated in numerous androgen dependent disease conditions. Androgen excess is the hallmark of 21-hydroxylase deficiency (21OHD) fuelled by an increase in the production of adrenal androgens and androgen precursors. In addition, increased levels of progesterone (P4) and 17α-hydroxyprogesterone (17OHP4), the substrates of the defective cytochrome P450 steroid 21-hydroxylase, have also been reported. Adrenal steroids are secreted into circulation, for further downstream metabolism. Conversion of adrenal steroids to active androgens in peripheral target tissue is dependent on the tissue specific expression of key enzymes, which significantly influence steroid profiles at cellular level, ultimately influencing homeostasis in androgen responsive tissue.
    [Show full text]
  • The Nematode Transcriptome Resource
    International Journal for Parasitology 41 (2011) 881–894 Contents lists available at ScienceDirect International Journal for Parasitology journal homepage: www.elsevier.com/locate/ijpara NEMBASE4: The nematode transcriptome resource ⇑ Benjamin Elsworth a, James Wasmuth b, Mark Blaxter a, a Institute of Evolutionary Biology, The University of Edinburgh, EH9 3JT, UK b Department of Comparative Biology and Experimental Medicine, Faculty of Veterinary Medicine, 3330, Hospital Drive, University of Calgary, Calgary, Alberta, Canada T2N 4N1 article info abstract Article history: Nematode parasites are of major importance in human health and agriculture, and free-living species Received 21 December 2010 deliver essential ecosystem services. The genomics revolution has resulted in the production of many Received in revised form 11 March 2011 datasets of expressed sequence tags (ESTs) from a phylogenetically wide range of nematode species, Accepted 14 March 2011 but these are not easily compared. NEMBASE4 presents a single portal into extensively functionally anno- Available online 21 April 2011 tated, EST-derived transcriptomes from over 60 species of nematodes, including plant and animal para- sites and free-living taxa. Using the PartiGene suite of tools, we have assembled the publicly available Keywords: ESTs for each species into a high-quality set of putative transcripts. These transcripts have been trans- Nematode lated to produce a protein sequence resource and each is annotated with functional information derived Transcriptome Genome from comparison with well-studied nematode species such as Caenorhabditis elegans and other non-nem- Expressed sequence tag atode resources. By cross-comparing the sequences within NEMBASE4, we have also generated a protein Database family assignment for each translation.
    [Show full text]
  • Supplementary Tables S1-S3
    Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse)
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2006/0053498A1 Bejanin Et Al
    US 20060053498A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2006/0053498A1 Bejanin et al. (43) Pub. Date: Mar. 9, 2006 (54) FULL-LENGTH HUMAN CDNAS ENCODING Publication Classification POTENTIALLY SECRETED PROTEINS (51) Int. Cl. (76) Inventors: Stephane Bejanin, Rochechouart (FR); AOIK 67/00 (2006.01) Jean-Baptiste Dumas Milne Edwards, C07K I4/47 (2006.01) CI2O I/68 (2006.01) Paris (FR); Jean-Yves Giordano, Paris C07H 21/04 (2006.01) (FR); Severin Jobert, Paris (FR); CI2P 21/06 (2006.01) Hiroaki Tanaka, Antony (FR) (52) U.S. Cl. ............ 800/8; 435/6; 435/69.1; 435/320.1; Correspondence Address: 435/325; 530/350, 536/23.5 SALIWANCHIK LLOYD & SALWANCHIK (57) ABSTRACT A PROFESSIONAL ASSOCATION PO BOX 142950 The invention concerns GENSET polynucleotides and GAINESVILLE, FL 32614-2950 (US) polypeptides. Such GENSET products may be used as reagents in forensic analyses, as chromosome markers, as (21) Appl. No.: 10/475,075 tissue/cell/organelle-Specific markers, in the production of expression vectors. In addition, they may be used in Screen (22) PCT Filed: Apr. 18, 2001 ing and diagnosis assays for abnormal GENSET expression and/or biological activity and for Screening compounds that (86) PCT No.: PCT/IB01/00914 may be used in the treatment of GENSET-related disorders. Patent Application Publication Mar. 9, 2006 Sheet 1 of 4 US 2006/0053498A1 D 125A 125B 125C E." 1OO COMPUTER SYSTEM PROCESSOR MEMORY 120 DATA RETRIEMNG DISPLAY DEVICE Figure 1 Patent Application Publication Mar. 9, 2006 Sheet 2 of 4 US 2006/0053498A1 2O2 STORE NEW SEQUENCE TO A MEMORY 204 OPEN DATABASE OF SEQUENCES 2O6 READ FIRST SECUENCE IN DATABASE 21 O PERFORM COMPARISON OF NEW SEQUENCE AND 224 STORED SEQUENCE GO TO NEXT 212 SEQUENCE IN DATABASE YES MORE SEQUENCESN DATABASE? Patent Application Publication Mar.
    [Show full text]