Modification of the Selectable Marker in the Nisin-Controlled Expression Vector, Pmsp3535

Construction of a Nisin-Controlled Expression Vector, a Derivative of pMSP3535 for Alternative Selectable Marker

Thesis

Presented in Partial Fulfillment of the Requirements for the Degree Master of Science in the Graduate School of The Ohio State University

Monchaya Rattanaprasert, B.S., M.S.

Graduate Program in Food Science and Nutrition

The Ohio State University

2009

Thesis Committee:

Hua Wang, Advisor

Ahmed Yousef

Zhongtang Yu

Monchaya Rattanaprasert

2009

Abstract

The plasmid pMPS3535 is a commonly-used nisin-inducible expression vector for homologous and heterologous genes in a variety of gram-positive bacteria. However, a number of limitations associate with this plasmid, including the use of the erythromycin resistance (Emr) marker. Emr is somewhat ubiquitous element in shuttle vectors, bacterial plasmids, and even in bacterial chromosomes, which limited its application in hosts naturally resistant to erythromycin and in combination with Emr-carrying vectors. To overcome this limitation, the Emr marker was displaced by an alternative tetracycline resistance maker encoded by tetL gene. The resulting vector, termed pMSP3535TLH, has been proved to be able to transform Enterococcus faecalis OG1RF, Lactococcus lactis

2301, and Escherichia coli DH5α to tetracycline resistance whose transformants were readily selected on selective plates supplemented with tetracycline. By taking advantage of the Emr marker removal to simultaneously excise a segment of copF gene, a negative regulator of copy number, the constructed vector has potential to become a high copy number derivative of the plasmid pMSP3535.

ii Acknowledgements

I wish to thank:

My adviser, Dr. Hua Wang, for her guidance and encouragement throughout this research

My committee members, Dr. Ahmed Yousef and Dr. Zhongtang Yu, for their time and support

Members of our lab, Yingli Li, Andrew Wassinger, Dan Kinkelaar, Hanna Cortado, Linlin Xiao, Lu Zhang, Xiaojing Li, and Xinhui Li, for their assistance and encouragement

My Royal Thai Government for granting me a scholarship for graduate studies

This research was supported by Dr. Wang’s OSU start-up fund.

iii Vita

November 1974 ……………………...... Bangkok, Thailand

1996………………………………B.S. Chemistry, Chulalongkorn University, Thailand

2000…………………………M.S. Biotechnology, Chulalongkorn University, Thailand

2001-2006 ……...... Research Assitant, National Center for Genetic

Engineering and Biotechnology, Thailand

2006-present…………………………….Graduate Student, Department of Food Science

and Technology, The Ohio State University

Publication

Rattanaprasert, M., Thumwan, N., Visessanguan, W., Smitinont, T., Tarnchompoo, B., and Valyasevi, R. 2005. Development of method for free sugars determination in Nham. Proceedings of the 9th Asean Food Conference, 8-10 August, 2005, Indonesia.

Fields of Study

Major Field: Food Science and Nutrition

iv Table of Contents

Abstract……………………………………………………………………………………ii

Acknowledgements…………………………………………………………………...... iii

Vita………………………………………………………………………………………..iv

List of Tables………………………………………………………………………..…....ix

List of Figures…………………………………………………………………………...... x

Chapter 1: Introduction……………………………………………………………………1

Bibliography………...………………...…………………………...…………..5

Chapter 2: Literature review………………………………..……………………………..7

2.1 Nisin-controlled gene expression system (NICE)……….………………………..7

2.2 The plasmid pMSP3535, a vector for nisin-controlled gene expression………...10

2.3 Applications of pMSP3535………………………………………………………12

2.4 Replication regions of pMSP3535………………………...…………………..…13

2.4.1 Enterococcus faecalis pAM1 replication region……………………….14

2.4.2 ColE1 replication origin………………...……………………………….19

2.5 Selectable marker of pMSP3534………………...…………………………..…..21

2.6 Modification of pMSP3535…………...………………………………….….…..22

2.7 The tetL gene, a tetracycline resistance determinant………………..……...... ….23

2.8 pDG1515, the vector harboring the tetL gene………………………….………..24

Bibliography………………………………………………..……………………25 v Chapter 3: Contruction of a Nisin-Controlled Expression Vector, a Derivative of pMPS3535 for alternative selectable marker………………………………………….....31

3.1 Objective…..…………………………..……………………………….………....31

3.2 Material and methods…………………………………………..………………....32

3.2.1 Detection of the tetL gene harbored by the plasmid pDG1515…………...32

3.2.2 Nucleotide sequenceing of the tetL gene and its up-and downstream

region……………….……………………………………………………33

3.2.3 PCR amplification of precursors of insert fragment……………………..34

3.2.4 Construction of the tetL-copF-PDE and tetL-PDE fragment……………….37

3.2.5 Restriction digestion of pMSP3535 and insert fragments……………….38

3.2.5.1 BglII- and NsiI-digestion………….…………………………………38

3.2.5.2 BglII- and SnaBI-digestion…………………………………………..39

3.2.6 Cloning of teL-containing inserts into the backbone vector pMPS3535...40

3.2.7 Introduction of the constructed vectors into gram-positive bacterial

hosts…………………………………………………………………..… 42

3.2.7.1 Electrotrasformation of E. faecalis OG1RF……………………...... 42

3.2.7.2 Electrotransformation of L.lactis 2301……………………………....44

3.2.7.3 Natural transformation of S. mutans…………………………………45

3.3 Reults and discussion………………………………………………………..…...46

3.3.1 Detectection of the tetL gene in plasmid pDG1515……………………..46

3.3.2 Nucleotide sequencing and sequence analysis of the tetL gene and its

flanking regions………………………………………………………….47

vi 3.3.3 DNA manipulation strategy for replacing the ermB gene with the tetL gene

and construction scheme of a pMSP3535 derivative…………………….52

3.3.4 Primer design and PCR amplification of the tetL fragment……………...54

3.3.5 Restriction digestion of the vector pMSP3535 and the tetL fragment …..56

3.3.6 Cloning of the tetL insert into pMSP3535 backbone vector…………...... 58

3.3.7 Functionality of pMSP3535TL into E. coli and gram-positive bacteria…61

3.3.8 Construction of a pMSP3535 derivative harboring the tetL gene and

carrying the promoter PDE to support the plasmid replication in gram-

positive bacteria……………………………………………………….…63

3.3.8.1 PCR amplification of the tetL fragment……………………..……….64

3.3.8.2 BglII and SnaBI restriction digestion of pMSP3535 and tetL

fragment………………………………...……………………………66

3.3.8.3 Cloning of the tetL insert into BglII- and SnaBI-digested

pMSP3535…………………………………………...………………67

3.3.9 DNA manipulation strategies to decrease the size of the constructed vector

and maintain the promoter PDE in the vector sequence…………..………71

3.3.9.1 Amplification of tetL and copF- and PDE-containing fragments….…78

3.3.9.2 Restriction digestion and ligation of the tetL and copF-and PDE-

containing fragments……………………...………………………….79

3.3.9.3 Insert fragment amplification………………………………………...83

3.3.9.4 BglII- and NsiI-digestion of insert fragments and fragment analysis .85

3.3.9.5 Cloning of the tetL-containing inserts into the backbone vector

pMSP3535………………………..………………………………….86

vii 3.3.10 Introduction of a constructed vector into gram-positive bacteria……..…91

3.3.10.1 Transformation of E. faecalis OG1RF………...…….…….……..91

3.3.10.2 Transformation of L. lactis 2301……..………………………….94

3.4 Conclusion and Future Development……………………………………………97

Bibliography……………………………………………...…………………….106

Complete Bibliography…………………………………………………………………109

viii List of Tables

Table 3.1. Primers used for nucleotide sequencing of tetL gene and flanking regions in pDG1515…………………………………………………………………...…………….34

Table 3.2. Primer sets and PCR conditions used for amplification of various DNA fragments………………………………………………………………………………....36

Table 3.3. E. coli transformants obtained from the introduction of ligation products in

CaCl2-treated competent cells……………………………………………………..……..60

ix List of Figures

Figure 2.1. Organization of nisin gene cluster………..…………………………………...8

Figure 2.2. Plasmid construction scheme of pMSP3535…..…………………………….12

Figure 2.3. (A) The replication and copy control region of pAMβ1 (B) The operator region of the repressor protein CopF………………………………...…………………..15

Figure 2.4. Model for the initiation of pAMβ1 replication……………………………....17

Figure 2.5. Model for the initiation of ColE1 replication…………………..……………21

Figure 3.1. (A) PCR amplicon of the tet L gene amplified from cell extract of E. coli

ECE98 (B) Agarose gel electrophoresis of plasmid extracts.………….…………...……47

Figure 3.2. A partial nucleotide sequence of vector pDG1515 including tetL gene and its up-and downstream region ……………………………………….……………………...49

Figure 3.3. A map of restriction sites of singly-cut endonucleases in the vector pMSP3535…………………………………………………………………..…..….…....53

Figure 3.4. Construction scheme of the vector pMSP3535TL……………….……...…..54

Figure 3.5. Oligonucleotide sequences of a pair of primers designed for PCR amplification of the tetL fragment………………………………….……………………55

Figure 3.6. PCR amplicon of the tetL fragment amplified from pDG1515 plasmid extract……………………………………………...……………………………………..56

Figure 3.7. Gel electrophoresis of digestion products treated with BglII and NsiI…...….57

Figure 3.8 Agarose gel electrophoresis of (A) plasmid extracts prepared from overnight cultures of Tetr E. coli transformants and (B) the tetL amplicon PCR- amplified from plasmid extracts……………………...……………….………………………………….59

Figure 3.9. Construction scheme II illustrates the second strategy employed to construct a pMSP3535 derivative…………………………………………………………………….64

Figure 3.10. Oligonucleotide sequence of a reverse primer, SnaTetL-R designed for PCR amplification of the tetL fragment…………………………….…………………………65

Figure 3.11. PCR amplicon of the tetL fragment amplified with BglTetL-F/SnaTetL-R primers………………………………………………………………………………..….65

Figure 3.12. Gel electrophoresis of digestion products treated with BglII and

SnaBI……………………………………………………………………………………..67

Figure 3.13. Agarose gel electrophoresis of (A) plasmid extracts. (B) tetL amplicon amplified from plasmid extracts….…….………………………………………..………69

Figure 3.14. Agarose gel electrophoresis of ligation products…………………...…..….70

Figure 3.15. A plasmid map of a pMSP3535 derivative expected as a result of 2nd construction strategy……………………………………...……………………………...71

Figure 3.16. Nucleotide sequence of a portion of the vector pMSP3535………………..73

Figure 3.17. Construction scheme of the vector pMSP3535TLH and another expected pMSP3535……………………………………………………………………………….77

Figure 3.18. Oligonucleotide sequences of two primer sets designed for PCR amplification of (A) the tetL fragment and (B) the copF-and PDE-containing fragment……………………………………………………………………………...…..80

Figure 3.19. Agarose gel electrophoresis of PCR products……………………………...81

Figure 3.20. Agarose gel electrophoresis of ligation products resulting from ligation reaction of the EagI-digested tetL and EagI-digested, copF-and PDE-containing fragment………………………………………………………………………………….81

Figure 3.21. Agarose gel electrophoresis of PCR products after purified by QIAquick

PCR purification kit……………………….…………………………………………….83

Figure 3.22. Agarose gel electrophoresis of PCR products amplified from the tetL-copF-

PDE fragment and the tetL-PDE fragment…………………………...…………………….84

Figure 3.23. Agarose gel electrophoresis of digestion products obtained from different digestion reactions…………………...…………………………………………………..86

Figure 3.24. Agarose gel electrophoresis of plasmid extracts prepared from overnight cultures of different Tetr transformants……………………….……………………….…87

Figure 3.25. Agarose gel electrophoresis of tetL-containing amplicon amplified from different plasmid extracts and DNA fragment ………….………………………….……88 xii

Figure 3.26. Agarose gel electrophoresis of digestion products obtained from the digestion of different recombinant DNAs with HindIII……………………..…………..90

Figure 3.27. Agarose gel electrophoresis of plasmid extracts obtained from different E. faecalis transformants and their digestion products cleaved by HindIII……………..….92

Figure 3.28. Agarose gel electrophoresis of tetL amplicon amplified from plasmid extracts of different E. faecalis transformants…………...………………………………93

Figure 3.29. Agarose gel electrophoresis of plasmid extracts obtained from different

L. lactis transformants…………………………………………………………...……….95

Figure 3.30. Agarose gel electrophoresis of tetL amplicon amplified from plasmid extracts of different L. lactis transformants……………………………..……………….95

Figure 3.31. Schematic diagram of the pAMβ1 replication region………………….....100

xiii

Chapter 1: Introduction

Inducible gene expression systems are invaluable tools for genetic and biochemical analysis of induced gene products (4). They also are effective tools for optimization of high-level protein production in cellular factory (5, 6). Overproduction can contribute to protein accumulation or degradation, in consequent, can be deleterious to cells (15). A variety of inducible gene expression systems have been developed for gram-negative and gram-positive bacteria. The most commonly used systems in gram-negative bacteria include the lac, trp, and T7 promoters derived from E. coli (4). Among a series of systems, such as a subtilin-regulated expression system, a Rro 12-dependent temperature inducible system, and a Pgad-initiating pH-inducible system (2, 5) developed for lactic acid bacteria and other gram-positive bacteria, the nisin-controlled expression (NICE) system is the most commonly used system (15). A number of plasmid vectors associated with NICE system have been constructed by making good use of the autoregulatory elements of the lactococcal nisin gene cluster including nisA (PnisA) or nisF (PnisF) promoter and two-component regulatory system (nisPR), all together able to efficiently modulate gene expression under the control of an extracellular inducer, nisin.

The plasmid pMSP3535 is a popular vector for nisin-inducible expression with capability to replicate in a wide-host-range including Escherichia coli and gram-positive bacteria

(4). The vector contains NICE system composed of PnisA promoter, nisK encoding a sensor kinase (NisK), and nisR encoding a response regulator (NisR). NICE system enables expression of a certain gene(s) fused to PnisA promoter under the control of a two-component regulatory system (NisK and NisR) and extracellular nisin. When added into a medium, nisin as extracellular peptide pheromone activates autophosphorylation of the sensor kinase (NisK) (12). The phosphorylated NisK then transfers a phosphate group to a response regulator (NisR), leading to active state of NisR. The phosphorylated NisR initiates trascription of the gene(s) preceeded by PnisA as its promoter. A heterologous gene(s) can be under control of NICE system by inserting the structural gene(s) at a multiple cloning site (MCS) located downstream of PnisA. It is a commonly-used nisin- inducible expression vector having been used for homologous and heterologous gene expression in a variety of gram-positive bacteria, including Lactococcus. lactis,

Lactobacillus paracasei, Streptococcus mutans, Enterococcus faecalis, Streptococcus gordonii, Streptococcus pneumonia, and Streptococcus pyogenes (6, 8, 15).

In addition to NICE system and MCS, pMSP3535 contains two replication regions, i.e. pAMβ1 and ColE1 replication regions. Derived from an Enterococcus faecalis broad- host-range plasmid, pAMβ1, the pAMβ1 replication regions with a theta-replicating origin (13, 3) enables the maintenance of pMSP3535 in a variety of LAB species (6).

However, this replicating element does not allow pMSP3535 to propagate in E. coli (9).

To endow it with the capability to replicate in E. coli, the second replication region derived from Colicin E1 plasmid (ColE1), an E. coli narrow-host-range plasmid with unidirectional theta replication mechanism (1, 7) was incorporated into pMSP3535 (4).

The other indispensible element for the selection of pMSP3535-tranformed cells is a selectable marker. The plasmid pMSP3535 was equipped with an erythromycin resistance gene, ermB, coding for N-methyltransferase (Methylase) (4). This protein confers resistance to macrolides, lincosamides, and streptogramin B antibiotics (MLS) which inhibit protein synthesis of bacterial cell by binding to the 50S ribosomal subunit

(10, 11). The methylase protein posttranscriptionally methylates adenine residues of 23S rRNA in the 50S subunit, leading to alteration of this drug target (14). Th ermB gene provides high level of erythromycin resistance, thereby making pMSP3535 easily selectable.

However, there were a few limitations associated with the applications of this plasmid.

First, it contains Emr as the selective marker. This marker is quite common in various shuttle vectors, therefore limits its application in genetic constructs where the functionalities of more than one factors need to be elucidated. Therefore, Dunny’s group

(4) in fact developed a derivative of pMG3535, which replaced the Emr marker with the kanamycin resistance encoding gene (kan). Limited protein expression is another disadvantage of the plasmid when high-level protein production is in need. Kim and Mills

(2007) (6) have dealt with this issue by several means including promoter, terminator and

3 plasmid copy number alteration. Modification of the promoter PnisA was carried out to shorten nonessential coding sequence, located downstream of the promoter, which may lower overall expression of a gene of interest. This approach as well as the insertion of a transcriptional terminator downstream of PnisA to inhibit possible disruption of nisin signal transduction resulting from run-on transcription from the promoter through the nisRP in opposite direction can improve protein expression to some extent. However, the most significant improvement was obtained from increasing the copy number of pMSP3535 by the interruption of copF gene encoding a negative regulator of copy number. In consequent, a 4.1-fold increase in tested GFP expression was observed.

Bibliography

1. Actis, L.A., M. E. Tolmasky, and J.H. Crosa. 1999. Bacterial plasmids: replication of extrachromosomal genetic elements encoding resistance to antimicrobial compounds. Frontiers in bioscience. 4: d43-62.

2. Bongers, R.S., J.W. Veening, M. Van Wieringen, O.P. Krupers, and M. Kleerebezem. 2005. Development and characterization of a subtilin-regulated expression system in Bacillus subtilis: Strict control of gene expression by addition of subtilin. Applied and environmental microbiology. 71: 8818-8824.

3. Bruand, C., S.D. Ehrlich, and L. Jannière. 1991. Unidirectional theta replication of the structurally stable Enterococcus faecalis plasmid pAMβ1. The EMBO journal. 10: 2171-2177.

4. Bryan, E.M., T. Bae, M. Kleerebezem, and G.M. Dunny. 2000. Improved vector for nisin-controlled expression in gram-positive bacteria. Plasmid. 44: 183- 190.

5. de Vos, W.M. 1999. Gene expression systems for lactic acid bacteria. Current opinion in microbiology. 2: 289-295.

6. Kim, J-H., and D.A. Mills. 2007. Improvement of a nisin-inducible expression vector for use in lactic acid bacteria. Plasmid. 58: 275-283.

7. Kües, U., and U. Stahl. 1989. Replication of plasmid in gram-negative bacteria. Microbiological reviews. 53: 491-516.

8. Oddone, G.M., D.A. Mills, and D. E. Block. 2009. Incorporation of nisI- mediated nisin immunity improves vector-based nisin-controlled gene expression in lactic acid bacteria. Plasmid. 61: 151-158.

9. Pérez-Arellano, I., M. Zúňiga, and G. Pérez-Martínez. 2001. Contruction of compatible wide-host-range shuttle vectors for lactic acid bacteria and Escherichia coli. Plasmid. 46: 106-116.

10. Roberts, M.C. 2004. Resistance to macrolide, lincosamide, streptogramin, ketolide, and oxazolidinone antibiotics. Molecular biotechnology. 28: 47-62.

11. Simon, D., and A. Chopin. 1988. Construction of a vector plasmid family and its use for molecular cloning in Streptococcus lactis. Biochimie. 70: 559-566.

12. Smith, J.L., P.M. Fratamico, and J.S. Novak. 2004. Quorum sensing: A primer for food microbiologists. Journal of food protection. 67: 1053-1070.

13. Swinfield, T.J., J.D. Oultram, D.E. Thompson, J.K. Brehm, and N.P. Minton. 1990. Physical characterization of the replication region of the Streptococcus faecalis plasmid pAMβ1. Gene. 87: 79-90.

14. Weisblum, B. 1995. Erythromycin resistance by ribosome modification. Antimicrobial agents and chemotherapy. 39: 577–585.

15. Zhou, X.X., W.F. Li, G.X. Ma, and Y.J. Pan. 2006. The nisin-controlled gene expression system: construction, application and improvements. Biotechnology advances. 24: 285-295.

Chapter 2: Literature Review

2.1 Nisin-controlled gene expression system (NICE)

Nisin-controlled expression system is an efficient, controllable expression system most commonly-used for homologous and heterologous gene expression in lactic acid bacteria (LAB) (53). NICE system was developed by exploiting a signal transduction for nisin biosynthesis in Lactococcus lactis. The nisin biosynthesis involves the transcription of the nisin gene cluster, nisABTCIPRKFEG, whose organization is shown in Figure 2.1 (27). The nisA is a structural gene encoding pre-nisinA, an unmodified precursor peptide (27). The pre-nisin A is then subjected to posttranslational modification processed by enzymes encoded by nisB and nisC gene, thereby becoming fully modified precursor nisinA (18, 27). The precursor nisinA is subsequently exported across cell membrane by an ABS transporter encoded by nisT

(14, 27). In the next step, the leader peptide is removed from the precursor nisinA by an extracellular protease encoded by nisP, leading to the release of active nisin with bacteriocidal activity (27; 48, 50). The nisin producers themselves are protected from the nisin action by immunity genes, i.e. nisI encoding a lipoprotein and nisFEG encoding a putative ATP-binding cassette exporter (14, 46).

The above nisin biosynthesis is autoregulated by nisin through signal transduction, which involves a classical two-component regulatory system comprising a sensor histidine kinase (NisK) and a response regulator (NisR) (27). The active nisin functions as the inducer reacting to NisK, resulting in autophosphorylation of NisK

(48). The phosphorylated NisK then transfers a phosphate group to a response regulator (NisR), leading to active state of NisR. The phosphorylated NisR then functions as a transcription activator initiating transcription of two inducible expression promoters, i.e. nisA promoter (PnisA) and nisF promoter (PnisF). The transcription of PnisA and PnisF then enables the expression of nisABTCIP genes and that of PnisF allows the expression of the nisFEG genes (26, 48).

Figure 2.1. Organization of nisin gene cluster (27)

The NICE system makes use of this signal transduction to control expression of a targeted gene. This system is fundamentally composted of the PnisA promoter and a two-component regulatory system including nisK and nisR (23, 53). The NICE system was firstly constructed by de Ruyter et al. (1996) (14). In this system, the PnisA

8 promoter was cloned into a plasmid and the nisRK genes together with the nisR promoter, which constitutively drives the expression of the nisRK, were integrated into chromosome of a host strain. After a gene was cloned downstream of the PnisA promoter of the plasmid and the plasmid was then introduced into the host strain, the cloned gene could be controllably expressed by the addition of nisin (14; 53). Thus far a series of the NICE systems has been constructed and the NICE system has been proved to function in various genera of lactic acid bacteria including Lactobacillus,

Streptococcus, Enterococcus, and Leuconostoc as well as Bacillus (11, 17, 24, 38).

This controllable expression system has a number of advantages: (a) nisin is considered a food-grade inducer, already widely used in food industry; (b) the gene expression is tightly controlled with undetectable protein level under uninduced state, making production of lethal proteins possible; (c) the degree of gene expression with a dynamic range of more than 1,000-fold is in direct relationship with the nisin concentration; and (d) very high protein level up to 60% of the total intercellular protein can be obtained (24, 28).

The NICE system has demonstrated applications in pharmaceutical, medical, and food technology fields (33, 53). Various applications are listed as the followings (35,

53).

 Expression of homologous and heterologous genes. The NICE system has

been used to express a wide variety of gram-positive, gram-negative, and

eukaryote genes to study gene and enzyme function and to produce enzymes

for food, medical, and technical application (35).

 Expression of prokaryotic and eukaryotic membrane proteins.

 Heterologous expression of bacteriocins

 Heterologous protein secretion and delivery in L. lactis

 Cloning and expression of toxic genes

2.2 The plasmid pMSP3535, a vector for nisin-controlled gene expression

Plasmid pMSP3535 was constructed by Bryan and coworkers (2000) (11) to function as a shuttle vector able to replicate in Escherichia coli and in Gram-positive bacteria.

It is one of the popular plasmids for nisin-controlled expression of heterologous gene in LAB (23). This plasmid was derived from a dual-plasmid NICE system which was developed by Kleerebezem and coworkers (1997) (24) to facilitate the inducible expression in LAB strains without the nisRK genes in their chromosome. The dual- plasmid system consists of one plasmid (pNZ9531/pNZ9530) harboring the nisRK genes along with a broad-host-range pAMβ1 replicon of Enterococcus faecalis. The other plasmid (pNZ8008) carrying the PnisA promoter is an L. lactis pSH71-derived shuttle vector able to replicate in wide-range of gram-positive bacteria and E. coli

(11, 40). When these two plasmids are transformed into a host cell, they can facilitate the nisin-controlled expression of a gene of interest placed at a polylinker downstream of PnisA.

The plasmid pMSP3535 is a single vector NICE system combining the principle elements of the NICE system found in the dual-plasmid system on a single vector. It was designed to simplify the implementation of the NICE system (11, 23). In the new system, only a single transformation is required to introduce all crucial NICE elements into a host strain. Moreover, the number of required antibiotic resistance selective markers and gram-positive replication origins were reduced, thereby making the new system compatible with the wider host range. The pMSP3535 vector also contains a general-purpose E. coli replication origin from pSP73 (Promega) instead of the pSH71 origin, improving transformation efficiency in recA E. coli strains (11). To construct pMSP3535, the PnisA promoter together with a polylinker containing 12 cloning sites was PCR amplified from pNZ8020, a pSH71-derived shuttle vector (15).

The amplified region was then cloned into the E. coli vector, pSP73 (Promega), to generate pMSP3502 [Figure 2.2 (11)]. The other crucial NICE-system components, nisRK genes, along with E. faecalis pAMβ1 replication origin and a selectable marker encoding erythromycin resistance (Emr) were PCR amplified from pNZ9531 (24) and subsequently cloned onto pMSP3502, creating a single vector NICE system, pMSP3535 [Figure 2.2 (11)]. The constructed vector contains the PnisA promoter and a polylinker from pNZ8020; nisRK genes, the pAMβ1 replication origin, and the Emr marker from pNZ9531; and the ColE1, the E. coli replication origin of pSP73.

Figure 2.2. Plasmid construction scheme for pMSP3535 (11).

2.3 Applications of pMSP3535

Plasmid pMSP3535 has recently been used for controlled gene expression in a wide variety of LAB species, including Lactococcus lactis, Lactobacillus paracasei,

Streptococcus mutans, Enterococcus faecalis, Streptococcus gordonii, Streptococcus pneumonia, and Streptococcus pyogenes (23, 37). Some of its applications are summarized as the followings. In Enterococcus faecalis, pMSP3535 was employed to control expression of sigV gene encoding a member of RNA polymerase sigma 12 factors to study its involvement in heat shock, ethanol, and acid stress response (2). In

Lactobacillus paracasei, it was employed for overexpression of a cheperone protein

(16). In Streptococcus gordonii, it was used for functional analysis of anchored glycoprotein GspB for adherence of S. gordonnii to glycoproteins (3) and of SecA for glycoprotein transport (4). Luo and colleagues from our laboratory (34) has successfully used pMSP3535 determined the CluA as a biofilm attribute in L. lactis.

2.4 Replication regions of pMSP3535

The pMSP3535 vector was constructed to carry two different replication elements so that it can serve as a broad-host-range expression vector able to replicate in many genera of gram-positive bacteria and in E. coli. The first element is the broad-host- range pAMβ1 replication region which is stable maintained in various LAB species

(23). However, it is not functional in E. coli (39). To enable the replication in E. coli, the second element which is an E. coli replication origin, ColE1, was included into pMSP3535. Both replication elements have theta-replicating mechanism (12) which generally provides a plasmid bearing this mode of replication with structural and segregational stability when a large DNA fragment is inserted (29).

2.4.1 Enterococcus faecalis pAMβ1 replication region.

Plasmid pAMβ1 has been considered one of the broad-host-range plasmids due to its ability to replicate in many different genera of gram-positive bacteria, such as

Bacillus, Clostridium, Lactococcus, Streptococcus, Enterococcus,

Staphylococcus, Lactobacillus, Leuconostoc, and Pediococcus (29). This plasmid has low copy number, with approximately 7-9 copies per cell, using a unidirectional theta mode for its replication with θ-shaped replication intermediates in which replication initiates at a fixed origin and progresses in only one direction (7, 8).

The pAMβ1 replication region contains two open reading frames (ORFs) named

D and E, preceded by a structure resembling a characteristic replication origin designated oriA and a 44 bp unstructured origin (ori) (Figure 2.3). Of two ORFs, only the ORF E harboring repE gene coding for a replication protein of 496 amino acids, termed RepE, is essential for plasmid replication (8, 49). The RepE was proposed to be involved in primer formation and maturation (22, 32). The oriA-like structure, which contains five iterons, a DnaA box, and an AT rich region, is also not an essential element for pAMβ1 replication (8). In contrast to the oriA-like structure, the short unstructured origin located 27 bp downstream of the stop codon of the repE gene is an indispensable element at which initiation of

14 leading-strand synthesis occurs (7). From this origin, DNA replication progresses unidirectionally in the same direction as transcriptional direction of repE (7).

copy control region replication region ori PF TF PDE TDE F D Rep E

TCT PCT

Figure 2.3. (A) The replication and copy control region of pAMβ1 (B) The operator region of the repressor protein CopF [modified from Le Chatelier el al., 1994 (30)]

In addition to the RepE protein and the 44 bp origin, initiation of pAMβ1 replication also requires a transcription step progressing through the origin in codirectional with the replication fork and host DNA polymerase I (Pol I) (5, 10,

32). The following model was proposed for pAMβ1 replication (Figure 2.4) (8, 9,

10, 32). The initiator protein RepE collaborating with RNA Polymerase (RNA

Pol) promotes the transcription through the origin, resulting in the RNA primer formation at the origin (Figure 2.4, 1-3). The primer is utilized by Pol I to synthesize a leading strand whose subsequent elongation generates a D-loop structure in which a primosome-assembly site, ssiA, is single stranded (Figure 2.4,

4-6). This site allows the entry of a primosome on a lagging strand and subsequent stimulates the assembly of a replisome, including DNA polymerase III holoenzyme (Pol III HE) which drives DNA synthesis of both strands (Figure 2.4,

6-7) (5, 22).

Replication of pAMβ1 was proposed to be regulated at the level of the repE transcription, based on the fact that the transcription through the origin which is rate-limiting factor for pAMβ1 replication is initiated at the repE promoter, PDE

(10). Two independent regulatory systems which regulate the origin-passing- through transcription and therefore regulate pAMβ1 replication are negative regulation by a repressor protein and countertranscript-driven transcriptional attenuation system (10, 30, 31).

Figure 2.4. Model for the initiation of pAMβ1 replication (9).

The first regulatory system is directed by the activity of a transcriptional repressor protein, named CopF, encoded by copF gene located upstream of the repE promoter (Figure 2.3A). CopF negatively regulates pAMβ1 replication by binding to an operator which is located immediately downstream of the copF gene and covers a part of the -35 box of PDE (Figure 2.3B), thereby hampering the origin- passing-through transcription as well as the expression of the RepE protein, both

17 of which are initiated at PDE (30). This negative regulation leads to approximately

10-fold reduction of transcription, which accounts for about 10-time increase in plasmid copy number when the copF gene is inactivated (30, 31).

The other negative regulation system for pAMβ1 replication is termed countertranscript-driven transcriptional attenuation system. This system requires a contertranscript (CT), a rho-independent transcription terminator (TDE), and a small inverted repeat to attenuate mRNA synthesis initiated at the repE promoter

(PDE) (31). CT is a small piece of mRNA whose synthesis involves a promoter

(PCT) and a terminator (TCT), both of which are located upstream of the repE promoter (Figure 2.3A). Mediated by stem-loop structure formed by the inverted repeat, CT interacts with the nascent PDE-initiated mRNA, leading to formation of a terminator at TDE (31, 36). The developed terminator causes attenuation of PDE- initiated mRNA synthesis. This negative regulation system alone leads to approximately 10-time reduction of transcription (31). Absence of this regulatory system together with the CopF-mediating regulatory system increases the copy number of pAMβ about 100-fold.

The entire pAMβ1 replication region was incorporated in the plasmid pMSP3535 to enable the propagation of pMSP3535 in a wide range of gram-positive bacterial hosts (11). The original source of this region is plasmid pHV1301 obtained from in vivo transformation of B. sublitis with pAMβ1. The plasmid pHV1301 was

18 manipulated by removing undesired regions and adding polylinkers to generate a low copy number plasmid (6-7 copies/chromosome), named pIL252, used for molecular cloning of L. lactis (47). The plasmid pIL2525 was incorporated with nisRK genes and a promoter (PnisR) to generate a member of a dual-plasmid NICE system, termed pNZ9531 (24). The pNZ9531 was subsequently employed as a source of the nisRK genes, PnisR, an erythromycin resistance marker, and pAMβ1 replication region for the development of pMSP3535 (11).

2.4.2 ColE1 replication origin.

Colicin E1 (ColE1) is an E. coli narrow-host range plasmid with a copy number of approximately 20 copies per cell (25). ColE1 replicates by theta-mechanism with no requirement for any initiator protein. Its replication is initiated at a unique origin site (ori) and progresses unidirectinally by the mediation of a number of host proteins, i.e. RNA polymerase (RNA Pol), Ribonuclease H

(Rnase H) and DNA polymerase I (Pol I) (1, 32). A common mechanism for

ColE1 replication was proposed as the following (1, 21, 25). The replication process begins with the synthesis of a primer precursor of 700 bp, termed RNA

II, which is initiated at 555 nucleotides upstream of the origin, elongated by

RNA Pol, and terminated downstream from the ori (Figure 2.5A and B). Based on its secondary structure formed at 5´ end, RNA II couples with the plasmid

19 template DNA, resuting in the formation of a RNAII-DNA hybrid at a position near the ori (Figure 2.5C). RNase H recognizes the RNAII-DNA hybrid and cleaves it at the ori, thereby generating a mature primer with 3´ hydroxy group for Pol I activity (Figure 2.5D). When the leading strand synthesis is initiated by

Pol I, the remaining portion of RNA II is cleaved by RNase H and subsequently digested by the 5´-3´ exonuclease activity of Pol I, while the RNA primer is removed from the newly-synthesized DNA by RNase H. The leading strand synthesis is initiated by Pol I and elongation process is completed by DNA polymerase III holoenzyme, which is in common with the mechanism found in pAMβ1 plasmid; however, pAMβ1 replication requires the RepE protein but

ColE1-type plasmids do not (9, 22).

Figure 2.5. Model for the initiation of ColE1 replication (1).

2.5 Selectable marker of pMSP3535

The plasmid pMSP3535 was equipped with an erythromycin resistance gene, termed

ermB, derived from E. faecalis plasmid, pAMβ1, as a dominant selectable marker (6,

11, 24, 47). The ermB gene encodes a N-methyltransferase (methylase), termed

Erm(B), which attaches one or more methyl groups to a specific adenine residue

located in 23S rRNA, which is a component of 50S ribosomal subunit. This alteration

protects 50S ribosomal subunit from the attack of antibiotics (13, 19, 51). In

consequence, the Erm(B) can confer resistance to macrolides, lincosamides, and

streptogramin B (MLS) antibiotics, all of which inhibit protein synthesis in bacterial

cell by binding to the 50S ribosomal subunit (43, 51).

2.6 Modification of pMSP3535

Several modifications of pMSP3535 have been reported. A pMPS3535 derivative,

named pMSP3535VA was constructed by replacing the Erm marker and pAMβ1

replication region with a kanamycin resistance marker and pVA380-1 replicon

respectively (11). This derivative is able to be used in combination with pMSP3535

or other plasmids that contain the Erm marker or pAMβ1 replicon. Kim and Mill

(2007) (23) made several modifications to pMSP3535 to improve level of protein

expression which is relatively low in pMSP3535. These modifications include (a)

deletion of a nonessential nucleotide sequence coding for a shot peptide from the nisA

promoter to reduce overall expression burden, (b) insertion of a rho independent

transcription terminator to prevent possible interruption of the nisin signal

transduction resulting from run-on transcription from the nisA promoter through the

nisRK genes in the opposite direction, and (c) adjustment of copy number by

interrupting copF gene, a negative regulator of copy number, which leads to the

increase in the pMSP3535 copy number. The resulting plasmid, named

PMSP3535H2, showed significant improvement in protein expression.

A recent modification of pMSP3535 was made by Oddone and coworkers (2009) (37)

to overcome the limitation of recombinant protein production due to inhibitory effect

of the inducer, nisin, on the survival of hosts. A member of nisin immunity genes,

termed nisI, which was previously reported to be the most important determinant

among several immunity genes in the nisin gene cluster (41) was incorporated into

pMSP3535H2 at a position upstream of the nisR gene. The resulting plasmid,

pMSP3535H3 was proved to increase nisin tolerance in bacteria hosting it. As a

consequence, higher dose of nisin can be added into the culture, thereby increasing

the recombinant protein production.

2.7 The tetL gene, a tetracycline resistance determinant

The tetL gene encodes an efflux protein, termed TetL, which confers resistance to

tetracycline and chlortetracycline by pumping these antimicrobial agents out of the

cell. The efflux proteins are energy-dependent membrane-associate proteins which

exchange a proton for a tetracycline-cation complex (42, 44, 52). This activity lowers

the intracellular concentration of tetracycline to harmless level to bacterial ribosomes.

The tetL gene is commonly associated with small transferable plasmids such as small

plasmids form bacilli and streptococci. It is also found to be located on large

staphylococci plasmid and occasionally found to be integrated into the chromosomal

DNA of staphylococci and Bacillus subtilis (40, 42, 45).

2.8 pDG1515, the vector harboring the tetL gene

The vector pDG1515 was constructed by Guérout-Fleury and coworkers. (1995) (20) to facilitate genetic manipulation in Bacillus subtilis as an origin of a readily- transferable, antibiotic- resistance cassette composed of the tetL gene along with its promoter and Rho-independent transcriptional terminator. The tetracycline-resistance cassette originated from Streptococcus agalactiae plasmid pLS1 was cloned into

PstI/EcoRI sites in the multiple cloning site of Escherichia coli plasmid pBluescript

KS+. The resulting vector pDG1515 contained the tetL gene whose upstream and downstream are flanked by a series of upstream and downstream restriction sites.

Consequently, owing to the presence of various restriction sites, the tetL gene can be readily removed from the vector pDG1515 for later application.

Bibliography

2. Benachour, A., C. Muller, M. Dabrowski-Coton, Y.L. Breton, J.-C. Giard, A. Rince´, Y. Auffray, and A. Hartke. 2005. The enterococcus faecalis sigv protein is an extracytoplasmic function sigma factor contributing to survival following heat, acid, and ethanol treatments. Journal of bacteriology. 187: 1022-1035.

3. Bensing, B. A., J.A. López, and P.M. Sullam. 2004. The Streptococcus gordonii surface proteins GspB and Hsa mediate binding to sialylated carbohydrate epitopes on the platelet membrane glycoprotein Ib . Infection and immunity. 72: 6528-6537.

4. Bensing, B. A., and P.M. Sullam. 2009. Characterization of Streptococcus gordonii SecA2 as a paralogue of SecA. Journal of bacteriology. 191: 3482-3491.

5. Bidnenko, V., S.D. Ehrlich, and L. Jannière. 1998. In vivo relations between pAMβ-encoded type I topoisomerase and plasmid replication. Molecular microbiology. 28: 1005-1016.

6. Brehm J., G. Salmond, and N. Minton. 1987. Sequence of the adenine methylase gene of the Streptococcus faecalis plasmid pAM. Nucleic acid research. 15: 3177.

7. Bruand, C., S.D. Ehrlich, and L. Jannière. 1991. Unidirectional theta replication of the structurally stable Enterococcus faecalis plasmid pAMβ1. The EMBO journal. 10: 2171-2177.

8. Bruand, C., E.L. Chatelier, S.D. Ehrlich, and L. Jannière. 1993. A fourth class of theta-replicating plasmids: The pAMβ1 family from gram-positive bacteria. Proceeding in tha national academy of sciences of the United States of America. 90: 11668-11672.

9. Bruand, C., S.D. Ehrlich, and L. Jannière. 1995. Primosome assembly site in Bacillus subtilis. The EMBO journal. 14: 2642-2650. 25

10. Bruand, C., and S.D. Ehrlich. 1998. Transcription-driven DNA replication of plasmid pAMβ1 in Bacillus subtilis. Molecular microbiology. 30: 135-145.

11. Bryan, E.M., T. Bae, M. Kleerebezem, and G.M. Dunny. 2000. Improved vector for nisin-controlled expression in gram-positive bacteria. Plasmid. 44: 183-190.

12. del Solar, G., R. Giraldo, M.J. Ruiz-Echevarría, M. Espinosa, and R. Díaz- orejas. 1998. Replication and control of circular bacterial plasmids. 62: 434-464.

13. Depardieu, F., I. Podglajen, R. Leclercq, E. Collatz, and P. Courvalin. 2007. Modes and modulations of antibiotic resistance gene expression. Clinical microbiology reviews. 20: 79–114.

14. de Ruyter, P.G.G.A., O.P. Kuipers, M.M. Beerthuyzen, I. van Alen-Boerrigter, and W.M. de Vos. 1996a. Functional Analysis of Promoters in the nisin gene cluster of Lactococcus lactis. Journal of bacteriology. 178: 3434-3439.

15. de Ruyter, P.G.G.A., O.P. Kuipers, and W.M. de Vos. 1996b. Controlled gene expression systems for Lactococccus lactis with the food-grade inducer nisin. Applied and environmental microbiology. 62: 3662-3667.

16. Desmond, C., G. F. Fitzgerald, C. Stanton, and R. P. Ross. 2004. Improved stress tolerance of GroESL-overproducing Lactococcus lactis and probiotic Lactobacillus paracasei NFBC 338. Applied and environmental microbiology. 70: 5929-5936.

17. Eichenbaum, Z., M.J. Federle, D. Marra, W.M. de Vos, O.P. Kuipers, M. Kleerebezem, and J.R. Scott. 1998. Use of the Lactococcal nisA promoter to regulate gene expression in gram-positive bacteria: Comparison of induction level and promoter strength. Applied and environmental microbiology. 64: 2763-2769.

18. Engelke, G., Z. Gutowski-Eckel, M. Hammelmann, and K.-D. Entian. 1992. Biosynthesis of the lantibiotic nisin: genomic organization and membrane localization of the NisB protein. Applied and environmental microbiology. 58: 3730-3743.

19. Feld, L., E. Bielak, K. Hammerb, and A. Wilcks. 2009. Characterization of a small erythromycin resistance plasmid pLFE1 from the food-isolate Lactobacillus plantarum M345. Plasmid. 61: 159-170.

20. Guérout-Fleury, A.-M., K. Shazand, N. Frandsen, and P. Stragier. 1995. Antibiotic-resistance cassettes for Bacillus subtilis. Gene. 167: 335-336.

21. Itoh, T., and J. Tomizawa. 1980. Formation of an RNA primer for initiation of replication of ColE1 DNA by ribonuclease H. Proceeding of the national academy of sciences of the United States of America. 77: 2450–2454.

22. Jannière, L., V. Bidnenko, S. McGovern, S.D. Ehrlich, and M.A. Petit. 1997. Replication terminus for DNA polymerase I during initiation of pAMβ replication: role of the plasmid-encoded resolution system. Molecular microbiology. 23: 525-535.

23. Kim, J.-H., and D.A. Mills. 2007. Improvement of a nisin-inducible expression vector for use in lactic acid bacteria. Plasmid. 58: 275-283.

24. Kleerebezem M., M.M. Beerthuyzen, E.E. Vaughan, W.M. de Vos, and O.P. Kuipers. 1997. Controlled gene expression systems for lactic acid bacteria: Transferable nisin-inducible expression cassettes for Lactococcus, Leuconostoc, and Lactobacillus spp. Applied and environmental microbiology. 63: 4581-4584.

25. Kües, U., and U. Stahl. 1989. Replication of plasmid in gram-negative bacteria. Microbiological reviews. 53: 491-516.

26. Kuipers, O.P., M.M. Beerthuyzen, R.J. Siezen, and W.M. de Vos. 1993. Characterization of the nisin gene cluster nisABTCIPR of Lactococcus lactis, requirement of expression of the nisA and nisI genes for development of immunity. European journal of biochemistry. 216: 281-291.

27. Kuipers, O.P., M.M. Beerthuyzen, P.G.G.A. de Ruyter, E.J. Luesink, and W.M. de Vos. 1995. Autoregulation of nisin biosynthesis in Lactococcus lactis by sinal transduction. Journal of biological chemistry. 270: 27299-27304.

28. Kuipers, O.P., P.G.G.A. de Ruyter, M. Kleerebezem, and W.M. de Vos. 1998. Quorum sensing-controlled gene expression in lactic acid bacteria. Journal of biotechnology. 64: 15-21.

29. Kiewiet, R., J. Kok, J.F.M.L. Seegers, G. Venema, and S. Bron. 1993. The mode of replication is a major factor in segregational plasmid instability in Lactococcus lactis. Applied and environmental microbiology. 59: 358–364.

30. Le Chatelier, E., S.D. Ehrlich, and L. Jannière. 1994. The pAMβ1 CopF repressor regulates plasmid copy number by controlling transcription of the repE gene. Molecular microbiology. 14: 463-471.

31. Le Chatelier, E., S.D. Ehrlich, and L. Jannière. 1996. Countertranscript-driven attenuation system of the pAMβ1 repE gene. Molecular microbiology. 20: 1099- 1112.

32. Le Chatelier, E., L. Jannière, S.D. Ehrlich, and D. Canceill. 2001. The RepE initiator is a double-stranded and single-stranded DNA-binding protein that form atypical open complex at the onset of replication of plasmid pAMβ1 from gram- positive bacteria. The journal of biological chemistry. 276: 10234-10246.

33. Le Loir, Y., S. Nouaille, J. Commissaire, L. Brétigny, A. Gruss, and P. Langella. 2001. Signal peptide and propeptide optimization for heterologous protein secretion in Lactococcus lactis. Applied and environmental microbiology. 67: 4119-4127.

34. Luo, H., K. Wan, and H. H. Wang. 2005. High-frequency conjugation system facilitates biofilm formation and pAMβ1 transmission by Lactococcus lactis. Applied and environmental microbiology. 71: 2970–2978.

35. Mierau, I, and M. Kleerebezem. 2005. 10 years of the nisin-controlled gene expression system (NICE) in Lactococcus lactis. Applied and environmental microbiology. 68: 705-717.

36. Novick, R.P., S. Iordanescu, S.J. Projan, J. Kornblum, and I. Edelman. 1989. pT181 plasmid replication is regulated by a countertranscript-driven transcriptional attenuator. Cell. 59: 395-404.

37. Oddone, G.M., D.A. Mills, and D. E. Block. 2009. Incorporation of nisI-mediated nisin immunity improves vector-based nisin-controlled gene expression in lactic acid bacteria. Plasmid. 61: 151-158.

38. Pavan, S., P. Hols, J. Delcour, M.-C. Geoffroy, C. Grangette, M. Kleerebezem, and A. Mercenier. 2000. Adaptation of the nisin-controlled expression system in Lactobacillus plantarum: a tool to study in vivo biological effects. Applied and environmental microbiology. 66: 4427-4432.

39. Pérez-Arellano, I., M. Zúňiga, and G. Pérez-Martínez. 2001. Contruction of compatible wide-host-range shuttle vectors for lactic acid bacteria and Escherichia coli. Plasmid. 46: 106-116.

40. Platteeuw, C., G. Simons, and W.M. de Vos. 1994. Use of the Escherichia coli β- glucuronidase (gusA) gene as a reporter gene for analyzing promoters in lactic acid bacteria. Applied and environmental microbiology. 60: 587-593.

41. Ra, R., M.M. Beerthuyzen, W.M. de Vos, P.E.J. Saris, O.P. Kuipers. 1999. Effects of gene disruptions in the nisin gene cluster of Lactococcus lactis on nisin production and producer immunity. Microbiology-UK. 145: 1227–1233.

42. Roberts, M.C. 1996. Tetracycline resistance determinants: mechanisms of action, regulation of expression, genetic mobility, and distribution. FEMS microbiology review. 19: 1-24.

43. Roberts, M.C. 2004. Resistance to macrolide, lincosamide, streptogramin,ketolide, and oxazolidinone antibiotics. Molecular biotechnology. 28: 47-62.

44. Roberts, M.C. 2005. Update on acquired tetracycline resistance gene. FEMS microbiology letters. 245: 195-203.

45. Schwarz, S., M. Cardoso, and H.C. Wegener. 1992. Nucleotide sequence and phylogeny of the tet(L) tetracycline resistance determinant encoded by plasmid pSTE1 from Staphylococcus hyicus. Antimicrobial agents and chemotherapy. 36: 580-588.

46. Seigers, K., and K.-D. Entian. 1995. Genes involved in immunity to the lantibiotic nisin produced by Lactococcus lactis 6F3. Applied and environmental microbiology. 61: 1082-1089.

47. Simon, D., and A. Chopin. 1988. Construction of a vector plasmid family and its use for molecular cloning in Streptococcus lactis. Biochimie. 70: 559-566.

48. Smith, J.L., P.M. Fratamico, and J.S. Novak. 2004. Quorum sensing: A primer for food microbiologists. Journal of food protection. 67: 1053-1070.

49. Swinfield, T.J., J.D. Oultram, D.E. Thompson, J.K. Brehm, and N.P. Minton. 1990. Physical characterization of the replication region of the Streptococcus faecalis plasmid pAMβ1. Gene. 87: 79-90.

50. van der Meer, J.R. J. Polman, M.M. Beerthuyzen, R.J. Siezen, O.P. Kuipers, and W.M. de Vos. 1993. Characterization of the Lactococcus lactis nisinA operon genes nisP, encoding a subtilisin-like serine protease involved in precursor processing, and nisR, encoding a regulatory protein involved in nisin biosynthesis. Journal of bacteriology. 175: 2578-2588.

51. Weisblum, B. 1995. Erythromycin resistance by ribosome modification. Antimicrobial agents and chemotherapy. 39: 577–585.

52. Yamaguchi, A., N. Ono, T. Akasaka, T. Noumi, and T. Sawai. 1990. Metal- tetracycline/H-antiporter of Escherichia coli encoded by a trasposon, Tn10. Journal of biological chemistry. 256: 15525-15530.

53. Zhou, X.X., W.F. Li, G.X. Ma, and Y.J. Pan. 2006. The nisin-controlled gene expression system: construction, application and improvements. Biotechnology advances. 24: 285-295.

Chapter 3: Construction of a Nisin-Controlled Expression Vector, a Derivative of

pMSP3535 for Alternative Selectable Marker

3.1 Objective

The objective of this study was to extend additional option for selective maker in pMSP35353. Our goal was to replace the ermB gene with a tetr gene, which can be co- selected in both Gram-positive and Gram-negative bacteria.

In this study, the ermB gene was replaced by the tetL gene to open the room for an alternative selective marker conferring tetracycline resistance. As a result, the modified vector should serve as a promising tool for driving insin-controlled expression in hosts naturally resistant to erythromycin and in combination with plasmids which contain Emr or other markers. Moreover, by taking advantage of ermB gene removal to simultaneously excise a segment of the copF gene, the resulting vector has a potential to become a high copy number derivative of pMSP3535.

3.2 Material and methods

3.2.1 Detection of the tetL gene harbored by the plasmid pDG1515.

Conventional PCR amplification was carried out to attest the presence of the tetL

gene in pDG1515. DNA template was prepared from cell extract of E. coli ECE98,

the pDG1515 carrier, using a method modified from Wang’s and coworker’s (2006)

(24). Stock culture of E. coli ECE98 was streaked onto an LB plate supplemented

with 100 µg/ml amplicillin. The streaked plate was aerobically incubated at 37oC for

24 hr. After incubation, a single colony was suspended in 200 µl sterile distilled

water containing 100 mg of 0.1 mm diameter glass beads (Biospec Products Inc.,

Bartlesville, OK). The mixtures were bead-beaten using Mini-Bead-BeaterTM

(Biospec Products Inc., Bartlesville, OK) for 3 min at maximum speed. The bead-

beaten mixtures were then boiled in a water bath for 20 min and then immediately

incubated in ice-cooled water bath. The cell extract was kept on ice until needed.

PCR was performed in a final volume of 20 µl containing 2 µl of 10x PCR buffer

(New England Biolabs Inc., Ipswich, MA), 1.2 µl of 10x MgCl2, 0.8 µl of 10 mM

dNTPs (each), 0.2 µl of 10 µM forward primer, 0.2 µl of 10 µM reverse primer, 14.4

µl of sterile distilled water, 1 µl of the cell extract, and 0.2 µl of Taq DNA

polymerase (New England Biolabs Inc., Ipswich, MA). The reaction was carried out

in a PCR thermocycler under the following conditions: initial denaturation at 95oC

for 5 min; 35 cycles of denaturation at 95oC for 30 sec, annealing at 53oC for 30 sec,

32 and elongation at 68oC for 50 sec; a final extension at 68oC for 5 min. A pair of primer, tetLF431; TTGGATCGATAGTAGCCATG and tetLR1340;

GTAACCAGCCAACTAATGAC, was used to amplified 0.9 kb tetL fragment.

PCR products were then detected by electrophoresis on 1% agarose gel. After

Ethidium bromide DNA staining and UV visualization, size of the PCR product amplified from the E. coli ECE98 template was compared to that of the PCR product obtained from a tetL positive control.

3.2.2 Nucleotide sequencing of the tetL gene and its up- and downstream

regions.

After the presence of the tetL gene on pDG1515 was confirmed by PCR, the nucleotide sequencing of the tetL gene and its flanking regions were carried out. A single colony of E. coli ECE98 was grown in 5 ml of LB broth supplemented with

100 µg/ml amplicillin at 37oC, 250 rpm for 12-16 hr. A 10 ml of properly-incubated culture was then used to prepare 50 µl of pDG1515 plasmid extract using QIAquick plasmid purification kit for low-copy plasmid (Qiagen Inc., Valencia, CA). The plasmid extract was subsequently analyzed for the nucleotide sequence of tet gene and its flanking regions using a DNA analyzer (ABI PRISMs 3700, Applied

Biosystems, Foster City, CA) at the Plant Genome Sequence Facility, The Ohio State

University. A set of primers shown in Table 3.1 were used for the nucleotide sequencing. After the DNA sequencing, sequence assembly was performed using

DNASTAR SeqMan program. The assembled sequence was analyzed for the structural tet gene, tet regulatory regions, and other components essential for tet gene expression by comparing the obtained sequence to sequences deposited in GenBank using BLAST (Basic Local Alignment Search Tool) (1).

Table 3.1. Primers used for nucleotide sequencing of tetL gene and flanking regions in pDG1515

Name Sequence (5´ to 3´)

TetLR1340 GTAACCAGCCAACTAATGAC

TetLR161 ACCCAGTTTGTACTCGCAGG

TetLF431 TTGGATCGATAGTAGCCATG

TetLF1246 GGTTGTTACCTATGGAAGTTG

3.2.3 PCR amplification of precursors of insert fragments.

Various DNA fragments were amplified and equipped with restriction sites at their terminus using different primer sets, each of which exclusively designed for each individual fragment amplifications and restriction site addition. The resulting fragments containing tetL gene and/or copF gene and/or promoter PDE would be used as precursors to generate restriction inserts for later DNA cloning. PfuUltraTM High-

Fidelity DNA Polymerase with proofreading activity (Stratagene, La Jolla, CA) was 34 used for these fragment amplification to minimize error in base pairing. PCR reactions were set up using conditions suggested in PfuUltraTM High-Fidelity DNA

Polymerase instruction manual. The reaction mixture (50 ml.) contained 5 µl of 10x

PfuUltra buffer (Stratagene, La Jolla, CA) 1.25 µl of 10 mM dNTPs (each), 2 µl of

10 µM forward primer, 2 µl of 10 µM reverse primer, 37.75 µl of sterile distilled water, 1 µl of DNA template, and 1 µl of 2.5 U/ µl PfuUltra high-fidelity DNA polymerase (Stratagene, La Jolla, CA). The reaction was performed in a PCR thermocycler under the following conditions: initial denaturation at 95oC for 2 min;

30 cycles of denaturation at 95oC for 30 s, annealing at a specific temperature depending on melting temperature (Tm) of the primers for 30 s, and elongation at

72oC for a specific time depending on the length of the amplified fragment; a final extension at 72oC for 10 min. Primer sets, annealing temperature, and elongation time used to amplify DNA fragments as well a the application of each fragment in future step are summarized in Table 3.2.

Table 3.2. Primer sets and PCR conditions used for amplification of various DNA fragments

Fragment Amplified DNA fragment Length Primer set Annealing Elongation Application no. (bp) temperature time (oC) (min)

1 tetL fragment with added BglII 1879 BglTetL-F/ 58 2 Digested with BglII and NsiI to and NsiI site NsiTetL-R generate the tetL insert in the1st strategy

2 tetL fragment with added BglII 1878 BglTetL-F/ 58 2 Digested with BglII and SnaBI to and SnaBI site SnaTetL-R generate the tetL insert in the 2nd strategy

3 tetL fragment with added BglII 1874 BglTetL-F/ 59 2 - Combined together after

36 and EagI site EagTetL-R digested with EagI to

generate fragment no. 5

4 copF-and PDE-containing 663 EagCopP-F/ 66 1 - Combined together after fragment with added EagI and CopP-R digested with HindIII to indigenous NsiI site generate fragment no. 6

5 tetL-copF-PDE fragment with 2515 BglTetL-F/ 59 3 Digested with BglII and NsiI to added BglII and indigenous CopP-R generate the tetL-copF-PDE insert NsiI site in the 3rd strategy

6 tetL-PDE fragment with added 2265 BglTetL-F/ 59 3 Digested with BglII and NsiI to BglII and indigenous NsiI site CopP-R generate the tetL-PDE insert in the4th strategy

After PCR amplification, Each PCR product was analyzed by agarose gel electrophoresis and a band of the targeted DNA fragment was then purified using

QIAquick gel extraction kit (Qiagen Inc., Valencia, CA). The purified fragment was observed on a 0.7% agarose gel after an electrophoresis and ethidium bromide staining were performed.

3.2.4 Construction of the tetL-copF-PDE and tetL-PDE fragment

The tetL-copF-PDE and tetL-PDE fragment were generated to serve as precursors of the tetL-copF-PDE and tetL-PDE insert respectively. Both DNA fragments were the products of assembling the tetL fragment containing BglII and EagI site and copF-and

PDE-containing fragment together. To construct the tetL-copF-PDE fragment, both tetL and copF-and PDE-containing fragment were digested with EagI. 1µg of each DNA fragment was digested with 10 U of EagI (New England Biolabs Inc., Ipswich, MA) in the reaction mixture containing 1X NEBuffer 3 (New England Biolabs Inc.,

Ipswich, MA) at 37oC for 2 hr. The digestion products were purified by QIAquick

PCR purification kit (Qiagen Inc., Valencia, CA) and then joined together by the activity of E. coli DNA Ligase (Invitrogen, Carlsbad, CA). The ligation mixture

contained the EagI-digested tetL fragment and the EagI-digested copF-and PDE- containing fragment at a molar ratio of 1:1, 10 U of E. coli DNA Ligase per 1 µg of the total DNA and 1X E. coli Ligase Buffer. The ligation mixture was incubated at 14oC for

12-16 hr. The ligation product was then analyzed by agarose gel electrophoresis and the

37 tetL-copF-PDE fragment was extracted from the gel using QIAquick gel extraction kit.

The similar protocol as above was employed to construct the tetL-PDE fragment. Each tetL and copF-and PDE-containing fragment was digested with HindIII rather than EagI. 10

U of HindIII (Invitrogen, Carlsbad, CA)was used to digest 1µg of the DNA fragment in the digestion mixture containing 1X ReAct 2 buffer (Invitrogen, Carlsbad, CA) at

37oC for 2 hr. The digestion products were purified and joined together by following the protocol described above.

3.2.5 Restriction digestion of pMSP3535 and insert fragments.

Two systems of restriction digestion were used for the digestion of pMSP3535 and insert fragments to generate backbone vector and insert, both of which contained homologous ends for following DNA ligation. These two digestion systems were;

3.2.5.1 BglII- and NsiI-digestion.

This system made use of BglII and NsiI to excise the ermB gene from the vector

pMSP3535, in consequence, the backbone vector with two distinctive ends was

generated. Furthermore, BglII and NsiI was used to digested several different tetL-

containing fragments mentioned in Table 3.2, i.e. fragment no. 1, 4, and 5, to

38 generate homologous ends as ones present on the backbone vector. Each DNA species was simultaneously digested with both BglII and NsiI at 37oC for 16 hr.

The digestion mixture contained both restriction enzymes and the DNA fragment at a ratio of 10 U of each enzyme to 1 µg DNA digested. The digestion reaction was conducted in the presence of 1X NEBuffer 3 at 37oC for 16 hr. The targeted fragments were separated from other digestion products by agrose gel electrophoresis and then purified using QIAquick gel extraction kit.

3.2.5.2 BglII- and SnaBI-digestion.

This system employed BglII and SnaBI to cleave pMSP3535 and the tetL fragment with BglII and SnaBI site. In this system, the DNAs were firstly digested with BglII at 37oC for 16 hr followed by the purification of the digestion products using

QIAquick PCR purification kit to remove the first buffer system and the enzyme.

Afterwards, the purified, BglII-digested product in water was cleaved with the second enzyme, SnaBI, at 37oC for 3 hr. Similar digestion mixtures were set up for both enzymatic reaction. The mixtures contained the targeted DNA and BglII or SnaBI at a ratio of 1 µg of DNA: 10 U of enzyme. Only one difference is that the BglII-digestion was performed in the presence of 1X NEBuffer 3 but the

SnaBI digestion was done in the present of 1X NEBuffer 4 and 1X BSA. After

SnaBI digestion, the same purification method was then applied for SnaBI- digested products. Each final product cleaved with two enzymes was eluted from

a QIAquick column with sterile distilled water. The BglII- and SnaBI-digested

products would be used for DNA ligation in the next step.

3.2.6 Cloning of tetL-containing inserts into the backbone vector pMSP3535

Each of the tetL-containing inserts was joined into backbone vectors derived from pMSP3535 by the aid of T4 DNA Ligase (Invitrogen, Carlsbad, CA). Different molar ratios of insert to vector including 1:1, 3:1, and 6:1 were used to set up ligation mixtures. In addition to insert and vector DNAs, the ligation mixtures (20 ml total) contained 1X DNA Ligase Reaction Buffer and T4 DNA Ligase at amount of 0. 1 and 1.0 U when ligation reactions of cohesive ends and blunt ends were set up respectively. The ligation mixtures were incubated at 14oC for 16-24 hr.

For the cloning of the tetL inserts derived from fragment no. 1 and 2 (Table 3.2), an aliquot of 10 µl of ligation products was directly introduced into competent E. coli

DH5α prepared by CaCl2 treatment as described by Sambrook and Russell in CSH protocols; 2006; doi:10.1101/pdb.prot3932 (21). Briefly, 10 µl of the ligation product was gently mixed with 200 µl of competent cells. The mixture was sat on ice for 30 min, transferred to incubated at 42oC for exactly 90 sec, and then sat on ice again for 1-2 min. Immediately after that, 800 µl of SOC medium was added into the mixture. The culture was incubate at 37oC, 150 rpm for 1 hr and then 100-200 µl of

40 the outgrowth culture was spread onto a LB plate containing 10 µg tetracycline/ml.

Plates were incubated at 37oC for 12-16 hr.

For the cloning of the tetL-copF-PDE and tetL-PDE insert into the backbone vector, the ligation products were purified and concentrated by extraction with ethanol. A 20

µl of the ligation product was mixed with 0.1 volume of 3M sodium acetate pH 5.2.

The mixture was then added with 2 volume of ice-cold ethanol and stored at -20oC for at least 30 min. In the next step, the mixture was centrifuged at 13000 rpm, 4 oC for 20 min. After the supernatant was removed, the DNA content was washed with 1 ml of ice-cold 70% ethanol. The mixture was centrifuged at 13000 rpm, 4 oC for 10 min. The DNAs were reconstituted in 4 µl of 10 mM Tris-Cl buffer pH 8.5.

Afterwards, 2 µl of purified ligation products were used to transform 40 µl of electro-competent E. coli DH5α by electroporation as described by Sambrook and

Russell in CSH protocols; 2006; doi:10.1101/pdb.prot3933 (22). Shortly, the mixture was incubated on ice for 30-60 sec before transferred to an ice-cold electroporation cuvette (0.1-cm gap). The DNA/cell mixture was electroporated at 1.25 kV, 25 µF capacitance, and 200 Ω resistance. Immediately after electric pulse delivery, 1 ml of

SOC medium was added into electroporated culture. The culture was then outgrown at 37 oC, 150 rpm for 1 hr and then 100-200 µl of the outgrowth culture was spread onto an LB plate containing 5 µg tetracycline/ml. Plates were incubated at 37 oC for

12-16 hr.

The transformed colonies isolated from the selective plates were streaked onto fresh plates and incubate at 37 oC for 12-16 hr. A single colony of each transformant was then grown in 5 ml of LB medium supplemented with 5 µg tetracycline/ml. After incubated at 37 oC, 250 rpm for 16 hr, the culture was used for plasmid extraction using GenElute HP Plasmid Miniprep kit (Sigma-Aldrich, St. Louis, MO). The plasmid extracts were subsequently analyzed by agarose gel electrophoresis.

3.2.7 Introduction of the constructed vectors into gram-positive bacterial hosts

The effectiveness of the constructed vector to transformed gram-positive bacterial hosts was examined in the following lactic acid bacteria.

3.2.7.1 Electrotransformation of E. faecalis OG1RF

The constructed vector was introduced into competent E. faecalis OG1RF by

electroporation. The competent cells were prepared and transformed as described

by Dunny and coworkers (1991) (10). In summary, a single colony of E. faecalis

OG1RF was grown in BYGT medium containing different concentrations of

glycine at 37oC for 12-15 hr. The culture growing in a glycine concentration that

gave 70-90% reduction in the OD600 of the culture as compared with control

culture without glycine was used to prepared the competent cells. The culture was

inoculated into fresh medium containing the same glycine concentration at 5%

inoculums. After the freshly-inoculated culture was grown at 37oC for 60 min, the

42 culture was chilled on ice and then centrifuged. The harvested cell were washed with 1/3 volume of chilled electroporation solution (0.625M sucrose + 1mM

MgCl2 pH 4.0), centrifuged, and resuspended in 1/30 to 1/100 the original volume of the electroporation solution. The cell suspension was sat on ice for 30-60 min and then a cell aliquot of 50 µl was transferred into an electroporation cuvette

(0.1-cm gap). Approximately 300 ng of the vector DNA in volume < 10 µl was gently mix with the competent cells. Immediately after that, the elctroporation was performed at 1.0 kV, 25 µF capacitance, and 200 Ω resistance. The electroporated cells were stored on ice for 1-2 min and diluted with 2 volumes of

THB medium. The cells were outgrown at 37oC for 90-120 min before spread onto THB agar plates containing 0.25 M sucrose at 10 µg tetracycline/ml. Plates were incubated at 37oC for 12-16 hr before transformants were observed. A number of transformants were streak on fresh selective THB agar plates and incubated at 37oC for 12-16 hr. After that, a single colony of each transformant was grown in 5 ml of BHI medium containing 10 µg tetracycline/ml at 37oC for

16 hr. The vector was extracted from the cell cultures using a method described by Anderson and McKay (1983) (3). Afterwards, plasmid extracts were analyzed by agarose gel electrophoresis and restriction digestion with HindIII for plasmid profile observation. Presence of the tetL insert was also analyzed by PCR amplification with BglTetL-F/CopP-R primers.

3.2.7.2 Electrotransformation of L. lactis 2301

The constructed vector was introduced into electrocompetent L. lactis 2301 by eletroporation using a protocol developed by McIntyre and Harlander (1989a and

1989b) (17, 18). In short, a single colony of L. lactis 2301 growing on a M17G plate was grown in 3 ml of M17G medium at 30oC for 12 hr. A 2.5 ml of the overnight culture was transferred into 50 ml of freshly-prepared, enriched RPMI medium and grown at 30oC for 48-60 hr. After that, cells were harvested by centrifuging at 8000 rpm 4oC for 10 min, washed with 10-20 ml ice-cold deionized distilled water (ddH2O) twice, and then collected by centrifuging at the

o 10000 rpm 4 C for 10 min. Cell pellets were suspended in 1.0 ml ddH2O and centrifuged at 13000 rpm 4oC for 3 min. The cell pellets were resuspended in 0.6 ml ddH2O. A aliquot of 0.2 ml of competent cells was gently mix with 200-450 ng of vector DNA and sat on ice for 1 min. The mixture was transferred into an ice-cold electroporation cuvette (0.1 cm gap) and then electroporated at 1.6 kV,

25 µF capacitance, and 200 Ω resistance. Immediately after that, A 750 µl of

M17G medium was added into the cuvette. The electroporated cells were outgrown at 30oC for 2 hr and then a 100-200 µl of outgrown culture was spread onto a M17G agar plate containing 4 µg tetracycline/ml. Plates were incubated at

30 oC for 48-72 hr before transformants could be observed. Afterwards transformants were streaked on selective M17G agar plates and a single colony isolated from each transformant was then grown in M17G medium supplemented

44 with 4 µg tetracycline/ml at 30oC for 48-72 hr. The transformant cultures were used for plasmid extraction using Anderson and McKay method (1983) (3). The plasmid extracts were analyzed by agarose gel electrophoresis and PCR amplified with a primer set of BglTetL-F/CopP-R.

3.2.7.3 Natural transformation of S. mutans

The constructed vector was introduced into a naturally competent S. mutans. A single colony of S. mutans anaerobically growing on a BHI agar plate was transferred into 10 ml of BHI medium at 37oC for 12-16 hr. The culture was then

1/10, 1/40, and 1/80 diluted with fresh BHI medium. The diluted cultures were

o incubated at 37 C for 3-4 hr. The culture which gave OD600 at 0.1-0.3 was used for natural transformation. A 400 µl of the culture was gently mixed with  1 µg vector DNA. The mixture was then incubated at 37oC for 2 hr before an aliquot of

100 µl of the transformed culture was spread on a BHI agar plate containing 10 ng tetracycline/ml. Plates were anaerobically incubated at 37oC for 24 hr before the presence of transformants was observed.

3.3 Results and discussion

3.3.1 Detection of the tetL gene in plasmid pDG1515.

The PCR product amplified from the cell extract of E. coli ECE98 hosting pDG1515

appeared as a single band of approximately 1 kb on a 1% agarose gel after

electrophoresis. This band was identical in size with a band obtained from the tetL

positive control as shown in Figure 3.1A. This result attested the existence of the tetL

gene on pDG1515. After the tetL detection, the plasmid pDG1515 was extracted

from E. coli host and detected by agarose gel electrophoresis. The plasmid was

present on a 1% agarose gel as a single band approximately 5-kb in size as compared

to a supercoiled DNA ladder Figure 3.1B.

A 1 2 3 4 5 B 1 2 3 4

5 kb 1000 bp

Figure 3.1. (A) PCR amplicon of the tet L gene amplified from cell extract of E. coli ECE98. Lanes 1, supercoiled DNA ladder; 2, tetL positive control; 3 and 4, E. coli ECE98 harboring pDG1515; and 4, negative control. (B) Agarose gel electrophoresis of plasmid extracts. Lane 1. supercoiled DNA ladder; 2 and 3, plasmid pDG1515 extracted from E. coli ECE98; and 4, 1 kb DNA ladder.

3.3.2 Nucleotide sequencing and sequence analysis of the tetL gene and its flanking regions

Purified pDG1515 plasmid extracted from host E. coli ECE98 was detected for nucleotide sequence of the tet gene and its flanking regions using four different primers. The assembled sequence shown in Figure 3.2 demonstrated the entire tetL gene as well as the upstream and downstream regions. An ORF of 1377 bp, starting from nucleotide 551 to 1927, is the structural tetL gene whose nucleotide sequence is

100% homologous to that of tetL gene of S. agalactiae plasmid pLS1 (13) which is the original source of the tetL gene of pDG1515 (11). The tetL gene was preceded by a putative promoter whose -35 box starts at nucleotide 397 and -10 box starts at nucleotide 420 and two putative ribosome binding sites (RBS). Sequence alignment revealed that a region from nucleotide 1 to 366 is 100% identical to the last 366 47 nucleotides of repB gene from the plasmid pLS1. A Rho-independent transcriptional terminator was found at 6-nucleotide downstream of the tetL stop codon. The terminator was followed a segment of pBluescript KS+ which is the parental plasmid of pDG1515. This pBluescript segment, starting from nucleotide 1882 to the last nucleotide of the sequence, includes a series of restriction sites which are members of a polylinker of pBluescript KS+, T3 promoter, lacZ promoter, and a portion of

ColE1 origin [(2) and Startagene pBluescript II phagemid vectors, instruction manual].

Based on the obtained nucleotide sequence and the sequence previously reported to be employed (20, 23), the nucleotide sequence needed to be remained intact for effective tetL function starts from nucleotide 396 to 1973.

60 AAACATGTTTATGATAAGGCTGATATAAAGCTAATCAATAATTTTGATATTGACCGTTAT

120 GTGACGTTAGATGTCGAGGAAAAGACCGAACTTTTCAATGTGGTTGTATCGCTTATTCGT

180 GCGTACACTCTCCAAAATATTTTTGATTTGTATGATTTCATTGACGAAAATGGAGAAACT

repB 240 TATGGGTTGACTATAAATTTGGTTAACGAAGTTATTGCAGGGAAAACTGGTTTTATGAAA

300 TTGTTGTTTGACGGAGCTTATCAACGTAGTAAGCGTGGAACAAAGAACGAAGAGAGATAA

360 AAAGTTGATCTTTGTGAAAACTACAGAAAGTAAAGAATGAAAAGAGTAATGCTAACATAG

420 CATTACGGATTTTATGACCGATGATGAAGAAAAGAATTTGAAACTTAGTTTATATGTGGT -35 480 AAAATGTTTTAATCAAGTTTAGGAGGAATTAATTATGAAGTGTAATTAATGTAACAGGGT -10 RBS 1 2 3 4 540 TCAATTAAAAGAGGGAAGCGTATCATTAACCCTATAAACTACGTCTGCCCTCATTATTGG

5 600 AGGGTGAAATGTGAATACATCCTATTCACAATCGAATTTACGACACAACCAAATTTTAAT RBS Start tetL 660 TTGGCTTTGCATTTTATCTTTTTTTAGCGTATTAAATGAAATGGTTTTGAACGTCTCATT

720 ACCTGATATTGCAAATGATTTTAATAAACCACCTGCGAGTACAAACTGGGTGAACACAGC

780 CTTTATGTTAACCTTTTCCATTGGAACAGCTGTATATGGAAAGCTATCTGATCAATTAGG

840 CATCAAAAGGTTACTCCTATTTGGAATTATAATAAATTGTTTCGGGTCGGTAATTGGGTT

900 TGTTGGCCATTCTTTCTTTTCCTTACTTATTATGGCTCGTTTTATTCAAGGGGCTGGTGC

960 AGCTGCATTTCCAGCACTCGTAATGGTTGTAGTTGCGCGCTATATTCCAAAGGAAAATAG

Continued

Figure 3.2. A partial nucleotide sequence of vector pDG1515 including tetL gene and its up-and downstream region

Figure 3.2 continued

1020 GGGTAAAGCATTTGGTCTTATTGGATCGATAGTAGCCATGGGAGAAGGAGTCGGTCCAGC

1080 GATTGGTGGAATGATAGCCCATTATATTCATTGGTCCTATCTTCTACTCATTCCTATGAT

1140 AACAATTATCACTGTTCCGTTTCTTATGAAATTATTAAAGAAAGAAGTAAGGATAAAAGG

1200 TCATTTTGATATCAAAGGAATTATACTAATGTCTGTAGGCATTGTATTTTTTATGTTGTT

1260 TACAACATCATATAGCATTTCTTTTCTTATCGTTAGCGTGCTGTCATTCCTGATATTTGT

1320 AAAACATATCAGGAAAGTAACAGATCCTTTTGTTGATCCCGGATTAGGGAAAAATATACC

1380 TTTTATGATTGGAGTTCTTTGTGGGGGAATTATATTTGGAACAGTAGCAGGGTTTGTCTC

1440 TATGGTTCCTTATATGATGAAAGATGTTCACCAGCTAAGTACTGCCGAAATCGGAAGTGT

1500 AATTATTTTCCCTGGAACAATGAGTGTCATTATTTTCGGCTACATTGGTGGGATACTTGT

1560 TGATAGAAGAGGTCCTTTATACGTGTTAAACATCGGAGTTACATTTCTTTCTGTTAGCTT

1620 TTTAACTGCTTCCTTTCTTTTAGAAACAACATCATGGTTCATGACAATTATAATCGTATT

1680 TGTTTTAGGTGGGCTTTCGTTCACCAAAACAGTTATATCAACAATTGTTTCAAGTAGCTT

1740 GAAACAGCAGGAAGCTGGTGCTGGAATGAGTTTGCTTAACTTTACCAGCTTTTTATCAGA

1800 GGGAACAGGTATTGCAATTGTAGGTGGTTTATTATCCATACCCTTACTTGATCAAAGGTT

1860 GTTACCTATGGAAGTTGATCAGTCAACTTATCTGTATAGTAATTTGTTATTACTTTTTTC

1920 AGGAATCATTGTCATTAGTTGGCTGGTTACCTTGAATGTATATAAACATTCTCAAAGGGA

Continued

Figure 3.2 continued

1980 TTTCTAAATCGTTAAGGGATCAACTTTGGGAGAGAGTTCAAAATTGATCCTTTTTTTATA Stop tetL Terminator ApaI, ClaI HincII, AccI EcoO10 2040 ACAGGAATTCGATATCAAGCTTATCGATACCGTCGACCTCGAGGGGGGGCCCGGTACCCA9I EcoR EcoRV HindI Bsp106 SalI XhoI DraI KpnI I II I 2100 GCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGT T3 promoter 2160 TTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACACAACATACGAGCCGGGAGCATAA

2220 AGTGTAAAGCCTGGGGTGCCTAATGAGTGAGCTAACTCACATTAATTGCGTTGCGCTCAC

2280 TGCCCGCTTTCCAGTCGGGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCG

2340 CGGGGAGAGGCGGTTTGCGTATTGGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGC

2400 GCTCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTAT

2460 CCACAGAATCAGGGGATAACGCANGAAAGAACATGTGAGCAAAAAGGCCAGCAAAAGGCC

2520 AGGAACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCTGACGAGC

2580 ATCACAAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATAC

2640 CAGGCGTTTCCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTAC

2700 CGGATACCTGTCCGCCTTTCTCCCTTCGG

3.3.3 DNA manipulation strategy for replacing the ermB gene with the tetL

gene and construction scheme of a pMSP3535 derivative

To locate sites for tetL insertion, restruction endonucleases with single cleavage sites in the pMSP3535 were analyzed using the NEBcutter V2.0 program at the New

England Biolabs website (http://tools.neb.com/NEBcutter2/) and pMSP3535 sequence deposited in GenBank (GenBank number: AY303239) and mapped as shown in Figure 3.3. The restriction-site mapping revealed that there were six restriction endonucleases cleaving pMSP3535 at either the structural ermB gene

(XcmI and SnaBI), the upstream region of the ermB gene (BglII), or the downstream region of the ermB gene (PpuMI, EcoO109I, and NsiI). Among them, BglII and NsiI were chosen for the DNA manipulation in this study principally due to their complementary ability to excise a 1810-bp DNA segment containing the entire ermB gene along with its up- and downstream region. Since the size of the removed segment was close to that of replacing tetL insert (1861 bp) subsequently combined to the pMSP3535 backbone vector, the energy burden loaded to hosts by the constructed pMSP3535 derivative should be almost the same as that loaded by the original plasmid pMSP3535. Therefore, like pMSP3535, the constructed vector should be stably maintained in bacterial hosts. The other crucial characteristic of

BglII and NsiI is that they do not cleave the tetL fragment. Therefore, BglII and NsiI digestion of the tetL fragment, whose termini are previously added with either BglII or NsiI site can be performed to generate a tetL insert complementary to BglII- and

NsiI-digested pMSP3535. Furthermore, after DNA cleavages, both BglII and NsiI yield sticky ends which facilitate later ligation of vector and insert DNA. BglII and

NsiI also share the same digestion buffer and temperature, thereby making the digestion step easy to be carried out.

Figure 3.3. A map of restriction sites of singly-cut endonucleases in the vector pMSP3535.

The strategy used to construct a pMSP3535 derivative carrying the tetL gene as a selective marker is illustrated in Figure 3.4.

Figure 3.4. Construction scheme of the vector pMSP3535TL

3.3.4 Primer design and PCR amplification of the tetL fragment

After the cut sites in pMSP3535 were designated, a pair of primers was designed to be used for amplification of the 1879-bp tetL fragment ranging from nucleotide 148 to 2026 (Figure 3.2). The amplified fragment primarily composed of the structural tetL gene, its upstream promoter, its downstream terminator, and the sites for BglII and NsiI which were added to the termini of amplified DNA. The sequences of 26- nucleotide forward primer and 28-neucleotide reverse primer are demonstrated in

Figure 3.5. This pair of primers was then used to amplify the tetL fragment from the

54 pDG1515 plasmid extract. The purified PCR product was detected by agarose gel electrophoresis and appeared as a single band approximately 1.8 kb in size (Figure

3.6) which was the expected size for the tetL fragment.

Forward primer: BglII BglTetL-F 5' TTGTATGATAGATCTGACGAAAATGG 3’

pDG1515 3’(148) AACATACTAAAGTAACTGCTTTTACC (173)5’

Reverse primer:

NsiI NsiTelL-R 5’ CCCCTAGATGCATACGGTATCGATAAGC 3’

pDG1515 3’(2026) GGGGAGCTCCAGCTGCCATAGCTATTCG (1999)5’

Figure 3.5. Oligonucleotide sequences of a pair of primers designed for PCR amplification of the tetL fragment. Sites for restriction endonucleases are highlighted.

1 2 3 4

Figure 3.6. PCR amplicon of the tetL fragment amplified from pDG1515 plasmid extract (lane 2 and 3); lane 1, 1-kb plus DNA ladder; and 4, negative control.

3.3.5 Restriction digestion of the vector pMSP3535 and the tetL fragment

The vector pMSP3535 was treated with BglII and NsiI to cleave the vector into two

DNA fragments. The larger fragment present on an agarose gel as an upper band of approximately 6.5 kb was the pMSP3535 backbone vector whose ermB-containing segment was cut out (Figure 3.7, lane 3). The excised, ermB-containing segment was present on the gel as a lower band which was 1.8 kb in size. The BglII- and NsiI- digested pMSP3535 contained two sticky ends, i.e. an overhanging single-stranded

5´ end generated by BglII and an overhanging single-stranded 3´end generated by

NsiI.

To generate compatible ends in the tetL fragment, the PCR-amplified tetL fragment was also treated with BglII and NsiI. BglII removed 10 nucleotides from the left end of the fragment, while NsiI excised 8 nucleotides from the right end. After the digestion, the original 1879-bp tetL fragment was shortened, yielding a 1861-bp tetL insert containing 5´ extension at the left end and 3´ extension at the right end (Figure

3.7, lane 8).

1 2 3 4 5 6 7 8

Figure 3.7. Gel electrophoresis of digestion products treated with BglII and NsiI. Lane 1, supercolied DNA ladder; lane 2, undigested pMSP35353; lane 3, BglII- and NsiI-digested pMSP3535; lane 4, BglII -digested pMSP3535; lane 5, NsiI-digested pMSP3535; lane 6, 1 kb plus DNA ladder; lane 7, undigested tetL fragment; lane 8, BglII- and NsiI-digested tetL insert.

3.3.6 Cloning of the tetL insert into pMSP3535 backbone vector

After the digestion reaction, the BglII- and NsiI-digested pMSP3535 backbone vector was separated from the ermB-containing segment by agarose gel electrophoresis and then purified using QIAquick gel extraction kit. The BglII- and NsiI-digested tetL insert was purified using QIAquick PCR purification kit to remove oligonuclotides.

Two individual purified DNAs were combined at molar ratios of 1:1, 3:1, and 6:1 insert:vector and then treated with T4 DNA Ligase. The products of the ligation mixtures were used to transform competent E. coli DH5α cells previously treated with calcium chloride to tetracycline resistance. A number of transformants were found on LB agar plates supplemented with 10 µg tetracycline/ml after the ligation products of the tetL insert and the pMSP3535 backbone vector were introduced to the competent cells, whereas no transformant was found from any control reactions containing either a single DNA species of pMPS3535 backbone vector, the tetL insert, or none of them (Table 3.3). These results reflect the success in cloning the tetL insert to pMSP3535 backbone vector.

The presence of the recombinant DNA was later confirmed by means of plasmid extraction and characterization. Agarose gel electrophoresis of plasmid extracts prepared from overnight cultures of Tetr E. coli transformants indicated the presence of plasmid DNA in the transformant cells (Figure 3.8A). An approximately 8.5- kb plasmid was detected from every transformants tested. The presence of the tetL gene

58 in the plasmid was determined by PCR amplification using a pair of primers, tetLF290 and tetLR. The PCR product amplified from all plasmid extracts appeared on an agarose gel as a band identical in size to that obtained from plasmid pDG1515, the original source of the tetL gene (Figure 3.8B). To confirm that the obtained plasmid is a pMSP3535 derivative harboring the tetL gene as selective marker, a purified plasmid was analyzed for its nucleotide sequence using fives different primers targeting tetL and its flanking sequences. A sequence of about 3200 nucleotides attested the presence of the entire tetL insert which was flanked by the sequences of pMSP3535.

A 1 2 3 4 5 6 7 8 B 1 2 3 4 5 6 7 8 9

Figure 3.8. Agarose gel electrophoresis of (A) plasmid extracts prepared from overnight cultures of Tetr E. coli transformants and (B) the tetL amplicon PCR- amplified from plasmid extracts. Lanes 1A, supercoiled DNA ladder; lane 1B, 1 kb plus DNA ladder;2A, pMSP3535 plasmid extract; lane 2B, pDG1515 plasmid extract; 3; 4; and 5, transformants obtained from the ligation mixture with a molar ratio of 1 tetL insert: 1 vector; Lanes 6 and 7, transformants obtained from the ligation mixture with a molar ratio of 3 tetL insert: 1 vector; Lane 8, a transformant obtained from the ligation mixture with a molar ratio of 6 tetL insert: 1 vector; Lane 9B, negative control for tetL PCR amplification. 59

Table 3.3. E. coli transformants obtained from the introduction of ligation products in CaCl2-treated competent cells

DNA component(s) in the Total DNA introduced Selective plate Dilution factor x CFU ligation mixture to competent cells Volume plated transformants (ng) /plate

1 tetL Insert: 1Vector a 32.2 LB + 10 µg/ml Tetb 100 x 0.1 ml 3, 6

3 tetL Insert: 1Vector a 46.3 LB + 10 µg/ml Tet 100 x 0.1 ml 1, 10

6 tetL Insert: 1Vector a 67.7 LB + 10 µg/ml Tet 100 x 0.1 ml 7

Vector (BglII- and NsiI- 25.0 LB + 10 µg/ml Tet 100 x 0.1 ml <1, <1 digested pMSP3535) [Background control]

60 0

tetL Insert 42.7 LB + 10 µg/ml Tet 10 x 0.1 ml <1, <1 (Background control)

No DNA 0.0 LB 100 x 0.1 ml Lawn of growth

LB + 10 µg/ml Tet 100 x 0.1 ml <1

BHI + 125 µg/ml Ermc 100 x 0.1 ml <1

6 ermB Insert: 1Vector 66.5 BHI + 125 µg/ml Erm 100 x 0.1 ml 24, 41 (Positive control for ligation)

Vector pMSP3535 (Positive 40 BHI + 125 µg/ml Erm 10-2 x 0.1 ml 83, 98 control for transformation)

a Molar ratio of insert to vector , b Tetracycline, c Erythromycin

The above results showed that the tetL insert was successfully cloned into the pMSP3535 backbone vector. The resulting vector named “pMSP3535TL” harbors the tetL gene functioning as a selective marker that confers tetracycline resistance to host cells to which the vector is introduced.

3.3.7 Functionality of pMSP3535TL in E. coli and gram-positive bacteria

The usefulness of the constructed vector, pMSP3535TL, was tested in E. coli and several gram-positive bacterial hosts. The purified vector was introduced first into competent E. coli DH5α cells treated with CaCl2 and showed its ability to transform the host cells to tetracycline resistance, with efficiency of 4.7 x 106 transformants/µg

DNA. The transformation efficiency obtained from pMSP3535TL was slightly higher than that obtained from the original vector pMSP3535 which could transform

E. coli DH5α cells to erythromycin resistance, with efficiency of 2.9 x 106 transformants/ µg DNA.

The ability of pMSP3535TL to transform gram-positive bacteria was determined in

Lactococcus lacis 2301, Enterococcus faecalis OG1RF, and Streptococcus mutans.

The vector was introduced by electroporation in L. lactis 2301 and E. faecalis

OG1RF; however, no transformant could be found from both hosts when selected for resistance to 10 µg tetracycline/ml. By contrast, when the original vector pMSP3535 was introduced into both hosts, transformants resistant to 10 µg/ml erythromycin

61 could be isolated with efficiency of 2.2 x 103 and 2.8 x 102 transformants/ µg DNA for L. lactis 2301 and E. faecalis OG1RF respectively. The vector pMSP3535 could also transform naturally competent S. mutans to erythromycin resistance with the transformation efficiency of 2.6 x 104 transformants/ µg DNA, whereas the constructed pMSP3535TL could not.

The vector pMSP3535TL constructed in this study can efficiently transform competent E. coli DH5α cells to tetracycline resistance, making them become selectable on selective agar media containing tetracycline. This result reflects that pMSP3535TL was already equipped with every element essential for the expression of the tetL gene. However, the vector could not transform gram-positive bacterial hosts to tetracycline resistance although the tetL gene has been proved to be able to express and confer resistance to a variety of gram-positive bacteria including L. lactis and E. faecalis (13, 20, 23). Above evidences together with ability of the original vector pMSP3535 to propagate in those gram-positive bacterial hosts lead to a hypothesis that the constructed vector may be deficient in any element vital for plasmid replication in gram-positive bacteria. After nucleotide sequences of pMSP3535TL and replication region in pMSP3535 were scrutinized, it was found that pMSP3535TL does not contain a promoter region, termed PDE. The promoter

PDE was reported to be an indispensable part of pAMβ1 replication region (7, 8) which is a replication element in pMSP3535, accounting for plasmid replication in gram-positive bacteria.

3.3.8 Construction of a pMSP3535 derivative harboring the tetL gene and

carrying the promoter PDE to support the plasmid replication in gram-

positive bacteria

The second DNA manipulation strategy was set up to prove the hypothesis that a pMSP3535 derivative which harbors the tetL insert and the promoter PDE should be able to propagate in gram-positive bacteria and transform them to tetracycline resistance and, certainly, to obtain a desired pMSP3535 derivative. In the second strategy (Figure 3.9), BglII and SnaBI were two restriction endonucleases used to remove 902 nucleotides containing a portion of the ermB gene as well as its promoter and upstream region from pMSP3535, whereas the promoter PDE was allowed to remain in pMSP3535. The excised part was subsequently displaced by the tetL insert each terminus of which was equipped with a site for either BglII or SnaBI.

Figure 3.9. Construction scheme II illustrates the second strategy employed to construct a pMSP3535 derivative

3.3.8.1 PCR amplification of the tetL fragment

In this strategy, a tetL fragment was amplified from the plasmid pDG1515 using a pair of primers, BglTetL-F/SnaTetL-R. The tetL fragment contains exactly the same nucleotide components as does the one used in the first strategy except for the NsiI site which is converted to SnaBI site by amplification with SnaTetL-R primer whose oligonuclotide sequence was illustrated in Figure 3.10. After PCR amplification, the PCR product was detected by agarose gel electrophoresis and present on a gel as a single bane of  1.8 kb which was the expected size for the tetL fragment, theoretically 1878 bp in size (Figure 3.11).

SnaBI SnaTelL-R 5’ CCCTCGTACGTAACGGTATCGATAAGC 3’

pDG1515 3’(2025) GGGAGCTCCAGCTGCCATAGCTATTCG (1999)5’

Figure 3.10. Oligonucleotide sequence of a reverse primer, SnaTetL-R designed for PCR amplification of the tetL fragment. The SnaBI site added to the amplified fragment is highlighted.

1 2 3 4

Figure 3.11. PCR amplicon of the tetL fragment amplified with BglTetL- F/SnaTetL-R primers. Lane 1, 1-kb plus DNA ladder; 2 and 3, tetL PCR products; and 4, negative control.

3.3.8.2 BglII and SnaBI restriction digestion of pMSP3535 and tetL fragment

The restriction digestion of the vector pMSP3535 was carried out to excise the portion of ermB gene, and therefore obtain the backbone vector pMSP3535.

When separated by agarose gel electrophoresis, the BglII- and SnaBI-digested pMSP3535 was present on a gel as a strong band of  7.4 kb, while the ermB fragment appeared below the vector band as a far weaker band of  0.9 kb (Figure

3.12). Both separated bands were then purified from the gel to make them ready for the later ligation reaction.

The amplified tetL fragment was also digested with BglII and SnaBI to generate a tetL insert whose termini were compatible with those of the backbone vector pMSP3535. In the course of restriction digestion, BglII worked on the left end of the tetL fragment by removing 10 nucleotides from anti-sense strand and 14 nucleotides from sense strand, resulting in the formation of a sticky end with 5´ extension at the left end. At the right end, SnaBI cut 9 nucleotides out from both strands and left a blunt end as a consequence. The tetL insert could be seen on an agarose gel as an approximately 1.8-kb band after gel electrophoresis (Figure

3.12).

1 2 3 4 5 6

Figure 3.12. Gel electrophoresis of digestion products treated with BglII and SnaBI. Lane 1, supercolied DNA ladder; lane 2, undigested pMSP35353; lane 3, BglII- and SnaBI-digested pMSP3535; lane 4, 1 kb plus DNA ladder; lane 5, undigested tetL fragment; lane 6, BglII- and NsiI-digested tetL insert.

3.3.8.3 Cloning of the tetL insert into BglII- and SnaBI-digested pMSP3535

Directional cloning of the tetL insert into the backbone vector pMSP3535 were carried out by introduction of the ligation products of both DNA components into

CaCl2-treated competent E. coli DH5α cells and selection for transformants resistant to 10 µg tetracycline/ml. A number of Tetr transformants could be isolated only when the ligation product of backbone vector pMSP3535 and the tetL insert was introduced into the competent cells. No transformant was found from the introduction of the ligation products prepared from each single DNA species. These results should reflect the success in cloning the tetL insert into the backbone vector pMSP3535. However, the agarose gel electrophoresis of plasmid 67 extracts revealed that although every single transformant carried at least one plasmid, none of them carried the desired plasmid approximately 9.3 kb in size

(Figure 3.13A). All plasmids found ranged in size from 3 to 5 kb. Despite their size was much smaller than that of expected vector, all isolated plasmids were found to carry the tetL gene whose PCR product amplified with tetL-F and tetL-R primers was present on an agrose gel as a band of 1 kb (Figure 3.13B).

The presence of a plasmid with  3-5 kb in size in every transformant and the presence of the tetL gene in every plasmid as well as the negative results obtained from the introduction of the ligation product of each single DNA species into the competent cells lead to a possibility that the constructed vector was subjected to

DNA deletion after introduced into the competent cells. To obtain more evidence to support this possibility, the product from the ligation reaction of two DNA species was analyzed by agarose gel electrophoresis. The result indicated that the tetL insert was already recombined into the backbone vector as present on the gel as a band located between 9 and 10 kb DNA ladder (Figure 3.14).

A 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

B 1 2 3 4 5 6 7 8 9 10 11 12

Figure 3.13. Agarose gel electrophoresis of (A) plasmid extracts. Lanes 1 and 14, 1 kb plus DNA ladder; 2 and 15, supercoiled DNA ladder; 3, plasmid pDG1515; 4 and 13, tetL insert; 5, ligation product of the tetL insert; 6-12, Tetr transformant no. 1-7. (B) tetL amplicon amplified from plasmid extracts. Lanes 1 and 12, 1 kb plus DNA ladder; 2, plasmid pDG1515; 3, the tetL insert; 4-10, Tetr transformant no. 1-7; 11, negative control for PCR reaction.

1 2 3 4 5 6 7 8

Figure 3.14. Agarose gel electrophoresis of ligation products. Lanes 1, 1 kb plus DNA ladder; 2 and 8, supercoiled DNA ladder; 3 and 4 ligation products of the tetL insert and the backbone vector pMSP3535; 5, ligation products of the vector; 6, the backbone vector pMSP3535; and 7, uncut pMSP3535.

The negative result obtained from the introduction of ligation product of the tetL insert points out that only by recombining with the backbone vector can the tetL insert propagate in the competent cells. However, how and why a portion of the recombinant DNA was deleted has still been unexplainable. It is possible that the size of the constructed vector is too large to be maintained in the E. coli cells. The cells probably have to already utilize much more energy than they do before to produce an efflux protein encoded by the tetL and to pump tetracycline out.

Therefore, to reduce the metabolic burden, the cells may process vector deletion to maintain only components essential for their survival under selective pressure.

Those components are definitely the tetL gene and possibly ColE1 replication region located 384-nucleotide upstream of BglII site of the recombinant DNA

(Figure 3.15). The entire DNA segment comprising the tetL gene, PnisA, and 70

ColE1 replication region is approximately 3.6 kb in size which is in the range of

plasmid sizes found.

Figure 3.15. A plasmid map of a pMSP3535 derivative expected as a result of 2nd construction strategy. DNA segment is possibly maintained in E. coli cells after transformation is indicated by rectangle.

3.3.9 DNA manipulation strategies to decrease the size of the constructed

vector and maintain the promoter PDE in the vector sequence.

Based on the above hypothesis about the size of the constructed vector, which may be too large to be maintained in the E. coli cells under the selective pressure, and the previous hypothesis about the promoter PDE, which may play a crucial role in ability of constructed vector to replicate in gram-positive bacterial hosts, two following

DNA manipulation strategies (3rd and 4th strategies) were set up to decrease the size

71 of the recombinant DNA as well as maintain the promoter PDE in its place, and therefore obtain a pMSP3535 derivative.

Since the tetL fragment was proved to function properly in the first strategy, extensive modification should not be made in this part. Therefore, the major approach to reduce the size of the constructed vector is to excise the longest segment as possible from the vector pMSP3535. However the excised portion must not include the promoter PDE. With these benchmarks in mind, after the principal elements located between BglII site and PDE promoter region were mapped in pMSP3535 as showed in Figure 3.16, two segments were designated to be removed from pMSP3535 for the construction of two different vectors. The first segment ranging from nucleotide 1 to 1179 mainly consisted of the entire ermB gene. This

DNA segment considered the longest portion of pMSP3535 could be excised without interrupting any principal elements besides the ermB gene.

The second segment, which also starts from nucleotide 1, was 1415 bp in size. This segment did not comprise only the entire ermB gene but also a portion of the copF gene including its promoter PF. The copF gene has been previously reported to be one of the major components of a negative regulation system for the control of plasmid copy number found in pAMβ1 replication region (14). However, it is not an indispensable element for plasmid replication. Moreover, the interruption of this gene has been found to boost the plasmid copy number up about ten times. Recently,

72 there has been a study succeeding in increase the copy number of pMSP3535 by interrupting the copF gene with an insert sequence to make the vector pMSP3535 becomes a better tool for highly level protein expression (12). In this study, the second segment was deliberately cut from pMSP3535 not only to minimize the size of the constructed vector, but also to take advantage of gene interruption to obtain a high copy number derivative of pMSP3535.

BglII 60 AGATCTGATCCGTAGCGGTTTTCAAAATTTGCAACCAGGAATGAATTACTATCCCTTTTA 120 TCAAGAAGCGCAAAAGAAAAACGAAATGATACACCAATCAGTGCAAAAAAAGATATAATG 180 GGAGATAAGACGGTTCGTGTTCGTGCTGACTTGCACCATATCATAAAAATCGAAACAGCA 240 AAGAATGGCGGAAACGTAAAAGAAGTTATGGAAATAAGACTTAGAAGCAAACTTAAGAGT 300 GTGTTGATAGTGCAGTATCTTAAAATTTTGTATAATAGGAATTGAAGTTAAATTAGATGC Start ermB 360 TAAAAATTTGTAATTAAGAAGGAGTGATTACATGAACAAAAATATAAAATATTCTCAAAA 420 CTTTTTAACGAGTGAAAAAGTACTCAACCAAATAATAAAACAATTGAATTTAAAAGAAAC 480 CGATACCGTTTACGAAATTGGAACAGGTAAAGGGCATTTAACGACGAAACTGGCTAAAAT 540 AAGTAAACAGGTAACGTCTATTGAATTAGACAGTCATCTATTCAACTTATCGTCAGAAAA 600 ATTAAAACTGAATACTCGTGTCACTTTAATTCACCAAGATATTCTACAGTTTCAATTCCC 660 TAACAAACAGAGGTATAAAATTGTTGGGAGTATTCCTTACCATTTAAGCACACAAATTAT 720 TAAAAAAGTGGTTTTTGAAAGCCATGCGTCTGACATCTATCTGATTGTTGAAGAAGGATT 780 CTACAAGCGTACCTTGGATATTCACCGAACACTAGGGTTGCTCTTGCACACTCAAGTCTC 840 GATTCAGCAATTGCTTAAGCTGCCAGCGGAATGCTTTCATCCTAAACCAAAAGTAAACAG 900 TGTCTTAATAAAACTTACCCGCCATACCACAGATGTTCCAGATAAATATTGGAAGCTATA Continued

Figure 3.16. Nucleotide sequence of a portion of the vector pMSP3535 73

Figure 3.16 continued 960 TACGTACTTTGTTTCAAAATGGGTCAATCGAGAATATCGTCAACTGTTTACTAAAAATCA 1020 GTTTCATCAAGCAATGAAACACGCCAAAGTAAACAATTTAAGTACCGTTACTTATGAGCA Stop ermB 1080 AGTATTGTCTATTTTTAATAGTTATCTATTATTTAACGGGAGGAAATAATTCTATGAGTC 1140 GCTTTTGTAAATTTGGAAAGTTACACGTTACTAAAGGGAATGTAGATAAATTATTAGGTA 1200 TACTACTGACAGCTTCCAAGGAGCTAAAGAGGTCCCTAGCGCTTAGAATCGCTTTAGGAA 1260 ACACGATCCAGTCCAATAATCGTCGATAAAAACTTTTGAAAAAGGTTGGTGAAATTACCT 1320 ACTTTTGGAATAATCACAAATCACAAGTGATTAATCACAAATCACAAGTGATTAATCACT PF 1380 TGTTTATTAAGATATTAAAAGCTATAATTTAAATAAAGCGTGAATTTTATTACACAAAAA Start copF HindIII 1440 GAGGGGGGAGAAACTTGGAACTAGCATTTAGAGAAAGCTTAAAAAAGATGAGAGGTACCA 1500 AATCAAAAGAAAAATTCTCCCAAGAATTAGAAATGAGTAGATCAAATTATTCACGAATAG 1560 AATCAGGAAAATCAGATCCAACCATAAAAACACTAGAACAAATTGCAAAGTTAACTAACT 1620 CAACGCTAGTAGTGGATTTAATCCCAAATGAGCCAACAGAACCAGAACCAGAAACAGAAT Stop copF CAGAACAAGTAACATTGGATTTAGAAATGGAAGAAGAAAAAAGCAATGACTTCGTGTGAA PDE 1740 TAATGCACGAAATCGTTGCTTATTTTTTTTTAAAAGCGGTATACTAGATATAACGAAACA TCT 1800 ACGAACTGAATAGAAACGAAAAAAGAGCCATGACACATTTATAAAATGTTTGACGACATT NisI 1860 TTATAAATGCATAGCCCGATAAGATTGCCAAACCAACGCTTATCAGTTAGTCAGATGAAC 1920 TCTTCCCTCGTAAGAAGTTATTTAATTAACTTTGTTTGAAGACGGTATATAACCGTACTA PCT 1980 TCATTATATAGGGAAATCAGAGAGTTTTCAAGTATCTAAGCTACTGAATTTAAGAATTGT 2040 TAAGCAATCAATCGGAAATCGTTTGATTGCTTTTTTTGTATTCATTTATAGAAGGTGGAG Start repD 2100 TTTGTATGAATCATGATGAATGTAAAACTTATATAAAAAATAGTTTATTGGAGATAAGAA 2160 AATTAGCAAATATCTATACACTAGAAACGTTTAAGAAAGAGTTAGAAAAGAGAAATATCT 2220 ACTTAGAAACAAAATCAGATAAGTATTTTTCTTCGGAGGGGGAAGATTATATATATAAGT

Due to the limitation of restriction sites located in the region of interest in pMSP3535, direct digestion of pMSP3535 with two restriction enzymes to excise the targeted segments could not be performed. Two construction strategies (Figure 3.17) developed afterwards were still relied on the excision of 1.8 kb segment containing the ermB gene, the copF gene, and PDE from the vector pMSP3535 by digesting the vector with BglII and NsiI as were two previous strategies. However, afterwards, a segment containing the intact copF gene and PDE was rejoined into the BglII- and

rd NsiI-digested pMSP3535 in the 3 strategy. Similarly, a segment containing PDE was recombined to the backbone vector in the 4th strategy.

The 3rd and 4th strategies were also greatly relied on the use of two pairs of primers.

The first pair of primers was used to amplify the tetL fragment from the vector pDG1515, while the second pair was used to amplify the 663-bp fragment from the vector pMSP3535. This fragment ranging from nucleotide 1171 to 1834 contained the entire copF gene and the promoter PDE (Figure 3.16 and 3.17). In the course of amplification, the designed primers also added a restriction site to each end of the amplified fragments. The first pair of primer added a BglII site to the left end of the tetL fragment and an EagI site to the right end (BglII-tetL-EagI). The other pair of primers was designed to add only an EagI site to the left end of the copF- and PDE- containing ragment, whereas a NsiI site was an indigenous restriction site located at the right end region of the fragment (EagI-copF-PDE-NsiI).

In the 3rd strategy, after fragment amplification, both DNA fragments were digested with EagI to generate a pair of compatible ends, i.e. the right end of the tetL fragment and the left end of the PDE-containing fragment. In the next step, two fragments each of which contained an EagI-digested end were linked together by activity of E. coli DNA Ligase. The combined fragment with a BglII site at the left end and the NsiI site at the right end (BglII-tetL-EagI-copF-PDE-NsiI) was subsequently amplified with a pair of primers, BglII forward primer/NsiI reverse primer, to maximize the amount of the recombinant DNA fragment. The amplified fragment as well as the vector pMSP3535 was then digested with BglII and NsiI to generate compatible ends. In the last step, the BglII- and NsiI-digested tetL insert would be cloned into the backbone vector pMSP3535 and then introduce into competent E. coli DH5α cells as done before to generate a derivative of pMSP3535.

4th Strategy

3rd Strategy

Figure 3.17. Construction scheme of the vector pMSP3535TLH and another expected pMSP3535

For the 4th strategy, nearly the same approach as above was applied. However, after fragment amplification, both DNA fragments were digested with HindIII instead of

EagI. This enzymatic approach could be done as a HindIII site is an indigenous restriction site in both tetL (Figure 3.2) and copF-and PDE-containing fragments

(Figure 3.16). The HindIII digestion removed only the EagI site along with 13 more nucleotides upstream of the EagI site from the right end of the tetL fragment (BglII- tetL-(HindIII)-EagI), while removed a far longer segment of 224 bp containing a portion of the copF gene and it promoter, PF, from left end of the copF-and PDE- containing fragment (EagI-copF-(HindIII)-PDE-NsiI). After that, the ligation reaction of both fragments carrying a compatible HindIII-digested site were carried out and followed by introduction of the ligation product into competent E. coli cells as mentioned before in the 3rd strategy.

3.3.9.1 Amplification of tetL and copF- and PDE-containing fragments

The 1874 bp tetL fragment was PCR amplified from the vector pDG1515 using a

primer set of BglTetL-F/EagTetL-R whose nucleotide sequences showed in

Figure 3.18A. The primer BglTel-F and EagTetL-R were designed to add a BglII

site to the left end and an EagI site to the right end of the fragment, respectively.

For the 663-bp copF-and PDE-containing fragment, it was amplified from the

vector pMSP3535 using the other primer set of EagCopP-F/CopP-R (Figure

3.18B). The amplified fragment, in which an indigenous site of NsiI was

78 endowed, was equipped with an EagI site at the right end by the aid of the primer

EagCopP-F. Agarose gel electrophoresis of PCR products demonstrated that both sets of designed primers worked effectively, and therefore the tetL and copF-and

PDE-containing fragments were amplified and present on a gel as  1.8-kb and

0.6-kb bands, respectively (Figure 3.19).

3.3.9.2 Restriction digestion and ligation of the tetL and copF-and PDE-

containing fragments

Restriction digestions were carried out to generate a homologous end at a

rd terminus of the tetL and copF-and PDE-containing fragments. For the 3 strategy,

EagI was used to generate a distinctive sticky end with 5´ extension at the right end of the tetL fragment and at the left end of the copF-and PDE-containing fragments. After the digestion reaction, two EagI-digested fragments were joined together by the activity of E.coli DNA Ligase. E. coli DNA Ligase was deliberately used for DNA ligation in this step in stead of T4 DNA Ligase to prevent blunt-end ligation which could lead to undesired arrangement of genes and elements of interest. The expected ligation product 2.5 kb in size was detected by agarose gel electrophoresis along with other products resulting from intermolecular ligation of either two EagI-digested tetL fragments or two EagI- digested, copF-and PDE-containing fragments (Figure 3.20).

A) A primer set for amplification of the 1874- bp tetL fragment from pDG1515 Forward primer:

BglII BglTetL-F 5' TTGTATGATAGATCTGACGAAAATGG 3’

pDG1515 3’(148) AACATACTAAAGTAACTGCTTTTACC (173)5’

Reverse primer: EagI EagTelL-R 5’ CGAGGTCGGCCGTATCGATAAGCTTG 3’

pDG1515 3’(2021) GCTCCAGCTGCCATAGCTATTCGAAC (1996)5’

B) A primer set for amplification of the 663-bp copF-and PDE-containing fragment from pMSP3535

Forward primer: EagI EagCopP-F 5’ GTCCCTCGGCCGTAGAATCGCTTTAGG 3’

pMSP3535 3’(1172) CAGGGATCGCGAATCTTAGCGAAATCC (1198)5’

Reverse primer:

CopP-R 5’ GGTTTGGCAATCTTATCGGGCTATG 3’

pMSP3535 3’(1834) CCAAACCGTTAGAATAGCCCGATACGTA (1810)5’ NsiI Figure 3.18. Oligonucleotide sequences of two primer sets designed for PCR amplification of (A) the tetL fragment and (B) the copF-and PDE-containing fragment. Restriction sites of BglII and EagI, added by designed primers into the fragments as well as an indigenous NsiI site in pMSP3535 are highlighted.

1 2 3 4 5 6 7 8

Figure 3.19. Agarose gel electrophoresis of PCR products. Lanes 1 and 5, 1 kb plus DNA ladder; 2 and 3, the tetL fragment amplified from pDG1515; 4 and 7 negative control for PCR reactions; 6 and 7, the copF-and PDE-containing fragment amplified from pMSP3535.

1 2 3 4

2.5-kb combining fragment

Figure 3.20. Agarose gel electrophoresis of ligation products resulting from ligation reaction of the EagI-digested tetL and EagI-digested, copF-and PDE- containing fragment. Lane 1, 1 kb plus DNA ladder; 2, ligation products of two EagI-digested fragments; 3, EagI-digested, copF-and PDE-containing fragments; and 4, EagI-digested tetL fragment.

For the 4th strategy, HindIII was used not only to generate two restriction fragments with homologous ends, but to shorten the copF-and PDE-containing fragment as well. After HindIII-digestion, 224-bp segment ranging from the left end to the HindIII site was cleaved from the 663-bp copF-and PDE-containing fragment. The excised segment consisted of a portion of the copF gene including its promoter, PF. The remaining fragment, referred to as HindIII-digested PDE- containing fragment, containing the promoter PDE was present on an agarose gel as a band 400 bp in size (Figure 3.21). The HindIII-digested tetL fragment whose right end was altered to a unique sticky end with 5´ extension was joined to

HindIII-digested PDE-containing fragment which had the identical sticky end at its left end. The ligation product about the size of 2.2 kb, termed tetL-PDE fragment, and the ligation product of  2.5-kb, termed tetL-copF-PDE fragment, obtained

rd from the 3 strategy would be cleaved with BglII and NsiI to generate tetL-PDE and tetL-copF-PDE inserts afterwards.

1 2 3 4 5 6 7

Figure 3.21. Agarose gel electrophoresis of PCR products after purified by QIAquick PCR purification kit. Lanes 1 and 4, 1 kb plus DNA ladder; 2, tetL fragment; 3, HindIII-digested tetL fragment; 5, copF-and PDE-containing fragment; 6, HindIII-digested PDE-containing fragment; and 7, supercoiled DNA ladder.

3.3.9.3 Insert fragment amplification

Before the tetL-copF-PDE and tetL-PDE fragments were subjected to BglII- and

NsiI-digestion, both fragments had been amplified with a pair of primers,

BglTetL-F and CopP-R, to increase the amount of both DNA species as well as to verify that they were the right fragments of interest. Theoretically, if these fragments are the correct ones, the primer BglTetL-F will attach to the left end of each fragments, which is the leftmost part of the tetL fragment and CopP-R will attach to the right end of each, which is the rightmost part of the copF-and PDE- containing fragment. Consequently, the PCR products whose size and nucleotide

83 sequence are identical to those of the tetL-copF-PDE and tetL-PDE fragments should be obtained. Agarose gel electrophoresis revealed that the PCR product amplified from the tetL-copF-PDE fragment is identical in size with the tetL-copF-

PDE fragment and the same result was found from PCR amplification of the tetL-

PDE fragment (Figure 3.22). These results reflect that the correct fragments were obtained.

1 2 3 4 5

Figure 3.22. Agarose gel electrophoresis of PCR products amplified from the tetL-copF-PDE fragment (lane 2) and the tetL-PDE fragment (lane 3). Lanes 1 and 4, 1 kb plus DNA ladder; and 5, negative control for PCR amplification.

3.3.9.4 BglII- and NsiI-digestion of insert fragments and fragment analysis

The 2515-bp tetL-copF-PDE and 2265 bp tetL-PDE fragments were subsequently digested with BglII and NsiI to generate tetL-copF-PDE and tetL-PDE inserts with two termini homologous to those BglII- and NsiI-digested pMSP3535. BglII altered the left end of each fragment to a sticky end with 5´ end extension and

NsiI converted the right end to a sticky end with 3´ extension. The resulting fragment obtained from BglII- and NsiI-digestion of the tetL-copF-PDE fragment was 2482 bp in size and termed “tetL-copF-PDE insert”. The resulting fragment of the tetL-PDE fragments has a shorter size of 2232 bp and was termed “tetL-PDE insert”. These inserts were later verified by restriction digestion. The tetL-copF-

PDE insert was fragmented by the activity of EagI into 2 segments present on an agarose gel as two bands about the size of the tetL fragment (1.8 kb) and of copF-and PDE-containing fragment ( 0.6 kb) (Figure 3.23). Two fragments were also detected on an agarose gel when the tetL-PDE insert was cleaved with HindIII.

The larger band was about the same size as the tetL fragment (1.8 kb) and the smaller one was about the size of the HindIII-digested PDE-containing fragment (

0.4 kb). Results obtained from restriction digestions confirm the presence of correct inserts.

1 2 3 4 5 6 7

Figure 3.23. Agarose gel electrophoresis of digestion products obtained from different digestion reactions. Lanes 1, 4, and 7, 1 kb plus DNA ladder; 2, BglII- and NsiI-digested tetL-PDE fragment (tetL-PDE insert); 3, HindIII-digested tetL-PDE insert; 5, BglII-and NsiI-digested tetL-copF-PDE fragment (tetL-copF-PDE insert); and 6, HindIII-digested tetL-copF-PDE insert.

3.3.9.5 Cloning of the tetL-containing inserts into the backbone vector

pMSP3535

Each of tetL-copF-PDE and tetL-PDE inserts was cloned into the backbone vector pMSP3535 whose segment containing the ermB gene, copF gene, and promoter,

PDE, site was previously removed by the activity of BglII and NsiI. The ligation product of each pairs of DNAs species was introduced into competent E. coli

DH5α by electroporation. Resulting transformants were selected for resistance to

5 µg tetracycline/ml on LB agar plates. The number of transformants resistant to tetracycline could be isolated from both cloning systems. However, results

86 obtained from plasmid extraction revealed that only from the cloning of the tetL-

PDE insert into the backbone vector pMSP3535 was recombinant DNAs with the correct size detected. Those recombinant DNAs present on an agarose gel were about the same size as expected vector (8.7 kb), whereas the recombinant DNAs from the cloning of the tetL-copF-PDE insert varied in size from 3.5 to 5 kb which were obviously smaller than the size of expected vector (9.0 kb) (Figure

3.24).

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

Figure 3.24. Agarose gel electrophoresis of plasmid extracts prepared from overnight cultures of different Tetr transformants. Lanes 1 and 15, 1 kb plus DNA ladder; 2, 8, and 14, supercoiled DNA ladder; 3-6, transformants obtained from the ligation product of the tetL-copF-PDE insert and the backbone vector pMSP3535; 7, vector pDG1515; 9-11, transformants obtained from the ligation product of the tetL-PDE insert and the backbone vector; 12, vector pMSP3535TL; 13, vector pMSP3535.

The recombinant DNAs were further examined to verify whether they are the correct vector. The plasmid extracts were used as DNA templates for PCR amplification of either tetL-copF-PDE or tetL-PDE insert using BglTetL-F and

CopP-R primers. The presence of tetL-PDE insert amplicon about the size of 2.2 kb (Figure 3.25) when plasmid extracts obtained from the cloning of the tetL-PDE insert were used as DNA templates pointed out that the recombinant DNAs harbor the tetL-PDE insert, and therefore they should be the desired vectors. By contrast, no PCR amplicon could be detected from the plasmid extracts of the tetL-copF-

PDE insert system. This result reflected that the recombinant DNAs were not made up of the entire tetL-copF-PDE insert.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

Figure 3.25. Agarose gel electrophoresis of tetL-containing amplicon amplified from different plasmid extracts and DNA fragments. Lanes 1,12, and 17, 1 kb plus DNA ladder; 2, the tetL-PDE fragment (positive control); and 3-6, transformants obtained from the ligation product of the tetL-PDE insert and the backbone vector pMSP3535; 7, tetL-copF-PDE fragment(Positive control); 8-11, transformants obtained from the ligation product of the tetL-copF-PDE insert and the backbone vector; 13, vector pMSP3535TL; 14, vector pDG1515; 16, vector pMSP3535; and 17, negative control for PCR reaction. 88

The recombinant DNAs were also verified by restriction digestion with HindIII.

Theoretically, HindIII cuts the recombinant DNA composed of the backbone vector pMSP3535 and tetL-PDE insert twice and generates two DNA fragments of

 2.0 and 6.8 kb as a result. Agarose gel electrophoresis of digestion products revealed that almost all recombinant DNAs from the tetL-PDE insert system were fragmented into two segments with the expected sizes (Figure 3.26A). This result is the other strong evidence to prove that the desired vector containing the tetL-

PDE insert was successfully constructed. In contrast, no expected fragment could be found from the recombinant DNAs of the tetL-copF-PDE insert system (Figure

3.26B). If a recombinant DNA is the correct vector, HindIII will cleave it at three different sites; therefore, 3 DNA segments about the size of 0.3, 2.0, and 6.8 kb should be detected from the digestion product.

All above results as well as nucleotide sequencing confirm that the recombinant

DNA obtained from the cloning of the tetL-PDE insert into the backbone vector pMSP3535 is the expected vector. This constructed vector, named pMSP3535TLH, is approximately 8.7 kb in size and harbors the tetL gene as a selective marker. The vector also carries the intact promoter PDE which should enable the vector replication in gram-positive bacterial hosts. Moreover, due to carrying only a portion of the copF gene, the constructed vector should propagate in a host cell with a higher copy number as compared to that of the original vector pMSP3535.

A 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

B 1 2 3 4 5 6 7 8

Figure 3.26. Agarose gel electrophoresis of digestion products obtained from the digestion of different recombinant DNAs with HindIII. (A) Recombinant DNAs obtained from cloning the tetL-PDE insert into the backbone vector pMSP353. Lanes 1 and 17; supercoiled DNA ladder; 2, 11,and 16, 1 kb plus DNA ladder; 3, 5, and 7, HindIII-digested recombinant DNAs; 4, 6, and 8, corresponding undigested recombinant DNAs; 9 and 10, HindIII-digested and undigested pMSP3535; 12 and 13, HindIII-digested and undigested pMSP3535TL; 14 and 15; HindIII-digested and undigested pDG1515. (B) Recombinant DNAs obtained from cloning the tetL-copF-PDE insert into the backbone vector. Lanes 1, 1 kb plus DNA ladder; 2, 4, and 6, HindIII-digested recombinant DNAs; 3, 5, and 7, corresponding undigested recombinant DNAs; and 8, supercoiled DNA ladder.

3.3.10 Introduction of a constructed vector into gram-positive bacteria

The vector, pMSP3535TLH, was engineered to overcome the major disadvantage of the first constructed vector, pMSP3535TL, which cannot transform gram-positive bacterial hosts to tetracycline resistance. Equipped with the promoter PDE, the vector pMSP3535TLH should favor the transformation of gram-positive bacteria. The ability of the vector pMSP3535TLH to transform gram-positive bacteria was tested in E. faecalis OG1RF and L. lactis 2301 as described in the following parts.

3.3.10.1 Transformation of E. faecalis OG1RF

The vector pMSP3535TLH was introduced into competent E. faecalis OG1RF by

eletroporation. The number of transformants resistant to 10 µg tetracycline/ml

could be isolated on selective THB agar plates after 12 hr of incubation at 37oC.

The presence of the vector pMSP3535TLH in the transformed cells was

subsequently examined by means of plasmid extraction followed by restriction

digestion. The plasmid profiles present on an agarose gel revealed the existence of

the vector pMSP3535TLH in the E. faecalis transformants (Figure 3.27). The

supercoiled vector pMSP3535TLH extracted from the E. faecalis transformants

was present on the gel as a band of  8.5 kb which was located at the same

position as that of the control pMSP3535TLH vector extracted from an E. coli

transformant. However, there were several bands present on the analytical gel.

Extra bands located above the supercoiled band were possibly open circular and dimer forms of the vector.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17

Figure 3.27. Agarose gel electrophoresis of plasmid extracts obtained from different E. faecalis transformants (lanes 2-7) and their digestion products cleaved by HindIII (lanes 10-15). Lanes 1 and 8, supercoiled DNA ladder; 9 and 16, 1 kb plus DNA ladder; 2 and 10, vector pMSP3535TLH no. 1 extracted from an E. coli tranasformant and its digestion products; 3-4 and 11-12, plasmid extracts of Tetr E. faecalis transformants transformed by vector pMSP3535TLH no. 1 and their digestion products; 5 and 13, vector pMSP3535TLH no. 2 extracted from an E. coli tranasformant and its digestion products; 6-7 and 14-15, plasmid extracts of Tetr E. faecalis transformants transformed by vector pMSP3535TLH no. 2 and their digestion products; and 17, negative control for restriction digestion.

The presence of the supercoiled and other forms of the vector in E. faecalis transformants was later confirmed by restriction digestion and insert fragment amplification. On an analytical gel, products obtained from digesting plasmid extracts of E. faecalis transformants with HindIII yielded two defined bands identical in size to those obtained from the control vector pMSP3535TLH (Figure

2.27). Those plasmid extracts also yielded a single band the size of tetL-PDE insert

92 fragment on the agarose gel (Figure 2.28) after amplified with a primer set of

BglTetL-F/CopP-R specifically designed for the insert fragment amplification.

These results testify that the vector pMSP3535TLH was successfully introduced into electro-competent E. faecalis OG1RF and able to reproduce itself in the host cells, and thereby transformed the cells to tetracycline resistance.

1 2 3 4 5 6 7 8 9 10 11

Figure 3.28. Agarose gel electrophoresis of tetL amplicon amplified from plasmid extracts of different E. faecalis transformants. Lanes 1, and 11, 1 kb plus DNA ladder; 2 vector pMSP3535TLH no. 1; 3, and 4, Tetr E. faecalis transformants transformed by vector pMSP3535TLH no. 1; 5, vector pMSP3535TLH no. 2; 6 and 7, Tetr E. faecalis transformants transformed by vector pMSP3535TLH no. 2; 8, vector pMSP3535; 9 and 10, Emr E. faecalis transformants transformed by vector pMSP3535.

3.3.10.2 Transformation of L. lactis 2301

The second gram-positive bacterial host tested for the transformation capability of

the constructed vector pMSP3535TLH was L. lactis 2301. The vector was

introduced into competent L. lactis cells by electroporation. Transformants

resistant to tetracycline were screened on selective M17G agar plates containing

10 µg tetracycline /ml. After 72-120 hr of the incubation at 30oC, a number of Tetr

transformants could be isolated. The existence of the vector pMSP3535TLH in

those transformed cells was subsequently examined. Plasmid extracts of L. lactis

Tetr transformants yielded a visible band not about the size of control supercoiled

vector pMSP35353TLH but about the size of 11 kb supercoiled DNA (Figure

3.29). This band should represent the open circular form of pMSP3535TLH and

should not be mistaken for genomic DNA since plasmid extracts obtained from

Emr transformants (Figure 3.29, lanes 10 and 11) transformed by the vector

pMSP35353 also yielded the similar result. Moreover, when used as DNA

templates for amplification of the tetL-PDE insert fragment using two specific

primers, BglTetL-F and CopP-R, those plasmid extracts gave an expected band

the same size as that of the tetL-PDE insert on the analytical gel (Figure 3.30). All

above results should be strong enough evidences to support the fact that

pMSP3535TLH is capable of transforming the competent L. lacis 2301 to

tetracycline resistance.

1 2 3 4 5 6 7 8 9 10 11 12 13

Figure 3.29. Agarose gel electrophoresis of plasmid extracts obtained from different L. lactis transformants. Lanes 1, 2 and 12, supercoiled DNA ladder; 3, vector pMSP3535TLH extracted from an E. coli transfromant; 4-8, plasmids from Tetr L. lactis transformants transformed by vector pMSP3535TLH; 9, vector pMSP3535 extracted from an E. coli transfromant; 10 and 11, Emr L. lactis transformants transformed by vector pMSP3535; and 13, 1 kb plus DNA ladder.

1 2 3 4 5 6 7 8 9 10 11 12 13 14

Figure 3.30. Agarose gel electrophoresis of tetL amplicon amplified from plasmid extracts of different L. lactis transformants. Lanes 1, and 9, 1 kb plus DNA ladder; 2 and 10, vector pMSP3535TLH no. 1; 3-6, Tetr L. lactis transformants transformed by vector pMSP3535TLH no. 1; 7, a Tetr L. lactis transformant transformed by vector pMSP3535TLH no. 2; 8 and 14, negative control for tetL PCR amplification; 11, vector pMSP3535; 12 and 13, Emr L. lactis transformants transformed by vector pMSP3535.

The drawback of the previously constructed vector pMSP3535TL which can transform only E. coli host cells to tetracycline resistant but not gram-positive bacterial hosts was eventually overcome in the later constructed vector pMSP3535TLH. The vector pMSP3535TLH is equipped with the promoter PDE when its size is kept minimized. These strategies render the vector pMSP3535TLH possible to reproduce and be maintained in gram-positive bacteria, and therefore be able to transforms them to tetracycline resistance.

3.4 Conclusion and Future Development

Since vector pMSP3535 was revolutionarily constructed to serve as a single vector

system for driving nisin-controlled expression (NICE), it has been used for inducible

expression of many different homologous and heterologous genes in a wide variety of

gram-positive bacteria (4, 5, 6, 9, 12, 19). Its growing in popularity reflects its efficiency

and versatility. In this work, attempts have been made to construct a pMSP3535

derivative which still maintains several useful features of pMPS3535, including (a) the

NICE system containing the nisA promoter and two members (nisRK) of a two-

component regulatory system, (b) a multiple cloning site for both blunt-end or sticky-end

generating restriction endonucleases, and (c) two replication regions, i.e. ColE1 and

pAMβ1 replicons, which allows the plasmid to replicate in E. coli and a wide range of

gram-positive bacteria. A major modification made to pMSP3535 is the replacement of a

selectable marker from an erythromycin resistance gene (ermB) to a tetracycline

resistance gene (tetL). This modification generates an alternative vector for driving nisin-

inducible expression in host strains already resistant to erythromycin. Moreover, the tetL-

containing vector may be used in combination with another compatible plasmid carrying

a different selectable maker for simultaneous driving of the NICE system.

Based on indigenous restriction sites present in pMSP3535 sequence, two strategies were

used for the replacement of the ermB gene with the tetL gene. The first strategy is to use

BglII and NsiI for the excision of 1.81 kb DNA fragment containing the entire ermB gene along with its 329 bp upstream and 737 bp downstream regions. Based upon this strategy, the size of excised fragment is almost identical to that of the tetL fragment

(1.86 kb); therefore, the modified plasmid should load nearly the same energy burden to hosts as dose pMSP3535 and consequently should be maintained in hosts as is pMSP3535. To enable ligation reaction, a primer set of BglTetL-F/NsiTetL-R was used to PCR amplify the tetL fragment containing structural tetL gene along with its upstream promoter and downstream Rho-independent transcriptional terminator from the plasmid pDG1515 (11) and also introduced Bg1II and NsiI sites to either 5´ or 3´ end of the fragment. The amplified tetL fragment was then cleaved with BglII and NsiI to generate the tetL insert which was cloned into BglII- and NsiI-digested pMSP3535 afterwards. The ligation mixture was used to transform CaCl2-induced competent E. coli DH5α and transformants harboring the contracted vector were selected on LB agar plates supplemented with 10 µg tetracycline/ml.

The first implemented strategy succeeded in replacing the ermB gene with the tetL gene.

The modified vector with expected size was extracted form an E. coli transformant growing on a tetracycline-containing plate. The presence of the tetL in pMSP3535 backbone was confirmed by both PCR amplification and nucleotide sequencing. After plasmid purification, the modified vector, named pMSP3535TL, efficiently transformed the competent E. coli DH5α to tetracycline resistance with transformation efficiency of

4.7 x 106 transformants/ µg DNA which was slightly higher than that of pMSP3535 (2.9 x 106 transformants/ µg DNA).

Although the modified vector, pMSP3535TL, successfully transformed E. coli DH5α, it could not transform L. lactis 2301, E. faecalis OG1RF , and S. mutans to tetracycline resistance, whereas the pMSP3535 could transform all of them into erythromycin resistance with the efficiency of 2.2 x 103, 2.8 x 102, and 2.6 x 104 transformants/ µg

DNA, respectively. The possibility that the tetL gene is unable to express in these gram- positive bacterial hosts is excluded since this gene originates from gram-positive S. agalactiae plasmid pLS1 (11) and was reported to be able to confer tetracycline resistance to L. lactis, E. faecalis, and B. subtilis (13, 20). A hypothesis that “some elements essential for driving the replication of pMSP3535TL in gram-positive bacterial hosts may be excised from the pAMβ1 replication region simultaneously with the removal of the ermB gene” was drawn. This hypothesis is supported by nucleotide sequence alignments of replication region of plasmid pAMβ1, pMSP3535, and pMSP3535LT. The sequence alignments revealed that pMSP3535 does not contain only repE gene and ORF D as reported in GeneBank (GeneBank number: AY303239.1) but also other seven functional elements, i.e. copF gene, three promoters, and three terminators, all of which located upstream of ORF D (Figure 3.31) (14, 15). Of the seven elements, only a Rho-independent promoter, termed PDE, is essential for pAMβ1 replication. At this promoter, transcription through the origin which is a rate-limiting step for pAMβ1 replication is initiated (8, 16). In contrast to PDE, the other six elements are 99 not required for the replication. However, each of them has its own function involved in negative regulation of plasmid copy number. The copF gene, encoding a repressor protein (CopF), along with its promoter (PF) and terminator (TF) are responsible for repression of plasmid copy number (14). A remaining promoter (PCT) and two terminators (TCT and TDE) works together to drive a countertranscript-driven attenuation system which is the other independent negative regulatory system for the control of pAMβ1 copy number (15).

copy control region region replication region ori PF TF PDE TDE CopF D Rep E F

TCT PCT

NsiI

Figure 3.31: Schematic diagram of the pAMβ1 replication region (14)

Whereas the original vector pMSP3535 contains the entire copy control region in which all above seven elements are located, the modified vector pMSP3535TL contains only a region downstream of TCT. The absence of any element, except PDE, in the copy control region should not lead to the incapability of pMSP3535TL to transform gram-positive bacterial hosts, by contrast, previous studies showed that mutation or deletion in either

100 the regulatory region increased 10-fold the transcription initiated at PDE and consequently dramatically increases plasmid copy number (14, 15). Moreover, the alteration of the copy control region was deliberately performed in pMSP3535 to increase its copy number, in consequence, higher level of protein expression was obtained (12,

19).

Results obtained from the second strategy used for the ermB gene replacement should provide a strong proof for the hypothesis about the consequence of lacking the promoter

PDE on the incapability of pMPS3535TL to transform gram-positive bacterial hosts. This strategy involves the use of BglII and SnaBI to excise a 0.9-kp DNA fragment containing upstream region and a part of the ermB gene from pMSP3535. Based upon this strategy, the complete pAMβ1 copy control region including PDE is maintained in BglII-and

SnaBI-digested pMSP3535. The backbone pMSP3535 was joined with a 1.86-kb tetL insert whose nucleotide sequence almost identical to that of the tetL insert used in the first strategy expect for a restriction site at the 3´ end which was altered from NsiI to

SnaBI site. After ligation and transformation reaction were carried out, the second modified plasmid should be buried in any transformant resistant to tetracycline.

Unfortunately, no desired vector with an expected size of  9.3 kb was obtained.

Although, a certain number of E. coli transformants were found and all of them harbor at least one recombinant DNA, none of them maintains the desired vector in their cells.

Those detected recombinant DNAs were hypothesized to be deletion mutants of the

101 constructed vector. This hypothesis was formed based on the fact that (1) size of the recombinant DNA ranging from 3 to 5 kb is far smaller than that of the expected vector but about the size of a vector segment ( 3.6 kb) composed of the tetL gene, PnisA, and

ColE1 replication region, (2) those recombinant DNAs are made up of the functional tetL gene whose existence was confirmed by PCR amplification and (3) no Tetr transformant can be isolated when the ligation products of a single tetL insert species was introduced into the competent cells. Therefore, only the tetL insert embraced with the backbone vector pMSP3535 should be incorporated into the host cells and then, somehow, some dispensable sequences of the original recombinant DNA was deleted to lower energy burden loaded to the cells which had already utilized considerable amount of energy to produce an efflux protein and pump tetracycline out. The size of the recombinant DNA was suspected to be a major cause of deletion mutation. Consequently, the other two construction strategies were developed to minimize the size of the recombinant DNA as well as equip the constructed vector with the promoter PDE.

Both of later developed strategies relied on the use of two primer sets to generate the shortest insert fragments principally comprise the tetL gene and promoter PDE. The first primer set of BglTetL-F/EagTetL-R was used to amplify a tetL fragment from the vector pDG1515. The resulting fragment was nearly identical in nucleotide sequence to the tetL fragment successfully used to construct pMSP3535TL except for the NsiI site at the right end of the fragment that was converted to EagI site to enable the future ligation. The

102 other set of primers, EagCopP-F/CopP-R was employed to amplify a copF-and PDE- containing fragment from the vector pMSP3535. This fragment basically consisted of

EagI site, copP gene, and promoter PDE, ranging from the left end to the right end of the fragment.

rd In the 3 strategy, both tetL and copF-and PDE-containing fragments were cleaved with

EagI to generate a homologous terminus at the right end of the tetL insert and the left end of the copF-and PDE-containing fragment. Two restriction fragments with a homologous end were subsequently joined together to generate the tetL-copF-PDE fragment about the size of 2.5 kb. This combining fragment was digested with BglII and NsiI and cloned into

BglII-and NsiI-digested pMSP3535 later on. Based on this strategy, a recombinant DNA approximately 9.0 kb in size should be obtained. Although the constructed vector is only

 0.3 kb smaller than the one expected from the 2nd strategy ( 9.3 kb) and still larger than the vector pMSP3535TL ( 8.4 kb), this vector could be considered the smallest recombinant DNA when any of the functional elements besides the ermB gene was in need. After the ligation products were introduced into the competent E. coli DH5α cells by electroporation, a number of transformants could be isolated on selective LB plates containing 10 µg tetracycline/ml. However, the similar result as found in the 2nd strategy was obtained. All of the Tetr transformants harbored a recombinant DNA but none of them carried the expected vector. This result raises the possibility of deletion mutation of the constructed vector inside E. coli cells.

103

An attempt to construct a smaller vector was made in the 4th strategy. The size of the constructed plasmid could be reduced from 9.0 to 8.7 kb by the removal of a segment of the copF gene including its promoter PF from the tetL-copF-PDE fragment. To achiever this goal, both tetL and tetL-copF-PDE fragments were digested with HindIII rather than

EagI. HindIII cleaved the tetL-copF-PDE fragment at its indigenous site located 20 bp downstream of copF start codon, and consequently fragmented the 663 bp fragment into two segment of 419 and 244 bp. The larger segment containing the promoter PDE was joined to the tetL fragment previously digested with HindIII whose restriction site was naturally present around the left end region of the tetL fragment. The resulting fragment 

2.2 kb in size, termed tetL-PDE fragment, was successfully cloned into the backbone vector pMSP3535 after both DNA species were digested with BglII and NsiI.

Electroporation of ligation products into competent E. coli cells yielded a number of transformants resistant to 10 µg tetracycline/ml, all of which buried the desired vector inside their cells. The existence of the correct vector was subsequently examined by means of size observation, restriction digestion, tetL insert amplification, and finally nucleotide sequencing. All detection methods used revealed a corresponding result that a derivative of pMSP3535 was successfully constructed. The constructed vector approximately 8.7 kb in size, named pMSP3535TLH, carries the tetL gene as a selective marker and the intact promoter PDE as a key element to enable plasmid replication in gram-positive bacteria. The vector is also made up of the interrupted copF gene which should allow the vector to be present in gram-positive bacterial hosts at a higher copy number as compared to the original vector pMSP3535. The usefulness of the constructed

104 vector to the applications in gram-positive bacteria was tested. The vector pMSP3535TLH showed its capability to transform E. faecalis OG1RF and L. lacis 2301 to tetracycline resistance and be maintained in those gram-positive bacterial hosts.

Therefore, the vector pMSP3535TLH should be a promising tool for inducible gene expression in gram-positive bacteria.

Further attempt should be made to evaluate efficiency of the vector pMSP3535T. The vector should be introduced into a wide variety of gram-positive and gram-negative bacterial hosts such as Bacilli, Lactobacilli, Streptococci, and Clostridium to examine the host range. In each transformable host, transformation efficiency, segregational and structural stability as well as plasmid copy number should be evaluated and probably compared to those of the vector pMSP3535. Moreover, as a controllable gene expression vector, the capability of the vector to control the expression of a gene of interest should also be determined.

Changing in the selective marker form an antibiotic resistance gene to a food grade marker should be taken into account for the future development so that the vector will be recognized as a safer genetic tool for the application in food. The other interesting improvement is the alteration of the copy number region of pAMβ1 replication region to obtain an expression vector that supports high level protein expression.

105

Bibliography

1. Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. Journal of molecular biology. 215: 403-410.

2. Alting-Mees, M.A. and J.M. Short. 1989. pBluescript II: gene mapping vectors. Nucleic acids research. 17: 9494.

3. Anderson, D.G., and L.L. McKay. 1983. Simple and rapid method for isolating large plasmid DNA from Lactic Streptococci. Applied and Environmental Microbiology. 46:549-552.

4. Benachour, A., C. Muller, M. Dabrowski-Coton, Y.L. Breton, J.-C. Giard, A. Rince´, Y. Auffray, and A. Hartke. 2005. The enterococcus faecalis sigv protein is an extracytoplasmic function sigma factor contributing to survival following heat, acid, and ethanol treatments. Journal of bacteriology. 187: 1022-1035.

5. Bensing, B. A., J.A. López, and P.M. Sullam. 2004. The Streptococcus gordonii surface proteins GspB and Hsa mediate binding to sialylated carbohydrate epitopes on the platelet membrane glycoprotein Ib . Infection and immunity. 72: 6528- 6537.

6. Bensing, B. A., and P.M. Sullam. 2009. Characterization of Streptococcus gordonii SecA2 as a paralogue of SecA. Journal of bacteriology. 191: 3482-3491.

7. Bidnenko, V., S.D. Ehrlich, and L. Jannière. 1998. In vivo relations between pAMβ-encoded type I topoisomerase and plasmid replication. Molecular microbiology. 28: 1005-1016.

8. Bruand, C., and S.D. Ehrlich. 1998. Transcription-driven DNA replication of plasmid pAMβ1 in Bacillus subtilis. Molecular microbiology. 30: 135-145.

106

9. Desmond, C., G. F. Fitzgerald, C. Stanton, and R. P. Ross. 2004. Improved stress tolerance of GroESL-overproducing Lactococcus lactis and probiotic Lactobacillus paracasei NFBC 338. Applied and environmental microbiology. 70: 5929-5936.

10. Dunny, G.M., L.N. Lee, and D. J. LEBlanc. 1991. Improved Electroporation and cloning vector system for gram-positive bacteria. Applied and environmental microbiology. 57: 1194-1201.

11. Guérout-Fleury, A-M., K. Shazand, N. Frandsen, and P. Stragier. 1995. Antibiotic-resistance cassettes for Bacillus subtilis. Gene. 167: 335-336.

12. Kim, J-H., and D.A. Mills. 2007. Improvement of a nisin-inducible expression vector for use in lactic acid bacteria. Plasmid. 58: 275-283.

13. Lacks, S.A., P. Lopez, B. Greenberg, and M. Espinosa. 1986. Identification and analysis of genes for tetracycline resistance and replication functions in the broad- host-range plasmid PLS1. Journal of molecular biology. 192: 753-765.

14. Le Chatelier, E., S.D. Ehrlich, and L. Jannière. 1994. The pAMβ1 CopF repressor regulates plasmid copy number by controlling transcription of the repE gene. Molecular microbiology. 14: 463-471.

15. Le Chatelier, E., S.D. Ehrlich, and L. Jannière. 1996. Countertranscript-driven attenuation system of the pAMβ1 repE gene. Molecular microbiology. 20: 1099- 1112.

16. Le Chatelier, E., L. Jannière, S.D. Ehrlich, and D. Canceill. 2001. The RepE initiator is a double-stranded and single-stranded DNA-binding protein that form atypical open complex at the onset of replication of plasmid pAMβ1 from gram- positive bacteria. The journal of biological chemistry. 276: 10234-10246.

17. McIntyre, D.A., and S.K. Harlander. 1989a. Genetic transformation of intact Lactococcus lactis supsp. lactis by high-voltage electroporation. Applied and environmental microbiology. 55: 604-610.

18. McIntyre, D.A., and S.K. Harlander. 1989b. Improved electroporation efficiency of intact Lactococcus lactis supsp. lactis cells grown in defined media. Applied and environmental microbiology. 55: 2621-2626.

19. Oddone, G.M., D.A. Mills, and D. E. Block. 2009. Incorporation of nisI-mediated nisin immunity improves vector-based nisin-controlled gene expression in lactic acid bacteria. Plasmid. 61: 151-158.

107

20. Platteeuw C., F. Michiels, H. Joos, J. Seurinck, and W.M. de Vos. 1995. Characterization and heterologous expression of the tetL gene and identification of iso-ISS1 elements from Enterococcusfaecalis plasmid pJH1. Gene. 160: 89-93.

21. Sambrook, J., and D.W. Russell. 2006. Preparation and transformation of competent E. coli using calcium chloride. Cold Spring Harbor Protocols. doi: 10.1101/pdb.prot3932.

22. Sambrook, J., and D.W. Russell. 2006. Transformation of E. coli by Electroporation. Cold Spring Harbor Protocols. doi: 10.1101/pdb.prot3933.

23. Suwannakham, S., Y. Huang, and S.-T. Yang. 2006. Construction and characterization of ack knock-out mutants of Propionibacterium acidipropionici for enhanced propionic acid fermentation. Biotechnology and bioengineering. 94: 383- 395.

24. Wang, H., M. Manuzon, M. Lehman, K. Wan, H. Luo, T. Wittum, A. Yousef, and L. Bakaletz. 2006. Food commensal microbes as a potentially important avenue in transmitting antibiotic resistance genes. FEMS microbiology letters. 254: 226-231.

108

Complete Bibliography

Actis, L.A., M. E. Tolmasky, and J.H. Crosa. 1999. Bacterial plasmids: replication of extrachromosomal genetic elements encoding resistance to antimicrobial componds. Frontiers in bioscience. 4: d43-62.

Altschul, S. F., W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment search tool. Journal of molecular biology. 215: 403-410.

Alting-Mees, M.A. and J.M. Short. 1989. pBluescript II: gene mapping vectors. Nucleic acids research. 17: 9494.

Anderson, D.G., and L.L. McKay. 1983. Simple and rapid method for isolating large plasmid DNA from Lactic Streptococci. Applied and Environmental Microbiology. 46:549-552.

Benachour, A., C. Muller, M. Dabrowski-Coton, Y.L. Breton, J.-C. Giard, A. Rince´, Y. Auffray, and A. Hartke. 2005. The enterococcus faecalis sigv protein is an extracytoplasmic function sigma factor contributing to survival following heat, acid, and ethanol treatments. Journal of bacteriology. 187: 1022-1035.

Bensing, B. A., J.A. López, and P.M. Sullam. 2004. The Streptococcus gordonii surface proteins GspB and Hsa mediate binding to sialylated carbohydrate epitopes on the platelet membrane glycoprotein Ib . Infection and immunity. 72: 6528-6537.

Bensing, B. A., and P.M. Sullam. 2009. Characterization of Streptococcus gordonii SecA2 as a paralogue of SecA. Journal of bacteriology. 191: 3482-3491.

Bidnenko, V., S.D. Ehrlich, and L. Jannière. 1998. In vivo relations between pAMβ- encoded type I topoisomerase and plasmid replication. Molecular microbiology. 28: 1005-1016.

Bongers, R.S., J.W. Veening, M. Van Wieringen, O.P. Krupers, and M. Kleerebezem. 2005. Development and characterization of a subtilin-regulated expression system in Bacillus subtilis: Strict control of gene expression by addition of subtilin. Applied and environmental microbiology. 71: 8818-8824.

109

Brehm J., G. Salmond, and N. Minton. 1987. Sequence of the adenine methylase gene of the Streptococcus faecalis plasmid pAM. Nucleic acid research. 15: 3177.

Bruand, C., S.D. Ehrlich, and L. Jannière. 1991. Unidirectional theta replication of the structurally stable Enterococcus faecalis plasmid pAMβ1. The EMBO journal. 10: 2171- 2177.

Bruand, C., E.L. Chatelier, S.D. Ehrlich, and L. Jannière. 1993. A fourth class of theta-replicating plasmids: The pAMβ1 family from gram-positive bacteria. Proceeding in tha national academy of sciences of the United States of America. 90: 11668-11672.

Bruand, C., S.D. Ehrlich, and L. Jannière. 1995. Primosome assembly site in Bacillus subtilis. The EMBO journal. 14: 2642-2650.

Bruand, C., and S.D. Ehrlich. 1998. Transcription-driven DNA replication of plasmid pAMβ1 in Bacillus subtilis. Molecular microbiology. 30: 135-145.

Bryan, E.M., T. Bae, M. Kleerebezem, and G.M. Dunny. 2000. Improved vector for nisin-controlled expression in gram-positive bacteria. Plasmid. 44: 183-190. del Solar, G., R. Giraldo, M.J. Ruiz-Echevarría, M. Espinosa, and R. Díaz-orejas. 1998. Replication and control of circular bacterial plasmids. 62: 434-464.

Depardieu, F., I. Podglajen, R. Leclercq, E. Collatz, and P. Courvalin. 2007. Modes and modulations of antibiotic resistance gene expression. Clinical microbiology reviews. 20: 79–114. de Ruyter, P.G.G.A., O.P. Kuipers, M.M. Beerthuyzen, I. van Alen-Boerrigter, and W.M. de Vos. 1996a. Functional Analysis of Promoters in the nisin gene cluster of Lactococcus lactis. Journal of bacteriology. 178: 3434-3439. de Ruyter, P.G.G.A., O.P. Kuipers, and W.M. de Vos. 1996b. Controlled gene expression systems for Lactococccus lactis with the food-grade inducer nisin. Applied and environmental microbiology. 62: 3662-3667.

Desmond, C., G. F. Fitzgerald, C. Stanton, and R. P. Ross. 2004. Improved stress tolerance of GroESL-overproducing Lactococcus lactis and probiotic Lactobacillus paracasei NFBC 338. Applied and environmental microbiology. 70: 5929-5936. de Vos, W.M. 1999. Gene expression systems for lactic acid bacteria. Current opinion in microbiology. 2: 289-295.

110

Dunny, G.M., L.N. Lee, and D. J. LEBlanc. 1991. Improved Electroporation and cloning vector system for gram-positive bacteria. Applied and environmental microbiology. 57: 1194-1201.

Eichenbaum, Z., M.J. Federle, D. Marra, W.M. de Vos, O.P. Kuipers, M. Kleerebezem, and J.R. Scott. 1998. Use of the Lactococcal nisA promoter to regulate gene expression in gram-positive bacteria: Comparison of induction level and promoter strength. Applied and environmental microbiology. 64: 2763-2769.

Engelke, G., Z. Gutowski-Eckel, M. Hammelmann, and K.-D. Entian. 1992. Biosynthesis of the lantibiotic nisin: genomic organization and membrane localization of the NisB protein. Applied and environmental microbiology. 58: 3730-3743.

Feld, L., E. Bielak, K. Hammerb, and A. Wilcks. 2009. Characterization of a small erythromycin resistance plasmid pLFE1 from the food-isolate Lactobacillus plantarum M345. Plasmid. 61: 159-170.

Guérout-Fleury, A.-M., K. Shazand, N. Frandsen, and P. Stragier. 1995. Antibiotic- resistance cassettes for Bacillus subtilis. Gene. 167: 335-336.

Itoh, T., and J. Tomizawa. 1980. Formation of an RNA primer for initiation of replication of ColE1 DNA by ribonuclease H. Proceeding of the national academy of sciences of the United States of America. 77: 2450–2454.

Jannière, L., V. Bidnenko, S. McGovern, S.D. Ehrlich, and M.A. Petit. 1997. Replication terminus for DNA polymerase I during initiation of pAMβ replication: role of the plasmid-encoded resolution system. Molecular microbiology. 23: 525-535.

Kiewiet, R., J. Kok, J.F.M.L. Seegers, G. Venema, and S. Bron. 1993. The mode of replication is a major factor in segregational plasmid instability in Lactococcus lactis. Applied and environmental microbiology. 59: 358–364.

Kim, J.-H., and D.A. Mills. 2007. Improvement of a nisin-inducible expression vector for use in lactic acid bacteria. Plasmid. 58: 275-283.

Kleerebezem M., M.M. Beerthuyzen, E.E. Vaughan, W.M. de Vos, and O.P. Kuipers. 1997. Controlled gene expression systems for lactic acid bacteria: Transferable nisin-inducible expression cassettes for Lactococcus, Leuconostoc, and Lactobacillus spp. Applied and environmental microbiology. 63: 4581-4584.

Kües, U., and U. Stahl. 1989. Replication of plasmid in gram-negative bacteria. Microbiological reviews. 53: 491-516.

111

Kuipers, O.P., M.M. Beerthuyzen, R.J. Siezen, and W.M. de Vos. 1993. Characterization of the nisin gene cluster nisABTCIPR of Lactococcus lactis, requirement of expression of the nisA and nisI genes for development of immunity. European journal of biochemistry. 216: 281-291.

Kuipers, O.P., M.M. Beerthuyzen, P.G.G.A. de Ruyter, E.J. Luesink, and W.M. de Vos. 1995. Autoregulation of nisin biosynthesis in Lactococcus lactis by sinal transduction. Journal of biological chemistry. 270: 27299-27304.

Kuipers, O.P., P.G.G.A. de Ruyter, M. Kleerebezem, and W.M. de Vos. 1998. Quorum sensing-controlled gene expression in lactic acid bacteria. Journal of biotechnology. 64: 15-21.

Lacks, S.A., P. Lopez, B. Greenberg, and M. Espinosa. 1986. Identification and analysis of genes for tetracycline resistance and replication functions in the broad-host- range plasmid PLS1. Journal of molecular biology. 192: 753-765.

Le Chatelier, E., S.D. Ehrlich, and L. Jannière. 1994. The pAMβ1 CopF repressor regulates plasmid copy number by controlling transcription of the repE gene. Molecular microbiology. 14: 463-471.

Le Chatelier, E., S.D. Ehrlich, and L. Jannière. 1996. Countertranscript-driven attenuation system of the pAMβ1 repE gene. Molecular microbiology. 20: 1099-1112.

Le Chatelier, E., L. Jannière, S.D. Ehrlich, and D. Canceill. 2001. The RepE initiator is a double-stranded and single-stranded DNA-binding protein that form atypical open complex at the onset of replication of plasmid pAMβ1 from gram-positive bacteria. The journal of biological chemistry. 276: 10234-10246.

Le Loir, Y., S. Nouaille, J. Commissaire, L. Brétigny, A. Gruss, and P. Langella. 2001. Signal peptide and propeptide optimization for heterologous protein secretion in Lactococcus lactis. Applied and environmental microbiology. 67: 4119-4127.

Luo, H., K. Wan, and H. H. Wang. 2005. High-frequency conjugation system facilitates biofilm formation and pAMβ1 transmission by Lactococcus lactis. Applied and environmental microbiology. 71: 2970–2978.

McIntyre, D.A., and S.K. Harlander. 1989a. Genetic transformation of intact Lactococcus lactis supsp. lactis by high-voltage electroporation. Applied and environmental microbiology. 55: 604-610.

112

McIntyre, D.A., and S.K. Harlander. 1989b. Improved electroporation efficiency of intact Lactococcus lactis supsp. lactis cells grown in defined media. Applied and environmental microbiology. 55: 2621-2626.

Mierau, I, and M. Kleerebezem. 2005. 10 years of the nisin-controlled gene expression system (NICE) in Lactococcus lactis. Applied and environmental microbiology. 68: 705- 717.

Novick, R.P., S. Iordanescu, S.J. Projan, J. Kornblum, and I. Edelman. 1989. pT181 plasmid replication is regulated by a countertranscript-driven transcriptional attenuator. Cell. 59: 395-404.

Oddone, G.M., D.A. Mills, and D. E. Block. 2009. Incorporation of nisI-mediated nisin immunity improves vector-based nisin-controlled gene expression in lactic acid bacteria. Plasmid. 61: 151-158.

Pavan, S., P. Hols, J. Delcour, M.-C. Geoffroy, C. Grangette, M. Kleerebezem, and A. Mercenier. 2000. Adaptation of the nisin-controlled expression system in Lactobacillus plantarum: a tool to study in vivo biological effects. Applied and environmental microbiology. 66: 4427-4432.

Pérez-Arellano, I., M. Zúňiga, and G. Pérez-Martínez. 2001. Contruction of compatible wide-host-range shuttle vectors for lactic acid bacteria and Escherichia coli. Plasmid. 46: 106-116.

Platteeuw, C., G. Simons, and W.M. de Vos. 1994. Use of the Escherichia coli β- glucuronidase (gusA) gene as a reporter gene for analyzing promoters in lactic acid bacteria. Applied and environmental microbiology. 60: 587-593.

Ra, R., M.M. Beerthuyzen, W.M. de Vos, P.E.J. Saris, O.P. Kuipers. 1999. Effects of gene disruptions in the nisin gene cluster of Lactococcus lactis on nisin production and producer immunity. Microbiology-UK. 145: 1227–1233.

Roberts, M.C. 1996. Tetracycline resistance determinants: mechanisms of action, regulation of expression, genetic mobility, and distribution. FEMS microbiology review. 19: 1-24.

Roberts, M.C. 2004. Resistance to macrolide, lincosamide, streptogramin,ketolide, and oxazolidinone antibiotics. Molecular biotechnology. 28: 47-62.

Roberts, M.C. 2005. Update on acquired tetracycline resistance gene. FEMS microbiology letters. 245: 195-203.

113

Sambrook, J., and D.W. Russell. 2006. Preparation and transformation of competent E. coli using calcium chloride. Cold Spring Harbor Protocols. doi: 10.1101/pdb.prot3932.

Sambrook, J., and D.W. Russell. 2006. Transformation of E. coli by Electroporation. Cold Spring Harbor Protocols. doi: 10.1101/pdb.prot3933.

Schwarz, S., M. Cardoso, and H.C. Wegener. 1992. Nucleotide sequence and phylogeny of the tet(L) tetracycline resistance determinant encoded by plasmid pSTE1 from Staphylococcus hyicus. Antimicrobial agents and chemotherapy. 36: 580-588.

Seigers, K., and K.-D. Entian. 1995. Genes involved in immunity to the lantibiotic nisin produced by Lactococcus lactis 6F3. Applied and environmental microbiology. 61: 1082- 1089.

Simon, D., and A. Chopin. 1988. Construction of a vector plasmid family and its use for molecular cloning in Streptococcus lactis. Biochimie. 70: 559-566.

Smith, J.L., P.M. Fratamico, and J.S. Novak. 2004. Quorum sensing: A primer for food microbiologists. Journal of food protection. 67: 1053-1070.

Suwannakham, S., Y. Huang, and S.-T. Yang. 2006. Construction and characterization of ack knock-out mutants of Propionibacterium acidipropionici for enhanced propionic acid fermentation. Biotechnology and bioengineering. 94: 383-395.

Swinfield, T.J., J.D. Oultram, D.E. Thompson, J.K. Brehm, and N.P. Minton. 1990. Physical characterization of the replication region of the Streptococcus faecalis plasmid pAMβ1. Gene. 87: 79-90. van der Meer, J.R. J. Polman, M.M. Beerthuyzen, R.J. Siezen, O.P. Kuipers, and W.M. de Vos. 1993. Characterization of the Lactococcus lactis nisinA operon genes nisP, encoding a subtilisin-like serine protease involved in precursor processing, and nisR, encoding a regulatory protein involved in nisin biosynthesis. Journal of bacteriology. 175: 2578-2588.

Wang, H., M. Manuzon, M. Lehman, K. Wan, H. Luo, T. Wittum, A. Yousef, and L. Bakaletz. 2006. Food commensal microbes as a potentially important avenue in transmitting antibiotic resistance genes. FEMS microbiology letters. 254: 226-231.

Weisblum, B. 1995. Erythromycin resistance by ribosome modification. Antimicrobial agents and chemotherapy. 39: 577–585.

Yamaguchi, A., N. Ono, T. Akasaka, T. Noumi, and T. Sawai. 1990. Metal- tetracycline/H-antiporter of Escherichia coli encoded by a trasposon, Tn10. Journal of biological chemistry. 256: 15525-15530.

114

Zhou, X.X., W.F. Li, G.X. Ma, and Y.J. Pan. 2006. The nisin-controlled gene expression system: construction, application and improvements. Biotechnology advances. 24: 285-295.

115