Supporting Information

Home , ARR3, Aryldialkylphosphatase, Cyanamide hydratase, DNA polymerase alpha, Gcn4, PMP2

Figure S1. The functionality of the tagged Arp6 and Swr1 was confirmed by monitoring cell growth and sensitivity to hydeoxyurea (HU). Five-fold serial dilutions of each strain were plated on YPD with or without 50 mM HU and incubated at 30°C or 37°C for 3 days.

Figure S2. Localization of Arp6 and Swr1 on chromosome 3. The binding of Arp6-FLAG (top), Swr1-FLAG (middle), and Arp6-FLAG in swr1 cells (bottom) are compared. The position of Tel 3L, Tel 3R, CEN3, and the RP gene are shown under the panels.

Figure S3. Localization of Arp6 and Swr1 on chromosome 4. The binding of Arp6-FLAG (top), Swr1-FLAG (middle), and Arp6-FLAG in swr1 cells (bottom) in the whole chromosome region are compared. The position of Tel 4L, Tel 4R, CEN4, SWR1, and RP genes are shown under the panels.

Figure S4. Localization of Arp6 and Swr1 on the region including the SWR1 gene of chromosome 4. The binding of Arp6- FLAG (top), Swr1-FLAG (middle), and Arp6-FLAG in swr1 cells (bottom) are compared. The position and orientation of the SWR1 gene is shown.

Figure S5. Localization of Arp6 and Swr1 on chromosome 5. The binding of Arp6-FLAG (top), Swr1-FLAG (middle), and Arp6-FLAG in swr1 cells (bottom) are compared. The position of Tel 5L, Tel 5R, CEN5, and the RP genes are shown under the panels.

Figure S6. Preferential localization of Arp6 and Swr1 in the 5′ end of genes. Vertical bars represent the binding ratio of proteins in each locus. The binding of Arp6-Flag (Top), Swr1-Flag (middle), and Arp6-Flag in swr1 cells (bottom) in the region 228K-244K of Chr 6R were compared. The orientation of transcription of the genes of Watson strand and Crick strand in the region was shown by arrows in the map over the panels. Regions of divergent promoters are indicated with gray shadow.

Figure S7. Correlation of the localizations of Arp6 and Swr1. The Arp6-binding log2 ratios of Arp6-binding loci (change p- value <0.025) in wild-type (A) and in swr1 cells (B) are represented as scatterplots versus the Swr1 binding log2 ratio in each Arp6 binding locus of wild-type cells. The yellow lines represent the hypothetical pattern of the data if Arp6 and Swr1 bind equally on the chromosomes.

Figure S8. ChIP analysis for Htz1 in cells lacking Arp6 or Swr1. Htz1 association to the promoter of GAL1, SWR1, and ribosomal protein (RPL13A and RPS16B) genes was analyzed using ChIP with an anti-Htz1 antibody (abcam, ab4626) and quantified using real-time quantitative PCR in wild-type (WT), arp6, and swr1 cells. The values are indicated as percentage of input DNA obtained by ChIP with anti-Htz1 antibody. The data points represent the mean ± SD for at least three independent experiments.

Figure S9. Quantitative analysis of RDS1 (YCR106W) and UBX3 (YDL091C) in arp6- and htz1-deletion mutants. The same amount of total RNA from wild-type, arp6, and htz1 cells was analyzed using real-time quantitative RT–PCR. The ACT1 gene was analyzed as a control. The relative amount of the transcript of the genes to ACT1 is shown. The data points represent the mean ± SD for at least three independent experiments.

Figure S10. ChIP analysis for nuclear pore complex with GAL1 gene in arp6 cells. The association of GAL1 gene with NPC was analyzed using ChIP with an antibody against nuclear pore complex proteins (Mab414, abcam, ab24609) in wild-type (WT) and arp6 cells grown on the glucose- or galactose containing media. Immunoprecipitated DNA was quantified using real-time PCR probed for GAL1 gene. The percentage of recovered DNA over input is plotted relative to wild-type cells on glucose as 1. The data points represent the mean ± SD for at least three independent experiments.

Table S1. Presence of Arp6 in nonrepetitive 10 kb subtelomere zones. (0.05 MB DOC)

Table S2. Microarray analysis in arp6Δ and swr1Δ cells. (1.10 MB XLS)

Table S3. Binding of Arp6 and Swr1 on ribosomal protein genes. (0.04 MB DOC)

Table S4. Expression of RP genes in arp6Δ and swr1Δ cells. (0.04 MB XLS)

Table S5. Genes markedly down-regulated in arp6 cells. (0.09 MB DOC)

Table S6. Strains used in this study. (0.06 MB DOC)

Text S1. Primer sequences. (0.04 MB DOC)

SWR1

Arp6

Swr1

Arp6 in swr1

Yoshida et al., Supplementary Fig. S3B

Arp6

Swr1

Arp6 in swr1

Yoshida et al., Supplementary Fig. S5 A Arp6 (log2) 4

3.5

2.5 r =0.278, n=2001 2

1.5

0.5

0 -2-101234567 Swr1 (log2)

B Arp6 in swr1 (log2)

3.5

2.5

2 r =0.138, n=1463 1.5

0.5

0 -2-101234567 Swr1 (log2)

Yoshida et al., Supplementary Fig. S6 ChIP analysis for Htz1 in arp6 and swr1 mutants

5 WT arp6 4 swr1

1 % precipitated by anti-Htz1 / input

0 GAL1 SWR1 RPL13A RPS16B

Yoshida et al. Supplementary Fig. S7 Quantitative rtPCR for Arp6/Swr1-bound genes

(x10- 3 ) 8 WT arp6 htz1

ACT1 6

2 Relative expression to

0 RDS1 UBX3

Yoshida et al., Supplementary Fig. S8 ChIP for GAL1-nuclear pore association

p<0.05 2.0 WT arp6

1.5

1.0 % (IP/ input) / WT gluc

0.5

0 glucose galactose

Yoshida et al., Supplementary Fig. S9 Supplementary Table S1. Presence of Arp6 in nonrepetitive 10 kb subtelomere zones

Chr3L (32)1) Chr4L (4) Chr5L (15) Chr6R (34) Total (145) Chr3R (34) Chr4R (13) Chr5R (13)

12) (3%)3) 1 (25%) 3 (20%) Arp6 binding loci 7 (21%) 16 (11%) 3 (9%) 1 (8%) 0 (0%) SWR1 coincidence with 0 (0%) 0 (0%) 2 (13%) 2 (6%) 7 (5%) Swr1 binding 3 (9%) 0 (0%) 0 (0%)

3 (9%) 0 (0%) 0 (0%) swr1 Arp6 binding loci 9 (26%) 22 (15%) 4 (12%) 5 (38%) 1 (8%)

1) number of subtelomeric probes in the array, 2) number of probes on which the ChIP-chip signal is significantly positive, 3) percentage of binding-positive probes

SupplemantaTable S2

arp6 swr1 arp6 log2 ratio swr1 log2 ratio t-test p-value t-test p-value

YAL001C -0.48778725 0.055121132 -0.651383868 0.009641293 TFC3 transcription factor tau (TFIIIC) subunit 138 Vps8p is a membrane-associated hydrophilic protein which contains a C-terminal cysteine-rich region that conforms to the H2 variant of the YAL002W -0.50137568 0.02012999 0.465583742 0.134286021 VPS8 RING finger Zn2+ binding motif. YAL003W 0.291356151 0.57828274 0.018063402 0.741564133 EFB1 Translation elongation factor EF-1beta, GDP/GTP exchange factor for Tef1p/Tef2p YAL004W -1.37471567 0.023223502 0.446599197 0.094749311 strong similarity to A.klebsiana glutamate dehydrogenase YAL007C 0.514959137 0.367907397 0.193498974 0.126415188 ERP2 p24 protein involved in membrane trafficking YAL008W -1.07248083 0.003902375 0.04877654 0.757249306 FUN14 hypothetical protein YAL009W -0.83886578 0.039587079 -0.007318718 0.898104961 SPO7 sporulation protein YAL010C 0.350119155 0.079737228 -0.110610526 0.32107038 MDM10 Mitochondrial outer membrane protein involved in mitochondrial morphology and inheritance YAL011W -0.34259393 0.310843521 -0.299325162 0.15316135 possible mitochondrial transit peptide/weak similarity to Mus musculus p53-associated cellular protein YAL012W 1.573242516 0.034945842 0.519382719 0.240287741 CYS3 cystathionine gamma-lyase YAL013W 0.10593589 0.260657892 0.288869805 0.318643395 DEP1 regulation of phospholipid metabolism YAL014C 0.190903734 0.569458913 0.169774313 0.044229011 hypothetical protein YAL015C 0.370541536 0.031276471 -0.245836227 0.004561835 NTG1 DNA glycosylase YAL016W -0.64975335 0.0560383 0.036635636 0.638828131 TPD3 protein phosphatase 2A regulatory subunit A YAL017W -1.25829846 0.004518805 0.126513184 0.38324032 FUN31 Serine/threonine kinase YAL018C -0.51051588 0.164932688 -0.264509297 0.317542105 3 transmembrane domains/weak similarity to hypothetical proteins YOL047c and YOL048c YAL019W 0.320792247 0.444493655 -0.211820784 0.280255331 FUN30 SNF2 protein family YAL021C -0.1074359 0.778044634 -0.008790493 0.798167731 CCR4 95 kDa containng leucine rich tandem repeats YAL022C 0.656687352 0.001364239 0.428924658 0.115624767 FUN26 predicted membrane protein YAL023C 0.778388229 0.117515196 0.53048886 0.106271155 PMT2 dolichyl phosphate-D-mannose:protein O-D-mannosyltransferase YAL024C 0.327596538 0.491315967 0.065792226 0.797949412 LTE1 putative GTP-exchange protein YAL025C 1.742728628 0.005475432 -0.503643316 0.197141618 MAK16 putative nuclear protein YAL026C -0.15225171 0.144316487 0.062776186 0.624950436 DRS2 Membrane-spanning Ca-ATPase (P-type),member of the cation transport (E1-E2) ATPases YAL027W -0.19310171 0.23325453 -0.364863449 0.173323366 hypothetical protein YAL028W -1.05821689 0.028312621 -0.12586505 0.263146998 similarity to hypothetical protein YOR324c YAL029C 1.414871688 0.169872272 0.17340552 0.14232505 MYO4 myosin YAL030W -0.82724505 0.037223546 0.300700811 0.135945922 SNC1 homolog of Snc2p, vesicle-associated membrane protein (synaptobrevin) homolog, forms a complex with Snc2p and Sec9p YAL031C -0.66093199 0.001932142 0.091597547 0.555114187 FUN21 FUN21 YAL032C -0.45984855 0.100362467 0.119635039 0.26845368 PRP45 pre-mRNA splicing factor YAL033W 0.516623095 0.085119298 -0.332318037 0.10772256 POP5 An integral subunit of RNase P and apparent subunit of RNase MRP YAL034C -1.37859175 0.009174568 0.462426647 0.033887391 FUN19 Function unknown now YAL034W-A 0.046056852 0.601311241 -0.173771005 0.501575118 MTW1 determining metaphase spindle length YAL035C-A 0.455896607 0.408337787 0.428415177 0.170295679 YAL035W 0.75438664 0.04599226 -0.221359802 0.054514118 FUN12 97 kDa protein YAL036C 1.239106861 0.048698109 0.063806118 0.17119679 FUN11 similar to Xenopus GTP-binding protein DRG YAL037W -0.57645571 0.009922233 -0.165687374 0.532682496 strong similarity to GTP-binding proteins YAL038W 0.891293531 0.223803982 0.838341102 0.122662277 CDC19 Pyruvate kinase YAL039C 0.367285033 0.377663351 0.193111406 0.48023897 CYC3 cytochrome c heme lyase (CCHL) YAL040C -0.19482503 0.251202381 0.567158599 0.138150953 CLN3 G(sub)1 cyclin YAL041W 0.121678523 0.623119848 0.001064527 0.995446938 CDC24 Guanine nucleotide exchange factor (a.k.a. GDP-release factor) for cdc42 YAL042W 0.520759379 0.112442757 0.121088992 0.106200684 ERV46 ER-Golgi transport vesicle protein YAL043C -0.09940515 0.785189261 0.642208033 0.063435676 PTA1 pre-tRNA processing YAL043C-A 0.364729879 0.471390403 0.118430232 0.175428015 YAL044C 1.22688802 0.213909953 0.359553331 0.125672906 GCV3 H-protein subunit of the glycine cleavage system YAL045C -0.15640282 0.262645106 0.601851976 0.070209367 hypothetical protein YAL047C -0.19449606 0.6792255 -0.488173264 0.134349146 SPC72 component of spindle pole bodies YAL048C -0.53508764 0.050309883 0.083250034 0.159663585 PEP4 vacuolar aspartic proteasse YAL049C -1.58912253 0.000295413 0.155651056 0.32049334 weak similarity to Legionella small basic protein sbpA YAL053W 1.167219198 0.23272621 0.494264836 0.182351238 strong similarity to hypothetical proteins YOR365c,YGL139w,YPL221w YAL054C -1.09564458 0.024545903 0.245199899 0.445281937 ACS1 inducible acetyl-coenzyme A synthetase YAL055W -1.18899461 0.004853529 -0.410131441 0.074131314 PEX22 peroxisomal matrix protein import YAL058C-A 0.154682303 0.736803287 0.434889949 0.03830118 YAL058W -0.3166379 0.01219009 0.124089103 0.085005861 CNE1 Calnexin and calreticulin homolog YAL059W 1.189087482 0.105757458 -0.368382138 0.180043241 ECM1 putative transmembrane domain protein involved in cell wall biogenesis YAL060W -0.33257326 0.461367286 0.208542234 0.398809867 FUN49 stereospecific (2R, 3R)-2,3-butanediol dehydrogenase YAL061W -1.7629215 0.014135456 0.322907683 0.261242406 FUN50 similarity to alcohol/sorbitol dehydrogenase YAL062W -1.71445039 0.006829855 0.056824429 0.427171159 GDH3 NADP-linked glutamate dehydrogenase YAL064C-A -0.1786571 0.740798376 0.233634589 0.382026263 strong similarity to Flo1p, Flo5p - putative pseudogene YAL064W -0.74505863 0.145378609 0.286819838 0.453965863 hypothetical protein YAL065C -1.17547087 0.003827097 0.399871097 0.081840231 strong similarity to Flo1p and Flo9p - putative pseudogene YAL066W -0.93408152 0.296857989 -0.005238039 0.9931692 weak similarity to membrane protein yybF - Bacillus subtilis YAL067C -1.2512459 0.039595582 -0.066498241 0.541023311 SEO1 putative permease/Suppressor of Sulfoxyde Ethionine resistance YAL069W -0.14723693 0.771200929 0.404281405 0.099211952 YAR002C-A 0.8089258 0.349749522 0.258873046 0.277899274 ERP1 p24 protein involved in membrane trafficking YAR002W 1.036070284 0.005377987 -0.125110616 0.316508824 NUP60 nuclear pore protein YAR003W -0.21157782 0.286119875 -0.439692436 0.028854891 FUN16 beta transducin domain/similarity to human RB protein binding protein YAR007C 0.63060681 0.128060752 0.193886043 0.236505966 RFA1 69 kDa subunit of the heterotrimeric RPA (RF-A) single-stranded DNA binding protein, binds URS1 and CAR1 YAR008W 0.531614843 0.249599706 0.007320805 0.966485591 SEN34 34kDa subunit of the tetrameric tRNA splicing endonuclease YAR009C 1.568985076 0.048845245 0.323389091 0.027024819 TY1B Ty1B protein YAR010C 1.440334364 0.067113503 0.4556637 0.009967175 TY1A TY1A protein YAR014C 0.68765935 0.06094559 -0.116161101 0.246966 BUD14 maximal growth/similarity to hypothetical protein S.pombe YAR015W 1.028246324 0.28042917 -0.063672942 0.498936214 ADE1 phosphoribosyl amino imidazolesuccinocarbozamide synthetase YAR018C 0.244945801 0.50654314 0.208883698 0.000210337 KIN3 protein kinase YAR019C -0.17792809 0.554620603 0.344762613 0.202010355 CDC15 protein kinase domain YAR020C 0.150018392 0.566814473 0.644597596 0.018234699 PAU7 similar to Pau3, member of Pau1 family YAR023C -0.63998255 0.061165085 0.011521673 0.926460784 membrane protein YAR027W -0.69710112 0.111520721 -0.196597495 0.124441656 FUN55 membrane protein/strong similarity to YAR028w, YCR007c, YGL053w, YAR031w, FUN59p and YGL051w YAR028W 0.02438456 0.965511157 0.018670564 0.788749248 membrane protein/strong similarity to Fun55p, YGL053w, YCR007c, YAR031w, Fun59p and YGL051w YAR030C 0.304108258 0.377811936 0.037110257 0.897034717 hypothetical protein YAR031W -0.6089193 0.023134268 -0.059812785 0.68063699 PRM9 membrane protein/strong similarity to YGL053w, Fun59p, YGL051w, Fun55p, YAR028w and YCR007c YAR033W -0.52963824 0.157687557 -0.030386547 0.852864032 FUN59 membrane protein/strong similarity to YGL051w, YGL053w, YAR031w, Fun55p, YAR028w and YCR007c YAR035W -0.07180285 0.912504663 -0.088423459 0.289350854 YAT1 Outer carnitine acetyltransferase, mitochondrial YAR042W -0.03006143 0.924880125 0.283718288 0.419166192 SWH1 ankyrin repeat YAR044W -0.00263468 0.994132468 -0.054374301 0.653312417 OSH1 Shows homology to the human oxysterol binding protein (OSBP) YAR047C -0.86387318 0.264807528 -0.457303432 0.435180037 predicted nuclear targeting signal YAR053W -0.58801994 0.172781392 0.483606121 0.307259816 predicted membrane protein YAR060C 0.132593072 0.858684956 0.077482878 0.674930742 strong similarity to hypothetical protein YHR212c YAR061W -0.49217382 0.264261253 -7.98871E-05 0.99978933 strong similarity to N-terminus of Flo1p - putative pseudogene YAR062W -0.16768339 0.455152005 0.565555252 0.070699921 strong similarity to Flo1p - putative pseudogene YAR064W 0.075841311 0.848648394 0.192771016 0.405714066 Potential membrane protein YAR066W 0.700203408 0.213023476 0.412287539 0.060145965 identical to YHR214w hypothetical protein, similarity to Sta1p YAR068W 0.245010922 0.505026924 0.479488019 0.125500624 Potential membrane protein YAR069C -0.74696325 0.059178657 1.062230426 0.074823538 Potential membrane protein YAR070C -0.05544974 0.578769239 -0.202657858 0.753174965 potential mitochondrial transit peptide YAR071W -0.24993142 0.657840395 0.242156128 0.04763318 PHO11 Acid phosphatase, secreted YAR073W 0.808656429 0.19847315 -0.391364075 0.012098201 IMD1 IMP dehydrogenase homolog YAR075W 1.350080559 0.042146299 0.285653905 0.110292263 strong similarity to IMP dehydrogenases YBL001C 0.521372342 0.063150214 0.377806625 0.007995235 ECM15 involved in cell wall biogenesis YBL002W 0.644046534 0.11247777 0.436611469 0.050795936 HTB2 Histone H2B (HTB1 and HTB2 code for nearly identical proteins) YBL005W-A 0.711706069 0.066631051 0.397034913 0.029499345 TyA gag protein. Gag processing produces capsid proteins. The TyB Gag-Pol protein. Gag processing produces capsid proteins. Pol is cleaved to produce protease, reverse transcriptase, and integrase YBL005W-B 0.806694821 0.004270475 0.44184349 0.099669502 activities. YBL007C -1.05475926 0.011207344 0.585806022 0.060636472 SLA1 contains 3 SH3 domains, interacts with Bee1p YBL008W -0.25713498 0.395843766 -0.291904995 0.082416055 HIR1 putative repressor protein homologous to yeast Tup1p and mammalian retinal transducin ; contains nuclear targeting signal YBL009W 0.377903649 0.410199557 -0.139775549 0.535123179 strong similarity to DNA damage responsive Alk1p YBL011W 0.732695584 0.029991524 0.08310294 0.483247349 SCT1 suppressor of choline-transport mutants YBL012C 0.122002089 0.818084302 0.501228611 0.245672062 questionable ORF YBL013W -0.54551921 0.247361356 -0.131201515 0.688835462 FMT1 Methionyl-tRNA Transformylase YBL014C 0.145227982 0.439522054 -0.259788052 0.108339886 RRN6 member of yeast Pol I core factor (CF) also composed of Rrn11p, Rrn7p and TATA-binding protein YBL015W -1.88887999 0.011757083 -0.089791178 0.380359889 ACH1 acetyl CoA hydrolase YBL016W 0.405385742 0.154177413 0.28688141 0.20783228 FUS3 cdc2+ /CDC28 related kinase with positive role in conjugation YBL017C -0.35057353 0.009578128 0.117031097 0.552092446 PEP1 carboxypeptidase Y sorting receptor in late Golgi ; Type I integral membrane protein 166aa cytoplasmic tail, 1300 aa lumenal domain YBL018C 0.429413309 0.189625608 0.017990194 0.520462645 POP8 integral subunit of RNase P and apparent subunit of RNase MRP YBL019W -0.44360937 0.193112906 0.251108094 0.139099165 APN2 AP endonuclease YBL020W -0.14644714 0.399902983 0.129851451 0.139006802 RFT1 67 kDa integral membrane protein YBL021C 0.418111438 0.094468832 0.244357052 0.122508233 HAP3 transcriptional activator protein of CYC1 YBL022C 0.057851963 0.823243187 -0.158622217 0.282644513 PIM1 mitochondrial ATP-dependent protease YBL023C 0.311056122 0.164045195 -0.186899983 0.230537931 MCM2 Minichromosome maintenance protein, transcription factor YBL024W 0.768176955 0.114518321 -0.234637929 0.036028563 NCL1 Probable proliferating-cell nucleolar antigen (human p120) YBL025W 0.214419035 0.022039086 0.005455163 0.978683975 RRN10 Upstream activation factor subunit YBL026W 0.550467742 0.123592519 -0.418656457 0.061304339 LSM2 snRNA-associated protein of the Sm class YBL027W 1.076896847 0.044605028 -0.188299044 0.495992786 RPL19B Ribosomal protein L19B (YL14) (L23B) (rpl5L) YBL028C 1.508809573 0.098454761 -0.774528492 0.132994667 hypothetical protein - involved in mating-type regulation YBL029W -0.69897514 0.012282849 -0.263262192 0.089300671 hypothetical protein YBL030C -0.9969331 0.023634487 0.172120597 0.083005311 PET9 mitochondrial ADP /ATP translocator YBL031W 0.234498822 0.377257191 -0.008179032 0.96811451 SHE1 hypothetical protein YBL032W -0.38895763 0.045985811 0.017670569 0.957997296 weak similarity to hnRNP complex protein homolog YBR233w YBL033C 0.267094143 0.071552505 -0.124879611 0.137726678 RIB1 GTP cyclohydrolase II YBL034C 0.923515409 0.026769582 -0.020444035 0.486715894 STU1 component of the mitotic spindle YBL035C 0.054515907 0.832182456 0.220668279 0.098781864 POL12 B subunit of DNA polymerase alpha-primase complex YBL036C 0.203816669 0.10506225 -0.458967973 0.030825796 Homolog to twitching motility protein (P. aeroginosa) YBL037W -0.50995488 0.039507578 -0.139849898 0.027220315 APL3 Large subunit of clathrin associated protein complex YBL038W 0.011903164 0.969512114 -0.436315028 0.061699688 MRPL16 Mitochondrial ribosomal protein MRPL16 YBL039C 1.641103523 0.101240934 0.074950286 0.541091171 URA7 CTP synthase, highly homologus to URA8 CTP synthase YBL040C 0.414488628 0.337366554 0.416949682 0.003866974 ERD2 encodes the HDEL receptor required for retention of ER proteins YBL041W 0.302973703 0.334706978 -0.259201017 0.10000259 PRE7 proteasome subunit YBL042C 1.549013444 0.235516871 0.314682648 0.192857668 FUI1 uridine permease YBL043W 0.858385132 0.0428885 -0.778409799 0.03665693 ECM13 (putative) involved in cell wall biogenesis YBL044W -0.19569315 0.623648411 -0.729946359 0.191344608 hypothetical protein YBL045C -0.79287106 0.006255025 0.176388947 0.299817881 COR1 44 kDa core protein of yeast coenzyme QH2 cytochrome c reductase YBL046W 0.3859612 0.081664134 -0.350887344 0.132967365 weak similarity to hypothetical protein YOR054c YBL048W -1.69306352 0.001064383 0.178308538 0.672634552 hypothetical protein YBL049W -1.69519851 0.003376388 -0.008092027 0.984683049 strong similarity to hypothetical protein - human YBL050W -0.41391761 0.141981425 -0.196815486 0.078672316 SEC17 peripheral membrane protein required for vesicular transport between ER and Golgi YBL051C 0.401509441 0.181824349 0.222847746 4.56E-05 hypothetical protein YBL052C 0.26976272 0.09049595 -0.752252813 0.012898381 SAS3 involved in silencing at HMR YBL053W 0.044255282 0.911991193 0.139375926 0.707387167 questionable ORF YBL054W 1.307919818 0.023417029 0.204899594 0.153605143 Homolog to myb transforming proteins YBL055C 0.358491013 0.481932574 -0.250402414 0.070487082 similarity to hypothetical S.pombe protein YBL056W -0.2865873 0.173469012 -0.273953725 0.042656459 PTC3 protein phosphatase type 2C YBL057C -0.32078047 0.406630018 -0.046334252 0.444338998 strong similarity to hypothetical S.pombe protein YBL058W -0.37962486 0.217951768 -0.078208021 0.418770366 SHP1 putative regulatory subunit for Glc7p, a phosphatase required for glucose repression YBL059W 0.462211321 0.198916479 -0.10554177 0.37878554 weak similarity to hypothetical protein YER093c-a YBL060W 0.077003492 0.582507009 -0.474268578 0.026406853 has homology to the sec7 domain of gtp exchange factors YBL061C 0.648278479 0.033692682 0.000146021 0.999335964 SKT5 Probable Ca++ binding membrane protein (prenylated) YBL062W 0.579637219 0.033550656 -0.196912671 0.008308333 questionable ORF YBL063W 0.525577525 0.275713837 0.208608817 0.330500908 KIP1 kinesin related protein YBL064C -1.18003348 0.008713809 -0.0127579 0.959222788 similar to thiol-specific antioxidant enzymes such as rehydrin /peroxiredoxin YBL065W -0.8494896 0.108915753 -0.191671497 0.466324124 questionable ORF YBL066C -0.69422618 0.143848615 0.262468137 0.257366393 SEF1 putative transcription factor YBL067C -0.51185761 0.052322307 -0.525739488 0.149092917 UBP13 ubiquitin carboxyl-terminal hydrolase YBL068W 0.552260638 0.019179853 0.013744302 0.745293033 PRS4 ribose-phosphate pyrophosphokinase 4 YBL069W -0.00725388 0.987732728 -0.025129386 0.8304204 AST1 involved in targeting of plasma membrane [H+]ATPase YBL070C 0.478395103 0.258147059 1.449527927 0.218831982 questionable ORF YBL071C 1.665104942 0.002268259 0.397246315 0.005194289 hypothetical protein YBL072C 2.202569138 0.067628298 0.170422683 0.317507363 RPS8A Ribosomal protein S8A (S14A) (rp19) (YS9) YBL073W -0.40522369 0.129399014 -0.621780705 0.1180431 questionable ORF YBL074C -0.5145695 0.044240228 -0.299340283 0.200705068 AAR2 MATa1-mRNA splicing factor YBL075C -1.40272499 0.038021942 0.103764729 0.516248929 SSA3 heat-inducible cytosolic member of the 70 kDa heat shock protein family YBL076C 0.581969244 0.096179447 0.035319811 0.6166625 ILS1 cytoplasmic isoleucyl-tRNA synthetase YBL077W 1.172703984 0.079621289 0.370471985 0.179126374 questionable ORF YBL078C -0.66417108 0.112692286 0.015724015 0.901271398 AUT7 Aut7p has homology to LC3, a microtubule-associated protein from rat. YBL079W -0.00134744 0.994454663 0.242089261 0.035448994 NUP170 Nucleoporin highly similar to Nup157p and to mammalian Nup155p (nup170 mutant can be complemented with NUP155) YBL080C -0.13981846 0.418501084 -0.465852982 0.073379563 PET112 62-kDa protein YBL081W 1.017113724 0.195899025 0.379908274 0.083287683 hypothetical protein YBL082C 0.289125972 0.451855036 0.462326619 0.194832428 RHK1 putative Dol-P-Man dependent alpha(1-3) mannosyltransferase involved in the biosynthesis of the lipid-linked oligosaccharide YBL083C 0.619332739 0.241584502 0.780879169 0.044070098 questionable ORF YBL085W 0.836764694 0.157704611 0.163004677 0.490774252 BOI1 BEM1-binding protein YBL086C -0.01015504 0.966715371 -0.043958057 0.723896157 involved in sugar metabolism YBL087C 1.69104705 0.026184735 0.387822345 0.047703769 RPL23A Ribosomal protein L23A (L17aA) (YL32) YBL089W 0.155452074 0.725891376 0.094285963 0.732266472 similar to amino acid transport proteins YBL090W 0.130930356 0.447528626 -0.444727802 0.137346139 MRP21 Component of the small subunit of mitochondrial ribosomes YBL091C -0.01592092 0.928530418 0.071111829 0.023003347 MAP2 methionine aminopeptidase 2 YBL092W 1.359675889 0.089999806 0.242349467 0.22278823 RPL32 Ribosomal protein L32 YBL093C 1.630542104 0.066445879 -0.40984133 0.216685648 ROX3 RNA polymerase II holoenzyme /mediator subunit YBL094C 0.152904229 0.515609558 0.109011177 0.180970885 questionable ORF YBL095W -0.59080451 0.004927264 -0.029633732 0.812978335 similarity to C.albicans hypothetical protein YBL096C 0.809338829 0.02935606 0.23293904 0.416154081 questionable ORF YBL097W 0.770433894 0.07368835 -0.361063246 0.146007606 BRN1 involved in chromosome maintenance ; similar to Drosophila barren, Xenopus XCAP-H, and human BRRN1 YBL098W 0.097303301 0.636822178 -0.297569623 0.074939331 similar to kynurenine 3-monoxygenase YBL099W -1.74485012 0.000944171 0.178292671 0.304697955 ATP1 mitochondrial F1F0-ATPase alpha subunit YBL100C -0.95817031 0.163043291 -0.229257504 0.056340994 YBL101C -1.01526877 0.019962145 0.067425577 0.379628367 ECM21 involved in cell wall biogenesis YBL101W-A -0.00154932 0.996505124 0.057147373 0.689363261 TyA gag protein. Gag processing produces capsid proteins. YBL102W -0.08028531 0.556077806 0.31092902 0.159417155 SFT2 similar to mammalian syntaxin 5 YBL103C 0.932300032 0.088718445 -0.176095807 0.262861795 RTG3 Probable cytochrome c subunit, copper binding YBL104C -0.2971584 0.219170985 0.019758268 0.843113947 weak similarity to S.pombe hypothetical protein SPAC12G12.01c YBL105C -0.29337151 0.173608517 0.261086456 0.115317532 PKC1 Protein Kinase C YBL106C -0.47851114 0.139929171 0.226125663 0.146577753 SRO77 yeast homolog of the Drosphila tumor suppressor, lethal giant larvae YBL107C 0.200780264 0.388844229 -0.749110279 0.052248549 hypothetical protein YBL111C -1.05003272 0.021440559 0.440875337 0.111353535 strong similarity to subtelomeric encoded proteins YBL112C 1.191795333 0.432220643 0.287071313 0.006904427 strong similarity to subtelomeric encoded proteins YBR001C -0.86549996 0.021060784 -0.160508473 0.39524395 NTH2 Neutral trehalase, highly homologous to Nth1p YBR002C 0.730283602 0.033873306 -0.289764979 0.119604952 RER2 cis-prenyltransferase YBR003W 0.100169714 0.480672151 -0.063057253 0.495326415 COQ1 hexaprenyl pyrophosphate synthetase YBR004C 1.295560514 0.221698384 0.132653291 0.387742124 similarity to S.pombe hypothetical protein SPAC18B11.05 YBR005W 0.924653953 0.249522237 0.104687752 0.366762602 strong similarity to hypothetical protein YDR003w YBR006W -1.52560357 0.008957363 -0.085669344 0.671433134 UGA2 succinate semialdehyde dehydrogenase YBR007C 0.517934495 0.057829417 -0.066320668 0.644967763 hypothetical protein YBR008C -0.37376243 0.011740901 0.30804565 0.089231413 FLR1 Major Facilitator Transporter YBR009C 1.79607489 0.160621987 -0.128225562 0.64736466 HHF1 Histone H4 (HHF1 and HHF2 code for identical proteins) YBR010W 0.269847874 0.520269233 -0.267808917 0.167146345 HHT1 Histone H3 (HHT1 and HHT2 code for identical proteins) YBR011C 0.711606067 0.094200466 0.487560056 0.077906597 IPP1 Inorganic pyrophosphatase YBR012C 0.020050112 0.961740639 -0.446376426 0.056950447 hypothetical protein YBR012W-A 0.92915986 0.054663881 0.458739681 0.025930922 TyA gag protein. Gag processing produces capsid proteins. The TyB Gag-Pol protein. Gag processing produces capsid proteins. Pol is cleaved to produce protease, reverse transcriptase, and integrase YBR012W-B 0.773827916 0.0389811 0.425029049 0.021804999 activities. YBR013C -0.1495441 0.5715657 -0.891616784 0.176515109 hypothetical protein YBR014C -0.41076534 0.117959158 -0.328502192 0.223802248 Glutaredoxin homolog YBR015C -0.29682379 0.107936446 0.82261182 0.018058492 MNN2 putative Golgi alpha-1,2-mannosyltransferase YBR016W -0.25382865 0.022234531 0.611211515 0.056973834 strong similarity to hypothetical proteins YDL012c and YDR210w YBR017C 0.664689855 0.106855369 0.255720225 0.063517032 KAP104 karyopherin beta 2, yeast transportin YBR018C -1.06276079 0.032440167 0.012997681 0.872951126 GAL7 galactose-1-phosphate uridyl transferase YBR019C -0.12604533 0.238774221 0.347151947 0.127300079 GAL10 UDP-glucose 4-epimerase YBR020W -0.55474059 0.016210963 -0.158015082 0.298445027 GAL1 galactokinase YBR021W 0.954354328 0.01878998 0.205890789 0.238395816 FUR4 uracil permease YBR022W 0.171306102 0.537296624 -0.349686836 0.001841431 hypothetical protein YBR023C 0.912263581 0.103935193 0.098668748 0.380427345 CHS3 chitin synthase 3 YBR024W -0.37180761 0.185577626 -0.224130893 0.118990855 SCO2 SCO1 protein homolog (S. cerevisiae) YBR025C -0.03253562 0.761316582 -0.334788143 0.025259256 probable purine nucleotide-binding protein YBR026C -1.79666811 0.001139509 -0.48834428 0.011001479 MRF1' Nuclear protein that binds to T-rich strand of core consensus sequence of autonomously replicating sequence YBR027C -0.31314044 0.383916149 0.438248599 0.092445593 hypothetical protein YBR028C -0.38795783 0.072758896 -0.181174175 0.043927954 Probable ser /thr-specific protein kinase, homolog to YKR2 and YPK1 (S. cerevisiae) YBR029C 1.873221503 0.202566076 0.439750334 0.025890012 CDS1 CDP-diacylglycerol synthase, CTP-phosphatidic acid cytidylyltransferase, CDP-diglyceride synthetase YBR030W 0.316712433 0.44526422 0.074472979 0.614228624 involved in inositol biosynthesis YBR031W 1.613544394 0.07541802 0.301061615 0.252079647 RPL4A Ribosomal protein L4A (L2A) (rp2) (YL2) YBR032W 1.575502204 0.339951907 0.793243286 0.144359497 hypothetical protein YBR033W -0.6757668 0.124799999 0.098550683 0.308753005 Probable regulatory Zn-finger protein, / homolog to YKL251 / YBR034C 2.228738544 0.203125817 -0.196495292 0.02866966 HMT1 nuclear protein arginine methyltransferase (mono- and asymmetrically dimethylating enzyme) YBR035C 0.130349129 0.80921713 0.13172004 0.328784715 PDX3 pyridoxine (pyridoxiamine) phosphate oxidase YBR036C 0.117417048 0.74068934 0.410956178 0.19827052 CSG2 contains 9 or 10 putative membrane spanning regions ; putative Ca2+ binding protein (homology to EF-hand Ca2+ binding site) YBR037C -0.17067536 0.570646079 0.105247342 0.414885441 SCO1 inner mitochondrial membrane protein YBR038W 0.305385214 0.644042442 0.282925941 0.398128117 CHS2 chitin synthase 2 YBR039W -0.59427459 0.08086054 0.001575296 0.966726017 ATP3 gamma subunit of mitochondrial ATP synthase YBR040W -0.00766125 0.989131704 0.778830158 0.523131592 FIG1 integral membrane protein YBR041W 0.436472937 0.314141745 0.289904233 0.04546478 FAT1 Fatty acid transporter YBR042C 0.242945218 0.666002818 -0.20606029 0.171424177 Probable membrane-bound small GTPase YBR043C 0.953943167 0.427049582 -0.075521683 0.353173974 similarity to benomyl/methotrexate resistance protein YBR044C 0.355155265 0.565508787 0.088443323 0.520230538 TCM62 mitochondrial protein ; (putative) chaperone YBR045C -0.58375387 0.209083688 -0.179532154 0.320474084 GIP1 putative Glc7 regulatory subunit YBR046C -0.50900369 0.078687096 -0.268805608 0.196696574 ZTA1 Homolog to quinone oxidoreductase (E. coli) YBR047W 0.345131914 0.214329255 -0.375710016 0.119849878 hypothetical protein YBR048W 0.603507542 0.135601762 0.102493926 0.627849268 RPS11B Ribosomal protein S11B (S18B) (rp41B) (YS12) YBR050C -2.74260779 0.001202836 -0.011903495 0.793037867 REG2 putative Glc7 regulatory subunit YBR051W -0.79954413 0.198635591 0.200747252 0.555528587 questionable ORF YBR052C -0.8837639 0.008813195 0.174626596 0.274162583 Homolog to YCR004, obr1 (S. pombe), trp repressor binding protein (E. coli) YBR053C -1.26196201 0.007530385 0.064568231 0.696539186 YBR054W -0.82416682 0.202367524 0.058253171 0.867115473 YRO2 Homolog to HSP30 heat shock protein YRO1 (S. cerevisiae) 7 YBR055C 0.065904703 0.47461113 -0.202555733 0.139190571 PRP6 RNA splicing factor YBR056W -1.83846967 0.000290729 -0.210984021 0.039238575 Homolog to glucan-1,3--glucosidase (EC 3.2.1.5 ; S. cerevisiae) 2 YBR057C 0.158454264 0.490280912 -0.566428757 0.108714877 MUM2 similar to ubiquitin C-terminal hydrolase, involved in meiosis YBR058C -0.19594084 0.322758995 -0.164023692 0.137950714 UBP14 Ubiquitin-specific protease YBR058C-A 0.558714653 0.129197159 0.109070903 0.250594504 TSC3 involved in sphingolipid biosynthesis YBR059C -0.34663956 0.363023316 -0.050829423 0.24066309 AKL1 Serine-threonine protein kinase YBR060C 0.27971224 0.531653043 -0.045186231 0.808705202 ORC2 origin recognition complex subunit 2 YBR061C 0.761585229 0.024965194 0.018200302 0.846360181 Homolog to ftsJ protein (E. coli) , / YCR054 / YBR062C 0.288290044 0.014632732 0.143601011 0.300327054 similarity to rat neurodegeneration associated protein 1 YBR063C -0.5003856 0.056147129 -0.656806607 0.011283221 Probable phosphopanthethein-binding protein YBR064W -0.34570159 0.402576203 0.046060395 0.886920932 questionable ORF YBR065C -0.2940729 0.363688044 -0.545170337 0.083682507 ECM2 (putative) involved in cell wall biogenesis and mRNA splicing YBR066C -0.40136934 0.47744334 -0.259366352 0.013534042 NRG2 homologue of NRG1 YBR067C 2.657290624 0.081659989 0.72893684 0.159134158 TIP1 cell wall mannoprotein YBR068C 1.13550092 0.1369263 0.318765583 0.082272981 BAP2 probable amino acid permease for leucine, valine, and isoleucine YBR069C 1.41986915 0.028245424 0.191598764 0.181834414 TAT1 Amino acid transport protein for valine, leucine, isoleucine, and tyrosine YBR070C 0.287654792 0.261069689 0.488579697 0.050932508 involved in osmotolerance YBR071W -0.23404102 0.135316418 0.14837919 0.017435005 hypothetical protein YBR072W -3.85355268 4.35429E-05 0.055242838 0.878228723 HSP26 heat shock protein 26 YBR073W 0.608580829 0.001122145 -0.12753796 0.410414866 RDH54 Putative helicase similar to RAD54 YBR074W -0.19530328 0.290335452 0.128192761 0.57522542 Homolog to aminopeptidase Y (S. cerevisiae) YBR075W -0.25958784 0.091043279 0.413375993 0.045078881 hypothetical protein YBR076W 1.684282025 0.193100244 0.559383528 0.162138918 ECM8 involved in cell wall biogenesis YBR077C 0.234624033 0.520606837 0.083520781 0.08062932 hypothetical protein YBR078W 0.634290106 0.458226343 0.744162625 0.020510107 ECM33 Homolog to sporulation specific protein SPS2 (S. cerevisiae) YBR079C 0.483314438 0.091929106 -0.020022852 0.790565166 RPG1 translation initiation factor eIF3 YBR080C 0.27960895 0.261880228 0.054506911 0.51489527 SEC18 cytoplasmic protein involved in protein transport between ER and Golgi ; ATPase YBR081C 0.015336017 0.901637858 -0.602169656 0.084527129 SPT7 transcription factor, member of the histone acetyltransferase SAGA complex YBR082C 0.745786076 0.215734436 0.458275415 0.052156525 UBC4 ubiquitin-conjugating enzyme YBR083W 0.377419467 0.234500318 0.371096396 0.091487714 TEC1 transcription factor of the TEA /ATTS DNA-binding domain family, regulator of Ty1 expression YBR084C-A 0.770050182 0.112341057 -0.104795619 0.566028018 RPL19A Ribosomal protein L19A (L23A) (rpl5L) (YL14) YBR084W 1.188056859 0.069026391 -0.132718809 0.233223694 MIS1 mitochondrial C1-tetrahydroflate synthase YBR085C-A -0.45963288 0.173741308 -0.115548995 0.121630525 YBR085W 0.775536388 0.315388654 -0.006882046 0.9720062 AAC3 mitochondrial ADP /ATP translocator YBR086C -0.51962399 0.013227985 0.514072473 0.011704358 IST2 Probable transmembrane protein YBR087W 0.366791886 0.080158132 -0.203183639 0.274914747 RFC5 Subunit 5 of Replication Factor C ; homologous to human RFC 38 kDa subunit YBR088C 0.582217388 0.430217799 0.172054271 0.147877261 POL30 Proliferating cell nuclear antigen YBR089C-A 0.353168257 0.001712314 -0.052165544 0.367424144 NHP6B 11-kDa nonhistone chromosomal protein YBR089W 0.502895686 0.47092082 -0.00422055 0.987306874 questionable ORF YBR090C-A 0.234674927 0.291935548 -0.135266362 0.047404854 NHP6B 11-kDa nonhistone chromosomal protein YBR091C 0.504693529 0.216331994 0.315297708 0.017157673 MRS5 Nuclear protein involved in mitochondrial intron splicing YBR092C 1.736442403 0.129025706 0.595934021 0.093824035 PHO3 Acid phosphatase, constitutive YBR093C 0.04984957 0.938038614 0.35220872 0.085780489 PHO5 Acid phosphatase, repressible YBR094W -0.42722508 0.162996742 -0.214104274 0.107077494 weak similarity to pig tubulin-tyrosine ligase YBR095C 0.009708822 0.962635018 -0.725473168 0.050087248 hypothetical protein YBR096W 1.074963895 0.37420027 -0.152282676 0.231555453 hypothetical protein YBR097W -0.114237 0.747320952 -0.03755605 0.341800838 VPS15 Myristoylated Serine /threonine protein kinase involved in vacuolar protein sorting YBR098W -0.01240989 0.97371254 -0.471351921 0.010062509 MMS4 putative transcriptional (co)activator for DNA damage YBR099C 0.168035608 0.814245141 0.466871476 0.069777313 weak similarity to T.brucei mitochondrion hypothetical protein 6 YBR100W 0.008731516 0.990177079 0.31732812 0.40871522 questionable ORF YBR101C 0.248460016 0.413730422 -0.142347219 0.261543905 weak similarity to S.pombe hypothetical protein SPBC3B9.01 YBR102C -0.17083911 0.592619313 -0.456775537 0.075861196 EXO84 Component of the exocyst complex ; homolog in rat brain called rExo84. YBR103W -0.08552846 0.629108182 -0.268252215 0.055159072 SIF2 535 amino acid protein containing 4 WD-40 repeats and a nuclear localization signal YBR104W 1.624948092 0.23686685 -0.305829446 0.036009706 YMC2 mitochondrial carrier protein YBR105C 2.185107187 0.324790108 0.399023242 0.026388571 VID24 peripheral vesicle membrane protein YBR106W 1.150168552 0.218305029 0.182319988 0.000366591 PHO88 regulator of Pho81, involved in regulating phosphate transport YBR107C -0.13651739 0.434793362 0.178345267 0.261216833 IML3 weakly similar to chitin synthases, involved in chromosomal segregation and mitosis YBR108W -0.4074947 0.226531476 0.555071992 0.093589902 Probable transcription factor YBR109C 0.468904245 0.030916527 0.149840856 0.389029838 CMD1 Calmodulin YBR110W 0.087676938 0.770914879 0.0151659 0.799135669 ALG1 beta-1,4-mannosyltransferase YBR111C -0.58976495 0.009540505 -0.238620354 0.037828356 YSA1 Homolog to serendipity protein (D. melanogaster) YBR112C -0.34174347 0.253248329 -0.111182611 0.374115035 CYC8 Transcription regulatory protein YBR113W 0.140320837 0.450798336 -0.054012496 0.72494431 questionable ORF YBR114W -0.29088133 0.191290459 0.001168098 0.9891889 RAD16 Radiation repair protein, putative DNA helicase YBR115C 0.967191336 0.317466492 0.385197467 0.146944543 LYS2 alpha aminoadipate reductase YBR116C -0.80811305 0.257222452 0.335862557 0.445169198 questionable ORF YBR117C -1.2675551 0.086050055 0.467605524 0.057156045 TKL2 transketolase, homologous to tkl1 YBR118W 0.784392039 0.113379642 0.571117676 0.052583248 TEF2 translational elongation factor EF-1 alpha YBR119W -0.30175105 0.270843113 -0.428445728 0.063364151 MUD1 U1 snRNP A protein YBR120C 0.144147453 0.0063578 -0.551668384 0.004814249 CBP6 Translational activator of COB mRNA YBR121C 0.973757136 0.066296132 0.312584642 0.125733917 GRS1 Glycyl-tRNA synthase YBR122C -0.0868928 0.553959129 -0.275073492 0.065433593 MRPL36 Mitochondrial ribosomal protein MRPL36 (YmL36) YBR123C -0.06468012 0.794681223 -0.072130675 0.796488601 TFC1 transcription factor tau (TFIIIC) subunit 95 YBR124W 0.147055961 0.696897079 0.360877443 0.21655836 questionable ORF YBR125C -0.10566963 0.455088005 0.132585626 0.350320599 PTC4 Type 2C protein phosphatase YBR126C -1.59513377 0.000235348 0.253060829 0.285855024 TPS1 56 kD synthase subunit of trehalose-6-phosphate synthase /phosphatase complex YBR127C 0.151899799 0.718318147 0.20003993 0.122565984 VMA2 vacuolar ATPase V1 domain subunit B (60 kDa) YBR128C -1.26969913 0.005563605 -0.054226244 0.560332521 APG14 involved in autophagy YBR129C -0.38589593 0.10676634 -0.624126925 0.046736002 OPY1 involved in mating pathway YBR130C 1.038823318 0.108846277 -0.199476763 0.375345651 SHE3 involved in cell polarity YBR131W 0.485247561 0.036200754 -0.249066232 0.072746414 CCZ1 involved in sporulation, caffeine, calcium, and zinc sensitivity YBR132C -1.20617204 0.008997214 0.500139776 0.143146781 AGP2 Amino acid permease YBR133C -0.00064304 0.996279319 0.369732782 0.150705474 HSL7 regulator of Swe1p kinase YBR134W -0.07990403 0.57447668 0.743239008 0.072579885 questionable ORF YBR135W 0.691560473 0.076914446 0.071993601 0.676545206 CKS1 subunit of the Cdc28 protein kinase YBR137W -0.32311625 0.305348182 -0.425401757 0.014491896 hypothetical protein YBR138C 0.136795656 0.4981847 -0.039309561 0.874119515 HDR1 High-Dosage Reductional segregation defective YBR139W -0.96543825 0.063276494 0.461400818 0.304871161 Probable serine-type carboxypeptidase (EC 3.4.16.1) YBR141C 0.591206019 0.08365463 0.034631733 0.781829905 hypothetical protein YBR142W 0.924343108 0.07339726 -0.580227207 0.057499394 MAK5 Probable pre-mRNA splicing RNA-helicase YBR143C 0.90735503 0.133972393 -0.319131944 0.046765953 SUP45 Homolog of eRF1 (eukaryotic Release Factor 1) in other metazoans. YBR144C 0.787480735 0.017024633 0.111093197 0.707300023 hypothetical protein YBR145W 1.69860482 0.199756232 0.314429383 0.17851089 ADH5 alcohol dehydrogenase isoenzyme V YBR146W 0.852689267 0.044002513 -0.427577062 0.005947323 MRPS9 Probable mitochondrial ribosomal protein S9 YBR147W 0.086878594 0.894271649 0.01857904 0.909256222 strong similarity to hypothetical protein YOL092w YBR148W 0.057009993 0.9378736 -0.505071738 0.016737578 YSW1 Spore-specific protein YBR149W -0.14603105 0.560710049 0.322233096 0.118067079 ARA1 D-arabinose dehydrogenase YBR150C -0.06849098 0.61877767 0.277404305 0.084780353 TBS1 Probable Zn-finger protein YBR151W 0.140882013 0.673956787 0.048499399 0.637535428 APD1 Actin Patches Distal YBR152W -0.31696976 0.186103218 -0.014294108 0.805824901 SPP381 U4 /U6.U5-associated snRNP protein ; contains a PEST proteolysis motif YBR153W 0.880774474 0.037629888 -0.137620267 0.430846051 RIB7 Riboflavin biosynthesis protein YBR154C 0.979098423 0.114884829 -0.678603044 0.069627695 RPB5 25-kDa RNA polymerase subunit (common to polymerases I, II and III) YBR155W 0.926643818 0.015741964 -0.423299063 0.192250705 CNS1 component of Hsp90p chaperone machinery YBR156C 0.621018615 0.041226544 -0.030346914 0.793541769 SLI15 Mitotic spindle protein involved in chromosome segregation. YBR157C -1.71986712 0.006172362 -0.248741575 0.085629762 ICS2 Increased Copper Sensitivity YBR158W 0.236090001 0.758909223 0.003422235 0.975268559 CST13 Chromosome STability protein YBR159W -0.40798658 0.146111319 -0.208230612 0.088504671 similarity to human 17-beta-hydroxysteroid dehydrogenase YBR160W 1.382688997 0.033637934 -0.089047975 0.31179147 CDC28 protein kinase catalytic subunit YBR161W -0.08785666 0.596919377 0.10257468 0.214915307 Homolog to suppressor of reduced viability of starvation (SUR1, S. cerevisiae) YBR162C 2.767805354 0.381081775 1.025781406 0.062845102 TOS1 similarity to hypothetical protein YJL171c YBR162W-A 1.090844591 0.12050417 -0.031166834 0.876106659 YSY6 involved in the secretory pathway YBR163W 0.083305197 0.771358216 -0.075321539 0.202356609 DEM1 Weak similarity to Pta1p (pre-tRNA processing protein) YBR164C 0.386971951 0.146788473 -0.30730063 0.279077924 ARL1 ADP-ribosylation factor-like protein 1 YBR165W 0.478450374 0.031594004 -0.110574637 0.068503035 UBS1 positive regulator of CDC34, involved in ubiquitin-mediated degradation YBR166C 1.077223888 0.119812637 -0.348329997 0.052540766 TYR1 Prephenate dehydrogenase (NADP+) YBR167C 0.725530505 0.085284247 -0.575616057 0.091172258 POP7 Pop7 protein, an integral subunit of RNase P and apparent subunit of RNase MRP YBR168W -0.33172247 0.013489087 -0.238383677 0.214573005 weak similarity to hypothetical protein YLR324w YBR169C -2.00430362 0.001309944 -0.237279361 0.207385649 SSE2 HSP70 family member, highly homologous to Sse1p YBR170C -0.38862164 0.009161953 -0.121312664 0.233974664 NPL4 Suppressor of SEC63 (S.cerevisiae), novel ER translocation component glycoprotein complexed with Sec62p and Sec63p in the Sec63 complex, an integral endoplasmic reticulum membrane protein complex YBR171W 0.465550263 0.391762515 -0.176381153 0.13428994 SEC66 required for translocation of presecretory proteins YBR172C 0.947045973 0.058028345 -0.240825609 0.324855802 SMY2 Kinesin-related protein suppressing myosin defects (MYO2) YBR173C 0.543487569 0.028689108 0.89073289 0.059037897 UMP1 20S proteasome maturation factor YBR174C -0.09574649 0.828021009 0.26542884 0.343600031 weak similarity to hypothetical protein YLR324w YBR175W 0.798115784 0.356656435 -0.050382926 0.123809345 Probable GTP-binding protein YBR176W 0.068803244 0.470897562 -0.394319913 0.027244144 ECM31 Alpha-Ketoisovalerate Hydroxymethyltransferase YBR177C -0.40821177 0.268763947 0.220857848 0.117486244 EHT1 alcohol acyl transferase YBR178W 0.171444756 0.6310156 0.259352923 0.551351751 questionable ORF homolog of Drosophila melanogaster fuzzy onions gene ; integral protein of the mitochondrial outer membrane which can be isolated as part of YBR179C 0.242929175 0.48422383 -0.167702237 0.424783503 FZO1 a high molecular weight complex YBR180W 0.497811941 0.321911208 -0.383876643 0.054128279 DTR1 dityrosine transporter MFS-MDR YBR181C 1.517480365 0.18681994 -0.277696415 0.046526669 RPS6B 40S ribosomal gene product S6B (S10B) (rp9) (YS4) YBR182C 1.07336623 0.32780709 0.107229696 0.503375908 SMP1 Probable DNA-binding transcription factor, Homolog to SRF /SL-2 YBR183W -0.32932225 0.100358245 0.024285921 0.81373346 YPC1 alkaline ceramidase with reverse activity YBR184W 0.532165774 0.05305851 -0.540524633 0.016569575 MEL1 alpha-galactosidase YBR185C -0.21994541 0.229580372 -0.395388433 0.0119799 MBA1 involved in assembly of mitochondrial respiratory complexes YBR186W 0.490784688 0.38844514 0.192577179 0.445672946 PCH2 Putative ATPase YBR187W 0.690417855 0.049928975 -0.257469763 0.087483562 probable membrane protein YBR188C 0.492925293 0.053081384 -0.025801954 0.86150773 NTC20 splicing factor YBR189W 0.950615102 0.051056367 0.047228918 0.81597576 RPS9B Ribosomal protein S9B (S13) (rp21) (YS11) YBR190W 0.854062672 0.084939876 0.106675398 0.396889145 questionable ORF YBR191W 0.575714408 0.535778578 0.080457252 0.439970647 RPL21A Ribosomal protein L21A YBR192W 0.509881138 0.005373514 -0.202658011 0.151330428 RIM2 Probable carrier protein, mitochondrial YBR193C -0.34403382 0.012995649 0.03899841 0.70048146 MED8 Stoichiometric member of mediator complex YBR194W 0.822733309 0.027278178 -0.138921462 0.204751803 hypothetical protein p50 subunit of the yeast omatin Assembly Factor-I (CAF-I) negative regulator of ras-mediated cAMP induction ; homologous to beta subunit of YBR195C 0.225699086 0.306618626 0.036364069 0.407332903 MSI1 GTP-binding proteins YBR196C 1.367685111 0.219334764 0.633114599 0.120857313 PGI1 Glucose-6-phosphate isomerase YBR197C -0.38684265 0.205152386 0.138519858 0.310187653 YBR198C -0.5545939 0.044090014 -0.139263158 0.110161572 TAF90 Probable transcription-associated factor protein, probable -transducin type YBR200W -0.15441417 0.540836335 -0.262692526 0.109752107 BEM1 contains two SH3 domains YBR201W 0.056424906 0.888422959 -0.235405671 0.187107537 DER1 involved in degradation in the ER YBR203W -0.33775006 0.576361511 -0.2045828 0.089979675 hypothetical protein YBR204C -0.90498283 0.00040729 -0.360269663 0.102683009 Probable serine-active lipase, peroxisomal (EX 3.1.1.-) YBR205W -0.27879779 0.043595084 0.018995774 0.840490764 KTR3 Putative alpha-1,2-mannosyltransferase YBR206W 0.318754718 0.295731593 0.345147806 0.229701265 questionable ORF YBR207W 0.242939647 0.453039051 0.107702995 0.194904608 FTH1 probable membrane protein YBR208C -0.88846186 0.148064307 0.245161263 0.391157674 DUR1,2 Urea amidolyase (contains urea carboxylase and allophanate hydrolase) YBR209W 2.248661321 0.297551441 0.381258931 0.281716371 hypothetical protein YBR210W 0.940789823 0.054030573 0.313341233 0.206973905 strong similarity to D.melanogaster cornichon protein YBR211C -0.31232008 0.154179443 -0.349551777 0.068109672 AME1 regulator of microtubule stability YBR212W -0.16875438 0.27183768 0.70435044 0.055337423 NGR1 negative growth regulatory protein YBR213W 0.273519351 0.582528693 0.202209774 0.245502392 MET8 Effector in the expression of PAPS reductase and sulfite reductase YBR214W -0.57347024 0.126908367 -0.125397825 0.063363362 SDS24 nuclear protein similar to pombe sds23 YBR215W 0.017037639 0.945053353 -0.372937798 0.19145978 HPC2 highly charged, basic protein YBR216C -0.00884559 0.953941411 -0.167736664 0.234462904 strong similarity to hypothetical protein YGL060w YBR217W -0.29756814 0.097019236 -0.832730836 0.036759735 APG12 involved in autophagy YBR218C -1.09366079 0.009460379 0.31101953 0.03629335 PYC2 pyruvate carboxylase YBR219C 0.335357966 0.235666601 0.453103199 0.146167607 YBR220C -0.14753261 0.152773414 0.043535552 0.58680398 similarity to human acetyl-coenzyme A transporter YBR221C 0.665723843 0.023979323 0.345653586 0.090351575 PDB1 beta subunit of pyruvate dehydrogenase (E1 beta) YBR222C 0.177197636 0.328760318 0.523832581 0.115135526 FAT2 Probable AMP-binding protein YBR223C -0.36083419 0.162988917 0.236622488 0.091031072 hypothetical protein YBR224W 0.533319791 0.523528918 -0.105555358 0.450829681 questionable ORF YBR225W -0.45521538 0.133909158 0.149731073 0.12255293 hypothetical protein YBR226C -0.1493116 0.540340059 0.398830403 0.134948712 questionable ORF YBR227C -0.02690793 0.804430878 -0.542974523 0.06158401 MCX1 Mitochondrial ATP-binding protein, similar to ClpX YBR228W -0.15251099 0.540466654 -0.30761674 0.088148112 similarity to hypothetical A.thaliana protein YBR229C -0.65280659 0.004625347 0.346345079 0.066488919 ROT2 Glucosidase II YBR230C -1.32094486 0.005924621 0.609470924 0.098929907 hypothetical protein YBR231C -0.19457994 0.205157819 -0.12528603 0.492388082 AOR1 Actin Overexpression Resistant YBR232C -0.25897947 0.337666247 -0.256882124 0.220949911 questionable ORF YBR233W 0.298632757 0.196470769 -0.167429571 0.303627903 PBP2 Homolog to human hnRNP complex K protein YBR234C -0.15061112 0.59134678 0.327554697 0.154113499 ARC40 component of Arp2 /Arp3 protein complex YBR235W -0.51010999 0.136185575 0.324796317 0.268142217 similarity to bumetanide-sensitive Na-K-Cl cotransport protein YBR236C -0.19651971 0.061628045 -0.424220761 0.074955691 ABD1 RNA (guanine-7-)methyltransferase (cap methyltransferase) YBR237W -0.04008757 0.626709146 -0.669193526 0.026466683 PRP5 RNA helicase homolog YBR238C 1.051169484 0.099958654 0.041128377 0.699872898 strong similarity to general chromatin factor Spt16p YBR239C -0.07996564 0.770885499 0.202238628 0.315917042 Probable Zn-finger protein YBR240C 0.721961605 0.06041823 0.08649645 0.403227564 THI2 Probable Zn-finger protein YBR241C -0.76927116 0.145479129 1.14753597 0.115479885 Probable sugar transport protein YBR242W 0.224206378 0.436104651 -0.246551427 0.166744907 Probable ATP /GTP-binding protein YBR243C 0.126453815 0.601538183 0.511759088 0.087117753 ALG7 UDP-N-acetyl-glucosamine-1-P transferase (GPT) YBR244W -0.04024886 0.876819875 -0.116780138 0.370779064 GPX2 Probable glutathione peroxidase (EC 1.11.1.9) YBR245C -0.13301951 0.656090366 -0.071741569 0.452528359 ISW1 ATPase component of a four subunit chromatin remodeling complex YBR246W 0.388094181 0.115107815 0.389870478 0.015081075 hypothetical protein YBR247C 0.806603288 0.088880609 -0.254803962 0.212989418 ENP1 Putative 57 kDa protein with an apparent MW of 70 kDa by SDS-PAGE YBR248C 0.653441412 0.163592168 -0.191623286 0.181164198 HIS7 glutamine amidotransferase:cyclase, also called imidazole glycerol phosphate synthase YBR249C 1.348261644 0.153199225 0.032589822 0.736940757 ARO4 3-deoxy-D-arabino-heptulosonate 7-phosphate (DAHP) synthase isoenzyme YBR250W 0.224285641 0.140766893 0.073786024 0.397492969 hypothetical protein YBR251W -0.11786867 0.494992133 -0.507917338 0.045434132 MRPS5 Probable mitochondrial ribosomal protein S5 YBR252W 1.903287036 0.147563507 0.458420776 0.017844943 DUT1 dUTP pyrophosphatase (dUTPase) YBR253W -0.14706684 0.324101008 -0.219063569 0.388466951 SRB6 transcription factor, part of Srb /Mediator complex YBR254C 0.639546525 0.287172459 -0.24298537 0.173539408 TRS20 TRAPP subunit of 20 kDa involved in targeting and fusion of ER to golgi transport vesicles YBR255W -0.41858626 0.152901982 -0.202385797 0.056861948 hypothetical protein YBR256C 0.930878649 0.187486647 -0.755503374 0.004847495 RIB5 Riboflavin synthase alpha-chain YBR257W 0.494753717 0.121237704 -0.462654215 0.111724708 POP4 protein component of RNase MRP and RNaseP YBR258C 0.725078695 0.030760877 -0.380549217 0.163616798 hypothetical protein YBR259W -0.24135173 0.069161552 -0.575328244 0.013191416 hypothetical protein YBR261C 0.539891551 0.272526166 0.185642064 0.109354215 similarity to hypothetical S. pombe protein YBR262C 1.000878929 0.014189283 0.034411521 0.72352909 questionable ORF YBR263W 0.150391027 0.622692791 0.271419058 0.293089621 SHM1 Serine hydroxymethyltransferase, mitochondrial YBR264C 0.007710954 0.984647757 -0.012657818 0.933117184 YPT10 similar to Rab proteins and other small GTP-binding proteins YBR265W 0.113829029 0.660366462 0.302990222 0.414465599 TSC10 3-ketosphinganine reductase YBR266C 1.120137295 0.004583262 -0.302187127 0.115279102 probable membrane protein YBR267W 1.63309769 0.012759847 -0.218004739 0.194116482 Probable Zn-finger protein (C2H2 type) YBR268W 0.962401766 0.003472891 0.027069757 0.816614251 MRPL37 Probable mitochondrial protein L37 YBR269C 0.014617611 0.909089789 0.406037746 0.069260539 hypothetical protein YBR270C -0.72538404 0.019767546 0.832718798 0.187401744 Probable ATP /GTP-binding protein YBR271W 0.173871886 0.205547877 -0.200456239 0.480922068 weak similarity to S.pombe uvi22 protein and hypothetical protein YNL024c YBR272C -0.49903178 0.039523648 -0.40658334 0.062265263 HSM3 mismatch repair protein /Hsm3p may be a member of the yeast MutS homolog family YBR273C -0.22105569 0.42890499 -0.1992883 0.20643045 YBR274W -0.40407486 0.114561032 -0.08893171 0.240788722 CHK1 Protein kinase Chk1 YBR275C 0.035634114 0.696102795 -0.04309139 0.807197749 RIF1 RAP1-interacting factor, involved in establishment of repressed chromatin YBR276C -0.33622662 0.135679939 -0.283470679 0.058195793 PPS1 dual specificity protein phosphatase YBR277C -0.26031884 0.290686091 -0.49239054 0.103704148 questionable ORF YBR278W -0.69552819 0.005303882 -0.447940644 0.074334828 DPB3 C and C' subunits of DNA polymerase II YBR279W 0.38369094 0.085309425 -0.485132906 0.233939856 PAF1 RNA polymerase II-associated protein YBR280C -0.9340368 0.043841773 0.035173859 0.667366308 hypothetical protein YBR281C 0.650829088 0.006817527 -0.022736831 0.750042188 Probable G-protein, -transducin type YBR282W 0.71505966 0.030645507 -0.464903536 0.080006278 MRPL27 Mitochondrial ribosomal protein MRPL27 (YmL27) YBR283C 0.892968455 0.073360951 0.823994118 0.017031024 SSH1 Probable SEC61 protein homolog YBR284W 0.019696592 0.963814119 0.045369302 0.551470936 similarity to AMP deaminase YBR285W -2.66001153 6.84735E-05 0.074298437 0.739763547 hypothetical protein YBR286W 0.251657324 0.243028097 0.566023743 0.182158267 APE3 Aminopeptidase yscIII YBR287W -0.18629357 0.74271645 0.355482309 0.235650164 similarity to hypothetical S. pombe protein YBR288C 0.750492999 0.217497619 -0.43257038 0.011643298 APM3 clathrin associated protein medium chain YBR289W -0.09826974 0.227247394 -0.233803768 0.049502185 SNF5 subunit of the chromatin remodeling Snf /Swi complex YBR290W 0.123035172 0.70556047 -1.127418439 0.046042061 BSD2 copper transporter YBR291C 2.181933332 0.241168804 -0.01129882 0.793295319 CTP1 citrate tranporter in mitochondrial inner membrane YBR292C 1.038407015 0.009510833 0.549401791 0.026657493 hypothetical protein YBR293W 0.386585146 0.050566207 -0.194228969 0.196222353 Probable multidrug resistance protein YBR294W -0.28798904 0.536211905 0.162073537 0.148736468 SUL1 Probable sulfate transport protein YBR295W 0.043871521 0.890476153 0.203627048 0.495255943 PCA1 Putative P-type Cu(2+)-transporting ATPase YBR296C -1.31625401 0.187575662 0.351496454 0.340942012 PHO89 Probable Na+ /Pi symporter YBR297W 0.428669808 0.329587918 0.249924475 0.022039665 MAL33 MAL-activator protein YBR298C -1.1710578 0.000745128 0.149218054 0.223507479 MAL31 Maltose permease YBR299W -0.81784101 0.016099907 0.027859457 0.875036619 MAL32 Maltase YBR300C -0.07515303 0.792152865 0.094764948 0.703543927 strong similarity to hypothetical protein YGR293c YBR301W -0.02853428 0.869233629 0.556361717 0.182610168 strong similarity to members of the Srp1p/Tip1p family YBR302C 0.071979462 0.870739718 -0.041588696 0.834063255 COS2 similar to other members of the Cos family, coded from subtelomeric region YCL002C 0.233291813 0.156894345 0.344533981 0.157793204 strong similarity to Saccharomyces pastorianus hypothetical protein LgYCL002c YCL004W -0.13653197 0.620223287 -0.028131853 0.666835756 PGS1 17 kDa phosphatidylglycerolphosphate synthase YCL005W 0.461090315 0.005712551 0.48275224 0.03849604 strong similarity to Saccharomyces pastorianus hypothetical protein LgYCL005w YCL007C 0.701381923 0.101478718 -0.226348843 0.070920354 CWH36 involved in cell wall biogenesis YCL008C 0.427867786 0.526864047 0.43339347 0.330065286 STP22 homologous to mouse and human Tsg101 tumor susceptibility genes YCL009C 0.40693392 0.502156255 0.342661335 0.026809035 ILV6 Small regulatory subunit of Acetolactate synthase YCL010C -0.25944003 0.542622163 -0.141020782 0.341088617 strong similarity to Saccharomyces pastorianus hypothetical protein LgYCL010c YCL011C -0.19722557 0.367221833 -0.11119195 0.240098603 GBP2 Protein with RNA recognition motifs YCL012W -0.53232875 0.136650404 0.36029898 0.046606299 part of budding protein Bud3p due to frameshift in DNA sequence YCL014W -0.00251603 0.994411539 -0.092927205 0.240243771 BUD3 Cell cycle regulated protein required for axial bud formation ; co-assembles with Bud4p at bud sites//budding protein YCL016C -0.37237138 0.076755229 0.173709625 0.401282592 DCC1 part of an alternative RFC complex YCL017C -0.24772129 0.191560122 -0.108234278 0.411776702 NFS1 regulates Iron-Sulfur cluster proteins, cellular Iron uptake, andIron distribution/NifS-like protein YCL018W -0.38889057 0.063534112 -0.121694107 0.301365363 LEU2 beta-IPM (isopropylmalate) dehydrogenase YCL019W 0.103855538 0.837669267 0.05087852 0.759636108 POL polyprotein YCL020W -0.09272221 0.651705871 -0.081297813 0.348182926 GAG polyprotein YCL022C -0.08161966 0.757833619 0.418620694 0.226747228 questionable ORF YCL023C 0.253790421 0.167299553 0.057655581 0.693748043 questionable ORF YCL024W -0.03007074 0.875206698 0.262926667 0.411772502 KCC4 protein kinase related to S. pombe Nim1p YCL025C -0.03632079 0.961295667 -0.229308228 0.624638235 AGP1 Amino acid permease YCL028W -0.13823754 0.363795652 0.197423864 0.020100272 RNQ1 transferable epigenetic modifier YCL029C 0.318326618 0.216060985 -0.16871408 0.4775348 BIK1 Microtubule-binding protein YCL030C -0.39340505 0.15107762 0.00164512 0.98196901 HIS4 histidinol dehydrogenase YCL031C 1.111253494 0.054141835 -0.732044438 0.092436232 RRP7 involved in rRNA processing YCL032W -0.04067269 0.829594532 0.029963522 0.769765063 STE50 possesses a SAM (sterile alpha motif) ; interacts with G protein and Ste11p//pheromone response pathway protein YCL033C -0.57877739 0.01617187 0.355918796 0.275674357 Transcription regulator YCL034W -0.7882154 0.009147107 0.163242568 0.343240181 similarity to hypothetical S.pombe protein YCL035C -0.27652739 0.575274358 0.051237264 0.72682063 GRX1 Glutaredoxin YCL036W -0.42872205 0.248571554 0.078957981 0.324033565 similarity to hypothetical protein YDR514c YCL037C 0.779786056 0.040403754 0.870911652 0.021547099 SRO9 RNA binding protein with La motif YCL038C -1.06235976 0.04592205 0.33559446 0.353270236 Membrane transporter YCL039W -0.91461348 0.016720432 0.385747537 0.014334748 regulatory protein YCL040W -1.09899477 0.000430123 0.136285383 0.630780745 GLK1 Glucokinase YCL042W -0.90472203 0.092506085 0.511993027 0.183101984 questionable ORF YCL043C -0.13561567 0.274279895 0.564921772 0.169640252 PDI1 protein disulfide isomerase YCL044C -0.12153399 0.798492919 0.324842289 0.184231221 hypothetical protein YCL045C 0.173704409 0.200526478 0.435608878 0.110175692 weak similarity to human ORF YCL046W -0.07510615 0.789396175 0.566988608 0.078848018 questionable ORF YCL047C -0.3436443 0.063047287 -0.350082851 0.027216203 hypothetical protein YCL048W -0.293194 0.118608193 -0.171432712 0.309459232 strong similarity to sporulation-specific protein Sps2p YCL049C -0.22736916 0.581455376 0.020090451 0.92124291 hypothetical protein YCL050C 1.200711575 0.177532507 0.372834751 0.029229123 APA1 diadenosine 5',5'''-P1,P4-tetraphosphate phosphorylase I YCL051W -0.05622379 0.543067464 -0.109475829 0.219411515 LRE1 involved in laminarase resistance YCL052C -0.25745447 0.289108271 -0.077160051 0.371869631 PBN1 Protease B, nonderepressible form YCL054W 1.504395251 0.061598507 -0.774518773 0.052048578 SPB1 Putative methyltransferase YCL055W 0.311924176 0.510663765 -0.239812236 0.116107645 KAR4 transcription factor involved in karyogamy YCL056C 0.188672916 0.209921488 -0.250851317 0.169595348 hypothetical protein YCL057W -0.45213136 0.107207335 0.257159891 0.346861644 PRD1 Saccharolysin (oligopeptidase yscD) YCL058C 0.442706384 0.131742991 0.274005591 0.090164441 hypothetical protein YCL059C 0.528020464 0.008328001 -1.237610027 0.020166823 KRR1 involved in cell division and spore germination YCL061C -0.68262457 0.16764337 -0.753950305 0.023443596 MRC1 similarity to URK1 YCL063W 0.645438708 0.2300253 0.655050216 0.173555279 weak similarity to yeast translation regulator Gcd6p YCL064C 0.406197902 0.3093267 -0.438401288 0.14835045 CHA1 catabolic serine (threonine) dehydratase YCL065W 0.708566031 0.174876713 0.689610607 0.064783199 hypotetical protein YCL066W -0.02091115 0.966127771 0.676956446 0.191334011 HMLALPHAtranscription factor involved in the regulation of alpha-specific genes YCL067C -0.33754707 0.193582361 -0.924582742 0.053504917 HMLALPHAMating type protein alpha-2 YCL068C -0.76551595 0.00313142 0.274495019 0.318174445 Bud site selection YCL069W -0.75048818 0.063417731 -0.295665528 0.16175713 strong similarity to drug resistance protein SGE1 YCL073C -0.60325134 0.033602912 -0.052911804 0.868177814 strong similarity to subtelomeric encoded proteins YCL074W -0.0852562 0.811691383 1.12931772 0.348460437 Psuedogene: encodes fragment of Ty Pol protein /Reverse transcriptase YCL075W 1.46202347 0.487165713 0.08819935 0.681675808 Homologous to a portion of the Aspartic protease signature Copia /TY1 family transposons. YCL076W 0.64036824 0.57239636 0.089049526 0.303716763 Hypothetical ORF YCR001W -0.3313965 0.210258611 -0.457339037 0.081897193 weak similarity to chloride channel proteins YCR002C 0.930211987 0.191963991 -0.126857473 0.07795437 CDC10 conserved potential GTP-ginding protein YCR003W 0.66865384 0.209152325 -0.473828324 0.016039911 MRPL32 Mitochondrial ribosomal protein MRPL32 (YmL32) YCR004C -0.13772514 0.610062347 0.139599795 0.224666739 YCP4 FMN-binding protein YCR005C 1.776528791 0.354902569 0.183943024 0.459115728 CIT2 non-mitochondrial citrate synthase YCR006C 0.542087517 0.026848639 0.152312598 0.260846156 YCR007C 0.420906915 0.565117946 -0.450712013 0.113672069 YCR008W -0.08060751 0.699158057 0.424926519 0.032871485 SAT4 Ser /Thr protein kinase YCR009C -0.1576904 0.627393721 -0.356895363 0.063043436 RVS161 Reduced viability on starvation protein RVS161 YCR010C -0.37401683 0.50646338 0.533083263 0.046227535 SPG2 YCR012W 0.852054817 0.470592487 0.485390872 0.169738623 PGK1 3-phosphoglycerate kinase YCR013C 1.350276059 0.325305903 0.508463498 0.209038001 YCR014C -0.77165546 0.012240252 -0.293423305 0.178980165 POL4 DNA polymerase IV YCR015C 0.48659745 0.132075289 -0.419248327 0.214641669 YCR016W 1.006874197 0.202729787 -0.923279026 0.04279018 YCR017C -0.10110951 0.555578847 0.458468047 0.098755146 YCR019W -0.36423501 0.108346278 0.122014611 0.139665519 MAK32 MAK32 sugar kinase YCR020C 3.077502622 0.237442646 0.298837156 0.052664577 PET18 Transcription regulator YCR020C-A 0.492002206 0.155352846 0.326280024 0.188951564 MAK31 MAK31 snRNP YCR020W-B -0.04011701 0.817708447 -0.863556984 0.039449987 HTL1 high-temperature lethal YCR021C -3.1082561 4.92928E-05 0.144669705 0.583608489 HSP30 Protein induced by heat shock, ethanol treatment, and entry into stationary phase ; located in plasma membrane YCR022C 1.233984543 0.023754963 0.414354646 0.149099618 hypothetical protein YCR023C -0.74423643 0.019299375 -0.07230973 0.233072767 Membrane transporter YCR024C 0.447688975 0.102292302 0.078933764 0.009344502 Asn-tRNA synthetase YCR025C 0.10125868 0.685133914 0.478780262 0.318801347 hypothetical protein YCR027C 0.296522896 0.131750957 -0.291018028 0.066757938 RSG1 rheb-like Gene involved in growth regulation/GTP-binding protein, ras family YCR028C -0.02599689 0.918110804 -0.099231143 0.119900367 FEN2 Amino acid permease YCR028C-A 0.213248895 0.644053146 0.343367676 0.005161637 RIM1 Single-stranded zinc finger DNA-binding protein YCR030C -0.94376038 0.029642486 0.509101594 0.012033517 YCR033W 0.174662719 0.2073373 0.147838891 0.18799601 similarity to nuclear receptor co-repressor N-Cor YCR034W 1.744009443 0.244683841 0.648708104 0.030562849 FEN1 Probable subunit of 1,3-beta-glucan synthase ; homolog of ELO1 YCR035C 0.494679342 0.016675749 -0.502418016 0.019026857 RRP43 Component of the exosome 3->5 exoribonuclease complex with Rrp4p, Rrp41p, Rrp42p and Dis3p (Rrp44p). YCR036W -0.09699581 0.649902206 -0.164009429 0.110375676 RBK1 ribokinase YCR037C 0.72709016 0.047120443 0.103587555 0.308690359 PHO87 phosphate permease YCR038C -0.42881356 0.189090967 0.280656296 0.117446151 BUD5 GTP /GDP exchange factor for Rsr1 protein YCR039C -0.23985913 0.018668122 -0.856749087 0.056321313 MATALPHA Mating type protein alpha-2 YCR040W 0.626259016 0.109702101 -0.070031617 0.81789174 MATALPHA transcription factor involved in the regulation of alpha-specific genes YCR041W 0.582362057 0.140822515 0.508767954 0.100165639 questionable ORF YCR042C 0.01135124 0.954434545 0.524735777 0.02708746 TSM1 TATA binding protein-associated factor (TAF) YCR043C 1.260961237 0.20575485 0.08769803 0.233125092 hypothetical protein YCR044C 0.217803182 0.265515222 0.430766664 0.169778001 PER1 Protein Processing in the ER YCR046C 0.823583115 0.172343225 0.130757379 0.025919264 IMG1 mitochondrial ribosomal protein YCR047C 0.29163712 0.370007416 0.318764826 0.031013533 Protein carboxyl methylase YCR048W 0.2736226 0.135605408 0.186640495 0.387662825 ARE1 Acyl-CoA cholesterol acyltransferase (sterol-ester synthetase) YCR049C 0.452885473 0.258362692 0.486339687 0.057395929 questionable ORF YCR050C 0.332825636 0.359414438 0.365424844 0.169781668 questionable ORF YCR051W 0.729831146 0.054996047 0.066904471 0.213159132 weak similarity to ankyrins YCR052W 0.114326729 0.272102128 0.171944294 0.121399176 RSC6 subunit of chromatin remodeling complex CTR86 shares a terminator region with THR4. CTR86 contains aGCN4 responsive site suggesting it may also be involved in amino acid YCR054C 0.383871933 0.147082978 -0.230720553 0.255024422 CTR86 biosynthesis. YCR057C 0.614686667 0.098949828 -0.182083188 0.2295728 PWP2 regulatory protein YCR059C 1.210109557 0.113528924 0.317163538 0.022490846 PMN1 piecemeal microautophagy of the nucleus (PMN) YCR060W 1.198922074 0.010400307 0.453599977 0.046926503 regulatory protein YCR061W -0.82105488 0.117511854 1.116690939 0.017054438 similarity to YTP1 YCR063W -0.29770553 0.606713447 0.418311719 0.264234762 similarity to Ytp1p protein YCR064C 1.039972722 0.065212513 0.913456205 0.029520564 G10-like protein YCR065W 0.673880225 0.054667552 0.405328291 0.007542787 YCR066W 0.025516194 0.962703441 0.516519352 0.320265801 HCM1 Transcription factor (fork head domain) YCR067C 0.142378538 0.123206814 0.336715903 0.267378725 SED4 Intracellular transport protein YCR068W -0.80397063 0.11462737 0.37869312 0.177922051 CVT17 Putative lipase required for the breakdown of Cvt bodies and autophagic bodies YCR069W -0.86602745 0.025209687 0.261420162 0.209173833 SCC3 cyclophilin homolog YCR071C 0.556108762 0.068767776 -0.055227192 0.658277811 IMG2 similar to Drosophila gonadal protein Z600 ; involved in mitochondrial DNA maitenance YCR072C 1.002167013 0.054659606 0.141691365 0.016054417 regulatory protein YCR073C 0.758618783 0.044606551 0.400324147 0.121081632 SSK22 protein kinase YCR073W-A -1.40461228 0.002558076 0.144508113 0.017198388 SOL2 shows similarity to glucose-6-phosphate dehydrogenase non-catalytic domains ; homologous to Sol1p and Sol3p YCR075C -1.25273988 0.00124749 0.491906314 0.042820992 ERS1 ERS1 protein, ER defect supressor YCR076C -0.71070684 0.015086607 0.488428686 0.198802405 hypothetical protein YCR079W -0.70112461 0.004146691 0.217787921 0.06231288 weak similarity to A.thaliana protein phosphatase 2C YCR081W 0.453559115 0.024412369 -0.148265434 0.169783944 SRB8 RNA polymerase II mediator subunit YCR082W -1.00504096 0.023438456 0.088433033 0.550230499 weak similarity to Rbk1p YCR083W -0.71152747 0.036551603 -0.291894008 0.01313871 TRX3 mitochondrial thioredoxin YCR084C 0.175901265 0.723133174 0.371075446 0.209697284 TUP1 glucose repression regulatory protein, exhibits similarity to beta subunits of G proteins YCR085W 0.862744523 0.082992925 0.019296688 0.950372471 hypothetical protein YCR086W 0.319115765 0.005084262 0.185000118 0.285505869 involved in nuclear migration YCR087C-A 1.077630492 0.030298282 -0.162116909 0.424261789 nucleic acid-binding protein YCR087W 1.010533486 0.118125123 0.305564029 0.213396059 questionable ORF YCR088W -0.89560588 0.047273951 0.187194347 0.586488573 ABP1 Actin binding protein YCR090C 1.004158898 0.025376236 -0.210386114 0.276899692 similarity to S. pombe SPBC2D10.03c Putative serine /threonine protein kinase most similar to cyclic nucleotide-dependent protein kinase subfamily and the protein kinase C YCR091W -1.22700723 0.005061876 0.205238193 0.338362658 KIN82 subfamily mutS homolog, forms a complex with Msh2p to repair insertion-deletion mispairs ; redundant with Pms3 /Msh6p in repair of insertion-deletion YCR092C -0.48347992 0.038813832 -0.187584544 0.049491282 MSH3 mispairs YCR094W -0.16620501 0.261431398 -0.285105037 0.126496125 CDC50 involved in cell cycle YCR095C -0.36993185 0.052374615 -0.800845227 0.01132401 similarity to Saccharomyces kluyveri strain NRRL Y-12651 YCR096C -0.17214299 0.08095577 -0.74149727 0.107177301 A2 Regulatory protein MATa2p (no known function) ; sequence is the same as the last 119 residues of MATalpha2p YCR098C -1.94254856 0.018159179 -0.393662324 0.013573311 GIT1 permease involved in the uptake of glycerophosphoinositol (GroPIns) YCR099C 0.284621132 0.587360871 -0.310666219 0.044815525 strong similarity to Pep1p, VTH1p and VTH22p YCR100C -0.07674588 0.887484474 -0.422956421 0.022677252 strong similarity to Pep1p, VTH1p and VTH22p YCR101C 0.158376681 0.673935418 -0.386967163 0.237267841 strong similarity to Pep1p, VTH1p and VTH22p YCR102C -0.59362917 0.061112722 0.13615273 0.398950074 similarity to C.carbonum toxD gene/Alcohol dehydrogenase YCR102W-A -1.05493453 0.075783869 -0.145376569 0.633612528 similarity to other hypothetical yeast proteins YCR104W -0.14532619 0.619474161 0.715360618 0.036495203 PAU3 similar to bovine alcohol dehydrogenase YCR105W -0.01632391 0.932642718 0.392672763 0.004834737 strong similarity to alcohol dehydrogenases YCR106W -0.41795945 0.014914755 0.013245331 0.917591091 similarity to transcription factor YCR107W -0.58514312 0.007381135 -0.02979112 0.846921522 AAD3 hypotetical aryl-alcohol dehydrogenase YDL001W 0.1360533 0.220182656 -0.409283669 0.243922278 similarity to hypothetical protein YFR048w, YDR282c and S.pombe hypothetical protein SPAC12G12.14 YDL002C -0.12418124 0.445376635 -0.83210355 0.043303102 NHP10 HMG1-box containing protein YDL003W 0.813712227 0.256263265 -0.192665886 0.54619669 MCD1 involved in mitosis, similar to pombe Rad21 YDL004W -0.42881752 0.299618391 0.109365679 0.155864744 ATP16 ATP synthase delta subunit YDL005C -0.08304329 0.577141277 -0.545539827 0.121383189 MED2 Stoichiometric member of mediator complex YDL006W 0.100381614 0.450165922 -0.215091024 0.145233855 PTC1 serine-threonine protein phosphatase YDL007W 0.055197529 0.763800874 -0.285700588 0.066605889 RPT2 (putative) 26S protease subunit YDL008W 0.018487675 0.921955505 -0.108159954 0.059471716 APC11 subunit of the anaphase promoting complex (APC) YDL009C -0.04094151 0.778351459 -0.345898871 0.014787019 questionable ORF YDL010W -0.41777237 0.133882837 -0.291335413 0.185763163 similarity to hypothetical protein YBR014c and glutaredoxins YDL011C 0.383585303 0.508087685 0.204121684 0.308381685 questionable ORF YDL012C 0.526862852 0.001410657 0.481652605 0.091998147 strong similarity to hypothetical protein YBR016w and YDR210w YDL013W 0.175418718 0.600074562 -0.021852544 0.90099832 HEX3 involved in hexose metabolism YDL014W 1.217127816 0.017378388 0.23986913 0.014376917 NOP1 nucleolar protein, homologous to mammalian fibrillarin YDL015C 0.333796754 0.343676045 0.248456774 0.077970126 similarity to rat synaptic glycoprotein SC2 YDL016C 0.754175511 0.124127131 0.607221245 0.02758052 questionable ORF YDL017W 0.719726282 0.007000915 -0.19292024 0.307522 CDC7 serine /threonine protein kinase YDL018C -0.12000345 0.219699484 -0.108893169 0.475777536 ERP3 p24 protein involved in membrane trafficking YDL019C -0.91686783 0.02784184 0.07094429 0.226825342 OSH2 OSbp Homologue (OSBP stands for Oxysterol binding protein) YDL020C -0.47787199 0.075415567 -0.309636299 0.058940539 RPN4 ubiquitin-mediated 26S proteasome subunit YDL021W -2.17789304 0.000219858 -0.684971798 0.016677876 GPM2 phosphoglycerate mutase, involved in glycolysis YDL022W -2.23984101 0.000421514 -0.162893838 0.214924251 GPD1 glycerol-3-phosphate dehydrogenase YDL023C -1.85019518 0.011392282 0.167938137 0.445908394 questionable ORF YDL024C -0.97330092 0.013770959 0.064090577 0.814963653 DIA3 strong similarity to acid phosphatase/Digs Into Agar YDL025C -0.01419232 0.969460342 -0.007939275 0.893996806 similarity to probable protein kinase NPR1 YDL026W -1.02525755 0.010350438 0.078784311 0.565144044 questionable ORF YDL027C -1.0092284 0.003268983 -0.057018308 0.368915526 hypothetical protein serine /threonine /tyrosine protein kinase (dual specificity), able to autophosphorylate as well as act on Mad1p. A mutation predicted to abolish YDL028C -0.10795617 0.562733286 -0.509010424 0.064539266 MPS1 kinase function eliminates in vitro protein kinase activity and behaves like a null mutation in vivo. YDL029W -0.07991371 0.719226522 -0.264988039 0.175733942 ARP2 actin-related protein YDL030W -0.038229 0.698751743 -0.280228656 0.090720961 PRP9 RNA splicing factor YDL031W 0.823862693 0.005019395 -0.437194776 0.07643666 DBP10 DEAD box protein 10/similar to RNA helicases YDL032W -0.65316029 0.213772535 0.25162771 0.709685364 questionable ORF YDL033C 0.179488184 0.490492304 0.258496364 0.13763763 similarity to H.influenzae hypothetical protein HI0174 YDL034W 0.089270732 0.880377639 0.1615131 0.531364198 questionable ORF YDL036C 0.014759741 0.890117691 -0.315568668 0.105894724 strong similarity to RIB2 protein YDL037C 0.559271771 0.65741304 0.23717564 0.213658447 strong similarity to glucan 1,4-alpha-glucosidase YDL038C 1.323159933 0.102415042 0.625900249 0.013186053 similarity to mucin proteins YDL039C 1.608493686 0.392720926 0.764200109 0.126210299 PRM7 pheromone-regulated membrane protein YDL040C 0.633411354 0.048208169 -0.079552133 0.100518051 NAT1 N-terminal acetyltransferase YDL041W 0.174288224 0.642503898 0.258375777 0.62589572 KRE26 Killer toxin REsistant YDL042C -0.10118825 0.794706138 -0.073951013 0.456369277 SIR2 regulator of silencing at HML, HMR, telomeres, and rDNA YDL043C -0.52563075 0.221880004 -0.541711335 0.05787954 PRP11 snRNA-associated protein YDL044C 0.10286614 0.603559734 -0.643456132 0.015415234 MTF2 involved in mRNA splicing YDL045C -0.12765433 0.444295987 0.100242513 0.111353338 FAD1 FAD synthetase YDL045W-A 0.852422552 0.083253409 0.092071622 0.621864993 MRP10 homologous to Yml37p, component of the 37 S subunit of mitochondrial ribosomes YDL046W 0.389095959 0.168440875 0.785538487 0.124999845 hypothetical protein YDL047W -0.23823088 0.287941087 0.196120856 0.167320397 SIT4 type 2A related protein phosphatase YDL048C -0.99820765 0.086957301 0.056948096 0.846017102 STP4 involved in tRNA splicing YDL049C -1.07021664 0.025207224 -0.199903487 0.363225697 KNH1 KRE9 homolog YDL050C 0.972964866 0.038218139 -0.383737321 0.040940004 questionable ORF YDL051W 0.926989603 0.08680128 -0.409082606 0.039835976 LHP1 RNA binding protein similar to human La autoantigen YDL052C 0.593664795 0.080781334 0.423615661 0.083231637 SLC1 putative 1-acyl-sn-gylcerol-3-phosphate acyl transferase YDL053C 0.286154473 0.157281354 -0.402547543 0.029444928 hypothetical protein YDL054C 0.512041385 0.399109838 0.326679615 0.57679833 hypothetical protein YDL055C 2.638318771 0.396372724 0.381406488 0.089838919 PSA1 mannose-1-phosphate guanyltransferase, GDP-mannose pyrophosphorylase YDL056W -0.20889058 0.164897414 -0.130549932 0.243231736 MBP1 transcription factor YDL057W 0.144105209 0.752696738 0.004234548 0.977190884 hypothetical protein YDL058W -0.0941124 0.672960832 -0.15243792 0.426707952 USO1 Integrin analogue gene YDL059C -0.65221223 0.142894576 -0.147626533 0.451259491 RAD59 The RAD59 gene product has homology to the Rad52 protein. YDL060W 1.034685519 0.030638507 -0.336745546 0.114774837 similarity to C.elegans hypothetical protein YDL061C 0.916519867 0.059769261 0.896321501 0.017545271 RPS29B Ribosomal protein S29B (S36B) (YS29) YDL062W 0.58883272 0.056815981 -0.232949174 0.322514661 questionable ORF YDL063C 1.328826069 0.162840609 -0.563186768 0.084177112 weak similarity to human estrogen-responsive finger protein YDL064W 0.708024303 0.018337768 0.1485291 0.275721116 UBC9 ubiquitin-conjugating enzyme YDL065C -0.06517681 0.636245286 -0.373826531 0.192819099 PEX19 40 kDa farnesylated protein associated with peroxisomes YDL066W -0.66771117 0.032746589 0.37912913 0.189582732 IDP1 Mitochondrial form of NADP-specific isocitrate dehydrogenase YDL067C -0.27072207 0.172636549 0.191353465 0.334545661 COX9 Subunit VIIa of cytochrome c oxidase YDL068W -0.54170324 0.265906018 -0.12231526 0.284518572 questionable ORF YDL069C -0.1692121 0.633309641 -0.545439906 0.12016737 CBS1 translational activator of cytochrome b YDL070W -0.01258233 0.963502322 -0.496672642 0.103736094 BDF2 Bromodomain protein, homolog of Bdf1 YDL071C 0.683244197 0.04764493 0.43366029 0.256079488 questionable ORF YDL072C 0.334945833 0.433315609 0.397777848 0.134447189 weak similarity to hypothetical protein YMR040w YDL073W 0.365624068 0.216148262 -0.175677529 0.135267149 weak similarity to Cyprinus carpio calcium channel protein YDL074C 0.331837013 0.279825701 -0.715733181 0.020643802 BRE1 weak similarity to spindle pole body protein NUF1 YDL075W 1.734797453 0.059763772 -0.16965972 0.560638925 RPL31A Ribosomal protein L31A (L34A) (YL28) YDL076C 0.604763082 0.043842493 -0.006097819 0.852662544 hypothetical protein YDL077C 0.181971946 0.199757304 -0.261035382 0.240744248 VAM6 involved in vacuolar morphogenesis YDL078C -0.58680541 0.122161553 0.177881461 0.436845774 MDH3 malate dehydrogenase YDL079C -0.27261408 0.397037282 0.394391824 0.091743863 MRK1 MDS1 related protein kinase YDL080C 0.648126243 0.118077486 -0.140476461 0.073749067 THI3 alpha-ketoisocaproate decarboxylase YDL081C 2.308299563 0.013332031 0.745970418 0.029550652 RPP1A Acidic ribosomal protein P1A (YP1alpha) (A1) YDL082W 1.546588088 0.00398878 -0.104410618 0.59360929 RPL13A Ribosomal protein L13A YDL083C 1.912603939 0.019191167 0.226168195 0.025123929 RPS16B Ribosomal protein S16B (rp61R) YDL084W 0.4594664 0.336090724 -0.160123822 0.015036567 SUB2 RNA helicase YDL085W -2.36621696 0.001212022 0.187522021 0.517938498 strong similarity to NADH dehydrogenase (ubiquinone) YDL086W -0.53539597 0.024201526 0.397887179 0.094136229 similarity to hypothetical Synechocystis protein YDL087C -0.13839079 0.603731988 0.048412355 0.893219661 LUC7 (putative) involved in mRNA processing YDL088C 0.371630982 0.01544691 0.04623587 0.621390657 ASM4 suppressor of temperature-sensitive mutations in Pol3p/Nuclear pore complex protein YDL089W -0.62138023 0.013528896 0.301911153 0.067740118 hypothetical protein YDL090C -0.52841019 0.032167518 0.076784202 0.627782726 RAM1 beta subunit of farnesyltransferase YDL091C -1.62532247 0.002709346 -0.345781127 0.044337665 weak similarity to mouse FAF1 protein YDL092W 0.634068878 0.079242332 -0.30839553 0.281821756 SRP14 Signal recognition particle subunit YDL093W -0.7839912 0.008683331 0.267040518 0.170564413 PMT5 dolichyl phosphate-D-mannose:protein O-D-mannosyltransferase YDL094C -0.27053916 0.205071132 -0.00947456 0.971160009 questionable ORF YDL095W -0.1308348 0.501835574 0.396132864 0.082577726 PMT1 dolichyl phosphate-D-mannose:protein O-D-mannosyltransferase YDL096C 0.148210834 0.871122316 0.624711025 0.095592563 questionable ORF YDL097C -0.02842374 0.895239664 -0.352623757 0.033915161 RPN6 Subunit of the regulatory particle of the proteasome YDL098C 0.117448367 0.714449523 -0.755396428 0.086540907 SNU23 Putative RNA binding zinc finger protein YDL099W -0.14315556 0.421844718 -0.817588706 0.054587846 weak similarity to myosin heavy chain proteins YDL100C -0.17008295 0.375364625 -0.25948525 0.034901867 similarity to E.coli arsenical pump-driving ATPase YDL101C 0.057389406 0.852544741 -0.178459665 0.289408735 DUN1 protein kinase YDL102W 0.429314165 0.014365988 0.067648587 0.357319886 CDC2 largest and catalytic subunit of DNA polymerase III (delta) YDL103C -0.43127486 0.149074668 -0.130979718 0.313073353 QRI1 UDP-N-acetylglucosamine pyrophosphorylase YDL104C -0.60142075 0.081328599 -0.280988715 0.046140248 QRI7 similar to H.influenzae sialoglycoprotease YDL105W -0.5886175 0.101118626 -0.167016637 0.43440265 QRI2 protein of unknown function YDL106C 0.106760551 0.529386853 -0.154022628 0.032931351 PHO2 Homeobox-domain containing transcription fractor which is a positive regulator of PHO5 and other genes. YDL107W -0.11140599 0.495411191 -0.578986844 0.067276656 MSS2 cox1 pre-mRNA splicing factor YDL108W -0.20730272 0.262018154 -0.268910375 0.068086427 KIN28 serine-threonine kinase, subunit of transcription factor TFIIK, a subcomplex of TFIIH YDL109C -0.80513432 0.099246077 0.053346712 0.564387067 lipase family protein containing serine active site YDL110C -0.51317772 0.168342914 -0.179036101 0.063827147 hypothetical protein YDL111C 1.16291458 0.012009052 0.274099734 0.285734157 RRP42 Component of the exosome 3->5 exoribonuclease complex with Rrp4p, Rrp41p, Rrp43p and Dis3p (Rrp44p). YDL112W 0.212169886 0.316664227 -0.042100125 0.687355311 TRM3 tRNA (Gm18) ribose methylase YDL113C -0.7481118 0.032269115 -0.550342252 0.135214166 similarity to hypothetical protein YDR425w YDL114W -0.10708913 0.764458558 0.456558706 0.345340836 weak similarity to Rhizobium nodulation protein nodG YDL115C -0.38270161 0.075406392 -0.694573277 0.021211445 hypothetical protein YDL116W 0.301172293 0.112455168 -0.18255526 0.06798221 NUP84 Protein with homology to mammalian Nup107p YDL117W 0.903460332 0.207110314 -0.047990172 0.673448623 CYK3 involved in CYtoKinesis YDL118W 0.628280079 0.087222954 -0.176375821 0.70654144 questionable ORF YDL119C 0.452444858 0.225415602 -0.213990714 0.059801652 similarity to bovine Graves disease carrier protein YDL120W 0.092569521 0.782716083 -0.169469045 0.091813854 YFH1 mitochondrial protein that regulates mitochondrial iron accumulation YDL121C 0.37361887 0.159729704 -0.374310663 0.109228217 hypothetical protein YDL122W 0.908685115 0.021761557 -0.405311128 0.034639539 UBP1 Ubiquitin-specific protease YDL123W 0.408394411 0.540582872 0.324832682 0.113866739 similarity to hypothetical protein YJL151c YDL124W -1.16317913 0.00602663 0.428474768 0.154348525 similarity to aldose reductases YDL125C -0.03379696 0.824601881 0.486990087 0.192150353 HNT1 similarity to protein kinase C inhibitor-I YDL126C -0.13456205 0.138641128 -0.043236507 0.671019613 CDC48 microsomal ATPase YDL127W 0.301438351 0.405353385 0.272462135 0.083906357 PCL2 G1 cyclin YDL128W -0.25552869 0.321427153 0.624347403 0.108734058 VCX1 vacuolar H+ /Ca2+ exchanger YDL129W -0.32143328 0.272821191 0.010593839 0.960449276 hypothetical protein YDL130W 1.828980435 0.017651205 0.438306831 0.011905829 RPP1B Ribosomal protein P1B (L44') (YP1beta) (Ax) YDL130W-A -1.45668041 0.004378691 -0.304107211 0.162527725 STF1 ATPase stabilizing factor YDL131W 1.325487503 0.309093892 0.398346251 0.114531272 LYS21 homocitrate synthase, highly homologous to YDL182W YDL132W -0.20318148 0.31224688 -0.262237622 0.05939558 CDC53 involved in G1 cyclin degradation YDL133W 0.347032801 0.369790558 -0.126822945 0.191932928 hypothetical protein YDL134C -0.47661537 0.094519655 -0.102178215 0.43566819 PPH21 serine-threonine protein phosphatase 2A YDL135C 0.182589017 0.165689078 -0.549611217 0.091923039 RDI1 Rho GDP dissociation inhibitor YDL136W 0.519972334 0.169363829 -0.586988481 0.092290158 RPL35B Ribosomal protein L35B YDL137W 0.423012142 0.154126337 -0.041985843 0.684144492 ARF2 ADP-ribosylation factor 2 YDL138W -0.43058681 0.027968482 0.278347572 0.191655691 RGT2 glucose permease YDL139C -0.35807454 0.20303989 -0.325932256 0.071237566 SCM3 Suppressor of chromosome missegregation YDL141W -0.56412825 0.100108697 0.176092537 0.290827663 BPL1 Biotin:apoprotein ligase YDL142C -0.63485391 0.014403083 0.056146661 0.521872646 CRD1 Cardiolipin synthase YDL143W 0.352461737 0.434555147 -0.169586735 0.018557114 CCT4 component of chaperonin complex YDL144C -0.36015322 0.022006768 0.370384435 0.228765515 hypothetical protein YDL145C -0.05797091 0.87617395 0.207658465 0.019681022 COP1 alpha subunit of the coatamer complex ; gamma-alpha-COP YDL146W 0.108465992 0.805769207 -0.22445922 0.016962723 weak similarity to Orc3p YDL147W 0.021536027 0.928632721 -0.526445112 0.18452506 RPN5 Subunit of the regulatory particle of the proteasome YDL148C 0.619219623 0.10753226 -0.949341861 0.027628925 similarity to human mRNA clone RES4-25 YDL149W -0.43503709 0.303753118 0.14286093 0.513223935 APG9 Integral membrane protein YDL150W 1.498750605 0.209194067 -0.468430643 0.044590875 RPC53 RNA polymerase III (C) subunit, homologus to human BN51 protein YDL151C 0.809575869 0.191172207 0.028189514 0.618050895 questionable ORF YDL152W 0.784222347 0.036006965 -0.555624287 0.047028449 questionable ORF YDL153C 0.406384202 0.062317418 -1.118773438 0.018600807 SAS10 nuclear protein involved in silencing YDL154W -0.10567891 0.814844214 -0.028282967 0.909084842 MSH5 MutS homolog involved in chromosome exchange YDL155W 0.590046199 0.011213664 -0.087214252 0.590242238 CLB3 G(sub)2-specific B-type cyclin YDL156W -0.23602455 0.456205937 0.055028366 0.770564649 weak similarity to Pas7p YDL157C 0.141937273 0.673118667 -0.23166741 0.065137012 hypothetical protein YDL158C 0.116794274 0.624666272 0.035977792 0.325584689 questionable ORF YDL159W -0.3590388 0.156765186 -0.008152833 0.905636851 STE7 MEK homolog YDL160C 0.07876036 0.65376352 0.314204232 0.069164556 DHH1 (putative) DEAD box RNA helicase YDL161W -0.05391601 0.686583889 -0.259938401 0.316152733 ENT1 Ent1p YDL162C 0.146612736 0.724381788 1.642680121 0.431119662 hypothetical protein YDL163W 0.190818476 0.590889586 -0.128223584 0.732772579 questionable ORF YDL164C -0.26679883 0.417581124 0.009539701 0.964252489 CDC9 DNA ligase YDL165W -0.10369019 0.31696461 0.213793848 0.112408902 CDC36 nuclear protein that negatively regulates basal transcription YDL166C 1.007255038 0.126517165 -0.175164626 0.143857389 weak similarity to Pyrococcus horikoshii hypothetical protein PHBJ019 YDL167C 1.579071749 0.050452599 -0.065875562 0.682902389 NRP1 Asparagine-rich protein YDL168W -0.26708089 0.359881509 0.088105719 0.405226076 SFA1 Long-chain alcohol dehydrogenase (glutathione-dependent formaldehyde dehydrogenase) YDL170W -0.06390677 0.729886002 -0.382276487 0.058097302 UGA3 zinc-finger transcription factor of the Zn(2)-Cys(6) binuclear cluster domain type YDL172C 0.063477954 0.863184503 0.080716474 0.553781991 questionable ORF YDL173W -0.34661006 0.247676493 -0.51427273 0.127086801 hypothetical protein YDL175C 0.18179685 0.28040713 -0.252502053 0.242408227 strong similarity to hypothetical protein YIL079c and weak similarity to cellular nucleic acid binding proteins YDL176W -0.84150439 0.012817077 -0.397517704 0.138905886 hypothetical protein YDL177C 0.70095935 0.087122601 -0.546722446 0.030264811 similarity to hypothetical protein YCR059c YDL178W 0.152736347 0.67103998 -0.141893234 0.161495958 AIP2 D-Lactate Dehydrogenase (Cytochrome) YDL179W 0.595904308 0.484834362 0.073558627 0.407549935 PCL9 cyclin like protein interacting with Pho85p YDL180W 0.167736634 0.662254347 0.23944357 0.045905187 hypothetical protein YDL181W -1.74369441 0.001755971 0.554533535 0.120770193 INH1 ATPase inhibitor YDL182W 1.295411835 0.310672555 0.429485016 0.060176286 LYS20 homocitrate synthase, highly homologous to YDL131W YDL183C 0.002045373 0.991083146 -0.065021409 0.28557679 weak similarity to S.pombe hypothetical protein SPAC23H3 YDL184C -0.02689704 0.95241093 -0.175430861 0.572890186 RPL41A Ribosomal protein L41A (YL41) (L47A) YDL185W -0.92830844 7.52782E-05 0.207326754 0.280076799 TFP1 vacuolar ATPase V1 domain subunit A (69 kDa) YDL186W 1.452018663 0.05972002 0.35308334 0.057784377 hypothetical protein YDL187C 1.573174276 0.174056852 0.418448668 0.079344725 questionable ORF YDL188C -0.55452206 0.063016955 -0.019929927 0.90318706 PPH22 serine-threonine protein phosphatase 2A YDL189W 0.348378665 0.094781314 -0.015402366 0.943444149 hypothetical protein YDL190C 0.048854131 0.794255268 0.430889635 0.042403567 UFD2 ubiquitin fusion degradation protein YDL191W 0.617598406 0.254340889 -0.560365742 0.036213696 RPL35A Ribosomal protein L35A YDL192W 0.905222946 0.321040607 -0.274910193 0.022639443 ARF1 ADP-ribosylation factor YDL193W -0.25214993 0.070810357 -0.193347977 0.11548141 similarity to N.crassa hypothetical 32 kDa protein YDL195W -0.33996636 0.314911932 0.660612937 0.041363009 SEC31 Component (p150) of COPII coat of secretory pathway vesicles YDL196W -0.2807457 0.421683454 1.061830277 0.002456133 hypothetical protein YDL197C -0.73333695 0.031900681 0.008681113 0.970813317 ASF2 Anti-silencing protein, involved in transcription YDL198C 0.806399253 0.216854159 0.15959481 0.321457176 YHM1 (putative) mitochondrial carrier protein YDL199C -0.3035713 0.468247117 0.244285048 0.006582327 similarity to sugar transporter proteins YDL200C -0.55290351 0.019078443 -0.457047236 0.017060942 MGT1 6-O-methylguanine-DNA methylase YDL201W 0.135300073 0.488686798 -0.219848437 0.147447463 putative methyltransferase YDL202W 0.27351953 0.053889959 -0.59430976 0.033975815 MRPL11 Mitochondrial ribosomal protein MRPL11 (YmL11) YDL203C -0.56632429 0.075826703 0.104979638 0.595739983 similarity to Skt5p YDL204W -2.04612452 0.001088483 0.196659039 0.218791016 similarity to hypothetical protein YDR233c YDL205C 0.706061277 0.103537875 0.088052421 0.385893494 HEM3 phorphobilinogen deaminase (uroporphyrinogen synthase), the third step in heme biosynthesis YDL206W -0.61199876 0.026311397 -0.204292372 0.285905821 weak similarity to transporter proteins YDL207W -0.06622244 0.590819544 -0.278230341 0.008368752 GLE1 Nuclear-export-signal (NES)-containing protein YDL208W 1.303474134 0.100387294 -0.607501604 0.063118132 NHP2 HMG-like nuclear protein YDL209C 0.180697076 0.215999809 -0.405044733 0.033814356 similarity to hypothetical S. pombe protein YDL210W -1.79114688 0.009972271 0.074275731 0.752955777 UGA4 GABA-specific transport protein YDL211C 1.219122075 0.036953354 0.480893434 0.05826958 similarity to hypothetical protein YNL176c YDL212W 0.399558887 0.448346454 -0.058448906 0.297279347 SHR3 Integral membrane component of the endoplasmic reticulum YDL213C 0.78646459 0.052548444 -0.458601818 0.091576813 has an RNA recognition domain in the N-terminal region YDL214C -0.34455264 0.465745662 0.119787414 0.385989426 strong similarity to putative protein kinase NPR1 YDL215C 0.691585049 0.550809764 -0.11910891 0.024926696 GDH2 NAD-dependent glutamate dehydrogenase YDL216C -0.7996671 0.003368148 -0.672510033 0.027396822 similarity to Jun activation domain binding protein homologue of A. thaliana YDL217C 0.398376258 0.233654505 -0.05775963 0.585115792 TIM22 Mitochondrial inner membrane protein involved in import YDL218W -0.6796419 0.306490896 0.578567451 0.101426901 weak similarity to hypothetical protein YNR061c YDL219W 0.38788163 0.472227267 -0.591291278 0.093936303 strong similarity to S.equisimilis hypothetical protein YDL220C -0.50093002 0.164046565 0.21723749 0.046993638 CDC13 binds to single-stranded TG1-3 telomere G-tails YDL221W -0.07474845 0.853978136 0.74166789 0.088276449 questionable ORF YDL222C -0.52423124 0.495336672 0.883755411 0.089155614 strong similarity to hypothetical protein YNL194c and similarity to YML052w YDL223C -0.93550172 0.167643558 0.48016019 0.192040142 weak similarity to mucin YDL224C -0.48976823 0.173553649 0.548573819 0.089645396 WHI4 Possible RNA binding protein. Homolog of Whi3. YDL225W 0.383302397 0.041825056 -0.544262354 0.09950373 SHS1 Septin homolog YDL226C -0.0623909 0.862375335 -0.239541383 0.055931012 GCS1 ADP-ribosylation factor GTPase-activating protein (ARF GAP) YDL227C -0.67007445 0.028838514 -0.277032432 0.260998503 HO Homothallic switching endonuclease YDL230W 0.396836517 0.510923426 0.290638395 0.173789663 similarity to A.klebsiana glutamate dehydrogenase YDL231C -0.33323203 0.270377017 0.026197314 0.797759383 BRE4 null mutant is sensitive to brefeldin A YDL232W 0.556385897 0.171765558 0.665396226 0.05373755 OST4 3.6-kDa protein, probably membrane-located YDL233W 0.30360855 0.02164613 0.216259905 0.088403983 hypothetical protein YDL234C 0.292553026 0.621131889 -0.305387079 0.013482185 GYP7 GTPase-activating protein YDL235C 0.908728072 0.280576046 -0.137079118 0.372324388 YPD1 Two-component phosphorelay intermediate YDL236W 0.368901914 0.662198269 -0.264931602 0.06164024 PHO13 p-nitrophenyl phosphatase YDL237W -0.47558101 0.235763402 0.126188973 0.512781998 hypothetical protein YDL238C 0.489471344 0.521597978 0.091636649 0.79193763 similarity to E.coli hypothetical protein and to chlorohydrolases YDL239C -1.30178901 0.004163185 -0.200762225 0.16337951 hypothetical protein YDL240W 0.078616273 0.760143959 -0.096099833 0.149062819 LRG1 Protein similar to LIM-domain proteins and to rho /rac GTPase-activating family of proteins YDL241W 1.34253034 0.008301684 0.016268961 0.905450236 hypothetical protein YDL242W 0.305363323 0.380731166 0.30630974 0.308433355 strong similarity to hypothetical protein YPR079w YDL243C -0.5312573 8.97975E-05 -0.023824921 0.669000201 AAD4 Hypothetical aryl-alcohol dehydrogenase YDL244W 4.757249417 0.379678093 0.509832996 0.420518011 THI13 strong similarity to Thi5p, YJR156c, YNL332w and A.parasiticus, S.pombe nmt1 protein YDL245C -1.0651814 0.002019619 0.132359563 0.452055658 HXT15 Hexose transporter YDL246C -0.73395831 0.034251545 -0.714909276 0.033808416 strong similarity to Sor1p YDL247W 0.401987656 0.293750243 0.276719361 0.279349369 strong similarity to sugar transport proteins YDL248W 0.031998334 0.938237782 -0.106851462 0.451324374 COS7 similar to other subtelomerically-encoded proteins YDR001C -1.20815299 9.87295E-05 0.006394819 0.965736383 NTH1 neutral trehalase YDR002W 0.875252223 0.203410784 -0.715100792 0.023215245 YRB1 nuclear GTPase-activating protein for Ran YDR003W -0.54686716 0.004011308 0.084778701 0.218758662 strong similarity to hypothetical protein YBR005w YDR004W -0.6623851 0.142028678 -0.223797725 0.19376891 RAD57 RecA homolog (similar to DMC1, RAD51, and RAD55), interacts with Rad 55p by two-hybrid analysis YDR005C -1.36268028 0.004459171 -0.544239287 0.006671934 MAF1 Mod5 protein sorting YDR006C 0.192403786 0.669220751 0.088696721 0.465921379 SOK1 high copy suppressor of cAMP-dependent protein kinase A temperature-sensitive mutations YDR007W 0.116952808 0.780421294 1.570697406 0.023937568 TRP1 n-(5'-phosphoribosyl)-anthranilate isomerase YDR008C 0.10768243 0.727881468 1.529049358 0.07013796 questionable ORF YDR009W -0.46284599 0.233771707 0.121735826 0.595205793 GAL3 involved in galactose induction of GAL genes YDR010C 0.747124934 0.356766501 3.079566864 0.406922635 hypothetical protein YDR011W -0.72437167 0.003023051 0.473283506 0.166712532 SNQ2 ABC transporter YDR012W 1.365812533 0.064550535 0.217296272 0.215143703 RPL4B Ribosomal protein L4B (L2B) (rp2) (YL2) YDR013W 0.478781848 0.126973108 -0.370299789 0.080020105 similarity to human hypothetical KIAA0186 protein YDR015C 0.267785814 0.113754648 0.174031169 0.283608625 weak similarity to chicken neurofilament triplet M protein YDR016C 0.085411603 0.699040544 -0.143612955 0.413610553 DAD1 Duo1 And Dam1 interacting ; localized to intranuclear spindles and spindle pole bodies YDR018C -1.28502098 0.000615924 -0.142919399 0.708620643 strong similarity to hypothetical protein YBR042c YDR019C 1.049665197 0.281083898 -0.179809466 0.152227846 GCV1 glycine cleavage T protein (T subunit of glycine decarboxylase complex YDR020C 0.766644855 0.097157641 -0.361945612 0.015562402 weak similarity to uridine kinases and phosphoribulokinases YDR021W 0.521637724 0.162057332 -0.477787446 0.067447341 FAL1 DEAD-box protein, putative RNA helicase YDR022C -0.99694739 0.002358519 -0.303556544 0.148573782 CIS1 involved in microtubule assembly YDR023W 0.210567307 0.56540803 -0.62233489 0.025381772 SES1 seryl-tRNA synthetase YDR024W 0.400137581 0.264560109 -0.023319302 0.801886668 hypothetical protein YDR025W 1.14703072 0.119007804 0.332549467 0.167976165 RPS11A Ribosomal protein S11A (S18A) (rp41A) (YS12) YDR026C 0.462065751 0.032862106 -1.050862095 0.023255976 strong similarity to DNA-binding protein Reb1p YDR028C -0.39131571 0.006427893 -0.474575704 0.009553515 REG1 regulator of phosphatase Glc7p, involved in glucose repression YDR029W 0.623463595 0.383805535 0.039165966 0.861826825 hypothetical protein YDR030C -0.3915176 0.095675988 -0.614657395 0.054064772 RAD28 involved in DNA repair, has WD repeats YDR031W -0.58603479 0.002678541 -0.189380852 0.102031839 hypothetical protein YDR032C -0.26938502 0.140904224 0.497382815 0.17765195 PST2 Protoplasts-SecreTed protein ; the gene product was detected among the proteins secreted by regenerating protoplasts Membrane protein Related to Hsp30p ; Localized by immunofluorescence to cell membranes, primarily the plasma membrane. A punctuate YDR033W 0.140284247 0.704384726 0.146789147 0.529131647 MRH1 immunofluorescence pattern was observed within cell buds. The nuclear envelope, but not the vacuole or mitochondrial membrane YDR034C 0.219685087 0.718996654 -0.16519193 0.017013893 LYS14 transcription factor involved in lysine biosynthesis YDR034C-A 0.084389188 0.851245036 -0.224333129 0.038772575 identified by SAGE expression analysis YDR034W-B 0.555897751 0.5291951 0.328459872 0.115295011 DAHP synthase ; a.k.a. phospho-2-dehydro-3-deoxyheptonate aldolase, phenylalanine-inhibited ; phospho-2-keto-3-deoxyheptonate aldolase ; YDR035W 0.194887176 0.571907742 -0.28802562 0.053158841 ARO3 2-dehydro-3-deoxyphosphoheptonate aldolase ; 3-deoxy-D-arabine-heptulosonate-7-phosphate synthase YDR036C 0.129283775 0.673432252 0.087454249 0.511272076 similarity to enoyl CoA hydratase YDR037W 1.278983148 0.141915776 -0.056339529 0.357760364 KRS1 lysyl-tRNA synthetase YDR038C -0.4719567 0.118268335 0.273467671 0.192866649 ENA5 Na(+) ATPase YDR039C -0.5462513 0.054339517 0.275283261 0.151392176 ENA2 plasma membrane protein ; putative Na+ pump ; P-type ATPase YDR040C -0.48398559 0.143005908 0.231572772 0.217763241 ENA1 Plasma membrane Na+ pump ; P-type ATPase YDR041W -0.5532923 0.150874186 -0.235426709 0.175352313 RSM10 protein of the small subunit of the mitochondrial ribosome YDR042C 0.067044436 0.880261945 0.070517572 0.48752248 hypothetical protein YDR043C -0.13300202 0.52097033 -0.167068055 0.142059202 NRG1 transcriptional repressor which can bind to UAS-1 in the STA1 promoter and which can interact with Ssn6p YDR044W 0.226294076 0.679222554 0.507142434 0.165908937 HEM13 Coproporphyrinogen III oxidase YDR045C 1.08571073 0.174673504 -0.373094463 0.063397669 RPC11 TFIIS-like small Pol III subunit C11 YDR046C 0.084269542 0.858615054 0.177224707 0.234078881 BAP3 Valine transporter YDR047W 0.506328447 0.038601615 0.08344245 0.589439918 HEM12 uroporphyrinogen decarboxylase YDR048C -0.05196993 0.93986346 0.432534785 0.578340595 questionable ORF YDR049W 0.02809158 0.905778633 -0.474509987 0.107396507 similarity to C.elegans K06H7.3 protein YDR050C 1.547383023 0.348987343 0.61695954 0.050707247 TPI1 triosephosphate isomerase YDR051C -0.68725518 0.019573053 -0.455166365 0.076931111 similarity to hypothetical A. thaliana protein BAC F7G19 YDR052C 0.844428057 0.015152142 -0.140823648 0.4904764 DBF4 Regulatory subunit of Cdc7p-Dbf4p kinase complex YDR053W 0.142877998 0.812398002 0.109234865 0.783649149 questionable ORF YDR054C 0.061561643 0.799020445 -0.028283433 0.750139235 CDC34 ubiquitin-conjugating enzyme, E2 YDR055W 2.44539686 0.357606499 0.40964352 0.284046982 PST1 The gene product has been detected among the proteins secreted by regenerating protoplasts YDR056C 0.591025664 0.466359648 0.012253766 0.924154381 hypothetical protein YDR057W -0.14599429 0.628561038 -0.529499989 0.002236042 weak similarity to L.lactis mleR protein YDR058C -0.66818434 0.100529704 -0.297029012 0.10581136 TGL2 Triglyceride Lipase YDR059C -0.04318585 0.880882276 0.470068232 0.258845782 UBC5 ubiquitin-conjugating enzyme YDR060W 1.329658672 0.065542303 -0.548414373 0.11480275 similarity to mouse putative CCAAT binding factor CBF1 and CBF2 YDR061W -0.04318019 0.918360964 -0.36346012 0.021932827 similarity to E.coli modF and photorepair protein phrA YDR062W 0.867350963 0.220324601 0.195965218 0.016412053 LCB2 Probable component of serine palmitoyltransferase, which catalyzes the first step in biosynthesis of long-chain sphingolipids YDR063W -0.76028946 0.03988093 -0.059650539 0.41399261 weak similarity to glia maturation factor beta YDR064W 1.542230434 0.055859956 0.376037692 0.013764765 RPS13 Ribosomal protein S13 (S27a) (YS15) YDR065W -0.43812732 0.119433964 -0.521337902 0.043427468 hypothetical protein YDR066C 0.514999152 0.039428234 0.000641623 0.996159507 similarity to hypothetical protein YER139c YDR067C 0.403265131 0.062795732 -0.264402985 0.038586121 similarity to YNL099c YDR068W 0.326556656 0.44053075 -0.943504276 0.055614156 DOS2 involved in genome stability YDR069C -0.75422855 0.032364613 0.003511031 0.979100385 DOA4 ubiquitin isopeptidase YDR070C -3.89565437 1.8649E-06 0.019198122 0.913522654 hypothetical protein YDR071C 0.326746909 0.401315156 -0.391781657 0.281122362 similarity to O.aries arylalkylamine N-acetyltransferase YDR072C 0.901127073 0.22784972 0.513528023 0.13032547 IPT1 inositolphosphotransferase 1 YDR073W 0.467540345 0.389193888 -0.243727659 0.126489088 SNF11 component of SWI /SNF global transcription activator complex YDR074W -1.46080113 0.004701094 0.23884715 0.01407825 TPS2 Trehalose-6-phosphate phosphatase YDR075W 1.028549792 0.065544849 -0.152763342 0.304872932 PPH3 protein phosphatase type 2A YDR076W -0.20556382 0.399191392 -0.098216408 0.169139027 RAD55 RecA homolog (related to DMC1, RAD51, RAD57), interacts with Rad51p and Rad57p by two-hybrid analysis YDR077W 1.1128521 0.010028767 0.818789315 0.191319729 SED1 putative cell surface glycoprotein YDR078C -0.32079972 0.081046299 -0.363344456 0.221385291 hypothetical protein YDR079W 0.205732238 0.1637856 -0.04673602 0.462786035 PET100 cytochrome c oxidase-specific assembly factor YDR080W 0.138628859 0.456489475 -0.190778968 0.2390144 VPS41 component of vacuolar membrane protein complex YDR081C 0.250672703 0.089894125 -0.286044967 0.028343182 PDC2 Asparagine and serine-rich protein YDR082W -0.79882281 0.007398495 -0.82231355 0.025656577 STN1 involved in telomere length regulation YDR083W 1.048538768 0.056845758 -0.571237095 0.137129017 nucleolar protein required for efficient processing of pre-rRNA at site A2; methyltransferase homolog YDR084C 0.167840951 0.463862107 0.533641863 0.088712384 similarity to hypothetical C.elegans protein YDR085C -0.26577884 0.564819788 -0.000240142 0.998781771 AFR1 cytoskeletal protein, similar to arrestins YDR086C 0.964724232 0.108831003 -0.325322839 0.017474553 SSS1 endoplasmic reticulum protein that is part of the Sec61 trimeric complex and the Ssh1 trimeric complex YDR087C 1.093029209 0.024459367 -0.394419488 0.116556334 RRP1 involved in rRNA processing YDR088C -0.18396633 0.051258911 -0.83209368 0.0520654 SLU7 involved in mRNA splicing YDR089W -0.59970888 0.007578221 0.225486441 0.144845196 weak similarity to Streptococcus transposase YDR090C -0.36818244 0.400776653 -0.039052463 0.306406927 weak similarity to YRO2 protein YDR091C 1.005209496 0.040446518 -0.110891708 0.282693147 RLI1 putative member of nontransporter group of ATP-binding cassette (ABC) superfamily YDR092W 0.131290593 0.296037041 0.126384265 0.038210595 UBC13 ubiquitin-conjugating enzyme YDR094W 0.551801703 0.446126384 0.829177811 0.058523864 questionable ORF YDR095C 0.55294995 0.437717435 0.397185577 0.488727796 hypothetical protein YDR096W -0.67910899 0.069475296 0.177594018 0.157277841 GIS1 putative zinc finger protein ; repressor of PHR1 transcription Homolog of the human GTBP protein, forms a complex with Msh2p to repair both single-base and insertion-deletion mispairs, redundant with YDR097C -0.22490207 0.196623771 -0.179176183 0.124517989 MSH6 Msh3p in repair of insertion-deletion mispairs YDR098C 0.785636776 0.031962428 0.057282951 0.294803224 GRX3 Protein with glutaredoxin activity YDR098C-A 0.457185037 0.453335327 -0.105163834 0.112663795 TyA gag protein. Gag processing produces capsid proteins. YDR099W -0.26351856 0.295561847 0.234629726 0.207190391 BMH2 member of conserved eukaryotic 14-3-3 gene family YDR100W 0.668533352 0.025831114 0.666594247 0.058956002 similarity to Dictyostelium development-specific membrane protein YDR101C 1.539722971 0.024871459 -0.222943583 0.332744365 weak similarity to proliferation-associated protein YDR102C 0.462629229 0.282869783 -0.242141903 0.54633374 hypothetical protein YDR103W 0.379393739 0.374610724 0.13440509 0.312901417 STE5 scaffold protein for MAP kinase cascade YDR104C 0.003137405 0.990908055 -0.244034114 0.104448716 SPO71 protein involved in spore wall formation YDR105C -0.60931762 0.033317128 -0.081659151 0.66232287 similarity to mouse hypothetical protein YDR106W -0.16692335 0.37125181 -0.332903163 0.148263715 ARP10 Actin-related protein YDR107C -0.34053483 0.289032877 0.264518538 0.243671101 strong similarity to Emp70 protein YDR108W 0.318720103 0.066121175 -0.433799342 0.039422471 GSG1 involved in meiosis YDR109C -0.48560042 0.100974577 -0.308492376 0.099468287 similarity to Mpa43p YDR110W 0.051836035 0.584635983 -0.6450296 0.059619344 FOB1 DNA replication fork blocking protein YDR111C -0.42885423 0.15526886 -0.148402542 0.452166113 strong similarity to alanine transaminase YDR112W -0.37612945 0.075429833 -0.204694202 0.347889092 questionable ORF YDR113C 0.671460009 0.10522709 -0.06828092 0.222901969 PDS1 42-kDa nuclear protein YDR114C 0.136467428 0.423700082 0.150744041 0.032711843 questionable ORF YDR115W 0.349320575 0.123737414 0.053392416 0.145180816 similarity to bacterial ribosomal L34 proteins YDR116C 0.552607992 0.11875336 -0.173352363 0.03751388 similarity to bacterial ribosomal L1 proteins YDR117C 0.050965096 0.36452597 -0.384536522 0.058925826 similarity to mouse ligatin, a trafficking receptor for phosphoglycoproteins YDR118W 0.05206907 0.892867276 -0.061386936 0.173088901 APC4 subunit of the anaphase promoting complex (APC) YDR119W 0.908003215 0.02481435 0.396780723 0.100716605 similarity to B.subtilis tetracyclin resistance YDR120C 0.270921481 0.209365611 -0.305215125 0.032526164 TRM1 N2,N2-dimethylguanosine-specific tRNA methyltransferase YDR121W -0.16709996 0.187618956 -0.47827627 0.147744908 DPB4 DNA polymerase II (epsilon) 4th subunit YDR122W -0.85214464 0.026454118 -0.103291822 0.082424128 KIN1 Serine /threonine protein kinase YDR123C 1.130996837 0.25380742 0.163152164 0.363718011 INO2 helix-loop-helix protein YDR124W -0.62275421 0.024022286 0.344401791 0.167794648 hypothetical protein YDR125C -0.31802701 0.314879864 0.05610886 0.590841908 ECM18 (putative) involved in cell wall biogenesis YDR126W 0.530524211 0.173197248 0.059098645 0.922763952 similarity to hypothetical protein YLR246w and YOL003c YDR128W -0.4643716 0.241837295 -0.103247372 0.511866485 weak similarity to Sec27p, YMR131c and human retinoblastoma-binding protein YDR129C -0.3238347 0.165664317 0.136389811 0.451242866 SAC6 fibrim homolog (actin-filament bundling protein) YDR130C -0.13213061 0.319844529 -0.481031737 0.063713244 FIN1 Cell cycle-dependent filament between nuclei YDR131C -0.20187633 0.474653843 -0.260348238 0.081078368 similarity to hypothetical protein YJL149w YDR132C 0.098286312 0.549917874 -0.155236307 0.227566495 strong similarity to hypothetical protein YLR108c YDR133C 0.03271035 0.667516068 0.711886001 0.081056806 questionable ORF YDR134C 0.080691599 0.519429204 1.089370012 0.064386573 strong similarity to Flo1p, Flo5p, Flo9p and YLR110c YDR136C 0.195265784 0.428396894 0.587253527 0.447140699 questionable ORF YDR137W -0.11722596 0.575913733 -0.566820358 0.044824916 RGP1 involved in mitotic growth YDR138W 0.763975985 0.213265281 0.010309538 0.946484139 HPR1 involved in mitosis, recombination ; similar to TOP1 across 2 regions YDR139C 0.359107222 0.066322274 -0.19784433 0.249250995 RUB1 ubiquitin-like protein YDR140W 0.818987136 0.035401721 0.129216946 0.21849309 putative methyltransferase YDR141C -0.02370197 0.906757849 0.186691526 0.035425303 DOP1 homolog of Emericella nidulans developmental regulatory gene, dopey (dopA). YDR142C 0.117963987 0.554427853 0.342528313 0.1106227 PEX7 Member of beta-transducin-related (WD-40) protein family YDR143C 0.355744664 0.348022742 0.422566127 0.026235832 SAN1 (putative) transcriptional regulator YDR144C 1.716196129 0.111577536 0.507792573 0.055896548 MKC7 aspartyl protease related to Yap3p YDR145W 0.233032013 0.201738703 -0.428850123 0.075726681 TAF61 TFIID subunit YDR146C 0.716935468 0.186514367 -0.218819758 0.496210946 SWI5 transcriptional activator YDR147W -0.13158841 0.634671383 -0.325367794 0.160316073 EKI1 Ethanolamine Kinase YDR148C -2.06296218 0.000822137 -0.013789727 0.911548181 KGD2 dihydrolipoyl transsuccinylase component of alpha-ketoglutarate dehydrogenase complex in mitochondria YDR149C 0.305613321 0.711624076 0.061090431 0.891792351 questionable ORF member of the CCCH zinc finger protein family that has two or more repeats of a novel zinc finger motif consisting of Cys and His residues in YDR151C 0.35366165 0.109943031 0.006231723 0.935456885 CTH1 the form Cx8Cx5Cx3H [where x is a variable amino acid (aa)] YDR152W 0.774441572 0.023621629 -0.320450863 0.361991534 weak similarity to C.elegans hypothetical protein CET26E3 YDR153C 0.112330355 0.461351798 -0.3127629 0.147898065 hypothetical protein YDR154C 0.150409115 0.699002116 0.544554289 0.205802688 questionable ORF YDR156W 1.3153461 0.13317978 0.811024436 0.012042792 RPA14 RNA polymerase I subunit A14 YDR157W 1.007524691 0.20257452 0.655445691 0.027422142 questionable ORF YDR158W 1.19084433 0.172631858 0.073971841 0.529115765 HOM2 aspartic beta semi-aldehyde dehydrogenase YDR159W 0.378374172 0.274138184 -0.331873737 0.145122921 SAC3 Leucine permease transcriptional regulator YDR160W -0.36663571 0.044051351 -0.201567224 0.0084845 SSY1 regulator of transporters YDR161W 0.689022539 0.021646055 -0.221977019 0.052875928 TCI1 interacts with PP2C YDR162C 0.269710168 0.242356048 -0.450901081 0.029741464 NBP2 interacts with Nap1, which is involved in histone assembly YDR163W -0.02634277 0.842859936 -0.492280766 0.045536771 weak similarity to S.pombe hypothetical protein YDR164C -0.4267988 0.13441724 -0.122895459 0.266175976 SEC1 (putative) SNARE docking complex subunit YDR165W 0.831941628 0.105674061 -0.240362626 0.236332236 weak similarity to hypothetical C.elegans protein YDR166C 0.109540847 0.638297289 0.04057337 0.810919393 SEC5 107 kDa component of the Exocyst complex ; required for exocytosis. YDR167W 0.080900411 0.511271694 -0.287421667 0.081915838 TAF25 TFIID subunit YDR168W -0.17026505 0.437790132 -0.710858837 0.032265286 CDC37 (putative) chaperone, involved in spindle pole body duplication and passage through START YDR169C -0.36041468 0.213578914 0.185839648 0.047786559 STB3 Sin3 binding protein YDR170C -0.32509896 0.117714678 0.024512258 0.767550811 SEC7 Guanine nucleotide exchange protein for ARF YDR171W -1.38992838 0.00932314 0.109623405 0.420883484 HSP42 heat shock protein similar to HSP26, involved in cytoskeleton assembly YDR172W 0.468661458 0.071219066 0.129687874 0.346522867 SUP35 translation termination factor eRF3 YDR173C -0.49412067 0.027865871 -0.261396756 0.147287006 ARG82 dual-specificity inositol 1,4,5-trisphosphate 6-kinase /inositol 1,4,5,6-tetrakisphosphate 3-kinase (IP3 6- /IP4 3-kinase) YDR174W -0.18212249 0.04969651 -0.301213645 0.088056575 HMO1 35 kDa protein belonging to the high mobility group (HMG) fanily of proteins YDR175C 0.364195882 0.310632245 -0.371693263 0.095241564 RSM24 protein of the small subunit of the mitochondrial ribosome transcription factor ; genetic and mutant analyses suggest that Ngg1p (Ada3p) is part of two transcriptional adaptor /HAT (histone YDR176W 0.683706011 0.103999825 -0.598928385 0.04997065 NGG1 acetyltransferase complexes, the 0.8 MD ADA complex and the 1.8 MD SAGA complex YDR177W 0.093652454 0.459345786 -0.269911319 0.102213898 UBC1 ubiquitin-conjugating enzyme YDR178W -0.9198194 0.011374168 0.818076826 0.119593387 SDH4 succinate dehydrogenase membrane anchor subunit YDR179C -0.338389 0.20218249 -0.781298061 0.00751141 hypothetical protein YDR179W-A 0.41078482 0.296013242 -0.159005538 0.028646094 hypothetical protein YDR180W 0.479892714 0.243994524 0.0958822 0.354139728 SCC2 Sister chromatid cohesion protein YDR181C -0.42654957 0.041263092 -0.972099434 0.032113731 SAS4 involved in silencing at telomeres, HML, and HMR YDR182W -0.19576155 0.109494391 -0.073197487 0.018663059 CDC1 involved in ion homeostasis YDR183W 0.183151948 0.395113722 -0.648403779 0.03220585 PLP1 Phosducin-Like Protein YDR184C 1.514422499 0.045833914 -0.213404863 0.34860958 ATC1 nuclear protein that interacts with Aip3 YDR185C 0.534086934 0.192845617 0.301053581 0.008101073 strong similarity to Msf1p YDR186C -0.25312804 0.002477664 -0.351093602 0.004445 hypothetical protein YDR187C 0.084761184 0.549220896 -0.002172045 0.989658997 questionable ORF YDR188W -0.00836729 0.95636657 -0.274295123 0.023865545 CCT6 component of cytoplasmic chaperonin complex YDR189W 0.364242732 0.07936368 -0.074752582 0.485833831 SLY1 SNARE docking complex subunit YDR190C 0.584539368 0.031631154 -0.274323636 0.06723679 RVB1 RUVB-like protein YDR191W 0.184328022 0.233489754 0.160522116 0.031724476 HST4 similar to nuclear lamins, involved in telomeric silencing YDR192C 0.184760319 0.47384085 0.129061898 0.02976581 NUP42 42-kD protein associated with nuclear pore complexes ; Nup42p is structurally related to the FG-nucleoporin family of pore proteins YDR193W 0.053925478 0.863112919 0.45412797 0.003831553 questionable ORF YDR194C 0.551315318 0.065672817 -0.99497623 0.001858219 MSS116 Mitochondrial DEAD box RNA helicase YDR195W 0.284667189 0.017240321 -0.085627234 0.400039845 REF2 RNA-binding protein, involved in mRNA processing YDR196C -0.46681995 0.010061187 -0.244271854 0.34264763 similarity to C.elegans hypothetical protein T05G5.5 YDR197W 0.48782613 0.076300948 -0.174542872 0.363208276 CBS2 cytochrome b translational activator YDR198C 0.378227801 0.027630418 -0.554916473 0.027999016 hypothetical protein YDR199W -0.18652689 0.384536148 0.180006991 0.455896264 questionable ORF YDR200C -0.08581319 0.622794745 -0.360476417 0.168755828 similarity to hypothetical protein YLR238w YDR201W 0.398434166 0.391370519 -0.35157571 0.087329291 SPC19 component of spindle pole YDR202C -0.70858516 0.012726916 -0.184353107 0.517385368 RAV2 Regulator of (H+)-ATPase in Vacuolar membrane YDR203W -0.7242513 0.032510066 0.013005458 0.941996197 questionable ORF YDR204W -1.04969527 0.00219414 0.021677225 0.766218858 COQ4 involved in ubiquinone biosynthesis YDR205W -0.62707918 0.023273356 0.536148824 0.11393379 MSC2 similarity to A.eutrophus cation efflux system membrane protein czcD, rat zinc transport protein ZnT-1 and Cot1p YDR206W 0.252225772 0.06545982 -0.211591993 0.388502823 EBS1 similar to Est1, which is a putative component of telomerase YDR207C 0.051111126 0.811339856 0.10611886 0.454731195 UME6 Ume6p is a C6 zinc finger URS1-binding protein. YDR208W -0.01853684 0.910556959 0.036098564 0.478206746 MSS4 Phosphatidylinositol 4-phosphate kinase YDR209C 0.391374526 0.084674312 -0.356586971 0.205906206 questionable ORF YDR210W 0.698903896 0.041686858 -0.332239046 0.063542978 strong similarity to hypothetical protein YBR016w YDR210W-C 0.882189219 0.040337792 0.428006112 0.038873466 TyA gag protein. Gag processing produces capsid proteins. YDR211W 0.343048215 0.258745689 -0.557836415 0.00206436 GCD6 Translation initiation factor eIF-2B epsilon subunit YDR212W -0.0964064 0.410909936 0.015192673 0.885295864 TCP1 chaperonin subunit alpha YDR213W 0.751034769 0.172301224 -0.150164598 0.179573676 UPC2 zinc finger transcription factor of the Zn(2)-Cys(6) binuclear cluster domain type YDR214W -0.70854059 0.001381083 -0.063505445 0.879967173 similarity to hypothetical protein YNL281w YDR215C -0.00850754 0.979126562 1.309139425 0.207865526 hypothetical protein YDR216W -1.44966312 0.00547645 0.17495673 0.412638103 ADR1 positive transcriptional regulator of ADH2 and peroxisomal protein genes YDR217C 0.059397125 0.589834054 -0.74267718 0.070309531 RAD9 cell cycle arrest protein YDR218C -0.325545 0.205048471 0.37834678 0.293047485 SPR28 septin-related protein expressed during sporulation YDR219C -0.80676903 0.026249692 -0.512237161 0.091153567 hypothetical protein YDR220C -0.53971804 0.02535959 0.292217238 0.348141776 questionable ORF YDR221W -0.04006467 0.840321735 0.147797673 0.268719962 weak similarity to the beta subunit of an ER luminal alpha-glucosidase from mouse YDR222W 0.053160881 0.87876346 0.171868272 0.129765016 strong similarity to hypothetical protein YLR225c YDR223W -0.46073488 0.43338354 0.353904593 0.159734333 similarity to Ifh1p YDR224C 0.536037205 0.141297826 0.256358027 0.149279852 HTB1 Histone H2B (HTB1 and HTB2 code for nearly identical proteins) YDR225W 1.375774247 0.202825605 0.184117926 0.251631696 HTA1 Histone H2A (HTA1 and HTA2 code for nearly identical proteins) YDR226W 1.23819216 0.331893837 0.186896007 0.251224095 ADK1 adenylate kinase YDR227W -0.32363599 0.357080791 -0.347779754 0.145214075 SIR4 regulator of silencing at HML, HMR, and telomeres YDR228C 0.257016534 0.115702536 -0.128277841 0.241369861 PCF11 Component of pre-mRNA cleavage and polyadenylation factor I YDR229W 0.08847097 0.571329776 -0.092324736 0.606678068 hypothetical protein YDR230W -0.49956786 0.105369828 0.339417324 0.506439288 questionable ORF YDR231C -0.98607883 0.017232467 0.114100044 0.618973549 COX20 protein required for maturation and assembly of cytochrome oxidase subunit II YDR232W 0.132023373 0.809325263 0.645044092 0.074156982 HEM1 5-aminolevulinate synthase YDR233C 0.748019233 0.070131039 0.818308015 0.040495499 similarity to hypothetical protein YDL204w YDR234W 0.731367269 0.201243178 -0.117591505 0.314127587 LYS4 homoaconitase YDR236C -1.03022089 0.000134445 0.219186708 0.10094327 FMN1 Riboflavin kinase YDR237W 0.416781114 0.182772546 0.547327986 0.001093921 MRPL7 Mitochondrial ribosomal protein MRPL7 (YmL7) YDR241W -0.15063944 0.830174573 0.040882038 0.216248826 questionable ORF YDR242W 0.565742501 0.379051947 -0.195785865 0.130202402 AMD2 putative amidase YDR243C 0.87894121 0.041508824 0.47021407 0.016251224 PRP28 RNA helicase YDR244W 0.361207609 0.357311766 -0.22424617 0.291128439 PEX5 69-kDa protein containing tetratricopeptide repeat (TPR) YDR245W 0.476929704 0.195282774 -0.389771342 0.061886094 MNN10 galactosyltransferase YDR246W -0.27673241 0.037569008 0.09335625 0.225863989 TRS23 TRAPP subunit of 23 kDa YDR247W -2.2195651 0.001297132 0.519009704 0.074589499 strong similarity to Sks1p YDR249C 0.49954876 0.218357692 0.093269378 0.042174535 weak similarity to cytochrome b YDR250C 0.154553214 0.73884961 0.098472868 0.422649731 hypothetical protein YDR251W -0.0074713 0.979865469 -0.158048216 0.107041615 PAM1 multicopy suppressor of protein phosphatase 2A YDR252W 0.209149716 0.324685982 -0.179917496 0.220846137 BTT1 negative regulator of RNA polymerase II YDR253C 0.144438455 0.784900697 0.23047807 0.16372162 MET32 zinc finger DNA binding factor, transcriptional regulator of sulfur amino acid metabolism, highly homologous to Met31p YDR254W -0.46543508 0.007148916 0.044163913 0.718873718 CHL4 chromosome segregation protein YDR255C -0.55527888 0.064055006 -0.077098865 0.059263055 weak similarity to hypothetical S.pombe hypothetical protein SPBC29A3 YDR256C -0.04740211 0.913361403 0.183705575 0.288703986 CTA1 catalase A YDR257C 0.451750618 0.112801427 -0.572866197 0.09536622 RMS1 (putative) transcriptional regulator YDR258C -1.38847847 0.004017737 -0.563415932 0.006690059 HSP78 Mitochondrial heat shock protein 78 kDa YDR259C -0.01612282 0.902499882 0.0944237 0.475097365 YAP6 basic leucine zipper transcription factor YDR260C 0.039315484 0.819934061 -0.061991021 0.377638839 SWM1 Spore Wall Maturation 1 YDR261C 1.117137287 0.13892855 0.506723694 0.093109816 EXG2 Exo-1,3-b-glucanase YDR262W -0.75660309 0.135289904 0.084541497 0.209037192 hypothetical protein YDR263C 0.834559779 0.035583013 0.340294284 0.278617548 DIN7 involved in DNA repair YDR264C 0.408084101 0.34816499 0.02087241 0.647954286 AKR1 Ankyrin repeat-containing protein YDR265W -0.03503159 0.89387485 -0.293686505 0.055903909 PEX10 C3HC4 zinc-binding integral peroxisomal membrane protein YDR266C 0.571158706 0.044005027 0.037847913 0.795088308 similarity to hypothetical C.elegans protein YDR267C 0.473846332 0.095887121 -0.007949727 0.848112462 weak similarity to human TAFII100 and other WD-40 repeat containing proteins YDR268W 0.628361651 0.22014172 -0.258907107 0.050999344 MSW1 mitochondrial tryptophanyl-tRNA synthetase YDR269C -0.37769852 0.366155496 -0.302964253 0.208559261 questionable ORF YDR270W -0.33118429 0.379535629 0.147804978 0.398331888 CCC2 Cu(2+)-transporting ATPase YDR271C -0.11986647 0.609725116 0.725267251 0.018915416 questionable ORF YDR272W -0.92784608 0.003276525 -0.32680297 0.032455709 GLO2 Cytoplasmic glyoxylase-II YDR273W -1.09202467 0.005839006 -0.156178139 0.410817823 weak similarity to YOR042w YDR274C 0.092589039 0.101726394 0.008934084 0.938715117 hypothetical protein YDR275W -1.07341788 0.003082148 -0.625282059 0.023715319 weak similarity to YOR042w YDR276C 0.252065661 0.448809343 0.792064688 0.122316766 PMP3 hypothetical transmembrane protein YDR277C -0.46989416 0.360348018 0.068364987 0.54501897 MTH1 Protein is 61 % identical to Msn3p YDR278C 0.225176024 0.658317249 1.294144031 0.094683403 hypothetical protein YDR279W 0.211505897 0.093712523 -0.290722625 0.114960707 hypothetical protein YDR280W 0.940828302 0.146812506 -0.39084996 0.132024068 RRP45 Putative 3'->5' exoribonuclease ; component of exosome complex of 3'->5' exonucleases YDR281C -3.09108484 1.65893E-05 0.426485093 0.56208095 PHM6 phosphate metabolism ; transcription is regulated by PHO system YDR282C -0.79988798 0.016591341 -0.472140367 0.000400624 similarity to hypothetical protein YDL001w, YFR048w and S.pombe hypothetical protein SPAC12G12.14 YDR283C 0.200148815 0.342108865 0.442649677 0.310735676 GCN2 eukaryotic initiation factor 2 alpha (eIF2-alpha) kinase YDR284C -0.53746221 0.13244537 0.389522796 0.246834229 DPP1 Diacylglycerol Pyrophosphate Phosphatase YDR285W -0.07958782 0.867106119 -0.240984375 0.426064413 ZIP1 synaptonemal complex protein YDR286C 0.031068848 0.782636815 -0.319559138 0.039433312 hypothetical protein YDR287W -0.4256767 0.084371208 -0.017302743 0.823927363 similarity to inositolmonophosphatases YDR288W -1.08740667 0.002644606 -0.633389513 0.097226878 hypothetical protein YDR289C -0.14625261 0.497268474 -0.872011891 0.00916851 RTT103 regulator of Ty1 Transposition YDR290W 0.109880177 0.822957476 0.425122993 0.35004386 questionable ORF YDR291W 0.077189235 0.378369157 -0.402537322 0.027916362 similarity to B.subtilis helicases YDR292C 0.367806884 0.08155011 -0.231562229 0.143617155 SRP101 signal recognition particle receptor - alpha subunit YDR293C -0.60196532 0.035784653 0.301959061 0.221714173 SSD1 putative protein phosphatase//involved in the tolerance to high concentration of Ca2+ YDR294C -0.3918463 0.031442325 0.057996929 0.665177156 DPL1 dihydrosphingosine phosphate lyase (also known as sphingosine phosphate lyase) YDR295C 0.203225925 0.441538848 -0.399218253 0.027928247 PLO2 Ploidy-related YDR296W 0.643290739 0.115802202 -0.144796834 0.281708489 MHR1 Involved in mitochondrial homologous DNA recombination YDR297W 0.60940165 0.487077662 0.592441019 0.02104678 SUR2 Syringomycin response protein 2 YDR298C -1.02440741 0.015304495 0.190312258 0.313488547 ATP5 ATP synthase subunit 5 ; oligomycin sensitivity-conferring protein YDR299W 1.039613703 0.072190318 -0.755654381 0.06795584 BFR2 involved in secretion YDR300C 0.823041186 0.195090145 -0.220847658 0.010302868 PRO1 gamma-glutamyl kinase YDR302W 0.128073106 0.594956584 0.162193616 0.002055641 GPI11 GPI-phosphoethanolamine transferase Gpi7p subunit YDR303C -0.26996637 0.110533266 0.012418052 0.855231473 RSC3 Zinc cluster protein YDR304C 0.151140212 0.101124336 0.505478174 0.026007632 CYP5 Cyclophilin D, Peptidyl-prolyl cis-trans isomerase D YDR305C -0.25634087 0.016922825 -0.162409736 0.21274682 HNT2 member of the histidine triad family YDR306C -0.97162481 0.009530572 -0.327650608 0.128722909 weak similarity to S.pombe hypothetical protein SPAC6F6 YDR307W -0.38685829 0.084945542 0.344183224 0.160605162 similarity to Pmt1p, Pmt2p, Pmt3p and Pmt5p YDR308C 0.49738241 0.158787129 -0.396866868 0.173159567 SRB7 RNA polymerase II holoenzyme component YDR309C 1.309271811 0.162511195 0.405386498 0.082988552 GIC2 Cdc42 binding protein, involved in bud emergence YDR310C -0.00509228 0.990256215 -0.028463666 0.741946352 SUM1 nuclear protein involved in silencing YDR311W 0.202367066 0.519868681 -0.540613327 0.083301012 TFB1 Component of transcription initiation factor IIb, 75 kDa subunit YDR312W 0.917173747 0.021081828 -0.704816627 0.066751245 SSF2 possibly involved in mating YDR313C -0.72671418 0.036108983 -0.068263192 0.337158487 PIB1 phosphatidylinositol(3)-phosphate binding protein YDR314C -0.73594857 0.003977244 -0.480859554 0.008034617 weak similarity to hypothetical S.pombe protein YDR315C 0.090200988 0.788192923 -0.369531309 0.080349992 IPK1 inositol 1,3,4,5,6-pentakisphosphate 2-kinase (IP5 2-kinase) YDR316W 0.635430718 0.05554938 -0.681186553 0.054737873 putative methyltransferase YDR316W-A 1.144766118 0.19349643 0.382734547 0.008266509 TyA gag protein. Gag processing produces capsid proteins. YDR317W 0.340156275 0.381328777 -0.09974564 0.01309692 hypothetical protein YDR318W 0.323630365 0.223663522 -0.136689587 0.264594185 MCM21 involved in minichromosome maintenance YDR319C -0.10183668 0.650294345 0.080801776 0.523795714 hypothetical protein YDR320C -0.30130955 0.576404864 -0.02836439 0.696306343 SWA2 Auxilin-like protein YDR321W 0.443949079 0.343356747 0.051334265 0.575697838 ASP1 Asparaginase I, intracellular isozyme YDR322C-A -0.90690127 0.004677359 -0.015235786 0.884402447 TIM11 subunit e of mitochondrial F1F0-ATPase YDR322W 0.624212866 0.244572423 -0.123886033 0.214790344 MRPL35 Mitochondrial ribosomal protein MRPL35 (YmL35) YDR323C -0.70640484 0.0108053 -0.239110713 0.171379058 PEP7 cytosolic and peripheral membrane protein with three zinc fingers ; cysteine rich regions of amino acids are essential for function YDR324C 1.296562731 0.04988691 -0.589718721 0.043538662 weak similarity to beta transducin from S. pombe and other WD-40 repeat containing proteins YDR325W -0.15777521 0.238748656 -0.586957787 0.122742879 YCG1 Yeast Condensin G YDR326C 0.776967535 0.021254445 0.387259298 0.134077021 strong similarity to YHR080c, similarity to YFL042c and YLR072w YDR327W 0.032050852 0.662294559 0.234813727 0.284606095 questionable ORF Skp1p encodes Cbf3d, a 29 Kd kinetochore protein subunit of CBF3 -- a complex which binds to the CDE III element of centromeres. Skp1p is YDR328C -0.13001779 0.331861724 0.083010175 0.456339183 SKP1 also a subunit of the SculCdc4 (also termed SCFCdc4p) complex. SculCdc4 transfers ubiquitin to phosphorylated Sic1p an YDR329C -0.44546159 0.087930718 -0.081796216 0.009829847 PEX3 48-kDa peroxisomal integral membrane protein YDR330W -0.63515583 0.023467532 -0.32805164 0.226711233 similarity to hypothetical S. pombe protein YDR331W 0.441427492 0.104994146 0.262280486 0.093792673 GPI8 (putative) transamidase involved in GPI anchor attachment YDR332W -0.158491 0.486517233 -0.443353869 0.03708463 similarity to E.coli hypothetical protein and weak similarity to RNA helicase MSS116 / YDR194c YDR333C 0.354558934 0.06906153 -0.45236397 0.058420741 similarity to hypothetical S. pombe protein YDR334W 1.180038031 0.020905523 -0.788724905 0.037120081 SWR1 DEAH-box protein, putative RNA helicase YDR335W -0.38339906 0.001947273 -0.066849526 0.535267259 MSN5 member of major facilitator superfamily, involved in pheromone response YDR336W -0.67073971 0.00668861 -0.384168538 0.036538568 weak similarity to B.subtilis hypothetical protein X YDR337W -0.02323003 0.882532974 -0.700979876 0.036993328 MRPS28 Mitochondrial ribosomal protein MRPS28 (E. coli S15) YDR338C -0.27860148 0.336050746 0.297020938 0.161556481 similarity to Erc1p YDR339C 0.778740257 0.052827563 -0.219557888 0.380283014 weak similarity to hypothetical protein YOR004w YDR340W 0.124890544 0.456853875 -0.039096633 0.763898966 questionable ORF YDR341C 0.807918061 0.069529398 -0.234887035 0.024463296 arginyl-tRNA synthetase, cytosolic YDR342C -0.98566979 0.131106634 0.624470061 0.132175048 HXT7 Hexose transporter YDR343C -0.90682682 0.168627204 0.474054126 0.143027206 HXT6 Hexose transporter YDR344C 0.536320684 0.355207017 0.81411449 0.089154329 hypothetical protein YDR345C 1.279014581 0.287016313 0.664694541 0.12390185 HXT3 Low-affinity glucose transporter YDR346C -0.01617388 0.944132722 -0.731270266 0.029709168 similarity to hypothetical S.pombe protein YDR347W 0.329247591 0.193969833 -0.066495992 0.590824861 MRP1 37 kDa mitochondrial ribosomal protein YDR348C 0.583405594 0.002966238 0.015082048 0.840339226 similarity to hypothetical protein YHR097c YDR349C 0.62369267 0.151051385 0.434266437 0.084043245 YPS7 GPI-anchored aspartic protease YDR350C -0.18347224 0.364505363 -0.214456194 0.027199199 TCM10 protein of unknown function YDR351W 0.820881295 0.113364131 -0.125761382 0.109860118 SBE2 involved in bud growth YDR352W -0.3811665 0.114259784 0.154680578 0.403931812 weak similarity to hypothetical proteins YOL092w, YBR147w and YMR010w YDR353W 0.792031628 0.33143244 0.232832587 0.314187473 TRR1 Thioredoxin reductase YDR354W 0.481821746 0.145145932 0.224272433 0.135230668 TRP4 anthranilate phosphoribosyl transferase YDR355C -0.106572 0.818878186 4.368111476 0.417154919 questionable ORF YDR356W 0.035600774 0.878504969 -0.702036029 0.060863921 NUF1 component of the spindle pole body that interacts with Spc42p, calmodulin, and a 35 kDa protein YDR357C -0.56722841 0.054611691 -0.405201685 0.001724743 hypothetical protein YDR358W -1.44976349 0.001770383 -0.309080538 0.088995647 GGA1 Arf-binding protein YDR360W 0.595875206 0.41037125 0.575655747 0.125326733 questionable ORF YDR361C 0.838337599 0.019311934 -0.444068153 0.105619865 hypothetical protein YDR362C -0.38431442 0.016360869 -0.335717738 0.015131379 TFC6 91 kDa tau91 subunit of transcription factor IIIC (TFIIIC) YDR363W -0.23386793 0.532168582 -0.618752292 0.058498904 ESC2 establishes silent chromatin YDR363W-A 0.545356774 0.060734551 -0.496686513 0.110228944 SEM1 unknown function, similar to S. pombe Dss1 YDR364C 0.011696618 0.878878791 -0.5012085 0.044683432 CDC40 Member of the beta transducin family YDR365C 0.921985996 0.146450281 -0.921463761 0.047930083 weak similarity to Streptococcus M protein YDR365W-A 0.915508242 0.010618658 0.442576964 0.021953487 TyA gag protein. Gag processing produces capsid proteins. YDR366C 0.326795808 0.379091497 0.070929539 0.437582139 similarity to YOL106w and YER181c YDR367W 0.147462381 0.731313317 0.159442615 0.08198696 hypothetical protein YDR368W -1.51818968 0.000864158 0.321163473 0.263063682 YPR1 similar to aldo-keto reductase YDR369C -0.5707983 0.029069973 -0.400264327 0.094436285 XRS2 DNA repair protein YDR370C 0.801674746 0.046340508 -0.262081672 0.231858658 hypothetical protein YDR371W 0.499616491 0.258224382 -0.325720196 0.24552824 similarity to chitinases YDR372C 0.111793902 0.699508919 -0.41233227 0.019002772 similarity to hypothetical S. pombe protein YDR373W 0.602253475 0.029969337 -0.141117709 0.016049025 FRQ1 regulator of phosphatidylinositol-4-OH kinase protein YDR374C 0.392982154 0.522875711 0.417977968 0.236249136 similarity to hypothetical A. thaliana protein BAC F21M12 YDR375C 0.686481635 0.183395379 -0.168728017 0.086368684 BCS1 Mitochondrial ATPase (AAA family) YDR376W 0.058579686 0.834083171 -0.386213369 0.004074666 ARH1 adrenodoxin oxidoreductase homolog YDR377W -0.82027602 0.001781848 -0.1793832 0.438550319 ATP17 ATP synthase subunit f YDR378C 0.378922289 0.069342427 0.084070678 0.184026588 LSM6 Sm-like protein YDR379W 0.268733771 0.591350091 -0.176475274 0.148868542 RGA2 Contains a Rho-GAP domain and two LIM domains. Has strong similarity to Rga1p. Has some similarity to all known Rho-GAPs. YDR380W -1.22152817 0.0363281 0.509793696 0.138236987 similarity to Pdc6p, Thi3p and to pyruvate decarboxylases YDR381W 0.529996932 0.324290354 0.025197995 0.781747868 YRA1 Nuclear RNA-binding RNA annealing protein YDR382W 2.220277424 0.066689938 0.428438433 0.003750935 RPP2B Ribosomal protein P2B (YP2beta) (L45) YDR383C 0.485441759 0.153799749 -0.205860487 0.135544998 weak similarity to S.pombe paramyosin YDR384C 1.43602624 0.151594784 0.610719551 0.021982557 strong similarity to Y.lipolytica GPR1 gene YDR385W 1.308443985 0.173032647 0.26345481 0.425144907 EFT2 translation elongation factor 2 (EF-2) YDR386W -0.33183069 0.089507768 -0.714809184 0.024298515 MUS81 involved in DNA repair, interacts with Rad54 YDR387C -0.16119172 0.556278671 0.133769676 0.378509624 similarity to Itr1p and Itr2p and E.coli araE YDR388W -0.49068859 0.122429304 0.153937595 0.160990184 RVS167 (putative) cytoskeletal protein YDR389W 0.34836191 0.180599178 0.402057369 0.071349243 SAC7 GTPase activating protein (GAP) for RHO1 YDR390C 0.386032067 0.077734581 -0.110015022 0.495536765 UBA2 similar to ubiquitin activating enzyme (E1) YDR391C 0.11065802 0.839098704 -0.012211618 0.713845493 transcriptional activator//general transcriptional adaptor or co-activator YDR392W -0.28487372 0.090996821 -0.584519519 0.010763734 SPT3 transcription factor, member of the histone acetyltransferase SAGA complex YDR393W -1.19063802 0.001807232 0.823266158 0.061393742 SHE9 similar to Arabidopsis Cip1, lethal when overexpressed YDR394W 0.133149596 0.663960597 0.019199598 0.384322886 RPT3 ATPase (AAA family) component of the 26S proteasome complex Sxm1p shares similarity with Cse1p homologs including Nmd5p, Cse1p, Lph2p, and the human cellular apoptosis susceptibility protein, CAS1 ; YDR395W 1.131609452 0.058341845 0.211052181 0.060565627 SXM1 Sxm1p also shares homology with the karyopherin, Kap95p ; Sxm1p is primarily a nuclear protein YDR396W 0.367176809 0.328080478 0.070262868 0.622672577 hypothetical protein YDR397C 0.343755804 0.188835565 -0.372481754 0.161741531 NCB2 repressor of class II transcription YDR398W 0.80151525 0.049737942 0.142475735 0.312080085 similarity to human KIAA0007 gene YDR399W 1.163829532 0.096682641 -0.029127361 0.788194658 HPT1 hypoxanthine guanine phosphoribosyltransferase YDR400W -0.06634951 0.808107658 0.151165234 0.295515628 URH1 uridine nucleosidase (uridine ribohydrolase) ; EC 3.2.2.3 YDR401W 0.163633737 0.57072403 0.223095935 0.426995089 questionable ORF YDR402C 0.219066424 0.603983284 -0.10549513 0.347333559 DIT2 Cytochrome P450 56, Dit2p catalyzes oxidation of N-formyl tyrosine to N,N-bisformyl dityrosine in vitro first enzyme in dityrosine synthesis in the outer layer of the spore wall pathway converting L-tyrosine to N-formyl-L-tyrosine, expressed late (10- YDR403W -0.35187998 0.009536199 -0.067972813 0.724489941 DIT1 16 hr) in sporulation YDR404C 0.700787011 0.038132526 0.314224765 0.057113029 RPB7 dissociable subunit of RNA polymerase II YDR405W 0.407869997 0.369789242 0.353183079 0.204100232 MRP20 263-amino acid mitochondrial ribosomal large subunit protein ; similar to L23 family of ribosomal proteins YDR407C 0.099383716 0.431500088 -0.019036441 0.885642482 TRS120 Component of targeting complex (TRAPP) involved in ER to Golgi membrane traffic YDR408C 0.908706344 0.202445621 0.210421228 0.173451021 ADE8 glycinamide ribotide transformylase YDR410C 0.905683825 0.236070062 0.542633146 0.081160598 STE14 farnesyl cysteine-carboxyl methyltransferase YDR411C 0.227379171 0.160110973 0.453362524 0.145694807 weak similarity to Der1p YDR412W 0.200787629 0.257764554 -0.694060937 0.038429862 questionable ORF YDR413C 0.044323259 0.789133565 -0.711652136 0.052076263 weak similarity to NADH dehydrogenase YDR414C 0.126965094 0.460110701 0.074952171 0.401226511 ERD1 involved in rentention of lumenal ER proteins YDR415C 0.236646186 0.508240151 0.211066833 0.163498664 strong similarity to bacterial leucyl aminopeptidase YDR416W 0.191920817 0.148750807 -0.395996953 0.017726727 SYF1 (putative) involved in cell cyle ; similar to Drosophila crooked neck YDR417C 0.109012398 0.705458291 0.105566986 0.049278455 questionable ORF YDR418W 0.718618587 0.036794052 0.039131475 0.493819128 RPL12B Ribosomal protein L12B (L15B) (YL23) YDR421W -0.6918314 0.095278557 -0.333093964 0.023030874 hypothetical protein YDR422C -0.3288677 0.053069588 0.243060843 0.226069715 SIP1 SNF1 protein kinase substrate YDR423C -0.32500139 0.161244822 0.122154395 0.147333682 CAD1 basic leucine zipper transcription factor YDR425W -0.30617011 0.248471638 -0.073626369 0.448723836 similarity to hypothetical protein YDL113c YDR427W 0.171985813 0.622925662 -0.374313538 0.084651338 RPN9 Subunit of the regulatory particle of the proteasome YDR428C -0.3573216 0.133073405 -0.341550531 0.011450049 hypothetical protein YDR429C 0.427038771 0.115919042 -0.748841678 0.033147906 TIF35 translation initiation factor eIF3 subunit YDR430C 0.557950535 0.205643787 -0.60075329 0.070439495 similarity to C.perfringens hypothetical hypA protein YDR431W 0.785073117 0.025177833 -0.129718546 0.433407813 questionable ORF YDR432W 0.377713434 0.495764478 -0.464364017 0.359797418 NPL3 nuclear shuttling protein with an RNA recognition motif YDR433W -0.0691753 0.865331191 -0.127728664 0.476396156 questionable ORF YDR434W -0.08024147 0.672738269 -0.059475483 0.086485818 similarity to S.pombe hypothetical protein YDR435C -0.80263171 0.034532013 -0.214719074 0.028539446 PPM1 carboxy methyl transferase for protein phosphatase 2A catalytic subunit YDR436W -0.31176373 0.466621601 0.439936567 0.179121988 PPZ2 serine-threonine phosphatase Z YDR437W 1.414359174 0.220805257 0.617353891 0.042670291 hypothetical protein YDR438W 3.220277118 0.309583604 0.568503813 0.103735308 strong similarity to hypothetical protein YML018c YDR439W -0.44812343 0.083386822 -0.333787069 0.049815178 LRS4 involved in rDNA silencing YDR440W 0.243719069 0.391652809 -0.453564985 0.020699001 DOT1 involved in meiosis and transcriptional silencing YDR441C 0.649793423 0.012137397 0.988321229 0.12149114 APT2 Adenine Phosphoribosyltransferase YDR442W 0.326767425 0.078852021 0.357901606 0.090503988 questionable ORF YDR443C -0.33714205 0.090916917 0.312589841 0.01964241 SSN2 transcription factor YDR444W 0.078000728 0.696797352 -0.339611151 0.040905102 lipase family protein containing serine active site YDR445C 0.05001446 0.845455469 0.403478098 0.018694971 questionable ORF YDR446W 0.356962096 0.545918924 -0.537438773 0.317538337 ECM11 (putative) involved in cell wall biogenesis YDR447C 1.055119248 0.089987338 -0.489944811 0.08489435 RPS17B Ribosomal protein S17B (rp51B) YDR448W 0.731821124 0.082515409 0.36585192 0.027264188 ADA2 transcription factor, member of ADA and SAGA, two transcriptional adaptor /HAT (histone acetyltransferase)complexes YDR449C 1.572678231 0.113073448 -0.65300726 0.135022595 hypothetical protein YDR450W 1.329530264 0.047370355 -0.073409286 0.687153255 RPS18A Ribosomal protein S18A YDR451C 0.64006381 0.211871888 0.381901384 0.041503308 strong similarity to Yox1p YDR452W -0.39520633 0.1134875 -0.230495457 0.093323904 PHM5 vacuolar polyphosphatase YDR453C -1.01039156 0.02072384 0.316183279 0.178791675 strong similarity to thiol-specific antioxidant proteins YDR454C 0.085390424 0.819950609 0.117912425 0.500345059 GUK1 guanylate kinase YDR455C 0.078012919 0.70840955 0.892289851 0.081305763 questionable ORF YDR456W -0.0811503 0.810741052 0.546027031 0.139090496 NHX1 Na+ /H+ exchanger YDR458C -0.39583791 0.05285198 -0.77354765 0.043644449 similarity to hypothetical protein YML034w and YML033w YDR459C 0.272717457 0.168395967 0.183703941 0.267191667 weak similarity to YNL326c YDR460W 0.137116239 0.49706668 -0.281656195 0.259832787 TFB3 TFIIH subunit Tfb3 , contains ring finger motif ; similar to mammalian CAK subunit YDR461W 0.107988642 0.835483221 0.641486691 0.206247667 MFA1 a-factor mating pheromone precursor YDR462W 0.690329011 0.167666367 0.190713969 0.217104614 MRPL28 Mitochondrial ribosomal protein MRPL28 (YmL28) YDR463W -0.22932134 0.376865243 0.003894358 0.977072166 STP1 Nuclear-localized protein containing zinc finger motifs YDR464W -0.4858465 0.099067405 -0.471035194 0.123596351 SPP41 negative regulator of prp genes YDR465C 1.269743619 0.012577124 -0.280269761 0.288398924 RMT2 Protein arginine methyltransferase YDR466W -0.1187259 0.330160874 -0.041971095 0.425605434 similarity to ser/thr protein kinase YDR467C 0.437282212 0.004341548 0.126771034 0.01268958 questionable ORF YDR468C 0.258528633 0.276279986 -0.480373122 0.195360173 TLG1 tSNARE that affects a Late Golgi compartment YDR469W 0.556475792 0.32891975 -0.567206696 0.127240107 hypothetical protein YDR470C 0.10599613 0.452434867 0.086002736 0.261479016 similarity to chromosome segregation protein Cse1p YDR471W 1.407346931 0.127932715 0.080286664 0.720570589 RPL27B Ribosomal protein L27B YDR472W 0.468252567 0.035173641 0.35102071 0.059983935 TRS31 Component of targeting complex (TRAPP) involved in ER to Golgi membrane traffic YDR473C -0.14501529 0.101737379 -0.796734521 0.035905134 PRP3 snRNP from U4 /U6 and U5 snRNPs YDR474C -1.1407093 0.025947946 0.097189595 0.574841579 similarity to C-terminal region of YOR019w YDR475C -0.64051052 0.171075436 -0.17928331 0.19340542 hypothetical protein YDR476C 0.424252463 0.29990515 0.722649894 0.061711419 hypothetical protein YDR477W -0.8803078 0.023770665 -0.009458246 0.927983207 SNF1 protein serine /threonine kinase YDR478W 0.443378162 0.204195488 -0.205440771 0.042849832 SNM1 RNase MRP (Mitochondrial RNA Processing) protein component YDR479C -0.38171273 0.212067837 0.04038653 0.637999562 weak similarity to YHR150w YDR480W 0.671051084 0.013578193 0.00856948 0.956587281 DIG2 MAP kinase-associated protein YDR481C -1.99037994 0.000686781 -0.009850281 0.836075207 PHO8 repressible alkaline phosphatase YDR482C 0.702960167 0.154600008 0.108230023 0.206729017 hypothetical protein YDR483W -0.22465382 0.54312052 0.354642104 0.105293477 KRE2 alpha-1,2-mannosyltransferase YDR484W -0.01054578 0.913939587 -0.476497722 0.125854483 SAC2 involved in localization of actin and chitin YDR485C 0.15733072 0.276606244 -0.559699956 0.056382733 similarity to trichohyalin YDR486C -0.08924129 0.417412719 -0.041197733 0.731263246 weak similarity to Snf7p YDR487C 1.241190587 0.208587209 0.410317033 0.060187364 RIB3 3,4-dihydroxy-2-butanone 4-phosphate synthase YDR488C -0.15336153 0.46013114 -0.016980803 0.937758614 PAC11 similar to rat dynein intermediate chain YDR489W 0.921891519 0.052915741 0.315647878 0.040247745 hypothetical protein YDR490C 0.070636664 0.901759143 0.474193278 0.160966541 PKH1 Ser /Thr protein kinase YDR491C -0.20905149 0.447728891 0.187816039 0.47027868 questionable ORF YDR492W 0.491705426 0.396576838 0.411732404 0.243057005 strong similarity to hypothetical protein YOL002c YDR493W 0.862295062 0.003628006 0.111636766 0.073595219 hypothetical protein YDR494W 0.463847109 0.168193919 -0.517510062 0.077217586 hypothetical protein YDR495C 0.025978746 0.865070204 -0.662219592 0.041925096 VPS3 vacuolar protein targeting protein YDR496C 1.500595307 0.082775931 -0.668803591 0.11620286 similarity to hypothetical human and C.elegans proteins YDR497C 1.503238844 0.326090113 0.367207341 0.195456864 ITR1 myo-inositol transporter YDR498C -0.37095569 0.100799671 0.180562466 0.550298297 SEC20 membrane glycoprotein, sorted by HDEL retrieval system YDR499W 0.444270404 0.093109272 -0.272011839 0.139747518 LCD1 cell cycle checkpoint protein YDR500C 0.866460723 0.052853159 0.097665805 0.419301977 RPL37B 60S ribosomal protein L37B (L43) (YL35) YDR501W 0.438229824 0.433029437 -0.03106866 0.601610181 PLM2 PLasmid Maintenance YDR502C 0.7778676 0.472161761 -0.128186071 0.135540786 SAM2 S-adenosylmethionine synthetase YDR503C -0.2329969 0.404714877 0.019556247 0.904029927 LPP1 Lipid phosphate phosphatase YDR504C -0.53148042 0.004292095 0.383036808 0.299934941 similarity to hypothetical T.brucei protein YDR505C -0.60910221 0.073575251 0.043434982 0.246013865 PSP1 high-copy suppressor of cdc17 DNA polymerase alpha mutations YDR506C -0.85572483 0.023926734 5.85044E-05 0.999528502 similarity to FET3, YFL041w and F.floriforme diphenol oxidase YDR507C 0.74856798 0.095197621 -0.040433591 0.789753296 GIN4 putative serine /threonine kinase YDR508C 0.725864745 0.038039857 0.216256055 0.031641512 GNP1 high-affinity glutamine permease YDR510W 0.709317217 0.041900883 0.165134377 0.456383289 SMT3 ubiquitin-like protein YDR511W 0.088543555 0.528529009 0.459097453 0.11998256 weak similarity to C. elegans protein F25H9.7 and to the human complement 3 precursor YDR512C -0.10016964 0.363968696 0.451674801 0.026372911 questionable ORF YDR513W -1.0791281 0.00255906 0.362849642 0.169457024 TTR1 Glutaredoxin (thioltransferase) (glutathione reductase) YDR514C 1.014838693 0.001830504 -0.330171546 0.120865308 strong similarity to hypothetical protein YCL036w YDR515W 0.60878404 0.098321923 -0.670410763 0.107214846 SLF1 RNA binding protein with La motif YDR516C -0.70646572 0.175719589 0.169365307 0.572838255 strong similarity to glucokinase YDR517W -0.85217115 0.005233038 0.097125926 0.785518675 GRH1 Yeast homologue of mammalian GRASP proteins, also localised to the Golgi apparatus. YDR518W -0.04192631 0.899156866 0.324688698 0.055299611 EUG1 Protein disulfide isomerase homolog YDR519W 0.387803425 0.47144229 0.255039565 0.132218247 FKB2 FKBP (FK506 binding protein) 13 ; peptidylprolyl cis-trans isomerase activity YDR520C 0.273002169 0.361623287 -0.106490365 0.233739684 weak similarity to transcription factors of the zinc finger class YDR521W 0.052428752 0.85998739 -0.015364 0.776403642 questionable ORF YDR522C -0.35264905 0.412209649 0.213158051 0.207712266 SPS2 involved in meiosis YDR523C -0.40579537 0.135973796 -0.266421109 0.049780018 SPS1 serine /threonine kinase homologous to Ste20p ; expressed in middle /late meiosis YDR524C 0.421821236 0.004517613 -0.005170742 0.921934563 AGE1 ARF GAP with effector function(s) YDR525W-A -0.05322003 0.77694401 1.366787888 0.081456285 identified by SAGE YDR526C 0.564034417 0.048789361 -0.202204038 0.483773555 questionable ORF YDR527W 0.819774645 0.040265077 -0.510715905 0.127999076 weak similarity to Plasmodium yoelii rhoptry protein YDR528W 0.145063816 0.656584383 -0.065891973 0.510619887 HLR1 Homologous to LRE1 ; antagonistic to PKA YDR529C -1.21816803 0.000415906 0.114455614 0.160800205 QCR7 ubiquinol-cytochrome c oxidoreductase subunit 7 (14 kDa) YDR530C -0.86633203 0.003829176 0.127038549 0.278623745 APA2 5',5'''-P-1,P-4-tetraphosphate phosphorylase II YDR531W 0.298274719 0.123707303 -0.36917609 0.026302615 similarity to hypothetical A. thaliana and C. elegans proteins YDR532C -0.21502178 0.128316543 -0.931480214 0.023468297 weak similarity Plasmodium repeat organellar protein YDR533C -1.40739449 0.027969868 0.041842272 0.812120196 strong similarity to hypothetical proteins YPL280w, YOR391c and YMR322c YDR534C -0.51341322 0.380127767 0.536777168 0.300353236 similarity to YOR383c,Sta1p and pig mucin YDR535C -0.26000857 0.559576667 -0.003325839 0.991810693 hypothetical protein YDR536W -0.23694247 0.640193399 0.105061316 0.354270602 STL1 sugar transporter-like protein YDR537C -0.20821396 0.216222598 0.215197438 0.379516311 questionable ORF YDR538W -0.15442208 0.339520414 0.088028108 0.3134879 PAD1 Phenylacrylic acid decarboxylase YDR539W -0.30521193 0.198449013 0.034452515 0.762023926 similarity to E.coli hypothetical 55.3 kDa protein in rfah-rfe intergenic region YDR540C 0.123253821 0.791617134 -0.309043239 0.081972816 hypothetical protein YDR541C 0.332612161 0.33524877 0.11774126 0.149216587 similarity to dihydroflavonol-4-reductases YDR542W 0.160225095 0.449910795 0.537975105 0.216087899 strong similarity to subtelomeric encoded proteins YDR543C 0.200700763 0.578094255 0.442827629 0.221753251 strong similarity to subtelomeric encoded proteins YDR544C -0.10229422 0.866371184 0.499674866 0.082319594 strong similarity to subtelomeric encoded proteins YDR545W -1.03543746 0.020183012 0.600980893 0.11044168 YRF1-1 Y'-helicase protein 1 YEL001C 1.10257407 0.166641125 0.486664889 0.053776311 hypothetical protein YEL002C 0.09139695 0.816980657 0.367100705 0.142196038 WBP1 oligosaccharyl transferase glycoprotein complex, beta subunit YEL003W 0.033995744 0.91557484 -0.934401915 0.005423721 GIM4 bovine prefoldin subunit 2 homolog (putative) YEL004W 0.456556507 0.254482734 0.067777252 0.181333424 YEA4 similar to Gog5, which is involved in vanadate resistance YEL005C -0.50621267 0.04712766 -0.097860296 0.257733978 VAB2 Vac8p binding protein of 31 kDa YEL006W -0.48193397 0.238856357 -0.336526258 0.060951514 similarity to peroxisomal membrane and mitochondrial carrier proteins YEL008W -0.00517178 0.974878143 0.660434159 9.25E-05 hypothetical protein YEL009C 1.290502612 0.148353071 0.15607677 0.09625498 GCN4 transcriptional activator of amino acid biosynthetic genes YEL010W 0.291551501 0.696653662 0.00476955 0.966678226 hypothetical protein YEL011W -2.49925762 0.00221088 0.298688628 0.351810097 GLC3 1,4-glucan-6-(1,4-glucano)-transferase YEL012W -1.57988663 0.006059706 -0.578477883 0.00696074 UBC8 ubiquitin-conjugating enzyme ; ubiquitin-protein ligase YEL013W -0.2972505 0.037025318 -0.280119285 0.052080505 VAC8 An armadillo repeat-containing protein localized on the vacuolar membrane YEL014C 0.337278941 0.395898678 0.086926635 0.397122206 hypothetical protein YEL015W 0.696610678 0.032507953 -0.582404665 0.073318202 weak similarity to Spa2p YEL016C -0.47177248 0.014843917 0.161139785 0.468612179 similarity to human nucleotide pyrophosphatase YEL017C-A 0.731820516 0.192799861 1.012351431 0.101589885 PMP2 Proteolipid associated with plasma membrane H(+)-ATPase (Pma1p) YEL017W -0.46485983 0.162160571 0.259192515 0.011130458 hypothetical protein YEL018W 0.828087808 0.065537726 -0.351204569 0.113767673 weak similarity to Rad50p YEL019C 0.338297315 0.299284447 0.176956882 0.443655371 MMS21 involved in DNA repair YEL020C -0.86827779 0.015521335 -0.135490194 0.168528786 similarity to O.formigenes oxalyl-CoA decarboxylase YEL020W-A 0.553601956 0.024829396 -0.104340348 0.241410413 TIM9 mitochondrial inner membrane translocase YEL022W 0.231437763 0.478549022 0.0226399 0.446993149 GEA2 ARF GTP /GDP exchange factor YEL023C -0.29614721 0.142933056 -0.127990323 0.224233316 hypothetical protein YEL024W -1.33690609 0.004423295 0.185844227 0.316572509 RIP1 Rieske iron-sulfur protein of the mitochondrial cytochrome bc1 complex YEL025C -0.00995806 0.957375295 -0.241570363 0.0038768 SRI1 SWI /SNF and RSC interacting protein 1 YEL026W 2.570613313 0.060898561 0.762544715 0.020900433 SNU13 U4 /U6.U5 snRNP component YEL027W 0.788604659 0.044054604 0.914573493 0.080478302 CUP5 vacuolar ATPase V0 domain subunit c (17 kDa) YEL028W 0.530700685 0.239803911 0.293969138 0.050658152 hypothetical protein YEL029C 0.795253956 0.403764732 -0.633751971 0.00223025 similarity to hypothetical protein YNR027w YEL030W -0.75581567 0.140568191 0.194495312 0.323459504 ECM10 similar to Hsp70, involved in cell wall biogenesis YEL031W -0.18803941 0.359111973 0.359063412 0.181983417 SPF1 P-type ATPase YEL033W 0.708141846 0.091912942 0.849938707 0.024812695 weak similarity to Sauroleishmania mitochondrial hypothetical ORF-5 protein YEL034W 0.504269654 0.117599088 0.72425885 0.016418616 HYP2 Translation initiation factor eIF-5A YEL035C 0.342691044 0.507620787 0.450163196 0.132886679 UTR5 protein of unknown function YEL036C 0.594893847 0.022602749 0.317008416 0.059023866 ANP1 subunit of mannosyltransferase complex YEL037C 0.453501065 0.084980312 0.086348871 0.604822376 RAD23 ubiquitin-like protein YEL038W -0.14716836 0.535009193 0.566644399 0.026350052 UTR4 similarity to K.oxytoca enolase-phosphatase E-1 YEL039C -1.04002342 0.018749387 0.227184676 0.043880023 CYC7 iso-2-cytochrome c YEL040W 3.128134933 0.201029382 0.501867212 0.026603408 UTR2 weak similarity to Bacillus 1,3-1,4-beta-glucanase YEL041W -0.90391944 0.026621318 -0.260816936 0.008490218 strong similarity to Utr1p YEL042W 0.527286173 0.240956724 0.348171598 0.001836517 GDA1 Guanosine diphosphatase of Golgi membrane YEL043W 0.015164796 0.962976194 0.335139821 0.036398563 weak similarity to Mad1p YEL044W 0.097459191 0.352332462 0.051738832 0.625780442 hypothetical protein YEL045C 1.143883768 0.19208892 1.344094103 0.020846541 weak similarity to cytochrome c oxidase III of T.brucei kinetoplast YEL046C -0.07792227 0.783790196 0.377726219 0.074570365 GLY1 Threonine Aldolase YEL047C 0.000202793 0.999428217 0.353079196 0.206645219 FRDS1 soluble fumarate reductase, cytoplasmic YEL048C 0.374183795 0.256834127 -0.355024051 0.208630951 hypothetical protein YEL049W -0.23049001 0.674442214 0.796362266 0.050661044 PAU2 similar to members of the seripauperin (PAU) family YEL050C 0.354406938 0.307282316 -0.144303536 0.13369724 RML2 mitochondrial ribosomal protein L2 of the large subunit YEL051W -0.2576987 0.568353779 -0.617727733 0.040326634 VMA8 vacuolar ATPase V1 domain subunit D YEL052W 0.14519015 0.703914225 0.158885982 0.43034003 AFG1 ATPase family gene YEL053C -0.0673508 0.592794022 -0.26974774 0.022716428 MAK10 glucose-repressible protein required for replication of dsRNA virus YEL055C 0.32732929 0.000951809 -0.094909271 0.213722042 POL5 DNA polymerase V YEL056W 0.395286493 0.078801933 0.090202285 0.325815561 HAT2 subunit of a cytoplasmic histone acetyltransferase YEL057C 0.541567273 0.043346283 0.391633863 0.206094219 hypothetical protein YEL059C-A -0.57813478 0.09806415 0.59895921 0.125611372 SOM1 involved in mitochondrial inner peptidase function YEL059W -0.14489734 0.537558225 0.358595536 0.124503286 hypothetical protein YEL061C 0.253292279 0.454418585 -0.412072528 0.273915435 CIN8 kinesin-related protein involved in establishment and maintenance of mitotic spindle YEL062W 0.176455514 0.5431103 0.31684684 0.12670636 NPR2 Non-membrane-embedded, PEST sequence-containing protein YEL063C -0.57901092 0.051010942 0.4224296 0.033076731 CAN1 arginine permease YEL064C -0.78964838 0.10483026 -0.037929459 0.81000969 similar to amino acid transport proteins YEL065W 0.623246967 0.429025132 0.083447472 0.48380425 SIT1 Ferrioxamine B permease YEL066W -0.45319575 0.421583791 0.570156961 0.217921578 HPA3 histone acetyltransferase complex subunit YEL067C 0.259295992 0.442559806 0.565018226 0.127292496 weak similarity to YKL083w YEL068C -0.79832174 0.036975695 0.281285116 0.259642681 hypothetical protein YEL069C -0.5363826 0.093179076 0.46983103 0.049358476 HXT13 high-affinity hexose transporter YEL070W -1.06894627 0.010600427 0.04623295 0.848219981 strong similarity to E.coli D-mannonate oxidoreductase YEL071W 1.036156571 0.198251377 -0.02913297 0.577182048 DLD3 D-lactate dehydrogenase YEL072W -0.7084363 0.026671707 -0.720483281 0.028670556 hypothetical protein YEL073C 0.950691263 0.387459627 -0.094232024 0.627892455 similarity to YJR108w YEL074W 0.042499175 0.84581291 0.418696436 0.278014253 similarity to subtelomeric encoded proteins YEL075C -0.11694537 0.59391621 0.546382513 0.094710629 strong similarity to subtelomeric encoded proteins YEL076C -0.68930116 0.028490828 0.556596854 0.037642554 hypothetical protein YEL076W-C -0.61515954 0.013022442 0.600998067 0.114525184 hypothetical protein YEL077C -1.12049312 0.003141734 0.435254078 0.241442627 strong similarity to subtelomeric encoded proteins YER001W -0.92158241 0.070827606 -0.248972626 0.1476173 MNN1 Alpha-1,3-mannosyltransferase YER002W 0.781694842 0.03632482 -0.772853997 0.150805416 weak similarity to chicken microfibril-associated protein YER003C 0.49706498 0.411542354 0.35823493 0.064457217 PMI40 mannose-6-phosphate isomerase YER004W 0.185296267 0.518408376 0.412215402 0.058139636 similarity to hypothetical E.coli and C.elegans proteins YER005W -0.19896161 0.291539999 0.059700367 0.53261671 YND1 apyrase (NDPase /NTPase) YER006W 1.18715661 0.049662508 -0.332887808 0.138792989 similarity to P.polycephalum myosin-related protein mlpA YER007W -0.31685305 0.390938418 -0.25389805 0.256643808 PAC2 (putative) tubulin cofactor E, involved in microtubule stability SEC3 encodes the 144 kD and 91 kD components of the Exocyst complex ; the 91 kD component is a C-terminal proteolytic breakdown YER008C 0.013184685 0.935504773 0.12067997 0.267924092 SEC3 product of full length Sec3p YER009W 1.125498361 0.090259381 0.651613619 0.025209974 NTF2 nuclear transport factor, homologous to mammalian cytosolic nuclear import factor NTF2 YER010C -0.11549357 0.610927563 0.569517032 0.081246701 similarity to L.pneumophila dlpA YER011W 3.173635106 0.194033743 0.892090316 0.075359512 TIR1 Cold-shock induced protein of the Srp1p /Tip1p family of serine-alanine-rich proteins YER012W 0.214874793 0.652734298 -0.105789773 0.245341971 PRE1 22.6 kDa proteasome subunit YER013W -0.31311754 0.097941921 -0.122236169 0.335682747 PRP22 helicase-like protein YER014W -0.14248224 0.548221134 -0.216528524 0.080562335 HEM14 protoporphyrinogen oxidase YER015W -1.08653383 0.028264117 -0.119665078 0.25414989 FAA2 Acyl-CoA synthetase (fatty acid activator 2) YER016W 0.42392771 0.230088748 -0.32769884 0.371003473 BIM1 microtubule-binding protein YER017C 0.321179217 0.473830136 0.016762808 0.819725638 AFG3 ATP-dependent metalloprotease YER018C 0.608409537 0.037957119 0.590408462 0.032122367 SPC25 component of spindle pole YER019C-A 0.591794412 0.057266362 0.553482064 0.001935659 SBH2 homologous to Sbh1p YER019W 0.530964282 0.041565297 0.831367976 0.105999988 ISC1 InositolphosphoSphingolipids-phospholipase C YER020W -1.00247284 0.022929428 0.164758676 0.206088851 GPA2 nucleotide binding regulatory protein YER021W -0.26491239 0.172621071 -0.257928275 0.153431222 RPN3 component of the regulatory module of the 26S proteasome, homologous to human p58 subunit YER022W -0.34913585 0.058188196 -0.679956661 0.060471371 SRB4 subunit of RNA polymerase II holoenzyme /mediator complex YER023W -0.3863816 0.239187986 -0.035554966 0.728360268 PRO3 delta 1-pyrroline-5-carboxylate reductase YER024W -0.09141187 0.842768068 -0.08947325 0.313509432 similarity to carnitine O-acetyltransferase Yat1p YER025W 0.785722786 0.017022523 -0.004711989 0.944659626 GCD11 gamma subunit of translational initiation factor eIF-2 YER027C -0.59907859 0.017362791 0.072341078 0.460404646 GAL83 glucose repression protein, a component of the Snf1 complex YER028C 0.395557263 0.123017502 0.169745818 0.051005331 similarity to Mig1p YER029C 0.060435835 0.717542003 -0.446392585 0.093140569 SMB1 U1 snRNP protein YER030W -0.03477296 0.870943298 -0.802488332 0.041247076 similarity to mouse nucleolin YER031C 0.350187306 0.360826982 0.081962878 0.470805003 YPT31 ras-like GTPase, highly homologous to YPT32 YER032W -0.23287507 0.398032991 0.491567133 0.180990708 FIR1 Putative participant in 3' mRNA processing YER033C -0.37051214 0.218533838 0.328759247 0.219842238 ZRG8 zinc regulated gene YER034W -0.2421468 0.203284137 -0.019521955 0.81821575 hypothetical protein YER035W -0.79961972 0.003181901 0.054135947 0.400062917 EDC2 Functions with Edc1p to stimulate mRNA decapping YER036C 0.695997665 0.156776985 -0.070889317 0.187793956 strong similarity to members of YER037W -1.37388592 0.027263351 -0.400454715 0.136855878 PHM8 strong similarity to hypothetical YER038C -0.16362813 0.561126381 -0.015153434 0.872022409 hypothetical protein YER039C -0.53675088 0.112983833 0.40698086 0.185544097 HVG1 (putative) nucleotide sugar transporter YER040W 0.027677093 0.900940113 0.23508607 0.252962954 GLN3 Transcriptional activator of nitrogen-regulated genes YER041W -0.40251896 0.173582491 -0.219977071 0.310660817 YEN1 weak similarity to DNA repair protein Rad2p and Dsh1p YER042W -0.10901661 0.44167315 -0.210773823 0.173981977 MXR1 peptide methionine sulfoxide reductase YER043C 1.241315334 0.289347163 0.378326091 0.054567809 SAH1 putative S-adenosyl-L-homocysteine hydrolase YER044C -0.7285593 0.02914278 0.440999044 0.051876826 involved in synthesis of ergosterol YER044C-A 1.117655734 0.241502598 -0.27132645 0.018568972 MEI4 mRNA is meiosis-specific and has 88 bp intron at 5' end spliced independently of MER1. YER046W -0.67245901 0.060102146 0.399552624 0.098533136 hypothetical protein YER048C -0.34119595 0.079673365 -0.460429862 0.129244905 CAJ1 homologous to E. coli DnaJ YER048W-A 0.63218342 0.029632386 0.067619093 0.115622284 dnaJ homolog YER049W 1.199754515 0.168538326 -0.308516145 0.053036603 strong similarity to hypothetical YER050C 0.409900521 0.023922948 -0.59560845 0.032048394 RSM18 protein of the small subunit of the mitochondrial ribosome YER051W -0.68741924 0.015019296 -0.348758188 0.06113218 similarity to C.elegans hypothetical YER052C 0.053937399 0.81141781 0.10233117 0.323964091 HOM3 Aspartate kinase (L-aspartate 4-P-transferase) (EC 2.7.2.4) YER053C -1.30991767 0.00814306 -0.285673053 0.022506636 strong similarity to mitochondrial YER054C -1.46437674 0.007797164 0.262312248 0.310548983 GIP2 (putative) regulator of Glc7, a PP1 family protein phosphatase YER055C 0.918639886 0.12511321 0.008035864 0.939606059 HIS1 ATP phosphoribosyltransferase YER056C 0.948740102 0.19763909 0.169017913 0.313612377 FCY2 purine-cytosine permease YER056C-A 1.171852004 0.026749893 0.409069495 0.072603787 RPL34A Ribosomal protein L34A YER057C -0.29141481 0.158922064 0.584955754 0.108191796 HIG1 heat-regulated protein YER058W 0.368581591 0.114589159 -0.447432266 0.180303655 PET117 cytochrome c oxidase assembly factor YER059W -0.48637349 0.023906705 -0.286446993 0.018510421 PCL6 PHO85 cyclin YER060W 0.065107948 0.820363419 0.812806244 0.05976457 FCY21 purine-cytosine permease YER061C 0.006687598 0.984077315 -0.148362832 0.235472137 CEM1 Protein homologous to beta-keto-acyl synthase YER063W -0.78808031 0.002726506 -0.180321213 0.241575451 THO1 (putative) involved in transcription YER064C 0.573209329 0.171199291 -0.191288321 0.011279422 similarity to hypothetical protein YIL056w YER065C -0.99600514 0.065285652 0.406477802 0.094173127 ICL1 isocitrate lyase YER066C-A -2.19890689 0.000334639 0.035518239 0.756006142 hypothetical protein YER066W -0.80272137 0.001924262 0.09718046 0.420566 strong similarity to cell division control protein Cdc4p YER067W -2.20033499 0.003723448 0.625438527 0.044229988 strong similarity to hypothetical protein YIL057c YER068W 0.366428029 0.138441471 0.226061084 0.06430291 MOT2 putative zinc finger protein YER069W 0.153417053 0.768672752 -0.331663238 0.217839979 ARG5,6 N-acetyl-gamma-glutamyl-phosphate reductase and acetylglutamate kinase YER070W 0.778789323 0.275682675 0.375799458 0.039332451 RNR1 ribonucleotide reductase YER071C 0.155973293 0.056351981 -0.081798647 0.025701073 hypothetical protein YER072W -0.47441952 0.293938017 0.820056893 0.02370575 VTC1 Homolog of S. pombe nrf1 (78 % identical in predicted amino acid sequence) YER073W -0.41916357 0.014894642 -0.028720888 0.809799268 ALD5 mitochondrial Aldehyde Dehydrogenase YER074W 1.118645861 0.072797967 -0.024958046 0.840624872 RPS24A 40S ribosomal protein S24A YER075C -0.14424749 0.755818484 0.107850213 0.364134219 PTP3 Protein tyrosine phosphatase YER076C -0.6710532 0.079655109 0.042041777 0.223116826 similarity to killer toxin Khr1p YER077C 0.656599861 0.041681647 -0.541680947 0.057857348 hypothetical protein YER078C -0.32615331 0.068451342 -0.177811931 0.136126824 similarity to E.coli X-Pro aminopeptidase II YER079W -1.07931513 0.001275629 -0.128182193 0.213180252 hypothetical protein YER080W -0.48194536 0.006874029 -0.151992062 0.197897002 hypothetical protein YER081W 0.496728494 0.25300829 0.117703954 0.430111756 SER3 3-phosphoglycerate dehydrogenase YER082C 1.269738114 0.005208242 -0.298055699 0.333707368 similarity to M.sexta steroid regulated MNG10 protein YER084W -0.44802761 0.368420377 0.185032223 0.804316977 questionable ORF YER085C 0.307231373 0.659170846 0.283561729 0.528422784 weak similarity to myosins YER086W 0.625126774 0.073160109 -0.057180288 0.309716361 ILV1 threonine deaminase YER087C-A 0.647897779 0.042390999 0.736545474 0.070823376 SBH1 homologous to Sbh2p YER087W 0.213958824 0.319412831 -0.238681062 0.160589622 similarity to E.coli prolyl-tRNA synthetase YER088C -0.46840666 0.072411058 0.608894283 0.160393351 DOT6 nuclear protein with Myb domain involved in telomeric silencing YER089C -0.30948419 0.043429856 0.440367292 0.078593093 PTC2 Protein phosphatase type 2C YER090W 0.538825966 0.307196867 -0.146107159 0.048924689 TRP2 anthranilate synthase Component I vitamin B12-(cobalamin)-independent isozyme of methionine synthase (also called N5-methyltetrahydrofolate homocysteine methyltransferase YER091C -0.47032438 0.378878988 0.407410181 0.035073447 MET6 or 5-methyltetrahydropteroyl triglutamate homocysteine methyltransferase) YER091C-A 0.088179248 0.845359135 0.004501228 0.978359201 hypothetical protein - identified by SAGE YER092W 0.532301846 0.025790949 -0.085677825 0.053477399 similarity to E.coli prolyl-tRNA synthetase YER093C 0.702766351 0.023484952 0.263431679 0.033938866 weak similarity to S.epidermidis PepB protein YER093C-A -0.20521317 0.351753085 0.31198502 0.198451499 similarity to hypothetical protein YBL059w YER094C 0.452961431 0.260380522 0.220761826 0.275158055 PUP3 20S proteasome subunit beta3_sc RecA homolog ; Rad51p colocalizes to ~ 65 spots with Dmc1p prior to synapsis (independently of ZIP1 and DMC1), and interacts with Rad52p YER095W 0.693565471 0.201799767 0.176279855 0.583079002 RAD51 and Rad55p ; human Rad51p homolog interacts with Brca2 protein which has been implicated in causing breast cancer YER096W -2.06256564 0.00128458 -0.36949923 0.08528454 SHC1 sporulation-specific homolog of csd4 YER097W -0.12176411 0.715010494 0.24179481 0.239910384 weak similarity to ribosomal S3 proteins YER098W -0.46015171 0.090731915 0.189894258 0.412084642 UBP9 ubiquitin carboxyl-terminal hydrolase YER099C -0.2153853 0.301972864 0.136720828 0.31459569 PRS2 ribose-phosphate pyrophosphokinase 2 YER100W 0.043410968 0.714741026 -0.133831227 0.16794667 UBC6 ubiquitin-conjugating enzyme YER101C -0.90656538 0.029059881 -0.05227519 0.521589441 AST2 involved in targeting of plasma membrane [H+]ATPase YER102W 2.076633921 0.067946003 0.196567561 0.245329992 RPS8B Ribosomal protein S8B (S14B) (rp19) (YS9) YER103W -2.46391839 0.001099776 0.058866473 0.734569223 SSA4 member of 70 kDa heat shock protein family YER104W -0.34399706 0.288723381 -0.057675984 0.3799567 RTT105 same phenotype as RTT101, 102, 103, 104 YER105C -0.13763518 0.026925989 0.081107134 0.010144546 NUP157 Nucleoporin similar to Nup157p and to mammalian Nup155p YER106W 0.401711254 0.465768109 -0.569699871 0.304515475 hypothetical protein YER107C 0.454831539 0.117502907 0.161724193 0.356302514 GLE2 homologous to S. pombe RAE1 gene ; 2-hybrid analysis demonstrates an interaction with Srp1p and Rip1p ; copurifies with Nup116p YER109C 0.040693367 0.846926201 -0.108503677 0.258833734 FLO8 putative transcriptional activator of FLO1 YER110C 0.552445294 0.228599039 0.192089397 0.090599551 KAP123 Karyopherin beta 4 YER111C 0.089205277 0.175218976 -0.188855835 0.367796755 SWI4 transcription factor YER112W 0.590781163 0.275417361 -0.595226168 0.068451166 LSM4 U6 snRNA associated protein YER113C -0.11725167 0.560952184 -0.194417451 0.29144341 similarity to Emp70p YER114C -0.12672944 0.78022673 0.062056723 0.846693983 BOI2 involved in bud formation, has SH3 domain YER115C -0.71472748 0.11916246 -0.216942142 0.147208105 SPR6 involved in sporulation YER116C 0.29667486 0.388123752 -0.247858975 0.063784328 zinc-finger protein YER117W 2.319339736 0.092618174 0.466867458 0.126093501 RPL23B Ribosomal protein L23B (L17aB) (YL32) YER118C 1.319027065 0.103266759 0.429769438 0.031099206 SHO1 Transmembrane osmosensor YER119C -0.91754573 0.017509107 1.082945438 0.062330537 similar to amino acid transport proteins YER120W 0.302813814 0.237473144 0.515730561 0.102430426 SCS2 involved in inositol metabolism, regulator of INO1 expression YER121W -0.94641432 0.016112353 0.117805432 0.360931597 hypothetical protein YER122C 0.391807498 0.06323217 -0.256240071 0.371785903 GLO3 Zinc-finger-containing protein with similarity to Gcs1p and Sps18p YER123W 0.128143448 0.365362108 -0.263614916 0.079322395 YCK3 plasma membrane-bound casein kinase I homolog YER124C -0.31143283 0.650969076 -0.016176873 0.880714953 weak similarity to Dictyostelium WD40 repeat protein 2 YER125W -0.59429104 0.040615867 0.314157941 0.218895318 RSP5 Rsp5p encodes a hect (homologous to E6-AP C terminus) and encodes a ubiquitin-protein ligase (E3 enzyme) YER126C 1.515316797 0.147776832 -0.403099366 0.15096468 Lethal with conditional pap1 allele YER127W 1.527539636 0.109307349 -0.511624634 0.097699427 LCP5 involved in ribosomal RNA processing YER128W 0.080266333 0.599581339 -0.133843055 0.603533083 high copy suppressor of temperature sensitive cdc17 (DNA polymerase alpha) mutations YER129W -0.25708566 0.400327792 0.000714572 0.985559945 PAK1 DNA polymerase alpha suppressing protein kinase YER130C 0.12157171 0.764604538 -0.295424817 0.060284414 similarity to Msn2p and weak similarity to Msn4p YER131W 0.771749498 0.071319758 0.089119006 0.601657361 RPS26B Ribosomal protein S26B YER133W -0.401109 0.015856517 -0.774539395 0.030042148 GLC7 protein phosphatase type I YER134C -0.12970269 0.372260409 -0.118234741 0.195966824 weak similarity to S.pombe SPBC13G1 and C.elegans F26F2.d hypothetical proteins YER135C -0.40388375 0.495957048 -0.28743071 0.661534437 hypothetical protein YER136W -0.58071722 0.064426618 -0.130472603 0.118824705 GDI1 GDP dissociation inhibitor YER137C 0.090322797 0.79115638 -0.496555878 0.107253787 weak similarity to Mycoplasma hominis P120 protein YER137C-A 0.570169869 0.093148838 0.268025026 0.050186283 TyA gag protein. Gag processing produces capsid proteins. YER138W-A 0.390037442 0.244377505 0.160909088 0.070752583 questionable ORF - identified by SAGE YER139C -0.66501214 0.000847934 -0.461819017 0.041338737 similarity to hypothetical protein YDR066c YER140W 0.117255053 0.67365522 -0.12171291 0.110293807 hypothetical protein YER141W -0.23144709 0.503999017 0.074085115 0.786175947 COX15 cytochrome oxidase assembly factor YER142C -0.51245625 0.091825098 -0.388615335 0.046081736 MAG1 3-methyladenine DNA glycosylase YER143W -0.06743518 0.830928696 0.103012529 0.390400758 DDI1 DNA Damage Inducible ; binds to T- and V- snare complexes YER144C -0.07788596 0.812717472 0.778417636 0.058698836 UBP5 Putative Ubiquitin-specific protease YER145C 0.438765749 0.384281406 0.099819034 0.366093241 FTR1 Iron permease YER146W 0.526627673 0.18735187 0.105041282 0.37237749 LSM5 Sm-like protein YER147C -0.45384448 0.420300523 0.00677716 0.952845752 weak similarity to mouse NAD(P)H dehydrogenase (quinone) YER148W 0.763679521 0.031776441 -0.372759141 0.127119119 SPT15 TATA-binding protein (tfIId) YER149C -0.31148224 0.236538577 -0.234934343 0.165505061 PEA2 Protein with coiled-coil domain YER150W -2.13279042 5.70628E-06 0.775621591 0.200223178 SPI1 similar to Sed1 ; highly expressed in stationary phase YER151C -0.02441145 0.920019572 -0.168634223 0.23667714 UBP3 Ubiquitin-specific protease YER152C -0.63603712 0.018226899 0.491045503 0.03395602 weak similarity to E.coli hypothetical protein f470 YER154W -0.21931015 0.382829959 0.385446985 0.201828117 OXA1 involved in cytochrome c oxidase and ATP synthase assembly YER156C 0.552355969 0.144521024 -0.096498978 0.263905508 similarity to hypothetical C. elegans protein C27H6.5 Sec34p is a 92.5 kD protein that is primarily cytosolic but a small pool associates with the particulate fraction upon centrifugation at 150,000xg. YER157W 0.45088621 0.209702388 -0.252703899 0.01575924 SEC34 Sec34p stably associates with Sec35p, a protein implicated in vesicle docking, to form a multiprotein comple YER158C -1.48995173 0.001280192 -0.005116252 0.971329828 weak similarity to Afr1p YER159C 0.631863273 0.244378323 -0.139341215 0.227908785 BUR6 Transcriptional regulator which functions in modulating the activity of the general transcription machinery in vivo YER160C 1.181353911 0.025645213 0.417677411 0.009619628 transposon Ty putative peptide with frame shift YER161C -0.15399064 0.050373655 -0.390131674 0.177155041 SPT2 non-specific DNA binding protein (sin1) YER162C -0.44125702 0.099932395 -0.519851475 0.040983481 RAD4 Nucleotide excision repair protein YER163C 0.232733028 0.712787017 0.143641981 0.257125252 weak similarity to E.coli cation transport protein YER164W -0.05965376 0.863041994 0.115650872 0.456728862 CHD1 transcriptional regulator YER165W -0.05206023 0.89187975 0.031310007 0.758543539 PAB1 Poly(A) binding protein, cytoplasmic and nuclear YER166W 0.138081502 0.723618247 0.745183467 0.154550072 similarity to ATPase P.falciparum ATPase 2 YER168C -0.15615899 0.402105006 -0.289413698 0.04039311 CCA1 tRNA nucleotidyltransferase (tRNA CCA-pyrophosphorylase) YER169W -0.40749239 0.158343032 0.041598109 0.689937025 RPH1 Repressor of PHR1 transcription ; binds to PHR1 URS YER170W 0.084521989 0.35324402 -0.092601157 0.730220471 ADK2 Adenylate kinase (mitochondrial GTP:AMP phosphotransferase) YER171W 0.44395914 0.167540592 -0.374956976 0.063865374 RAD3 DNA repair helicase component of transcription factor b YER172C -0.20399519 0.406884666 -0.063266587 0.429990429 BRR2 putative ATP-dependent RNA helicase YER173W -0.08350545 0.350661753 -0.269333953 0.161919196 RAD24 (putative) cell cycle exonuclease YER174C -0.24860609 0.200560953 -0.189281804 0.014570593 GRX4 Protein with glutaredoxin activity YER175C -0.3741393 0.483126384 -0.455116077 0.026553244 putative methyltransferase YER176W -0.57362416 0.02508399 -0.449695781 0.06687362 ECM32 DNA Helicase I YER177W 0.658907557 0.11943742 0.353166678 0.028275109 BMH1 Homolog of mammalian 14-3-3 proteins YER178W 0.170728596 0.607529599 0.250361871 0.276110074 PDA1 alpha subunit of pyruvate dehydrogenase (E1 alpha) meiosis-specific protein related to RecA and Rad51p. Dmc1p colocalizes with Rad51p to discrete subnuclear sites in nuclear spreads during YER179W -0.1731058 0.239596192 0.340965645 0.013294406 DMC1 mid prophase, briefly colocalizes with Zip1p, and then disappears by pachytene YER180C -0.1944957 0.327585258 -0.111846696 0.548650285 ISC10 involved in meoisis, spore formation YER181C 0.231334756 0.505828875 -0.176404136 0.377390106 questionable ORF YER182W -0.23002645 0.39205277 -0.286310721 0.037659185 hypothetical protein YER183C 0.551395257 0.009248904 -0.021608911 0.826341051 FAU1 5,10-methenyltetrahydrofolate synthetase YER184C -0.01751418 0.960951261 -0.293933943 0.002728812 similarity to multidrug resistance proteins Pdr3p and Pdr1p YER185W 0.557878568 0.288705239 -0.081021094 0.693834694 strong similarity to Rtm1p YER186C -1.64480744 0.002427008 -0.378508795 0.036838594 weak similarity to hypothetical protein YMR316w YER187W 0.084126279 0.904811026 0.213037254 0.422649731 similar to killer toxin YER187W-A 0.316263046 0.633358876 0.088500738 0.422649731 KHS1 Killer toxin YER188W 0.763182552 0.558819396 -0.103085091 0.788983337 hypothetical protein YER189W -0.76040885 0.010079099 0.406365569 0.029429254 strong similarity to subtelomeric encoded proteins YER190W -1.08120685 0.002489209 0.643798115 0.111371606 YRF1-2 Y'-helicase protein 1 YFL001W 0.45414667 0.013205244 -0.017383584 0.937229105 DEG1 Depressed growth-rate protein YFL002C 0.024004103 0.911678196 -0.584828944 0.117469606 SPB4 ATP-dependent RNA helicase The TyB Gag-Pol protein. Gag processing produces capsid proteins. Pol is cleaved to produce protease, reverse transcriptase, and integrase YFL002W-B -0.16363352 0.537939501 -0.029293055 0.641473679 activities. YFL003C 0.137145363 0.390621322 0.045160165 0.659248247 MSH4 meiosis specific protein, E.coli MutS protein, localizes to discrete sites on meiotic chromosomes YFL004W -1.05904695 0.031581147 -0.369281017 0.031501139 VTC2 polyphosphate synthetase (putative) YFL005W -0.15659272 0.428446224 -0.302546722 0.01639448 SEC4 Ras-like small GTP-binding protein YFL006W -0.34034978 0.260586393 0.406858747 0.126900582 hypothetical protein YFL008W 0.089638109 0.671967162 -0.666337646 0.005889652 SMC1 SMC chromosomal ATPase family member YFL009W -0.34079258 0.007210986 -0.099656425 0.145429181 CDC4 part of a ubiquitin ligase complex YFL010C 0.447473986 0.102118991 0.308489937 0.027636501 questionable ORF YFL011W -0.08177175 0.358312642 0.201440536 0.327632764 HXT10 high-affinity hexose transporter YFL012W -0.37546142 0.490870089 0.263629031 0.19490163 hypothetical protein YFL013C -0.05812814 0.617620722 -0.465893705 0.083996628 weak similarity to Dictyostelium protein kinase YFL014W -2.91601589 0.000496719 -0.446564594 0.287591881 HSP12 12 kDa heat shock protein YFL015C 0.128326848 0.618226465 0.080643212 0.863734123 weak similarity to YDR504c YFL016C 0.115314195 0.31204124 -0.231276598 0.129066373 MDJ1 DnaJ homolog involved in mitochondrial biogenesis and protein folding YFL017C 0.06749962 0.545167552 0.280183649 0.134141133 GNA1 glucosamine-phosphate N-acetyltransferase YFL017W-A 0.160406456 0.206067724 0.483440341 0.053977065 SMX2 snRNP G protein (the homologue of the human Sm-G) YFL018C -1.08418508 0.003100238 -0.179089195 0.023332266 LPD1 dihydrolipoamide dehydrogenase precursor (mature protein is the E3 component of alpha-ketoacid dehydrogenase complexes) YFL019C 0.105981521 0.654843906 0.634359511 0.168602428 hypothetical protein YFL020C 0.230060723 0.620650143 0.584177879 0.150993117 PAU5 member of the seripauperin (PAU) family YFL021W -0.64125536 0.143379631 0.633265958 0.077845911 GAT1 transcriptional activator with GATA-1-type Zn finger DNA-binding motif YFL022C 0.207802634 0.271090919 0.442073942 0.047005352 FRS2 Phenylalanyl-tRNA synthetase, beta subunit, cytoplasmic YFL023W -0.15622884 0.559076407 -0.824144846 0.015885694 similarity to repeat structures in a Plasmodium falciparum protein (MESA) that binds human erythrocyte protein 4.1. YFL024C 0.07405782 0.670970839 -0.222734694 0.077964588 EPL1 Probable chromatin protein because of homology to Drosophila Enahncer of Polycomb YFL025C 0.421717269 0.145115806 0.246521191 0.202120033 BST1 negative regulator of COPII vesicle formation YFL026W 1.251944317 0.200366694 0.484008409 0.048623833 STE2 alpha-factor pheromone receptor ; seven-transmembrane domain protein YFL027C 0.313698938 0.325761831 -0.426581957 0.082383596 weak similarity to P.falciparum Pfmdr2 protein YFL028C 0.11351165 0.759562699 -0.563458169 0.017574936 CAF16 ABC ATPase YFL029C -0.20627297 0.081689528 -0.244415633 0.044640974 CAK1 Cyclin-dependent kinase-activating kinase YFL030W -2.18507371 0.000840074 -0.029626183 0.940774483 similarity to several transaminases YFL031W -0.47132143 0.130307304 1.013285685 0.179832526 HAC1 bZIP (basic-leucine zipper) protein YFL032W 0.204676762 0.383120557 1.547834939 0.165149017 questionable ORF YFL034C-B 0.804957067 0.132525978 0.305051389 0.142636862 MOB2 Mob1p-like protein YFL034W -0.17939623 0.242696472 -0.076372269 0.696353561 similarity to hypothetical S. pombe protein and to C.elegans F35D11 protein YFL036W 0.20581969 0.434363199 0.087817259 0.385373314 RPO41 mitohcondrial RNA polymerase YFL037W 0.657742143 0.333425768 0.015569657 0.812810694 TUB2 beta-tubulin YFL038C 0.254487542 0.473918892 0.169731275 0.347574778 YPT1 Ras-like GTP-binding protein ; most similar to mammalian Rab1A protein YFL039C 1.202849588 0.228014499 0 #DIV/0! ACT1 Actin YFL040W -0.189092 0.512534201 -0.031469625 0.882069504 similarity to yeast glucose transport proteins YFL041W -0.04284735 0.845082255 0.272184076 0.105179833 FET5 multicopper oxidase, type 1 integral membrane protein YFL042C -0.85664732 0.048373203 -0.041589822 0.831224901 similarity to hypothetical protein YLR072w YFL044C -0.47377886 0.059188311 0.111813416 0.127296871 weak similarity to human dystrophin YFL045C 0.974428999 0.189471471 0.096015385 0.197553347 SEC53 phosphomannomutase YFL046W 0.290262327 0.230880015 -0.493725188 0.061256813 weak similarity to middle part of C.elegans myosin heavy chain A YFL047W 0.863926421 0.202631287 -0.019680145 0.770405709 similarity to S.pombe hypothetical protein SPAC2F7.18c YFL048C -0.01364779 0.951204171 -0.131393231 0.210658634 EMP47 47 kDa type I transmembrane protein localized to the Golgi YFL049W 0.363255561 0.096833534 -0.326570519 0.098060548 weak similarity to Npl6p YFL050C -0.25027449 0.119019944 0.001501196 0.987046298 ALR2 (putative) ion transporter YFL051C -0.03712187 0.959245029 0.344229182 0.448771883 putative pseudogene YFL052W -0.17863344 0.260265259 0.00720234 0.986586318 strong similarity to Mal63p, YPR196w and Mal13p YFL053W -0.2856803 0.268649812 0.923067577 0.03229297 DAK2 dihydroxyacetone kinase YFL054C -0.45702961 0.214419548 0.006736539 0.968984986 similarity to channel proteins YFL055W -0.0933733 0.79502653 0.431156044 0.131273223 AGP3 Amino acid permease YFL056C -0.68402157 0.069803552 0.106423567 0.582497613 AAD6 Hypothetical aryl-alcohol dehydrogenase (AAD) YFL057C -0.23041875 0.254297973 0.311513204 0.154042213 strong similarity to aryl-alcohol dehydrogenases YFL058W 4.802122735 0.383094082 0.463856465 0.387792531 THI5 a thiamine regulated pyrimidine precursor biosynthesis enzyme YFL059W 1.304299163 0.002251963 0.425371583 0.165185809 SNZ3 member of the stationary phase-induced gene family YFL061W 0.827559336 0.011530528 0.118529622 0.000126846 similarity to M.verrucaria cyanamide hydratase YFL062W 0.28389828 0.569196636 -0.034057911 0.824063909 COS4 similar to subtelomerically-encoded proteins YFL063W 0.268122435 0.39801209 0.488671709 0.474458271 strong similarity to subtelomeric encoded proteins YFL064C -0.6405705 0.050960247 0.505039563 0.08794111 strong similarity to subtelomeric encoded proteins YFL065C -0.54427355 0.067350593 0.706402926 0.042813465 strong similarity to subtelomeric encoded proteins YFL066C -1.2411318 0.014928361 0.694259615 0.248718982 strong similarity to subtelomeric encoded proteins YFL067W -1.36871764 0.006430003 0.711190268 0.117606387 similarity to mouse period clock protein YFL068W -1.02589817 0.021531388 0.352936011 0.28993442 weak similarity to hypothetical E.coli protein YFR001W 0.894250622 0.063345822 -0.893991505 0.112682463 LOC1 Double-stranded RNA-binding protein YFR002W 0.447455667 0.168158103 -0.330558402 0.102818977 NIC96 96 kDa nucleoporin-interacting component YFR003C -0.54738422 0.056964043 -0.192148411 0.189234945 hypothetical protein YFR004W 0.211079933 0.514842258 -0.224931979 0.194195599 RPN11 Similar to S. pombe PAD1 gene product YFR005C 0.824564823 0.109391834 -0.038146813 0.61834184 SAD1 SnRNP assembly defective YFR006W 0.49374042 0.125615394 0.05051867 0.717808688 similarity to X-Pro dipeptidases YFR007W -0.38958673 0.196646795 -0.239195879 0.034615543 weak similarity to YER176w YFR008W -0.47839069 0.00266374 -0.570956294 0.018033779 weak similarity to human centromere protein E YFR009W 0.688032791 0.044003043 -0.204732562 0.068298283 GCN20 Member of ATP-binding cassette (ABC) family of proteins YFR010W -0.14642223 0.235870643 -0.437901559 0.118228379 UBP6 (putative) ubiquitin-specific protease YFR011C 0.007141633 0.969952243 -0.168449677 0.429076369 ochre suppressor tyr-tRNA YFR012W -1.37878326 0.022778606 -0.474856986 0.34934955 similarity to hypothetical protein YOL019w YFR013W -0.01398348 0.955329186 -0.28346937 0.194656582 IOC3 ISWI One Complex YFR014C -1.37330016 0.008671943 -0.046836886 0.642420837 CMK1 Calmodulin-dependent protein kinase YFR015C -2.15659488 6.5854E-05 0.351214704 0.114614736 GSY1 Glycogen synthase (UDP-gluocse--starch glucosyltransferase) YFR016C -0.3752958 0.146002093 -0.1575837 0.466581505 similarity to mammalian neurofilament proteins and to Dictyostelium protein kinase YFR017C -1.62428625 0.003116802 0.642692806 0.097841539 hypothetical protein YFR018C 0.211335614 0.205714167 0.504760513 0.203587299 similarity to human glutaminyl-peptide cyclotransferase YFR020W 0.026404487 0.945012365 0.164173149 0.271174778 hypothetical protein YFR021W -0.44566557 0.091063032 0.285246524 0.162134774 similarity to hypothetical protein YPL100w YFR022W -0.3635142 0.525078163 0.439531488 0.243444183 similarity to Rod1p YFR023W -0.72942636 0.008952884 -0.344710633 0.569666052 PES4 poly(A) binding protein ; related to PES4 protein homolog YHR015w YFR024C -0.02741103 0.945730915 0.168345966 0.303913615 YFR024C-A -0.11209022 0.700483252 0.411553856 0.190585804 similarity to Acanthamoeba myosin heavy chain IC and weak similarity to other myosin class I heavy chains YFR025C 0.235839776 0.60226827 -0.149363049 0.09229715 HIS2 Histidinolphosphatase YFR026C -0.63709358 0.188394004 0.167374402 0.527846254 hypothetical protein YFR027W 0.076644823 0.518565707 0.146854347 0.342197336 ECO1 involved in establishment of cohesion between sister chromatids YFR028C 0.857697722 0.093176874 0.23868094 0.050585399 CDC14 soluble tyrosine-specific protein phosphatase YFR029W -0.03553586 0.911762323 0.515406128 0.119213614 PTR3 regulator of peptide permease YFR030W -0.79104887 0.082032483 0.514281758 0.072390553 MET10 subunit of assimilatory sulfite reductase YFR031C 0.734882267 0.014077235 -0.032367896 0.577255905 SMC2 SMC chromosomal ATPase family member YFR032C 0.292316196 0.686814081 0.342755771 0.188075125 weak similarity to S.pombe polyadenylate-binding protein, YPR112c and Sbp1p YFR033C -1.5623361 0.008254556 -0.19882711 0.008135648 QCR6 ubiquinol-cytochrome c oxidoreductase subunit 6 (17 kDa) YFR034C -0.00741145 0.982885402 0.110183032 0.202303237 PHO4 myc-type helix-loop-helix transcription factor YFR035C 0.738644613 0.006794544 0.180885805 0.286344404 hypothetical protein YFR036W 0.403694359 0.017390726 0.380134418 0.003215169 CDC26 cell division control protein YFR037C 0.07734959 0.265496037 -0.253200468 0.072778796 RSC8 chromatin remodeling complex subunit YFR038W -0.18715605 0.568271597 -0.205415844 0.064203074 strong similarity to mouse lymphocyte specific helicase YFR039C -0.01796693 0.959466532 -0.139045627 0.009855866 similarity to hypothetical protein YGL228w YFR040W -0.37758438 0.105205116 -0.378824944 0.019237231 SAP155 cell cycle protein, interacts with Sit4 YFR041C -0.33270446 0.220502618 -0.664017903 0.069316991 weak similarity to dnaJ-like heat shock proteins YFR042W 0.248667229 0.524980278 0.449788754 0.044539874 hypothetical protein YFR043C -0.23788364 0.32091714 0.09358608 0.260452317 hypothetical protein YFR044C 0.133708856 0.163525287 0.536425417 0.173392333 similarity to hypothetical protein YBR281c YFR045W -0.10267085 0.306676772 0.229796082 0.354406975 similarity to mitochondrial citrate transport proteins YFR046C -0.37120781 0.038255029 -0.332171379 0.379576189 hypothetical protein YFR047C -0.30161436 0.430683724 0.263317456 0.389584507 strong similarity to human quinolinate phosphoribosyltransferase YFR048W -0.42317036 0.097798217 -0.138685679 0.147503188 similarity to hypothetical S.pombe protein SPAC12G12.14 and to YDL001w and YDR282c YFR049W -1.27288193 0.000505242 0.43404344 0.007322835 YMR31 mitochondrial ribosomal protein (precursor) YFR050C 0.109880538 0.713875621 0.360929248 0.017572807 PRE4 proteasome subunit necessary for peptidyl glutamyl peptide hydrolyzing activity YFR051C 0.056824119 0.703369845 0.220168457 0.326127304 RET2 vesicle coat component YFR052W 0.10730818 0.602595573 -0.262306 0.097267871 RPN12 cytoplasmic 32 - 34 kDa protein YFR053C 0.786166686 0.583463747 0.506590529 0.116846358 HXK1 Hexokinase I (PI) (also called Hexokinase A) YFR054C -0.6449174 0.161875654 0.045707234 0.687804758 hypothetical protein YFR055W 2.363183774 0.33152012 -0.223699047 0.077438351 strong similarity to beta-cystathionases YFR056C 1.34935445 0.279096261 -0.27220436 0.217407971 questionable ORF YFR057W 0.024747785 0.974520488 -0.246439188 0.551526002 weak similarity to Cha4p YGL001C 0.86689434 0.341822956 0.188595458 0.139111138 ERG26 C-3 sterol dehydrogenase YGL002W -0.28857167 0.149859179 -0.094970422 0.057973425 ERP6 p24 protein involved in membrane trafficking YGL003C -0.51494103 0.142259087 0.080340399 0.422531542 CDH1 protein required for Clb2 and Ase1 degradation YGL004C -0.29849319 0.230422963 -0.120826934 0.158246623 weak similarity to Tup1p YGL005C -1.36357966 0.000203822 -0.763077534 0.011690124 weak similarity to Xenopus kinesin-related protein Eg5 YGL006W -1.08557718 0.028345361 0.283309006 0.114228854 PMC1 putative vacuolar Ca2+ ATPase YGL007W -0.72961984 0.063218927 -0.085174672 0.693595776 questionable ORF YGL008C 0.778073565 0.53624709 0.232984725 0.237435049 PMA1 plasma membrane H+-ATPase YGL009C -0.07500064 0.253927277 0.081078401 0.12705699 LEU1 isopropylmalate isomerase YGL010W -0.26337441 0.470973013 0.334821654 0.070978997 similarity to hypothetical S. pombe protein YGL011C 0.069463769 0.823239529 -0.064414701 0.191295004 SCL1 Proteasome subunit YC7alpha /Y8 (protease yscE subunit 7) YGL012W 1.700655618 0.138631954 0.478962538 0.12871263 ERG4 Sterol C-24 reductase YGL013C 0.205048828 0.493667088 -0.065759231 0.213174266 PDR1 zinc-finger transcription factor of the Zn(2)-Cys(6) binuclear cluster domain type YGL014W 0.406013118 0.342703172 0 #DIV/0! similarity to Drosophila pumilio protein and Mpt5p protein YGL015C 0.619172674 0.437358382 0.058985183 0.81844225 hypothetical protein YGL017W 0.046021296 0.786286744 0.065497474 0.300748525 ATE1 arginyl-tRNA-protein transferase YGL018C 0.343622263 0.34037542 0.053265562 0.538299838 JAC1 member of the 20-kDa J-protein family of co-chaperones ; homolog of E. coli Hsc20 co-chaperone protein YGL019W 0.092717221 0.378061275 0.228732518 0.246429935 CKB1 beta (38kDa) subunit of casein kinase II (CKII) YGL020C 0.29551445 0.059585509 0.009153369 0.934164968 hypothetical protein YGL021W 0.868493912 0.187871353 -0.071516413 0.782574474 ALK1 DNA damage-responsive protein YGL023C -0.56105195 0.197226227 -0.059630484 0.629633276 PIB2 similar to Fab1 and Vps27 ; involved in telomere-proximal repression of gene expression YGL025C 0.382226401 0.18735377 0.450901649 0.016070181 PGD1 RNA polymerase II mediator subunit YGL026C -0.35064629 0.00316749 0.158510691 0.523536952 TRP5 tryptophan synthetase YGL027C -0.26628041 0.053158797 0.120102261 0.472410693 CWH41 glucosidase I YGL028C 1.090991868 0.372389189 0.659626997 0.084090978 SCW11 soluble cell wall protein YGL029W 1.354435262 0.268339881 -1.018154608 0.083532505 CGR1 coiled-coil protein YGL030W 2.178075603 0.02767725 0.512600129 0.038983735 RPL30 Large ribosomal subunit protein L30 (L32) (rp73) (YL38) YGL031C 1.254458262 0.099772146 -0.056718833 0.792606769 RPL24A Ribosomal protein L24A (rp29) (YL21) (L30A) YGL032C 0.484283683 0.167490133 0.674204098 0.078692609 AGA2 adhesion subunit of a-agglutinin YGL033W -0.01071648 0.961772953 0.195460177 0.438441633 HOP2 Meiosis-specific gene required for the pairing of homologous chromosomes YGL034C -0.12551114 0.759150907 0.540594797 0.322736834 questionable ORF YGL035C 0.706635422 0.325975508 0.282088029 0.001972402 MIG1 C2H2 zinc finger protein which resembles the mammalian Egr and Wilms tumour proteins YGL036W 0.072466498 0.634115347 0.22438575 0.030948737 MTC2 Mtf1 Two Hybrid Clone 2 YGL037C -0.29033452 0.463075731 0.21638862 0.106631185 PNC1 pyrazinamidase and nicotinamidase YGL038C -0.96316023 0.006983747 0.316838213 0.190390675 OCH1 membrane-bound alpha-1,6-mannosyltransferase YGL039W 1.110410753 0.110944232 0.040639458 0.743016642 similarity to V. vinifera dihydroflavonol reductase YGL040C -0.52582562 0.073201848 -0.027356534 0.617584977 HEM2 delta-aminolevulinate dehydratase (porphobilinogen synthase) YGL041C 0.203117838 0.544379172 0.078643652 0.170670531 weak similarity to YJL109c YGL042C -0.02526342 0.751771602 -0.106997782 0.616894002 questionable ORF YGL043W 0.240191672 0.044658011 -0.662870825 0.10005712 DST1 RNA polymerase II elongation factor YGL044C 0.418145897 0.018268619 -0.098791071 0.035973862 RNA15 component of the cleavage and polyadenylation factor CF I involved in pre-mRNA 3'-end processing YGL045W -0.31014338 0.122706538 -0.025196832 0.848194136 hypothetical protein YGL046W -0.03690305 0.902659634 -0.287164089 0.155841379 hypothetical protein YGL047W -0.30248372 0.23996829 -0.130461117 0.407979108 similarity to hypothetical S. pombe protein YGL048C -0.16040262 0.392995493 -0.022237716 0.583336728 RPT6 ATPase YGL049C 0.432592783 0.074189875 0.019021771 0.907487342 TIF4632 TIF4632 encodes one of two homologs of eIF-4G, the 150 kD subunit of the mRNA cap-binding complex (eIF-4F) YGL050W 0.54905542 0.134103804 -0.292802769 0.173980993 hypothetical protein YGL051W -0.74833533 0.06428939 0.083650815 0.003200356 strong similarity to YAR033w protein YGL052W -0.30844872 0.094896869 0.288725399 0.272137435 questionable ORF YGL053W -0.72048542 0.033503975 -0.028676307 0.852918505 PRM8 pheromone-regulated membrane protein YGL054C 0.517134743 0.087768549 0.118292159 0.092761693 ERV14 14 KDa protein found on ER-derived vesicles YGL055W -0.20913291 0.706080516 0.04957515 0.834894061 OLE1 delta-9-fatty acid desaturase YGL056C -0.30030476 0.452546539 0.362387915 0.01901641 SDS23 similar to S. pombe sds23 YGL057C -0.27740012 0.155291453 -0.152631667 0.087692454 hypothetical protein Ubiquitin conjugating (E2) enzyme. The C-terminal 23 residues are critical for sporulation and histone polyubiquitinating activity, but not UV YGL058W 0.422228156 0.17904814 -0.096317051 0.450715342 RAD6 repair or induced mutagenesis. YGL059W -0.58469298 0.057637601 -0.560703105 0.042805489 similarity to rat branched-chain alpha-ketoacid dehydrogenase kinase YGL060W -0.05920726 0.851614298 -0.070366847 0.384825544 strong similarity to hypothetical protein YBR216c YGL061C 0.364181927 0.579709178 -0.111388892 0.618439065 DUO1 Death Upon Overexpression YGL062W -0.94368676 0.052710305 0.224775993 0.079102301 PYC1 pyruvate carboxylase YGL063W -0.08995316 0.908828583 0.34289231 0.114529995 PUS2 pseudouridine synthase 2 YGL064C 0.966143598 0.111062866 -0.071048862 0.551264655 similarity to YLR276c and YKR024c YGL065C 0.153138657 0.498783111 0.194540378 0.04451345 ALG2 glycosyltransferase YGL066W 0.131246272 0.396625298 -0.38270757 0.047593799 hypothetical protein YGL067W 0.43892762 0.195518552 0.094491237 0.482650719 NPY1 NADH pyrophosphatase 1 YGL068W 0.313978984 0.435549849 -0.012554694 0.79479866 probable ribosomal protein L12 YGL069C 0.106482699 0.703924976 0.054463161 0.34811734 questionable ORF YGL070C 1.116852632 0.189837063 0.052740796 0.626671832 RPB9 RNA polymerase II subunit YGL072C 1.103573546 0.125218912 0.635600006 0.106745044 questionable ORF YGL073W 1.252385873 0.219140478 0.332803536 0.031277102 HSF1 heat shock transcription factor YGL074C -0.30718143 0.347306933 -0.125349521 0.53344274 questionable ORF YGL075C -0.68466798 0.006979492 -0.296253054 0.079843614 MPS2 nuclear envelope /ER protein involved in chromosomal segregation YGL076C 0.853779945 0.050831096 0.374890396 0.039602658 RPL7A Ribosomal protein L7A (L6A) (rp11) (YL8) YGL077C 0.956323203 0.375712258 0.615803604 0.113989589 HNM1 Transporter (permease) for choline and nitrogen mustard ; share homology with UGA4 YGL078C 1.07488983 0.04015872 -0.481601638 0.070984533 DBP3 ATP-dependent RNA helicase CA3 of the DEAD /DEAH box family YGL079W 0.008397519 0.906758903 -0.014002278 0.880162516 hypothetical protein YGL080W 0.466001621 0.13724433 0.051402941 0.330872796 strong similarity to C.elegans R07E5.13 protein YGL081W -0.99442083 0.005396706 -0.319591633 0.175927211 hypothetical protein YGL082W -0.1273414 0.575901664 -0.192203687 0.047533311 strong similarity to hypothetical protein YPL191c YGL083W 0.124437078 0.538383184 0.066190966 0.142477266 SCY1 similar to bovine rhodopsin kinase ; suppressor of GTPase mutation YGL084C 0.090158568 0.689051713 0.515508825 0.123471172 GUP1 putative glycerol transporter YGL085W -0.28281439 0.184839917 -0.381843356 0.001293259 weak similarity to Staphylococcus aureus nuclease (SNase) YGL087C 0.251117322 0.098040105 0.39669272 0.118258081 MMS2 Similar to ubiquitin conjugating protein family YGL088W 0.707766022 0.103384128 1.152593698 0.061444034 questionable ORF YGL089C -0.34576079 0.519925819 -0.415909805 0.333503958 MF(ALPHA alpha mating factor YGL090W -0.49450791 0.464532966 -0.465566001 0.155929099 LIF1 interacts with DNA ligase protein YGL091C 0.160556998 0.440578722 0.017527884 0.66391667 NBP35 35 kDa nucleotide binding protein YGL092W 0.255410029 0.60918357 0.46017248 0.065919579 NUP145 nuclear pore protein YGL093W 0.132478236 0.329267485 -0.445587357 0.122290432 SPC105 component of spindle pole YGL094C 0.503637398 0.245052978 0.108078828 0.025368829 PAN2 135-kDa protein that is subunit of poly(A) ribonuclease YGL095C -0.08249414 0.451879588 -0.404320941 0.041875659 VPS45 cytosolic and peripheral membrane protein YGL097W 0.632716056 0.226987512 -0.173170504 0.310555333 SRM1 pheromone response pathway suppressor YGL098W -0.08332336 0.358181713 -0.76073702 0.021488875 hypothetical protein YGL099W 0.700725366 0.133529528 -0.302832994 0.254891396 similarity to putative human GTP-binding protein MMR1 YGL100W 0.24386191 0.526233149 -0.012351059 0.930514823 SEH1 nuclear pore protein YGL101W 0.675243153 0.375045891 -0.414127736 0.059643728 strong similarity to hypothetical protein YBR242w YGL102C 1.384579126 0.082127598 0.248642613 0.112240025 questionable ORF YGL103W 2.029320192 0.097768807 0.135393296 0.213072135 RPL28 Ribosomal protein L28 (L29) (rp44) (YL24) YGL104C -0.65293459 0.002670883 -0.056859636 0.514252905 similarity to glucose transport proteins YGL105W 0.379770339 0.352275765 0.20411786 0.089906127 ARC1 G4 nucleic acid binding protein, involved in tRNA aminoacylation YGL106W 0.325016379 0.346889341 -0.182859324 0.203631084 MLC1 light chain for myosin Myo2p YGL107C 0.500452629 0.169490244 -0.385621604 0.014299586 strong similarity to hypothetical protein YBR238c YGL108C -0.18949647 0.270586792 -0.343513377 0.244160001 weak similarity to hypotetical S.pombe protein YGL109W 0.282506147 0.472401654 -0.114676903 0.657936797 questionable ORF YGL110C 0.169077698 0.613154556 -0.257667038 0.034688876 hypothetical protein YGL111W 0.789659045 0.000572338 -0.404699255 0.073455473 hypothetical protein YGL112C -0.18903288 0.324602598 -0.070004724 0.648055959 TAF60 TATA-binding protein-associated-factor YGL113W 0.104623483 0.735028447 -0.277631914 0.060139078 weak similarity to YOR165w YGL114W -0.49856338 0.110878661 0.121706458 0.138576095 weak similarity to H.influenzae permease YGL115W -0.09334834 0.480114245 -0.259705553 0.052451546 SNF4 associates with Snf1p YGL116W 0.363136699 0.190192325 -0.153203096 0.621491425 CDC20 anaphase promoting complex subunit YGL117W 0.131148796 0.730804533 -0.718974035 0.039895529 hypothetical protein YGL118C -0.45114526 0.377711313 0.020345268 0.422649731 questionable ORF YGL119W -0.10690078 0.653821389 -0.197465981 0.011042553 ABC1 ubiquinol-cytochrome-c reductase assembly protein YGL120C 1.859252663 0.245463236 0.097887572 0.217476251 PRP43 RNA helicase YGL121C -0.95690157 0.098832943 -0.093309901 0.776174583 hypothetical protein YGL122C -0.13896144 0.374075584 -0.324686471 0.502470201 NAB2 nuclear polyadenylated RNA binding protein YGL123W 1.47580959 0.176326389 0.298163085 0.176786808 RPS2 Ribosomal protein S2 (S4) (rp12) (YS5) YGL124C -0.13329573 0.445543705 -0.16067816 0.11934161 MON1 hypothetical protein YGL125W -0.92545748 0.033421869 0.419972862 0.007721024 MET13 putative methylenetetrahydrofolate reductase (mthfr) YGL126W 0.063614329 0.866948488 0.343348611 0.32290246 SCS3 involved in inositol biosynthesis SOH1 encodes a novel 14-kD protein with limited sequence similarity to RNA polymerases. The Soh1 protein interacts with a DNA repair YGL127C 0.875929887 0.06749458 0.60377419 0.032963762 SOH1 protein, Rad5p, in a two-hybrid system assay. YGL128C -0.17259403 0.571612805 0.513061144 0.135789177 putative heat shock protein protein YGL129C 0.754404065 0.160306671 -0.202149229 0.030918943 RSM23 protein of the small subunit of the mitochondrial ribosome YGL130W -0.05137306 0.835022688 0.136658837 0.150155169 CEG1 mRNA guanylyltransferase (mRNA capping enzyme), alpha subunit YGL131C 0.233210147 0.374967233 -0.136169705 0.368304751 weak similarity to S.pombe hypothetical protein C3H1.12C YGL132W -0.08661443 0.349200476 0.437994676 0.127781706 questionable ORF YGL133W 0.267649292 0.069662771 0.617390842 0.085479281 ITC1 A subunit of Isw2 chromatin remodeling complex YGL134W -0.04444229 0.864079782 -0.246242782 0.233974627 PCL10 PHO85 cyclin YGL135W 1.595980048 0.008230744 0.465602625 0.017986272 RPL1B Ribosomal protein L1B YGL136C -0.66747033 0.02022567 0.025673862 0.657834654 weak similarity to E.coli ftsJ protein YGL137W -0.03974449 0.811895779 0.075362968 0.580767343 SEC27 encodes beta'-subunit of yeast coatomer YGL138C 0.372987806 0.60529681 0 #DIV/0! hypothetical protein YGL139W -0.14516081 0.214493651 0.302385829 0.141466956 strong similarity to hypothetical protein YPL221w YGL141W -0.29257507 0.349306609 -0.010455181 0.857797264 HUL5 ubiquitin-protein ligase (E3) Protein involved in Glycosyl Phosphatidyl Inositol synthesis ; could be the target of the GPI synthesis inhibitor, YW3548 ; Most likely an alpha YGL142C -0.09967989 0.744736846 0.223435116 0.287557709 GPI10 1,2 mannosyltransferase utilized for the addition of the third mannose onto the GPI core structure. YGL143C -0.02431993 0.914976709 -0.089771274 0.237038952 MRF1 Mitochondrial polypeptide chain release factor YGL144C -0.24152822 0.204038486 -0.384395873 0.001917885 lipase motif protein YGL145W 0.277766316 0.279651477 -0.470795257 0.02617348 TIP20 transport protein that interacts with Sec20p ; required for protein transport from the endoplasmic reticulum to the golgi apparatus YGL146C -1.17811737 0.024785445 -0.182462631 0.249289185 YGL147C 2.001154361 0.033862605 0.058206669 0.780159902 RPL9A Ribosomal protein L9A (L8A) (rp24) (YL11) YGL148W 0.448194368 0.376741146 0.195972141 0.235833808 ARO2 Chorismate synthase YGL149W 0.382276386 0.25670559 0.07827197 0.598124175 questionable ORF YGL150C -0.28871956 0.509506774 -0.315092928 0.016333488 INO80 similar to the Snf2p family of DNA-dependent ATPases YGL151W 0.453857649 0.054071017 0.222917955 0.188577193 NUT1 negative regulator of HO endonuclease YGL152C 0.023306898 0.930670482 -0.408467439 0.026556497 questionable ORF YGL153W -0.16526837 0.540064072 -0.469806494 0.045028856 PEX14 component of peroxisomal import machinery YGL154C -0.01411467 0.928333067 0.052991773 0.103649764 LYS5 aminoadipate-semialdehyde dehydrogenase small subunit (alpha-aminoadipate reductase) YGL155W 0.300538956 0.309032047 0.045510046 0.146922147 CDC43 polypeptide subunit of a yeast type 1 protein geranylgeranyltransferase YGL156W -2.31282008 0.000181206 0.142521199 0.588891781 AMS1 vacuolar alpha mannosidase YGL157W 2.90742189 0.394227137 0.043815062 0.573304799 similarity to V.vinifera dihydroflavonol 4-reductase YGL158W 0.205862729 0.632327364 -0.387416151 0.293363412 RCK1 Serine /threonine protein kinase YGL159W -0.40804121 0.09505632 -0.638616347 0.010498556 hypothetical protein YGL160W 0.168518041 0.171444684 0.436463219 0.101241908 similarity to hypothetical protein YLR047c and Fre2p YGL161C -0.26822895 0.256712676 0.424038632 0.102680943 hypothetical protein YGL162W 1.054924502 0.238637038 0.257809924 0.202059382 SUT1 hypoxic gene family involved in sterol transport YGL163C -0.0550967 0.861742602 -0.265856802 0.098405149 RAD54 DNA-dependent ATPase YGL164C -0.28357214 0.114066025 -0.671138546 0.044378772 similarity to S.pombe hypothetical protein SPAC31A2.10 YGL165C 0.114871513 0.817770519 0.190257943 0.260311502 questionable ORF YGL166W 0.161380771 0.833718462 0.083848498 0.43081407 CUP2 Activator of transcription YGL167C -0.01838558 0.946968064 0.431733104 0.079501728 PMR1 Ca++-Pump, ATPase YGL168W 0.230471695 0.159267188 0.834712514 0.101908754 questionable ORF YGL169W 0.613083452 0.017629446 -0.18011771 0.000409411 SUA5 translation initiation protein YGL170C 0.514102543 0.251371652 0.36598755 0.057082686 hypothetical protein YGL171W 0.953424893 0.188663314 -0.478425916 0.153503257 ROK1 RNA helicase involved in rRNA processing YGL172W -0.12754819 0.352385111 -0.052281782 0.534160772 NUP49 nuclear pore complex protein with GLFG repetitive sequence motif YGL173C -0.43720818 0.18897 0.342232078 0.116316616 KEM1 cytoplasmic 5'-to-3' exonuclease. YGL174W -0.20769256 0.284462204 -0.365358444 0.046247944 weak similarity to C.elegans hypothetical protein R08D7.1 YGL175C 0.138511723 0.633758119 -0.133916559 0.621780092 SAE2 involved in meiotic recombination YGL176C -0.46961448 0.027277749 -0.322066629 0.075164406 weak similarity to Oryctolagus calcium channel BIII YGL177W -0.05426997 0.742876826 0.940841874 0.032251433 questionable ORF YGL178W 0.459761635 0.247683167 0.478231101 0.146015708 MPT5 multicopy suppressor of POP2 YGL179C 0.00729222 0.989782315 -0.001898794 0.978482578 TOS3 strong similarity to Pak1p, Elm1p and Kin82p YGL180W -0.85148324 0.051160586 -0.102695347 0.140157579 APG1 Protein kinase YGL181W -0.09075206 0.630931348 -0.170865483 0.002287436 GTS1 Glycine-threonine-serine repeat protein YGL182C 0.540674806 0.603127628 -0.23176122 0.422649731 questionable ORF YGL183C -0.20728313 0.641737148 0.050083012 0.677598746 hypothetical protein YGL184C -0.43313751 0.321914961 -0.036811149 0.677227 STR3 Cystathionine beta-lyase YGL185C -0.66868024 0.010109949 -0.351887424 0.077007399 weak similarity to dehydrogenases YGL186C 0.393512661 0.264912822 0.166510348 0.395623681 similarity to hypothetical protein Fcy21p and weak similarity to FCY2 protein YGL187C -2.12848189 0.000904118 -0.041084238 0.726324551 COX4 subunit IV of cytochrome c oxidase YGL188C -1.90555513 0.000537189 -0.024188529 0.857446312 hypothetical protein YGL189C 1.432802172 0.091822196 0.132248912 0.42787916 RPS26A Ribosomal protein S26A YGL190C -0.05600597 0.344141063 -0.320595262 0.061911212 CDC55 Protein phosphatase 2A regulatory subunit B YGL191W -1.12369695 0.000356155 0.335233415 0.181787904 COX13 subunit VIa of cytochrome c oxidase, may specifically interact with ATP YGL192W -0.28568762 0.26727716 0.426904957 0.369673071 IME4 mRNA methyltransferase (putative) YGL193C 0.162150706 0.583308744 0.746796671 0.092719427 questionable ORF YGL194C -0.77085317 0.000572336 0.046422212 0.015802607 HOS2 (putative) histone deacetylase YGL196W -0.77695372 0.047074099 0.234606343 0.397576705 hypothetical protein YGL197W -0.70665777 0.070068174 0.435114604 0.121276979 MDS3 negative regulator of early meiotic genes YGL198W 0.557686765 0.019807361 0.493214052 0.090186651 weak similarity to Yip1p YGL199C 0.277107277 0.16090635 0.558237324 0.065061788 questionable ORF YGL200C 0.636164764 0.139842544 0.597813087 0.127997314 EMP24 type I transmemebrane protein, component of COPII-coated, ER-derived transport vesicles YGL201C -0.19118208 0.623168499 -0.160702852 0.196123654 MCM6 component of MCM initiator complex involved in DNA replication YGL202W 0.450576609 0.501598384 0.156572998 0.31450457 ARO8 aromatic amino acid aminotransferase YGL203C 0.330737478 0.282331718 -0.330401424 0.085909422 KEX1 carboxypeptidase B-like processing protease YGL204C 0.383818363 0.495367672 0.428401874 0.164701702 questionable ORF YGL205W -0.26466305 0.609196084 0.911819568 0.03593723 POX1 fatty-acyl coenzyme A oxidase YGL206C -0.41959845 0.007786152 0.324727729 0.050273862 CHC1 presumed vesicle coat protein YGL207W -0.09943549 0.4864863 0.142836209 0.252399472 SPT16 global regulator of transcription YGL208W -1.11167837 0.016789153 0.09699025 0.402275506 SIP2 component of Snf1 protein complex involved in response to glucose starvation YGL209W 0.987149006 0.365232572 0.580200231 0.198543001 MIG2 Protein containing zinc fingers very similar to zinc fingers in Mig1p YGL210W 0.286617211 0.626948958 -0.198568692 0.050757891 YPT32 ras-like GTPase, highly homologous to YPT31 YGL211W -0.19284332 0.36472606 -0.149051355 0.22932606 similarity to M.jannaschii hypothetical proteins MJ1157 and MJ1478 YGL212W -0.05001913 0.857947861 0.202600963 0.38126868 VAM7 hydrophilic protein, heptad repeat motif YGL213C 0.319269212 0.151488985 0.20307174 0.289008161 SKI8 antiviral protein, mRNA is induced early in meiosis YGL214W 0.433521147 0.09596751 0.319516711 0.104771772 questionable ORF YGL215W 0.091023462 0.75935305 0.567934132 0.054206234 CLG1 cyclin-like protein that interacts with Pho85 YGL216W -0.5002086 0.180704502 0.292824027 0.097022977 KIP3 kinesin-related protein involved in mitosis YGL217C 0.324206129 0.510578309 0.337497231 0.682781151 questionable ORF YGL218W -0.18909055 0.478293101 0.114277359 0.53930527 questionable ORF YGL219C -0.07101328 0.790965459 0.210020666 0.204989015 hypothetical protein YGL220W 0.78932595 0.104261059 0.571967273 0.014117691 weak similarity to V.alginolyticus bolA protein YGL221C 0.176409565 0.286446727 0.33918449 0.074073041 NIF3 similar to Listeria monocytogenes major sigma factor (rpoD gene product) YGL222C -0.35981681 0.200988633 0.589760092 0.01052929 EDC1 Enhancer of mRNA Decapping YGL223C 0.109690854 0.559476753 0.052899524 0.465122882 weak similarity to Clostridium regulatory protein YGL224C -0.37970735 0.332312141 0.140372025 0.218673939 strong similarity to hypothetical protein YER037w YGL225W 1.419550177 0.283781864 0.864306102 0.034894397 GOG5 Golgi GDP-mannose transporter YGL226C-A 0.447221888 0.277250458 0.840126566 0.016459088 OST5 9.5-kDa zeta subunit of oligosaccharyltransferase complex YGL226W 0.487271756 0.092753289 0.015296821 0.884261639 similarity to N.crassa cytochrome-c oxidase chain V YGL227W -0.6580472 0.118456637 0.082239146 0.270458359 VID30 TOR inhibitory protein, similar to Dictyostelium discoideum non-receptor tyrosine kinase YGL228W -0.41124834 0.104145422 -0.096850994 0.218564785 SHE10 lethal when overexpressed YGL229C -0.35423244 0.318330517 0.02482893 0.751302684 SAP4 Sit4 protein phosphatase-associated protein YGL230C 1.112835356 0.057584538 0.058964675 0.61970254 hypothetical protein YGL231C 1.063273076 0.130839074 0.147194849 0.004921146 hypothetical protein YGL232W 0.49811141 0.186570941 -0.649107203 0.116417924 weak similarity to P.falciparum dihydropteroate synthase 113kD component of the Exocyst complex, which contains the gene products encoded by SEC3, SEC5, SEC6, SEC8, SEC10, SEC15 and YGL233W -0.59412919 0.080123832 -0.236989966 0.021061359 SEC15 EXO70. YGL234W 0.70135199 0.070214392 -0.05372842 0.536088159 ADE5,7 glycinamide ribotide synthetase and aminoimidazole ribotide synthetase YGL235W -0.76204898 0.049406933 -0.018575861 0.941151927 questionable ORF YGL236C 0.525203832 0.31783073 0.09179018 0.598875447 MTO1 Mitochondrial Translation Optimization ; Strong similarity to E. coli GidA YGL237C -0.77148263 0.000578582 -0.051285166 0.436566901 HAP2 transcriptional activator protein of CYC1 YGL238W 0.218266262 0.103160953 -0.148982993 0.087019469 CSE1 (putative) kinetochore protein YGL239C 0.226707873 0.523744232 0.366954975 0.142705873 questionable ORF YGL240W 0.286700534 0.022360976 -0.062555671 0.736138121 DOC1 component of the anaphase-promoting complex YGL241W -0.13322021 0.464982646 -0.210115684 0.098493339 KAP114 Kap114p YGL242C 0.707754296 0.204973508 -0.107058829 0.438673486 weak similarity to Drosophila ANK protein YGL243W -0.47710782 0.01719815 -0.545114086 0.005808255 TAD1 tRNA-specific adenosine deaminase 1 (TAD1) ; Tad1p /scADAT1 YGL244W -0.38173696 0.028258051 -1.097002938 0.022747178 RTF1 Nuclear protein YGL245W -0.01233866 0.95249199 0.065741226 0.577600462 strong similarity to glutamine--tRNA ligase YGL246C 0.478994241 0.240459172 -0.597228331 0.055615874 RAI1 weak similarity to C.elegans dom-3 protein YGL247W -0.13115753 0.44103792 -0.098504003 0.309583504 similarity to hypothetical protein YHR036w YGL248W -0.40124954 0.205574585 0.037061082 0.510974687 PDE1 3',5'-Cyclic-nucleotide phosphodiesterase, low affinity YGL249W 0.589035102 0.166576336 -0.146933495 0.021825343 ZIP2 involved in meiotic recombination and disjunction YGL250W -1.84237827 0.000198569 -0.181752397 0.198187542 hypothetical protein YGL251C -0.55976518 0.029869141 0.013305024 0.84517926 HFM1 C4 zinc finger DNA-binding protein of low sequence specificity in vitro ; Probable 119 kD DNA /RNA helicase family member YGL252C 0.085172945 0.799727513 -0.011160266 0.95698642 RTG2 involved in interorganelle communication between mitochondria, peroxisomes, and nucleus YGL253W 2.377755953 0.365431351 0.575674758 0.018378815 HXK2 Hexokinase II (PII) (also called Hexokinase B) YGL254W 0.171213311 0.594438581 0.239087007 0.169256791 FZF1 putative transcription factor, has five zinc fingers YGL255W 0.807265295 0.397085617 0.492144494 0.120106197 ZRT1 high-affinity zinc transport protein YGL256W -2.24369104 0.009676821 -0.360301639 0.495327114 ADH4 alcohol dehydrogenase isoenzyme IV YGL257C -1.28528995 0.003161946 -0.565775543 0.029815752 MNT2 alpha-1,3-mannosyltransferase YGL258W -1.73291698 0.049095843 -0.110647823 0.897585072 strong similarity to hypothetical protein YOR387c YGL259W -0.65601746 0.094369404 0.014709638 0.956171394 YPS5 GPI-anchored aspartic protease YGL260W 0.124327612 0.85638779 0.088368207 0.638670818 strong similarity to subtelomeric encoded proteins YGL261C 0.005511888 0.985337126 0.772303392 0.062414755 strong similarity to members of the Srp1/Tip1 family YGL262W -0.7967933 0.025308075 -0.228194689 0.203168884 similarity to hypothetical protein YER187w YGL263W 0.564158745 0.215240041 -0.307995906 0.058630212 COS12 similar to subtelomerically-encoded proteins YGR001C 0.164722539 0.067096551 0.015277053 0.940339242 similarity to C.elegans hypothetical M142.5 protein YGR002C 0.524441255 0.068492369 -0.193212726 0.434800883 similarity to hypothetical S. pombe protein YGR003W 0.094740009 0.691839707 -0.181315874 0.092971762 similarity to D.melanogaster lin19 protein YGR004W 0.323143645 0.280735274 0.429807698 0.133262058 similarity to D.melanogaster lin19 protein YGR005C 0.036693205 0.843487408 -0.491809565 0.146098403 TFG2 transcription initiation factor TFIIF middle subunit YGR006W 0.507152152 0.25206873 -0.136668467 0.582102295 PRP18 RNA splicing factor associated with U5 snRNP YGR007W 0.44393268 0.222512347 -0.022648106 0.70254583 MUQ1 choline phosphate cytidylyltransferase (also called phosphoethanolamine cytidylyltransferase or phosphocholine cytidylyltransferase) YGR008C -1.01470663 0.051418897 -0.197125042 0.001167427 STF2 ATPase stabilizing factor YGR009C 0.038341336 0.848316758 -0.825546473 0.007410352 SEC9 Putative t-SNARE of the plasma membrane YGR010W -0.71223813 0.005863035 0.012615307 0.541541905 strong similarity to hypothetical protein YLR328w YGR011W -0.19649837 0.374559057 0.142500466 0.067326642 questionable ORF YGR012W -0.54326712 0.034929276 -0.344597877 0.010822852 similarity to E.nidulans cysteine synthase YGR013W 0.181146334 0.494446321 -0.211743161 0.22148502 SNU71 U1 snRNP protein YGR015C -0.46223676 0.207235046 -0.318941558 0.424436751 similarity to hypothetical protein YGR031w YGR016W -0.49580565 0.103619994 -0.334365864 0.012203843 weak similarity to M.jannaschii hypothetical protein MJ1317 YGR017W 0.602400461 0.038670848 -0.244909512 0.230469598 hypothetical protein YGR018C 0.646473886 0.00961816 0.172238333 0.31387684 questionable ORF YGR019W -0.43665655 0.245949696 0.138705989 0.600288835 UGA1 gamma-aminobutyrate (GABA) transaminase (4-aminobutyrate aminotransferase) YGR020C 0.305178321 0.530965888 0.27801036 0.259026695 VMA7 vacuolar ATPase V1 domain subunit F (14 kDa) YGR021W 0.494341966 0.309896209 -0.351941122 0.081236084 similarity to M.leprae yfcA protein YGR022C -0.16004148 0.671189916 0.394574525 0.060587102 questionable ORF YGR023W -0.11691183 0.725749341 0.910019239 0.033393898 MTL1 acts in concert with Mid2p to transduce cell wall stress signals YGR024C -0.32385635 0.299003363 -0.746112165 0.025865969 weak similarity to Methanobacterium thermoautotrophicum hypothetical protein MTH972 YGR025W -0.45221147 0.014027775 0.365491134 0.109933375 questionable ORF YGR026W -0.16743778 0.197958996 0.365191244 0.169898848 hypothetical protein YGR027C 0.639048422 0.02798567 0.129112644 0.028986798 RPS25A Ribosomal protein S25A (S31A) (rp45) (YS23) YGR027W-A 1.116779505 0.186552291 0.4877318 0.035847754 TyA gag protein. Gag processing produces capsid proteins. YGR028W -1.07683601 0.017641432 -0.391276985 0.014663753 MSP1 40 kDa putative membrane-spanning ATPase YGR029W 0.40142303 0.111424691 -0.18962391 0.04636784 ERV1 involved in mitochondrial biogenesis YGR030C 0.146790183 0.230705774 -0.415481504 0.194509083 POP6 integral subunit of RNase P and apparent subunit of RNase MRP YGR031W -0.91655707 0.00379962 0.100741504 0.163524246 similarity to hypothetical protein YGR015c and weak similarity H.influenzae dihydrolipoamide acetyltransferase YGR033C -0.31872457 0.012514194 -0.452631189 0.063770704 hypothetical protein YGR034W 1.397907971 0.129421428 0.291451143 0.147152203 RPL26B Ribosomal protein L26B (L33B) (YL33) YGR035C 0.506823275 0.135333807 0.137500063 0.664263479 hypothetical protein CAX4p contains 3 short stretches of amino acids that are characteristic for a wide variety of phosphatases, including lipid phosphatases and a YGR036C 1.377245936 0.310576632 0.180666336 0.073962728 CAX4 protein phosphatase. YGR037C 0.412954866 0.521214523 0.526935257 0.132902697 ACB1 Acyl-CoA-binding protein (ACBP) /Diazepam binding inhibitor (DBI) /endozepine (EP) YGR038C-A 1.142473873 0.077625447 0.51053945 0.017047251 TyA gag protein. Gag processing produces capsid proteins. YGR038W 0.144220723 0.4012412 0.729151434 0.064907233 ORM1 strong similarity to hypothetical protein YLR350w YGR039W 1.255368845 0.099054447 0.776559467 0.025394302 questionable ORF YGR040W 1.337129245 0.147829101 0.166593643 0.09144382 KSS1 MAP protein kinase homolog involved in pheromone signal transduction YGR041W -0.63903023 0.025254456 0.540272815 0.156819622 BUD9 involved in bud-site selection YGR042W -0.7414906 0.005421941 -0.371114037 0.211364333 hypothetical protein YGR043C -1.72886464 0.019325214 -0.400689051 0.067722441 strong similarity to transaldolase YGR044C -0.74806306 0.176829418 -0.006560591 0.961670618 RME1 zinc finger protein ; negative regulator of meiosis ; directly repressed by a1-a2 regulator YGR045C -0.10089851 0.593765198 0.212178926 0.237213557 questionable ORF YGR046W -0.08776282 0.742478469 -0.144031918 0.147393663 hypothetical protein YGR047C -0.05887125 0.636722003 -0.326309628 0.027238301 TFC4 transcription factor tau (TFIIIC) subunit 131 YGR048W 0.140467095 0.720372868 -0.008489511 0.925046453 UFD1 ubiquitin fusion degradation protein YGR049W 0.821619998 0.178732698 0.469578092 0.070840113 SCM4 suppressor of cdc4 mutations YGR050C -0.80781769 0.003607189 0.270039648 0.404712252 questionable ORF YGR051C -0.55421403 0.039762777 -0.246925763 0.216126441 questionable ORF YGR052W -3.16303919 0.00022605 -0.221523834 0.298897231 similarity to ser/thr protein kinases YGR053C -1.9161916 0.000450867 -0.869462482 0.003866847 hypothetical protein YGR055W -0.23847659 0.3693832 0.53722241 0.062011041 MUP1 high affinity methionine permease YGR056W 0.056603261 0.771842906 -0.041137301 0.272529306 RSC1 Member of RSC complex YGR057C -0.06966855 0.800248811 -0.740502572 0.014803947 LST7 involved in transport of nitrogen-regulated permeases YGR058W -0.26482908 0.039585293 0.042096472 0.685715936 similarity to mouse calcium-binding protein YGR059W -0.73988645 0.024829185 0 #DIV/0! SPR3 septin protein involved in sporulation YGR060W 0.029051137 0.92886288 0.369947256 0.205291632 ERG25 C-4 sterol methyl oxidase YGR061C -0.05770667 0.810893013 -0.127641844 0.223239159 ADE6 5'-phosphoribosylformyl glycinamidine synthetase YGR062C -0.06584873 0.363089176 0.102654669 0.460999992 COX18 required for mitochondrial cytochrome oxidase activity YGR063C 0.884398821 0.114999203 0.557578285 0.09105786 SPT4 Zn-finger protein, transcriptional regulator YGR064W 0.86781237 0.140649607 0.501445222 0.17888786 questionable ORF YGR065C 0.022263949 0.93165123 0.621454017 0.0721802 VHT1 H+-biotin symporter YGR066C -1.89594281 0.00022269 -0.188528693 0.622240023 similarity to hypothetical protein YBR105c YGR067C -1.05778693 0.127313154 0.147902489 0.34145805 weak similarity to transcription factors YGR068C -0.50847474 0.214545559 0.10134827 0.213892247 weak similarity to Rod1p YGR069W 1.411427005 0.102835149 0.58466646 0.303992382 questionable ORF YGR070W -0.69190985 0.054737961 -0.0150259 0.726873264 ROM1 Rho1 GDP /GTP exchange protein YGR071C 0.043580385 0.768444043 -0.500476196 0.049291136 similarity to hypothetical protein YLR373c YGR072W -0.07631209 0.52210071 -0.955776753 0.042067768 UPF3 involved in decay of mRNA containing nonsense codons YGR073C 0.273629275 0.428406649 0.401764978 0.003991274 questionable ORF YGR074W 0.47627433 0.192950269 0.33105209 0.042600931 SMD1 U6 snRNP protein YGR075C 0.311130245 0.064807613 0.117930479 0.370033951 PRP38 RNA splicing factor YGR076C 0.433978151 0.062314547 -0.37425857 0.157123185 MRPL25 Mitochondrial ribosomal protein MRPL25 (YmL25) YGR077C -0.34172938 0.235476017 0.331955356 0.086124141 PEX8 peroxisome associated protein containing a PTS1 signal YGR078C 0.28272047 0.340402808 0.377506166 0.25608899 PAC10 Polypeptide 3 of a Yeast Non-native Actin Binding Complex, homolog of a component of the bovine NABC complex YGR079W 0.88173678 0.283589032 0.180497129 0.255419334 hypothetical protein YGR081C 1.002901892 0.043669575 -0.735966878 0.075630956 weak similarity to mammalian myosin heavy chain YGR082W 1.108355355 0.001741568 0.346078362 0.125164144 TOM20 20 kDa mitochondrial outer membrane protein import receptor YGR083C 0.318390601 0.113107308 -0.284928327 0.197759362 GCD2 translation initiation factor eIF2B, 71 kDa (delta) subunit ; translational repressor of GCN4 protein YGR084C 0.280623417 0.160345172 -0.189396595 0.331992017 MRP13 35 kDa mitochondrial ribosomal small subunit protein YGR085C 1.143842256 0.033554383 0.055413968 0.803008706 RPL11B 60S ribosomal protein L11B (L16B) (rp39B) (YL22) YGR086C -0.81521255 0.022525733 0.025316352 0.836144577 strong similarity to hypothetical protein YPL004c YGR087C -0.17406522 0.819416947 0.784909256 0.068347413 PDC6 Third, minor isozyme of pyruvate decarboxylase YGR088W -3.31111885 0.000318882 0.050016287 0.583860999 CTT1 cytoplasmic catalase T YGR089W 0.824416004 0.091945158 0.421871492 0.037461971 weak similarity to rat tropomyosin YGR090W 1.729811443 0.119978147 0.508210015 0.080224615 hypothetical protein YGR091W -0.3976683 0.075633846 -0.151535252 0.243885531 PRP31 pre-mRNA splicing protein YGR092W 0.218656276 0.556901292 -0.218460214 0.040296064 DBF2 Serine /threonine protein kinase YGR093W -0.10699224 0.466453575 -0.362161823 0.073182067 similarity to hypothetical S.pombe protein YGR094W 0.757183407 0.067390758 -0.022458302 0.701580861 VAS1 mitochondrial and cytoplasmic valyl-tRNA synthetase YGR095C 0.405388253 0.178301128 -0.169741722 0.368974372 RRP46 Putative 3'->5' exoribonuclease ; component of exosome complex of 3'->5' exonucleases YGR096W 0.603261859 0.041423443 0.269048897 0.019558938 similarity to bovine Graves disease carrier protein YGR097W 0.485585 0.034909839 0.324735043 0.086368807 ASK10 transcriptional activator of the SKN7 mediated 'two-component' regulatory system YGR098C -0.08206393 0.711717985 0.226083945 0.009570962 ESP1 involved in regulation of spindle pole body duplication YGR099W -0.52246294 0.059208656 -0.396904735 0.012825266 TEL2 telomere binding protein YGR100W -0.27145031 0.120434755 -0.247174038 0.018025748 MDR1 interacts with Mac1, a transcription factor that regulates genes involved in copper and iron utilization YGR101W -0.05837415 0.732234512 0.341037869 0.332916002 weak similarity to B.subtilis YqgP YGR102C -0.40681773 0.138260633 -0.036530678 0.901909434 hypothetical protein YGR103W 0.679743831 0.168238312 -0.42613317 0.197641921 similarity to zebrafish essential for embryonic development gene pescadillo YGR104C 0.501994511 0.104550225 -0.16866311 0.229039467 SRB5 subunit of RNA polymerase II holoenzyme /mediator complex YGR105W 0.187796072 0.515565298 0.027382489 0.78295841 VMA21 vacuolar H+-ATPase assembly protein YGR106C 0.138623243 0.689860033 0.293843887 0.043079301 hypothetical protein YGR107W -0.64482083 0.17557976 0.478229411 0.240642274 questionable ORF YGR108W 0.372496881 0.752231415 -0.13342706 0.144320836 CLB1 G(sub)2-specific B-type cyclin YGR109C -0.55894205 0.224045765 0.548437103 0.002667461 CLB6 B-type cyclin YGR109W-A -0.78806192 0.005094078 -0.250404017 0.568367406 Ty3A gag protein. Gag processing produces capsid proteins. YGR110W -1.02060027 0.035275985 -0.182841436 0.215250911 weak similarity to YLR099c and YDR125c YGR111W -0.74292626 0.019071716 -0.308823539 0.066745443 weak similarity to mosquito carboxylesterase YGR112W -0.31071148 0.306723484 -0.346999028 0.031284813 SHY1 mitochondrial protein with homology to the mammalian SURF-1 gene YGR113W -0.19552776 0.159803705 -0.097428379 0.177515551 DAM1 spindle pole body protein YGR114C -0.00016231 0.9993667 0.082192883 0.461461171 questionable ORF YGR115C -0.36570866 0.109866244 -0.384435828 0.171014228 questionable ORF YGR116W 0.379368052 0.079021089 -0.437845055 0.08642645 SPT6 transcriptional regulator, interacts with histones, primarily histone H3, possesses nucleosome assembly activity YGR117C 1.339202661 0.057462384 0.17748875 0.516283023 hypothetical protein YGR118W 1.905998532 0.143971105 -0.055413475 0.723544445 RPS23A Ribosomal protein S23A (S28A) (rp37) (YS14) YGR119C 0.714709436 0.06492075 -0.781664385 0.132510056 NUP57 Contains GLFG repeats in N-terminal half and heptad repeats in C-terminal half YGR120C 0.119706897 0.452851002 -0.478293265 0.056896756 SEC35 peripheral membrane protein involved in secretion YGR121C -1.2205737 0.047035435 0.326477707 0.183889787 MEP1 ammonia permease YGR122C-A 0.185582322 0.306698835 0.241219307 0.156540636 questionable ORF - identified by SAGE YGR122W -0.98955886 0.001393801 -0.400832807 0.063127385 hypothetical protein YGR123C 0.942247017 0.192314227 -0.042150916 0.66204098 PPT1 serine /threonine phosphatase YGR124W 1.032332679 0.124128431 0.113767664 0.10422262 ASN2 asparagine synthetase YGR125W -0.07892454 0.901536035 0.317545307 0.300789337 similarity to S.pombe hypothetical protein SPAC24H6.11c YGR126W -0.32410413 0.369329406 0.196778778 0.261673655 weak similarity to hypothetical protein YPR156c YGR127W -0.35089241 0.031912412 -0.017130201 0.89642087 weak similarity to mouse T10 protein YGR128C 1.225414626 0.057221041 -0.184765722 0.272680824 hypothetical protein YGR129W 0.049035464 0.763774974 -0.541401809 0.039423444 SYF2 (putative) involved in pre-mRNA splicing YGR130C -0.83756723 0.03127352 -0.196822231 0.002863839 weak similarity to myosin heavy chain proteins YGR131W 0.812310036 0.08211439 0.328423819 0.009556425 strong similarity to Nce2p YGR132C 0.00112033 0.997579541 -0.288946702 0.108535619 PHB1 mitochondrial protein, prohibitin homolog ; similar to S. cerevisiae Phb2p YGR133W -0.47183916 0.095073927 0.365912418 0.134291324 PEX4 Member of ubiquitin-conjugating protein family YGR134W 0.197393158 0.207915635 -0.062886809 0.36375383 CAF130 CCR4 associated factor 130 kDa YGR135W 0.034141025 0.915661881 -0.443858981 0.023393449 PRE9 proteasome component Y13 YGR136W 0.634386755 0.216750544 0.171343481 0.179006452 weak similarity to chicken growth factor receptor-binding protein GRB2 homolog YGR137W 0.860243269 0.250439989 0.341507668 0.003216456 questionable ORF YGR138C -1.0342082 0.058641067 -0.085576597 0.74073522 similarity to multidrug resistance proteins YGR139W -0.11674957 0.186642433 0.671648685 0.09331819 questionable ORF YGR140W 0.653918314 0.213847035 0.129070448 0.546113959 CBF2 110 kDa subunit of the centromere binding factor CBF3 YGR141W -0.68650758 0.079241239 0.047476563 0.64291758 strong similarity to hypothetical protein YPR157w YGR142W -0.91113225 0.05186615 -0.427149946 0.093256888 BTN2 Gene /protein whose expression is elevated in a btn1 minus /Btn1p lacking yeast strain. YGR143W -1.25673543 0.000950023 0.407984106 0.095022684 SKN1 encodes a predicted type II membrane protein highly homologous to Kre6p YGR144W 2.213715142 0.184984559 0.752889325 0.145215223 THI4 component of the biosynthetic pathway producing the thiazole precursor of thiamine YGR145W -0.52241609 0.203936523 -0.758246722 0.05226602 similarity to C.elegans hypothetical protein YGR146C -0.4756977 0.057670868 0.516174001 0.024474063 hypothetical protein YGR147C 0.390202008 0.206870432 0.139743429 0.325395549 NAT2 N alpha-acetyltransferase that acts on methionine termini YGR148C 0.818354508 0.047120709 -0.16705702 0.555549897 RPL24B Ribosomal protein L24B (rp29) (YL21) (L30B) YGR149W 0.339577565 0.66053139 0.501806772 0.121723002 hypothetical protein YGR150C 0.573433644 0.067520116 -0.799897284 0.003071718 hypothetical protein YGR151C 1.328706533 0.224236822 -0.510682288 0.090083812 questionable ORF YGR152C 1.598803546 0.265637286 -0.613032295 0.11000592 RSR1 GTP-binding protein, ras superfamily YGR153W 1.398172773 0.125766022 -0.086719301 0.686438744 TOS10 hypothetical protein YGR154C -0.15598049 0.692721709 0.088528521 0.383706201 strong similarity to hypothetical proteins YKR076w and YMR251w YGR155W 0.096115731 0.737789494 0.432116099 0.106243576 CYS4 Cystathionine beta-synthase YGR156W 0.588154464 0.031624826 0.63450009 0.000432366 hypothetical protein YGR157W -0.1495812 0.683355196 0.24119096 0.043166849 CHO2 Phosphatidyl-ethanolamine N-methyltransferase YGR158C 0.310167656 0.154868067 0.019048651 0.865638825 MTR3 nucleolar protein involved in mRNA transport YGR159C 1.433290815 0.19832217 -0.402660389 0.002428318 NSR1 nuclear localization sequence binding protein YGR160W 0.254563456 0.634046817 -0.738982831 0.011135784 questionable ORF YGR161C 0.146395644 0.6986124 0.081928186 0.57267813 hypothetical protein YGR162W 0.301467441 0.565044564 -0.25876581 0.108460121 TIF4631 mRNA cap-binding protein (eIF-4F), 150K subunit , highly homologous to Tif4632p, homologs of mammalian p220 YGR163W -0.46522764 0.055714147 -0.028989435 0.326712515 GTR2 (putative) small GTPase, similar to Gtr1 YGR164W 0.077093662 0.792711917 0.330031129 0.405727483 questionable ORF YGR165W 0.437317265 0.150957794 0.106911395 0.279241218 hypothetical protein YGR166W 1.957216013 0.123050509 0.226059446 0.079034555 KRE11 involved in cell wall biogenesis YGR167W 0.21164061 0.256580966 -0.135569763 0.456059764 CLC1 Clathrin light chain YGR168C 0.135048146 0.354120838 -0.167150551 0.52903482 hypothetical protein YGR169C 0.163639678 0.432149113 -0.21288136 0.167242827 similarity to Rib2p YGR171C 0.259690364 0.150421544 0.01571259 0.739676026 MSM1 mitochondrial methionyl-tRNA synthetase YGR172C 0.40846631 0.15379209 0.689115771 0.040044404 YIP1 Golgi integral membrane protein, interacts with Ypt proteins YGR173W 0.565973056 0.132941039 -0.353907119 0.079308255 strong similarity to human GTP-binding protein YGR174C -0.3175136 0.462679618 0.03480879 0.830498154 CBP4 ubiquinol--cytochrome-c reductase assembly factor YGR175C 0.381667679 0.592202565 0.123166763 0.361437719 ERG1 Squalene monooxygenase YGR176W 0.260040914 0.571964486 0.621535149 0.037207465 questionable ORF YGR177C 0.576996178 0.326334537 0.092706233 0.486021999 ATF2 Alcohol acetyltransferase YGR178C -0.04088992 0.88795945 0.026863749 0.83411597 PBP1 interacts with poly(A)-binding protein YGR179C -0.26501513 0.041750981 -0.497706971 0.078405462 hypothetical protein YGR180C 0.659924072 0.462748805 0.526466539 0.153283852 RNR4 Ribonucleotide Reductase YGR181W 0.019900214 0.931828345 0.277337537 0.001306275 TIM13 Subunit of mitochondrial protein import machinery YGR182C -0.97923913 0.002251397 0.057651361 0.705931701 questionable ORF YGR183C -0.94853975 0.005690217 -0.049502896 0.402609417 QCR9 7.3 kDa subunit 9 of the ubiquinol cytochrome c oxidoreductase complex YGR185C 1.108702654 0.25843125 0.022794105 0.723773434 TYS1 tyrosyl-tRNA synthetase, cytoplasmic YGR186W -0.31071757 0.209377792 -0.502077355 0.053628213 TFG1 Transcription factor TFIIF large subunit YGR187C 0.93683661 0.200667375 -0.69328914 0.09582857 HGH1 (putative) Hmg1 /2 protein YGR188C -0.02019959 0.948657422 -0.309275286 0.212511438 BUB1 Serine /threonine protein kinase required for cell cycle arrest in response to loss of microtubule function YGR189C 2.249648859 0.22341789 0.445000867 0.143350482 CRH1 Cell wall protein YGR190C 0.627075464 0.005917838 0.282406874 0.19419146 questionable ORF YGR191W 0.584922249 0.002341945 0.523726363 0.095125367 HIP1 histidine permease YGR192C 0.880923937 0.191531829 0.768922948 0.159502261 TDH3 Glyceraldehyde-3-phosphate dehydrogenase 3 YGR193C 0.322506154 0.001541844 -0.082844217 0.368053388 PDX1 Protein X component of mitochondrial pyruvate dehydrogenase complex YGR194C -1.0984037 0.012850279 0.046121844 0.693754546 XKS1 Xylulokinase YGR195W 0.936708053 0.05844103 -0.052207337 0.544197335 SKI6 homolog of RNAse PH YGR196C 0.162410826 0.486737073 -0.668666436 0.008661067 weak similarity to Tetrahymena acidic repetitive protein arp1 YGR197C 0.072043158 0.762477051 0.276670039 0.14385776 SNG1 involved in nitrosoguanidine resistance YGR198W 0.958001362 0.173239509 -0.385717828 0.056613995 hypothetical protein YGR199W -0.41732521 0.041995775 0.236771216 0.208672399 PMT6 dolichyl phosphate-D-mannose:protein O-D-mannosyltransferase YGR200C 0.22269841 0.389854489 -0.10866288 0.29611013 ELP2 90 kD subunit of elongator and elongating RNA pol II holoenzyme YGR201C -1.74512325 0.003615327 0.236366844 0.388325985 strong similarity to translation elongation factor eEF1 alpha chain Cam1p YGR202C 0.103469524 0.509364408 -0.781523078 0.008668422 PCT1 phosphorylcholine transferase ; or cholinephosphate cytidylyltransferase YGR203W 0.973449016 0.090867581 0.606918829 0.124444772 weak similarity to X.laevis protein-tyrosin-phosphatase cdc homolog 2 and to hypothetical protein YPR200c YGR204W 0.196387476 0.139415125 0.629932888 0.142758822 ADE3 encodes the cytoplasmic trifunctional enzyme C1-tetrahydrofolate synthase YGR205W -0.73083948 0.024880422 0.232050495 0.33139012 similarity to S.pombe hypothetical protein D89234 YGR206W -0.80487028 0.003776645 0.102067358 0.445067705 similarity to Xenopus transcription factor Oct-1.17 YGR207C 0.031954838 0.906355555 -0.562327279 0.073153342 ETF-BETA electron-transferring flavoprotein, beta chain YGR208W 1.368772651 0.042959768 -0.017833859 0.907245817 SER2 phosphoserine phosphatase YGR209C 0.43753087 0.022837415 0.587052357 0.033462491 TRX2 thioredoxin YGR210C -0.5759268 0.030195896 0.044790756 0.571796704 similarity to M.jannaschii GTP-binding protein and to M.capricolum hypothetical protein SGC3 YGR211W 0.23539715 0.365436635 0.346291225 0.020361386 ZPR1 zinc finger protein YGR212W 0.2055298 0.061377787 0.066407592 0.194434172 weak similarity to S.pombe hypothetical protein SPAC18B11.03c YGR213C 0.471887069 0.504887559 0.218751236 0.2413573 RTA1 involved in 7-aminocholesterol resistance YGR214W 0.905528953 0.004652697 0.316660171 0.010957085 RPS0A Ribosomal protein S0A YGR215W 0.502387534 0.010096626 0.025541179 0.870654737 RSM27 protein of the small subunit of the mitochondrial ribosome YGR216C 0.675450696 0.004291721 0.382225143 0.18503978 GPI1 involved in first step of GPI (N-acetylglucosaminylphosphatidylinositol) anchor synthesis YGR218W -0.57274737 0.096047594 0.201044941 0.044773308 CRM1 omosome region maintenance protein YGR219W 0.723359781 0.02823017 -0.146592818 0.384818643 questionable ORF YGR220C 0.214321804 0.265957365 -0.219436496 0.136857375 MRPL9 Mitochondrial ribosomal protein MRPL9 (YmL9) (E. coli L3) (human MRL3) YGR221C -1.35671699 0.009341723 0.310381265 0.124863976 TOS2 similarity to hypothetical protein YHR149c YGR222W -0.0897455 0.594517722 -0.167207322 0.284989192 PET54 translational activator of cytochrome c oxidase subunit III YGR223C 0.129292118 0.604239251 -0.048064197 0.1121444 weak similarity to hypothetical protein YFR021w YGR224W 1.144797322 0.007231496 0.478649897 0.042496623 AZR1 small molecule transport/MFS-MDR YGR225W -1.10864586 0.035220555 0.249186062 0.469505786 AMA1 Required for sporulation ; highly induced during sporulation YGR226C 0.322983473 0.251645697 0.209694744 0.286089768 hypothetical protein YGR228W 0.159867805 0.42088248 -1.267416922 0.012059019 questionable ORF YGR229C 1.006304631 0.258143628 -0.507559358 0.149194917 SMI1 57 kDa nuclear protein YGR230W 0.539263724 0.220426426 -0.256859132 0.326511052 BNS1 similar to Spo12, involved in sporulation YGR231C 0.062864077 0.680118357 -0.41330347 0.023458103 PHB2 mitochondrial protein, prohibitin homolog ; homolog of mammalian BAP37 and S. cerevisiae Phb1p YGR232W 0.001568921 0.991403369 0.165958238 0.114856544 NAS6 Interaction with the 19S regulatory particle of the 26S proteasome detected by coimmunoprecipitation YGR233C -1.53251546 0.004199795 -0.073728448 0.428484293 PHO81 Pho85 kinase inhibitor YGR234W 0.373610852 0.320131068 0.443626734 0.002873872 YHB1 Flavohemoglobin YGR235C -0.04660157 0.808153924 -0.132168199 0.087732018 hypothetical protein YGR236C -1.67234003 0.030497721 0.060493875 0.768258884 SPG1 stationary phase gene YGR237C -0.35816185 0.01026221 -0.320378411 0.01599475 weak similarity to YOR019w YGR238C -0.80632228 0.042893614 -0.236480267 0.343200747 KEL2 involved in cell fusion and morphology ; contains six Kelch repeats YGR239C 0.792685529 0.284689434 0.039320545 0.574581683 PEX21 Peroxin Pex21p YGR240C 0.345541092 0.37851418 0.212295088 0.069178448 PFK1 phosphofructokinase alpha subunit YGR241C 0.009674497 0.976686178 0.337848537 0.038883796 YAP1802 member of clathrin assembly polypeptide AP180 family YGR242W 0.366255602 0.717458956 0.031389723 0.886155725 questionable ORF YGR243W -1.33425269 0.013788224 0.258429873 0.237325777 strong similarity to hypothetical protein YGR243w//strong similarity to hypothetical protein YHR162w YGR244C -0.76830403 0.059589909 0.259687498 0.132493826 LSC2 Succinate-CoA Ligase (ADP-Forming) YGR245C 0.740041817 0.008890811 -0.372376229 0.025733918 SDA1 Severe Depolymerization of Actin YGR246C -0.51838385 0.090954986 0.021874651 0.901597328 BRF1 RNA polymerase III transcription factor with homology to TFIIB YGR247W -0.98388934 0.035337703 -0.067966372 0.274072726 hypothetical protein YGR248W -3.05069509 6.70854E-05 0.104138306 0.611072488 SOL4 similar to SOL3 YGR249W -2.02105903 0.006992032 0.304105286 0.226486698 MGA1 Mga1p shows similarity to heat shock transcription factor YGR250C -0.87347146 0.010399815 -0.588631376 0.002995777 weak similarity to human cleavage stimulation factor 64K chain YGR251W 0.528064286 0.237913357 -0.567860674 0.088737055 hypothetical protein YGR252W 0.249642663 0.174758461 -0.164087624 0.017600794 GCN5 histone acetyltransferase YGR253C 0.068309879 0.890347101 -0.53233139 0.071694996 PUP2 Proteasome subunit YGR254W -0.21950997 0.573279469 0.173513849 0.412884213 ENO1 enolase I YGR255C 0.62745397 0.307772755 0.233738138 0.273800646 COQ6 COQ6 monooxygenase YGR256W -2.59716225 0.001641311 -0.104964865 0.753278712 GND2 6-phosphogluconate dehydrogenase YGR257C 0.582186635 0.074956432 -0.369807549 0.004684275 similarity to C.elegans C16C10.1 homolog of xeroderma pigmentosum group G (XPG) protein, copufurifies with transcription factor, TFIIH, mRNA is cell cycle regulated and YGR258C -0.61530941 0.053489324 -0.317812262 0.12786496 RAD2 induced by DNA damage and by meiosis (different cis-sites utilized in damage and meiotic induction YGR259C 0.227978928 0.56995863 0.226132746 0.532845658 questionable ORF YGR260W 0.361676936 0.411983663 0.417039553 0.320754886 TNA1 Tna1p is a high affinity nicotinic acid plasma membrane permease YGR261C 0.153924585 0.425155493 -0.109426796 0.478531639 APL6 putative beta adaptin component of the membrane-associate clathrin assembly complex YGR262C -0.36091999 0.076723959 0.06545637 0.582528345 ser/thr protein kinase YGR263C -0.09540075 0.623510438 0.477773475 0.011057239 weak similarity to E.coli lipase like enzyme YGR264C 1.289294917 0.143007878 -0.114142019 0.155246184 MES1 methionyl tRNA synthetase YGR265W 1.070077689 0.02773434 0.190029345 0.054850704 questionable ORF YGR266W 0.008438963 0.973587904 -0.027581454 0.531673907 hypothetical protein YGR267C 0.099319025 0.533873661 -0.132155977 0.199577706 FOL2 GTP-cyclohydrolase I YGR268C -0.0939989 0.820277661 0.554190402 0.070399823 weak similarity to S.pombe hypothetical protein SPAC17A5 YGR269W 1.176581976 0.407347222 0.185856418 0.554719738 questionable ORF YGR270W -0.4494557 0.137235601 -0.193942507 0.1502483 YTA7 26S proteasome ATPase YGR271W -0.16009157 0.468924299 0.042734814 0.86068605 strong similarity to S.pombe RNA helicase YGR272C 1.140846422 0.116135538 -1.208853937 0.021456802 similarity to hypothetical S.pombe protein SPAC12G12.02 YGR273C 0.31752713 0.587981105 0.505347531 0.390372455 similarity to hypothetical protein YMR295c YGR274C 0.19708739 0.453305159 -0.27476247 0.093894561 TAF145 TFIID 145 KDa subunit YGR275W 0.032496077 0.898989127 -0.218570857 0.192122298 RTT102 regulator of Ty1 transposition YGR276C -0.17074037 0.343708113 -0.649249304 0.020359505 RNH70 ribonuclease H YGR277C 0.000688722 0.997331789 -0.327442612 0.064469853 similarity to hypothetical S.pombe protein YGR278W 0.27070663 0.241587897 -0.268881087 0.066745168 similarity to C.elegans LET-858 YGR279C 0.528805239 0.362499081 0.81522253 0.059839819 SCW4 soluble cell wall protein ; can be released from SDS-extracted cell walls under reducing conditions YGR280C 0.565105343 0.235585045 -0.804323575 0.027013763 weak similarity to Cbf5p YGR281W -0.89563402 0.034346317 0.210350566 0.264655391 YOR1 ABC transporter YGR282C 1.397834203 0.230180937 0.602444244 0.217841958 BGL2 Cell wall endo-beta-1,3-glucanase YGR283C 1.333078004 0.060995305 0.109389504 0.447374217 similarity to hypothetical protein YMR310c YGR284C -0.11521695 0.697206685 0.045838064 0.769995263 ERV29 ER-Golgi transport vesicle protein YGR285C 0.694542529 0.055285903 0.571070861 0.001189185 ZUO1 Zuotin, putative Z-DNA binding protein YGR286C -0.72026533 0.039008709 0.007608952 0.970664509 BIO2 Biotin synthase YGR287C -1.34340446 0.01764757 -0.057013756 0.72362413 strong similarity to maltase YGR288W 0.104566979 0.863649221 0.024344927 0.879209614 MAL13 MAL-activator protein YGR289C -1.2517479 0.002823882 0.378641918 0.345670103 MAL11 Alpha-glucoside transporter ; maltose permease YGR290W 0.120926803 0.864783541 -0.542162599 0.292845351 hypothetical protein YGR291C -0.7013692 0.038622533 0.380458579 0.510008252 hypothetical protein YGR292W -1.11477474 0.007788982 -0.067178641 0.68848526 MAL12 alpha-glucosidase of the MAL1 locus YGR293C 0.215429419 0.073104369 0.228718214 0.352444136 strong similarity to hypothetical protein YBR300c YGR294W 0.154276356 0.362531736 0.414835223 0.129257955 strong similarity to members of the Srp1p/Tip1p family YGR295C -0.45967222 0.246984692 0.13057919 0.440358725 COS6 similar to other subtelomerically-encoded proteins YHL001W 1.703989493 0.014953649 0.219833568 0.025672879 RPL14B Ribosomal protein L14B YHL002W 0.169409203 0.227953354 0.046157254 0.40074328 SH3 domain YHL003C -0.27473027 0.190104808 -0.152452128 0.377444723 LAG1 longevity-assurance protein YHL004W 0.741307402 0.126367812 0.256858794 0.145458246 MRP4 mitochondrial ribosomal protein, homologous to E. coli ribosomal protein S2, component of the 37 S subunit of mitochondrial ribosomes YHL005C 0.197844031 0.640882149 0.287854544 0.018694264 hypothetical protein YHL006C 0.5006168 0.16272783 0.440998503 0.087130276 SHU1 suppressor of HU sensitivity of sgs1 mutations YHL007C 0.092071198 0.706929839 0.148233243 0.139363867 STE20 serine /threonine protein kinase YHL008C -0.69115676 0.142903534 0.191855095 0.495945352 Potential formate transporter nirC YHL009C -0.63446494 0.026619037 -0.476225797 0.054013178 YAP3 bZip DNA binding proteins YHL009W-A -0.75550557 0.037930741 -0.518234108 0.138522511 TyA gag protein. Gag processing produces capsid proteins. YHL011C 0.633922201 0.242202075 -0.104516803 0.132047194 PRS3 ribose-phosphate pyrophosphokinase 3 YHL012W 0.923944545 0.106723654 0.140768849 0.179438337 UDP Glucose pyrophosphorylase YHL013C 0.424282916 0.032448931 -0.789416361 0.045730037 similarity to C.elegans hypothetical protein F21D5.2 YHL014C -0.1346036 0.537585433 -0.595671268 0.032309764 YLF2 GTP-binding protein and glycogen phosphorylase (weak) YHL015W 0.874570837 0.062183127 -0.346054478 0.095767284 RPS20 Ribosomal protein S20 YHL016C -1.25509128 0.085062945 0.25223857 0.427019334 DUR3 Urea transporter YHL017W -0.22041028 0.471786785 -0.050600381 0.858752257 Probable transmembrane protein PTM1 YHL018W 0.353762018 0.381349214 0.176811489 0.164986455 Dimerization cofactor of homeodomian protein NF1-alpha YHL019C -0.51618054 0.073210578 -0.328440609 0.075194349 APM2 Similiar to clathrin coat proteins YHL020C 0.297069908 0.639095974 -0.103316301 0.408974033 OPI1 negative regulator of phospholipid biosynthesis YHL021C 0.506153964 0.598249896 0.38725502 0.265355104 weak similarity to Pseudomonas gamma-butyrobetaine hydroxylase YHL022C 0.375683618 0.504008039 0.222296026 0.059594746 SPO11 Encodes one of the earliest meiosis-specific recombination functions. YHL023C -0.63936933 0.046717914 -0.069831876 0.48875303 hypothetical protein YHL024W -0.40524323 0.425195742 0.262778756 0.252976979 RIM4 RNA-binding protein of the RRM class (putative) YHL025W -0.21283942 0.297324418 -0.298369117 0.26418369 SNF6 subunit of the chromatin remodeling Snf /Swi complex YHL026C 0.368162449 0.575263228 0.302359944 0.016110602 hypothetical protein YHL028W -1.54029824 0.00335701 0.245428226 0.372887528 WSC4 Putative integral membrane protein containing novel cysteine motif. Similarity to SLG1 (WSC1), WSC2 and WSC3 YHL029C 0.766228834 0.003879005 0.305558493 0.064787062 hypothetical protein YHL030W -0.18091916 0.439355999 0.045551418 0.109930881 ECM29 involved in cell wall biogenesis YHL031C -0.21642045 0.306037277 0.492972193 0.047264901 GOS1 Golgi SNARE protein YHL032C -1.1518371 0.063867672 0.396930537 0.069655484 GUT1 glyerol kinase (converts glycerol to glycerol-3-phosphate YHL033C 1.16890719 0.014402862 0.301355911 0.00110139 RPL8A Ribosomal protein L8A (rp6) (YL5) (L4A) YHL034C -0.05130939 0.77720484 0.094471586 0.112651875 SBP1 Single-strand nucleic acid binding protein YHL035C -0.29258963 0.374674738 -0.013313141 0.935382792 ABC transporter YHL036W -0.16415202 0.396728793 0.248338992 0.010743036 MUP3 very low affinity methionine permease YHL037C 1.174908398 0.445698719 0.013795049 0.892388883 hypothetical protein YHL038C -0.13423601 0.471510757 -0.14161606 0.131891928 CBP2 Cytochrome B pre-mRNA processing protein YHL039W 0.474909855 0.022989247 0.131567476 0.146149547 weak similarity to YPL208w YHL040C 0.501910608 0.257440455 0.464145522 0.087185742 ARN1 ferrichrome-type siderophore transporter YHL041W -0.67746604 0.042474659 -0.397936512 0.384875814 weak similarity to Drosophila hypothetical protein 6 YHL042W -0.03222344 0.653448424 0.16809894 0.276864062 similarity to subtelomeric encoded proteins YHL043W -0.4747536 0.010660598 0.072100393 0.744990659 ECM34 ExtraCellular Mutant//involved in cell wall biogenesis and architectureinvolved in cell wall biogenesis and architecture YHL044W -0.57225626 0.001966708 -0.228104541 0.062081365 similarity to subtelomeric encoded proteins YHL045W -0.21662926 0.588610206 0.367547148 0.501879328 strong similarity to subtelomeric encoded proteins YHL046C 0.255686069 0.521141583 0.698883144 0.064260303 strong similarity to members of the Srp1p/Tip1p family YHL047C 0.124629528 0.804537092 -0.111151702 0.238641369 TAF1 Triacetylfusarinine C transporter YHL048W -0.30467617 0.484831893 -0.213599232 0.172943342 COS8 similar to other subtelomerically-encoded proteins YHL049C -0.73261789 0.010757523 0.453262815 0.146694368 strong similarity to subtelomeric encoded proteins YHL050C -1.22554239 0.00322466 0.387532647 0.231977115 strong similarity to subtelomeric encoded proteins YHR001W -1.28884548 0.002742997 -0.360850981 0.022823205 60kD chaperonin (weak) YHR002W -0.60461553 0.038229672 -0.354029054 0.070286437 Mitochondrial carrier protein /Grave's disease carrier protein YHR003C 0.278038647 0.032246641 -0.466508303 0.031682942 thiF, moeB, ubiquitin activating enzyme (all weak) YHR004C -0.6004327 0.045350886 -0.102434147 0.363599026 NEM1 Nuclear Envelope Morphology YHR005C 0.123188552 0.298705672 -0.42238405 0.079720114 GPA1 alpha subunit of G protein coupled to mating factor receptors YHR005C-A 1.093135976 0.013751446 0.177392491 0.48113003 MRS11 component of mitochondrial import machinery YHR006W 0.266687658 0.490222003 0.33826826 0.016509902 STP2 Zinc finger (Cys(2)-His(2)) YHR007C 0.105946748 0.795140659 0.279781508 0.237388994 ERG11 cytochrome P450 lanosterol 14a-demethylase YHR008C -1.91592298 0.000839021 0.507213172 0.072083811 SOD2 Manganese-containing superoxide dismutase YHR009C 0.194491912 0.534673426 0.544938606 0.095125598 similarity to S.pombe hypothetical protein YHR010W 1.528535589 0.093482478 -0.034577612 0.875676605 RPL27A Ribosomal protein L27A YHR011W -0.41563418 0.131682792 -0.372849548 0.096312595 DIA4 Seryl-tRNA synthetase YHR012W -0.34790686 0.04794147 -0.334534634 0.098779559 VPS29 involved in vacuolar protein sorting YHR013C 0.290773926 0.309877011 0.061843534 0.516317857 ARD1 subunit of the major N alpha-acetyltransferase ; complexes with Nat1p YHR014W 0.315743047 0.270687936 0.127871239 0.644644463 SPO13 sporulation protein YHR015W -1.86580598 0.008292054 -0.675955259 0.098251172 MIP6 PolyA-binding protein YHR016C -0.99287008 0.016201804 -0.031180463 0.583886788 YSC84 SH3 domain in C-terminus YHR017W -0.08106326 0.711889689 0.028357169 0.740832184 YSC83 similar to S. douglasii YSD83 YHR018C 1.208241348 0.350886743 -0.13634341 0.353000658 ARG4 argininosuccinate lyase YHR019C 0.265809374 0.072068645 0.30016003 0.046733317 DED81 Asparaginyl-tRNA synthetase YHR020W 0.434144015 0.013290724 -0.220135182 0.103877662 Aminoacyl tRNA-synthetase YHR021C 2.175756787 0.027671927 0.690090147 0.023466091 RPS27B 40S Ribosomal protein S27B (rp61) (YS20) YHR021W-A 0.261374039 0.537325613 0.233401905 0.407365047 ECM12 (putative) involved in cell wall biogenesis YHR022C 0.670719224 0.242592767 0.200603925 0.03778279 RAS-related protein YHR023W 0.503771159 0.590566551 -0.069285625 0.532404662 MYO1 Class II Myosin YHR024C 1.003996046 0.053263979 -0.017681058 0.62682353 MAS2 53 kDa subunit of the mitochondrial processing protease YHR025W 1.007435303 0.109757319 0.417886016 0.129155104 THR1 homoserine kinase YHR026W 0.557309724 0.232133195 0.269186173 0.030278427 PPA1 vacuolar ATPase V0 domain subunit c'' YHR027C 0.029245109 0.871054466 -0.238628503 0.071941966 RPN1 Subunit of 26S Proteasome (PA700 subunit) YHR028C -0.6399085 0.050951438 0.142477545 0.226041755 DAP2 Dipeptidyl aminopeptidase B (DPAP B) YHR029C -0.89117047 0.0355358 -0.518984869 0.034609776 Thymidylate synthase (putative ; weak) YHR030C 0.853698078 0.286745249 -0.09817604 0.419527221 SLT2 serine /threonine MAP kinase YHR031C -0.1144014 0.722751871 -0.180359154 0.083848929 RRM3 DNA helicase YHR032W 0.08136409 0.835950796 0.164696431 0.416744217 ethionine resistance protein YHR033W -0.80367965 0.232810578 0.877507754 0.114641658 Pro1p (Gamma-glutamyl kinase) YHR034C -0.67233881 0.097187307 0.110794198 0.437200072 hypothetical protein YHR035W 0.594814755 0.199394067 0.138502455 0.133744291 weak similarity to human Sec23 protein YHR036W 0.326704272 0.13417374 0.025295974 0.807163963 similarity to hypothetical protein YGL247w YHR037W -0.34198777 0.160697331 -0.098943493 0.143253896 PUT2 delta-1-pyrroline-5-carboxylate dehydrogenase YHR038W 0.657014023 0.024244405 -0.346575989 0.236461162 FIL1 Putative mitochondrial ribosome recycling factor YHR039C -0.28177403 0.013396827 0.308465233 0.007693046 Aldehyde dehydrogenases YHR040W -0.56838253 0.13224627 -0.247787242 0.050281913 weak similarity to Hit1p YHR041C 0.669049495 0.121764764 0.861711004 0.06723048 SRB2 RNA polymerase II holoenzyme /mediator subunit YHR042W 0.309984566 0.363063539 0.755379039 0.047452351 NCP1 NADP-cytochrome P450 reductase YHR043C -0.17127183 0.702095199 -0.16862018 0.08037727 DOG2 2-deoxyglucose-6-phosphate phosphatase YHR044C -0.06366259 0.866612295 -0.21479172 0.027141704 DOG1 2-deoxyglucose-6-phosphate phosphatase YHR045W 0.474988847 0.02191573 0.036194147 0.644135208 hypothetical protein YHR046C 0.466489252 0.250596663 -0.326654357 0.033645146 Inositol monophosphatase YHR047C 0.524318583 0.177190497 0.380622937 0.021010788 AAP1' arginine /alanine aminopeptidase YHR048W 0.927406157 0.113460005 0.288187282 0.075437781 similarity to multidrug resistance proteins YHR049C-A 1.082593719 0.098785229 0.437825833 0.017522041 questionable ORF YHR049W 1.763368304 0.17020191 0.136029047 0.337502972 similarity to S.pombe dihydrofolate reductase and YOR280c YHR050W 0.16632212 0.565428224 0.534845584 0.115838845 SMF2 localized to mitochondrial membrane YHR051W -1.59075669 0.000966808 -0.415742798 0.006225004 COX6 subunit VI of cytochrome c oxidase YHR052W 1.287386697 0.077484986 -0.594289633 0.115632555 weak similarity to P.yoelii rhoptry protein YHR053C -0.9056248 0.000213858 -0.161247146 0.195232285 CUP1-1 copper-binding metallothionein YHR054C -1.73559725 0.000881801 -0.083869977 0.188773404 weak similarity to YOR262w YHR055C -0.793701 0.001171231 -0.275752243 0.213574342 CUP1-2 copper-binding metallothionein YHR056C -1.05166452 0.001265546 0.240924711 0.170556502 ORF-X' in the CUP1 repeat region YHR057C -0.90036025 0.00218626 0.340155959 0.040117038 CYP2 Peptidylprolyl isomerase (cyclophilin) ER or secreted YHR058C -0.18629987 0.290102504 -0.214539597 0.048613191 MED6 RNA polymerase II mediator subunit YHR059W 0.898887805 0.084846903 -0.005435989 0.958244854 weak similarity to Ustilago hordei B east mating protein 2 YHR060W -0.17767955 0.637255223 -0.799937176 0.068220265 VMA22 vacuolar H+-ATPase assembly protein YHR061C 0.540709783 0.052633572 0.276148253 0.038369782 GIC1 interacts with GTPase, involved in bud emergence YHR062C 0.952800577 0.02590862 0.049684216 0.77960657 RPP1 Protein subunit of nuclear ribonuclease P (RNase P) YHR063C 0.881859791 0.396487063 -0.14169076 0.316345916 PAN5 Ketopantoate Reductase YHR064C 1.11513957 0.274795944 0.046993172 0.494261472 PDR13 Hsp70 Protein RRP3 is a DEAD box gene homologous to eIF-4a which encodes an RNA-dependent ATPase possessing helicase activity which is not specific YHR065C 0.520439699 0.180794079 -0.621759101 0.057584468 RRP3 for RNA YHR066W 1.086103811 0.058825821 -0.576103287 0.160133322 SSF1 homologous to Ssf2p YHR067W -0.15578463 0.700109194 0.030627129 0.806082766 hypothetical protein YHR068W 1.425360821 0.193100944 0.298298149 0.166841745 DYS1 Deoxyhypusine synthase YHR069C 0.762321025 0.14209158 -0.254412372 0.050335213 RRP4 3->5 exoribonuclease ; Component of the exosome 3->5 exonuclease complex with Rrp41p, Rrp42p, Rrp43p and Dis3p (Rrp44p). YHR070W 0.511395346 0.02987825 0.235140752 0.078590545 strong similarity to N.crassa met-10+ protein YHR071W 0.520121392 0.289934117 0.02091108 0.823211638 PCL5 G1 /S cyclin (weak) YHR072W 0.02474641 0.890464456 0.089162636 0.043174191 ERG7 2,3-oxidosqualene-lanosterol cyclase YHR072W-A 1.578518266 0.021117818 0.191510858 0.410517505 NOP10 Component of H /ACA-box snoRNPs YHR073W 0.23466517 0.182955189 -0.059121193 0.115755461 OSH3 Oxysterol-binding protein YHR074W -0.67439849 0.06413981 0.089955636 0.534714555 QNS1 weak similarity to B.subtilis spore outgrowth factor B YHR075C -1.39841012 0.000336301 -0.289721299 0.077420809 PPE1 ribosomal protein of the small subunit, mitochondrial /carboxyl methyl esterase YHR076W -0.9911158 0.014018701 -0.259846635 0.033257415 weak similarity to C.elegans hypothetical protein CEW09D10 YHR077C 0.094437324 0.211864325 -0.248273562 0.204285488 NMD2 Highly acidic C-terminus YHR079C -0.0797747 0.40562298 0.921384414 0.015356841 IRE1 Ire1p is a transmembrane protein that has both serine-threonine kinase and endoribonuclease activities YHR080C -0.78595783 0.027401721 0.713282885 0.245050664 similarity to hypothetical protein YDR326c, YFL042c and YLR072w YHR081W 0.59521292 0.061544161 -0.111711418 0.320345297 weak similarity to human C1D protein YHR083W -0.54599489 0.087391487 -0.682792968 0.084318999 hypothetical protein YHR084W 0.430234845 0.058687492 0.356296861 0.084808579 STE12 Transcription factor YHR085W 1.376273892 0.067821032 0.6932294 0.047723499 weak similarity to fruit fly brahma transcriptional activator YHR086W -0.39551625 0.067685125 -0.206416466 0.423152802 NAM8 putative RNA binding protein, involved in meiosis-specific splicing of the REC107 transcripts in cooperation with the Mer1 protein YHR087W -1.42775287 0.014126441 0.201581048 0.179335187 hypothetical protein YHR088W 0.75127057 0.037388357 0.17350043 0.301787357 RPF1 similarity to hypothetical protein YNL075w YHR089C 1.491385459 0.158550081 -0.496060108 0.184374179 GAR1 small nucleolar RNP proteins YHR090C -0.2875236 0.326839861 0.143541684 0.102858712 YNG2 NuA4 histone acetyltransferase complex component YHR091C 0.022984675 0.898892028 -0.569832518 0.102572644 MSR1 Arginyl-tRNA synthetase YHR092C -0.70701111 0.351587942 0.171362223 0.066003985 HXT4 High-affinity glucose transporter the AHT1 DNA sequence is upstream of HXT4 and contains an HXT4 regulatory element which is a multicopy suppressor of glucose transport YHR093W 0.411938884 0.491298246 0.573519666 0.078974959 AHT1 defects ; probable non-functional ORF YHR094C 0.730722646 0.35708953 0.377391135 0.422649731 HXT1 High-affinity hexose (glucose) transporter YHR095W 0.626624451 0.139053731 0.513771653 0.105125437 hypothetical protein YHR096C -1.7941009 0.005037945 1.334048652 0.268296644 HXT5 hexose transporter YHR098C 0.252355495 0.513268143 0.548181753 0.099785833 SFB3 binds to Sed5p and Sec23p by distinct domains YHR100C -0.33376095 0.371661916 0.700705475 0.083092909 hypothetical protein YHR101C -0.21305077 0.213689181 0.231859985 0.057302068 BIG1 involved in cell growth and size YHR103W 0.13538419 0.434733567 -0.374660027 0.098945709 SBE22 involved in bud growth YHR104W -1.08570408 0.019635441 0.133912931 0.641899153 GRE3 a keto-aldose reductase YHR105W -0.58925258 0.008748452 -0.119382618 0.111879633 weak similarity to Mvp1p YHR106W -1.24069228 0.000135022 0.106623455 0.355042309 TRR2 mitochondrial thioredoxin reductase YHR107C 0.416065801 0.313566188 -0.050605888 0.770686761 CDC12 Component of 10 nm filaments of mother-bud neck (septin) YHR108W 0.185939518 0.285338509 0.445778602 0.013972345 GGA2 Arf-binding protein YHR109W -0.30453018 0.271248799 -0.145992781 0.294923163 CTM1 Cytochrome c methyltransferase YHR110W -0.15798353 0.285774294 -0.091529155 0.088167437 ERP5 p24 protein involved in membrane trafficking YHR111W -0.07172194 0.721769538 -0.102674617 0.25760136 moeB, thiF, UBA1 YHR112C -0.80968321 0.023013865 -0.166711759 0.137976526 Cystathionine gamma-synthase YHR113W -0.81974015 0.024144998 0.180807828 0.268320657 Vacuolar aminopeptidase YHR114W -0.3293218 0.017996836 -0.183604629 0.224227021 BZZ1 Myo3 /5p-Bee1p-Vrp1p actin assembly complex component YHR115C -0.20001606 0.27700481 0.307478871 0.09555716 strong similarity to hypothetical protein YNL116w YHR116W 0.828605039 0.125133911 0.320404565 0.145923483 hypothetical protein YHR117W -0.59141567 0.011672334 -0.019256597 0.855403279 TOM71 71-kDa component of the protein translocase of the outer membrane of mitochondria YHR118C 0.398191835 0.039512797 -0.280727138 0.002493837 ORC6 50-kDa subunit of ORC YHR119W 0.037019078 0.899974058 0.310880472 0.082583845 SET1 involved in chromatin-mediated gene regulation / trithorax YHR120W 0.731396567 0.22593704 -0.410869526 0.057922656 MSH1 mutS homolog involved in mitochondrial DNA repair YHR121W 0.23546585 0.170920074 -0.293614839 0.087363005 weak similarity to C.elegans hypothetical protein YHR122W 0.290516884 0.511367378 -0.454088397 0.014931859 similarity to hypothetical C. elegans protein F45G2.a YHR123W 1.469421843 0.152960586 0.43464764 0.122023103 EPT1 sn-1,2-diacylglycerol ethanolamine- and cholinephosphotranferase YHR124W -0.10168322 0.680336847 0.048664854 0.744193693 NDT80 DNA-binding transcription factor that activates middle sporulation genes YHR125W 0.283948896 0.400620666 0.159095976 0.517667064 questionable ORF YHR126C -0.17854284 0.756274863 0.769362309 0.030295907 hypothetical protein (H)igh copy (S)uppressor of (N)34 dominant negative allele of SEC4. Suppression is very specific to this allele. It has no affect on the YHR127W 0.077049149 0.8448317 0.158306861 0.237550777 HSN1 analogous YPT1 allele. No homology or known function. YHR128W 0.7904179 0.311448917 -0.004708133 0.966127234 FUR1 UPRTase YHR129C -0.36244395 0.48009763 -0.035667713 0.891465152 ARP1 Centractin YHR130C 0.141675511 0.282507793 0.333469076 0.211537839 YHR131C -0.11852997 0.271168751 0.139696261 0.217567818 Highly acidic C-terminus YHR132C 0.095084156 0.818468667 0.454236812 0.219786603 ECM14 Carboxypeptidase YHR133C 0.975753542 0.13731858 -0.063938044 0.144825257 hypothetical protein YHR134W 0.615336015 0.003742255 -0.052330627 0.375344178 WSS1 Weak suppressor of smt3 mutant YHR135C -0.21423215 0.621814499 0.206329219 0.266871033 YCK1 membrane-bound casein kinase I homolog YHR136C -1.43999234 0.048978586 0.560841527 0.147735751 SPL2 17 kDa protein YHR137W -1.32751075 0.000504292 0.757847274 0.047656431 ARO9 aromatic amino acid aminotransferase II YHR138C -0.91748654 0.096292939 -0.145953593 0.578322018 hypothetical protein YHR139C -3.7282522 0.0002836 0.158940966 0.433418657 SPS100 sporulation-specific wall maturation protein YHR139C-A -0.72406884 0.33188876 0.293328054 0.551516688 hypothetical protein YHR140W -2.61008669 0.000188247 0.426368166 0.466843453 hypothetical protein YHR141C 1.518585016 0.071401945 0.362117748 0.070641919 RPL42B Ribosomal protein L42B (YL27) (L41B) (YP44) YHR142W 1.451853247 0.039783606 0.438635185 0.061248974 CHS7 The seventh gene identified that is involved in chitin synthesis ; involved in Chs3p export from the ER YHR143W 1.273840915 0.344033007 1.053395568 0.043898363 Ser-Thr rich protein YHR143W-A 2.027108834 0.045258535 0.034372907 0.863404633 RPC10 subunit of RNA polymerase II YHR144C 1.566484148 0.204399121 -0.200260543 0.203614485 DCD1 dCMP deaminase YHR145C 0.372578731 0.344489224 0.120178946 0.078624647 questionable ORF YHR146W -0.29330386 0.050712166 -0.667000859 0.03149637 similarity to pheromone-response G-protein Mdg1p YHR147C 0.292750068 0.343685993 -0.13544817 0.19026596 MRPL6 Mitochondrial ribosomal protein MRPL6 (YmL6) YHR148W 1.10051973 0.026877946 -0.269970169 0.399239485 IMP3 ribosomal protein (weak similarity) YHR149C 0.584497301 0.102466938 0.023976948 0.789586532 similarity to hypothetical protein YGR221c YHR151C 0.169863702 0.519689018 0.238598494 0.205221745 hypothetical protein 20 kDa protein with negatively charged C-terminus required for function ; thought to be a positive regulator of exit from M-phase in mitosis and YHR152W -0.01883398 0.904353101 -0.195837058 0.425205464 SPO12 meiosis. Spo12p interacts with Dbf2p and Dbf20p protein kinases. YHR153C -0.16959163 0.496560982 0.231183174 0.004594551 SPO16 sporulation protein YHR154W 0.433065842 0.197242677 -0.170183052 0.572236021 ESC4 involved in silencing YHR155W -0.23049358 0.2660326 0.009450714 0.870607498 Snf1-interacting protein Sip3p YHR156C 0.612122357 0.38372208 -0.297845476 0.2448325 weak similarity to mouse kinesin KIF3B YHR157W -0.01648238 0.980415337 0.356562536 0.412953595 REC104 mRNA is induced early in meiosis YHR158C -0.19341009 0.586542104 -0.003894349 0.974714735 KEL1 involved in cell fusion and morphology ; contains six Kelch repeats YHR159W -0.64544645 0.002801864 -0.19090303 0.257023399 hypothetical protein YHR160C -0.44643654 0.316054456 0.206848452 0.219147546 PEX18 Peroxin Pex18p YHR161C -0.20135642 0.595362151 0.230473329 0.071370154 YAP1801 clathrin assembly protein YHR162W 1.298133308 0.029000323 0.242149655 0.035099721 strong similarity to hypothetical protein YGR243w YHR163W 1.262319154 0.306916372 0.251153613 0.108962714 SOL3 shows similarity to glucose-6-phosphate dehydrogenase non-catalytic domains ; homologous to Sol2p and Sol1p YHR166C -0.11002653 0.704471525 -0.289240226 0.13391981 CDC23 Cell division cycle protein YHR167W 0.441589925 0.256848447 -0.447390751 0.049732556 hypothetical protein YHR168W -0.54858136 0.041153137 -0.09395572 0.237406632 GTP-binding protein YHR169W 1.071023322 0.026341381 -0.052940909 0.73277128 DBP8 DEAD-box protein YHR170W 1.149229672 0.06563694 -0.274778166 0.185176879 NMD3 cytoplasmic factor required for a late cytoplasmic assembly step of the 60S subunit YHR171W -0.9865548 0.041410971 -0.156756234 0.104952879 APG7 similar to ubiquitin-activating enzymes, involved in autophagy YHR172W 0.565156624 0.207692328 0.315992596 0.151787532 SPC97 spindle pole body component, associates in a complex with Spc98p and Tub4p perhaps as part of the microtubule attachment site of the SBP YHR173C 0.395659129 0.332106741 0.64869922 0.049053595 YHR174W -0.09773865 0.81203759 0.38643507 0.161464467 ENO2 enolase YHR175W -0.10090145 0.708685104 0.335355267 0.118950333 CTR2 copper transporter YHR176W -0.93665307 0.05271515 -0.001520971 0.971887034 FMO Dimethylaniline monoxygenase YHR177W -0.10878464 0.735157407 0.113161025 0.189471322 hypothetical protein YHR178W -0.13233263 0.539553767 0.073912083 0.055042398 STB5 Zinc finger (6-Cys) YHR179W 1.21204097 0.05912328 0.142390634 0.233966001 OYE2 NAPDH dehydrogenase (old yellow enzyme), isoform 2 YHR180W -0.54804587 0.055290141 0.320387705 0.174835092 hypothetical protein YHR181W 0.520305948 0.024205744 0.68612666 0.044860772 similarity to mouse TEG-261 protein YHR182W -0.40614112 0.305893378 -0.036561851 0.822805533 hypothetical protein YHR183W 1.038341297 0.409122011 0.37344342 0.245342797 GND1 Phosphogluconate Dehydrogenase (Decarboxylating) YHR184W -1.70612433 0.001502293 -0.490917239 0.017619383 SSP1 involved in meiosis, nuclear division and spore formation YHR185C 0.166921392 0.800306594 0.120073277 0.502741733 ADY1 (putative) involved in meiosis YHR186C -0.24345021 0.164814702 0.013028668 0.851036889 similarity to C.elegans hypothetical protein C10C5.6 YHR187W 0.063654797 0.652567706 -0.190930922 0.084309329 IKI1 involved in sensitivity to pGKL killer toxin YHR188C -0.49831124 0.131344396 0.764773577 0.021780812 similarity to hypothetical C. elegans proteins F17c11.7 YHR189W -0.25221721 0.493684844 0.403145448 0.10232142 similarity to peptidyl-tRNA hydrolases YHR190W -0.10191439 0.618185574 0.220185479 0.054227583 ERG9 squalene synthetase YHR191C 0.526989588 0.007199883 0.273177293 0.007378805 CTF8 (putative) kinetochore protein YHR192W -0.03320415 0.689616679 -0.075368759 0.335939938 hypothetical protein YHR193C 0.64444792 0.042873528 0.297232313 0.099778173 EGD2 GAL4 enhancer protein, homolog of human alpha NAC subunit of the nascent-polypeptide-associated complex YHR194W -0.46188026 0.179817358 0.176756556 0.310017326 similarity to hypothetical protein YOR147w YHR195W -0.10231317 0.58444096 -0.436870368 0.040478026 NVJ1 Vac8p binding protein ; nucleus-vacuole junction YHR196W 0.899712809 0.196434291 -0.884708707 0.060006891 hypothetical protein YHR197W 0.889286837 0.110947379 -0.274387708 0.180804135 hypothetical protein YHR198C -0.65878703 0.004797093 0.104031701 0.386507865 strong similarity to hypothetical protein YHR199c YHR199C -0.11046916 0.789742707 0.376926074 0.033499469 strong similarity to hypothetical protein YHR198c YHR200W 0.052933961 0.738562943 0.276110534 0.295463438 RPN10 homolog of the mammalian S5a protein, component of 26S proteasome YHR201C 0.802711026 0.079264839 -0.049502495 0.692184354 PPX1 Cytosolic exopolyphosphatase YHR202W -1.26728247 0.005314423 0.072078089 0.188463507 similarity to S.pombe hypothetical protein SPAC17G6 YHR203C 1.426400066 0.003420178 0.455713295 0.040050033 RPS4B Ribosomal protein S4B (YS6) (rp5) (S7B) YHR204W 0.83568021 0.113108803 0.580345165 0.026553757 HTM1 degradation lectin YHR205W -0.34979531 0.392392328 0.353612158 0.220941105 SCH9 cAMP-dependent protein kinase homolog, suppressor of cdc25ts YHR206W 0.445342993 0.098329703 0.193416854 0.057927714 SKN7 transcription factor involved in oxidative stress response YHR207C 0.230093423 0.368648488 -0.48239663 0.171488573 weak similarity to YPL165c YHR208W 1.219136266 0.091252877 0.172069854 0.036984466 BAT1 branched-chain amino acid transaminase, highly similar to mammalian ECA39, which is regulated by the oncogene myc YHR209W 0.488329364 0.3400545 -0.262077561 0.039905244 putative methyltransferase YHR210C -0.10793441 0.63365572 -0.017744512 0.820329908 UDP-glucose-4-epimerase (GAL10, galE) YHR211W -0.39892233 0.343156205 0.61032881 0.134690503 FLO5 Flocculin, similar to flocculation protein Flo1p YHR212C 0.401484347 0.393313373 -0.193979962 0.411995133 identical with hypothetical protein YAR060c YHR213W 0.133670902 0.508405928 0.364254039 0.268759284 putative pseudogene YHR214C-C 1.025116718 0.200272452 0.490696775 0.029564393 TyA gag protein. Gag processing produces capsid proteins. YHR214W 0.5392961 0.322789773 0.515055442 0.09269564 identical to YAR066w hypothetical protein, similarity to Sta1p YHR214W-A 0.223120952 0.476039421 0.772410171 0.106047437 strong similarity to hypothetical protein YAR068w YHR215W -0.55718205 0.292696166 0.491153679 0.138003756 PHO12 Acid phosphatase, nearly identical to Pho11p YHR216W 0.820397275 0.094455733 0.054133861 0.690255067 IMD2 IMP dehydrogenase ; probable PUR5 gene YHR217C -0.00505134 0.989208831 0.74024248 0.006702785 strong similarity to subtelomeric encoded YDR544c YHR218W -0.97151712 0.021241896 0.397253915 0.256384155 strong similarity to subtelomeric encoded proteins /gene in Y' repeat region YHR219W -1.1512685 0.016474946 0.441073979 0.156187602 strong similarity to other subtelomeric encoded proteins YIL001W -0.09160555 0.673382508 0.075883051 0.153053555 similarity to S.pombe hypothetical protein, weak similarity to human ankyrin YIL002C 0.216905266 0.614172566 -0.107933116 0.063512218 INP51 phosphatidylinositol 4,5-bisphosphate 5-phosphatase YIL003W -0.13517256 0.373316219 -0.096642683 0.217327519 strong similarity to Nbp35p and human nucleotide-binding protein YIL004C 0.417493426 0.038146388 -0.04701578 0.485994482 BET1 involved in ER-Golgi transport YIL005W -0.009214 0.970204909 0.220948032 0.221412247 similarity to protein disulfide isomerases YIL006W -0.42056772 0.343622299 0.648233692 0.086907398 similarity to Flx1p YIL007C -0.29258931 0.082183337 -0.022994642 0.767619607 similarity to C.elegans hypothetical protein YIL008W 1.503221928 0.109604288 -0.157022249 0.623349975 URM1 ubiquitin related modifier YIL009C-A -0.07209557 0.541527057 0.272867235 0.102120249 EST3 181aa protein - 20.5 kD YIL009W -0.68262418 0.057182335 0.032295888 0.561233369 FAA3 Acyl CoA synthase YIL010W -0.35570308 0.02731422 0.045339424 0.697402541 DOT5 involved in telomeric silencing YIL011W 1.064165148 0.174296051 0.330089098 0.333459752 strong similarity to members of the Srp1p/Tip1p family YIL012W -0.62157446 0.089298272 1.137185686 0.417861958 hypothetical protein YIL013C -0.22309105 0.018103151 0.515075812 0.075017314 PDR11 Putative member of the ABC family of membrane transporters YIL014W 0.180717919 0.420730504 -0.082273187 0.285228026 MNT3 alpha-1,3-mannosyltransferase YIL015C-A -0.52734748 0.110547586 0.186216821 0.486660799 YIL016W -0.08189779 0.765268414 -0.072442021 0.484504346 SNL1 18.3 kD integral membrane protein YIL017C -0.95728696 0.00991492 0.309775995 0.143451376 VID28 vacuole import and degradation YIL018W 2.978587365 0.194555902 0.507191111 0.161837926 RPL2B Ribosomal protein L2B (L5B) (rp8) (YL6) YIL019W 0.365084504 0.563447405 -0.726673622 0.047063315 weak similarity to S.pombe hypothetical protein SPAC3F10 YIL020C 0.507458006 0.158607466 0.131135898 0.032119514 HIS6 phosphoribosyl-5-amino-1-phosphoribosyl-4-imidazolecarboxiamide isomerase YIL021W 0.37473562 0.094761099 -0.24503253 0.188496848 RPB3 45 kDa subunit of RNA polymerase II YIL022W 0.321725728 0.422791035 0.102583907 0.49877391 TIM44 48.8 kDa protein involved in mitochondrial protein import YIL023C 0.657581748 0.033591145 0.407268041 0.066475592 similarity to mouse MHC H-2K/t-w5-linked ORF precursor YIL024C -1.47183789 0.006904432 0.597774602 0.149837655 hypothetical protein YIL025C -0.28734184 0.607419172 0.097648544 0.841360747 weak similarity to E.gracilis RNA polymerase subunit YIL026C 0.079762062 0.677406151 -0.211784831 0.106556966 IRR1 Irregular//essential protein YIL027C 0.535676333 0.284133926 -0.174712082 0.317328666 hypothetical protein YIL028W -0.06030142 0.913912323 0.008594349 0.976775911 hypothetical protein YIL029C -0.26283521 0.24382912 -0.364091086 0.022936136 YIL031W -0.47818984 0.132074531 -0.213563506 0.157902702 ULP2 Smt3p-specific protease, degrades conjugated ubiquitin-like protein Smt3p YIL032C 0.104453996 0.784218652 -0.193229339 0.006721346 hypothetical protein YIL033C -0.8888344 0.006188575 0.402662481 0.222131195 BCY1 regulatory subunit of cAMP-dependent protein kinase YIL034C -0.27523524 0.008340894 0.662014564 0.054747832 CAP2 beta subunit of capping protein YIL035C 0.795058141 0.024517162 -0.491832062 0.077338642 CKA1 alpha subunit of casein kinase II YIL036W -0.46758394 0.026899964 0.228915995 0.048803033 CST6 omosome STability YIL037C -0.21928666 0.267181985 0.085190283 0.586339372 PRM2 pheromone-regulated membrane protein YIL038C -0.01231968 0.962751811 -0.462448882 0.089251299 NOT3 CCR4 trascriptional complex component YIL039W -0.24388481 0.54394423 0.296573407 0.109410433 hypothetical protein YIL040W 1.57923939 0.15359519 0.845833391 0.017631627 weak similarity to T.brucei NADH dehydrogenase YIL041W -0.05740829 0.790704385 0.527544501 0.068299482 similarity to S.pombe hypothetical protein YIL042C -0.74856486 0.085638333 0.349160592 0.242207012 similarity to rat branched-chain alpha-ketoacid dehydrogenase kinase YIL043C 0.146635478 0.243741968 0.444139975 0.042153734 CBR1 cytochrome b reductase YIL044C 0.375135001 0.44209613 -0.159926883 0.40538758 AGE2 ARF GAP with effector function(s) YIL045W -2.14883841 0.001395234 -0.477118562 0.030036605 PIG2 Protein with 30 % identity to protein corresponding to YER054 YIL046W -0.89447966 0.030549911 0.25300586 0.321801754 MET30 Met30p contains five copies of WD40 motif and interacts with and regulates Met4p YIL047C 0.05393996 0.352422675 0.537037953 0.047984161 SYG1 plasma membrane protein YIL048W 0.191602792 0.294666605 0.137810603 0.134065562 NEO1 P-Type ATPase YIL049W 0.656603842 0.13863485 0.577686739 0.108509341 DFG10 involved in filamentous growth YIL050W -0.62671141 0.052497278 0.062650935 0.135706755 PCL7 PHO85 cyclin YIL051C 0.392512902 0.062559692 0.776044876 0.045849346 MMD1 Maintenance of Mitochondrial DNA 1 YIL052C 1.135289748 0.044008456 0.35202333 0.146665611 RPL34B Ribosomal protein L34B YIL053W 0.829574508 0.101822061 0.033085833 0.88166581 RHR2 DL-glycerol-3-phosphatase YIL054W -0.34314481 0.514199581 0.670285915 0.551443934 weak similarity to fruit fly NADH dehydrogenase YIL055C -0.7953206 0.093870175 0.348430803 0.258182438 hypothetical protein YIL057C -0.45630569 0.359882424 0.1260716 0.422649731 strong similarity to YER067w YIL058W -0.15784162 0.630258117 0.283257275 0.07749864 hypothetical protein YIL059C -1.01642298 0.007585394 0.179668494 0.066584901 hypothetical protein YIL060W -0.14232829 0.570195751 0.060180052 0.590928297 questionable ORF YIL061C 0.104021078 0.705839133 0.243085237 0.219642015 SNP1 U1snRNP 70K protein homolog YIL062C -0.18386936 0.406449306 0.369171539 0.027763816 ARC15 ARP2 /3 complex component YIL063C -0.20466469 0.378448935 -0.63945988 0.156977128 YRB2 nuclear protein, interacts with Gsp1p and Crm1p YIL064W -0.40489333 0.208185933 0.064589705 0.496770016 putative methyltransferase YIL065C -0.71229279 0.036194177 0.144161277 0.158889403 FIS1 mitochondrial fission YIL066C -0.7769214 0.113459848 0.389666668 0.070885608 RNR3 Ribonucleotide reductase (ribonucleoside-diphosphate reductase) large subunit YIL067C 0.387900958 0.355194717 0.11608919 0.309875893 hypothetical protein 88 kD component of the Exocyst complex, which contains the gene products encoded by SEC3, SEC5, SEC6, SEC8, SEC10, SEC15 and YIL068C -0.14312897 0.048530054 -0.619414513 0.034908361 SEC6 EXO70 YIL069C 1.146720758 0.044086876 -0.070902167 0.675752713 RPS24B 40S ribosomal protein S24B YIL070C 0.7474478 0.150008052 -0.131640019 0.217439817 MAM33 Mitochondrial protein involved in respiration YIL072W -0.93432663 0.006438583 0.223829037 0.439788909 HOP1 DNA binding protein YIL073C -0.07103993 0.734230144 -0.041316668 0.812464831 SPO22 meiosis-specific phospholipase A2 homolog YIL074C -0.10118791 0.672165896 0.056414171 0.180743273 SER33 3-phosphoglycerate dehydrogenase YIL075C 0.335898048 0.210415146 -0.123071298 0.166030805 RPN2 RPN2p is a component of the 26S proteosome YIL076W 0.533368933 0.44998696 -0.427882379 0.13967927 SEC28 epsilon-COP coatomer subunit Sec28p YIL077C -0.57725151 0.060554411 0.010967974 0.908212038 hypothetical protein YIL078W 0.872746115 0.053601611 -0.233308757 0.165740371 THS1 Threonyl-tRNA synthetase, cytoplasmic YIL079C 1.642098321 0.234191627 -0.516342137 0.096996009 strong similarity to hypothetical protein YDL175c Ty3B Gag-Pol protein. Gag processing produces capsid proteins. Pol is cleaved to produce protease, reverse transcriptase and integrase YIL080W -0.18904764 0.718836182 0.042235352 0.83171438 activities. YIL082W -0.31473501 0.156976617 0.03388795 0.829234936 TY3A protein YIL083C -0.73045057 0.007137924 -0.060480044 0.546384977 hypothetical protein YIL084C -0.11786036 0.767712681 0.117091205 0.342522391 SDS3 Functions are similar to those of SIN3 and RPD3/(putative) transcriptional regulator YIL085C -0.68578997 0.009924702 -0.066727987 0.478416763 KTR7 (putative) mannosyltransferase YIL086C -0.35990359 0.359428625 0.28163798 0.388132575 hypothetical protein YIL087C -0.95582344 0.026860307 0.941411462 0.122407896 hypothetical protein YIL088C 0.011628331 0.984335157 0.144612195 0.385662238 similar to amino acid transport proteins YIL089W -1.03223128 0.00161743 -0.095838044 0.495466297 similarity to hypothetical protein YLR036c YIL090W -0.25265757 0.345146238 0.111303049 0.164228963 similarity to hypothetical S. pombe protein YIL091C 0.952844868 0.012734456 -0.587183716 0.060538025 weak similarity to spt5p YIL092W 0.457547672 0.056134011 -0.364426032 0.01013772 hypothetical protein YIL093C 0.308817303 0.223126172 -0.045758193 0.137822968 RSM25 protein of the small subunit of the mitochondrial ribosome YIL094C 3.01154943 0.233079348 -0.330494911 0.032889955 LYS12 Homo-isocitrate dehydrogenase YIL095W 0.991069255 0.122252277 -0.03908687 0.615700752 PRK1 probable serine /threonine-protein kinase YIL096C 0.350053859 0.421074918 -0.794879392 0.045877958 hypothetical protein YIL097W -1.00693506 0.004216961 -0.61968221 0.037443579 hypothetical protein YIL098C -0.00269308 0.986769775 -0.609444217 0.078544153 FMC1 Formation of Mitochondrial Cytochromes 1 YIL099W -0.83453916 0.017299127 0.056309722 0.679124453 SGA1 intracellular glucoamylase YIL100W 0.279275753 0.424971528 0.524041605 0.091460614 similarity to mouse Gcap1 protein and fruit fly Bkm-like sex-determining region hypothetical YIL101C -0.71155455 0.218567243 0.461411213 0.119611025 XBP1 transcriptional repressor YIL102C 0.47934189 0.178626794 0.139095502 0.276765443 strong similarity to YIL014c-a YIL103W 0.525849445 0.221349187 -0.23143496 0.085844787 weak similarity to Dph2 protein YIL104C 0.423386507 0.036063909 -0.51538229 0.068132026 similarity to hypothetical S. pombe protein YIL105C -0.22638526 0.434311443 -0.370811269 0.026982314 weak similarity to probable transcription factor Ask10p YIL106W 0.678201223 0.029279814 0.205400858 0.428318923 MOB1 required for completion of mitosis and maintenance of ploidy /(putative) transcriptional regulator involved in mitosis YIL107C -0.78055 0.008997496 -0.333213644 0.147691874 PFK26 6-Phosphofructose-2-kinase YIL108W 0.121721916 0.491115493 0.346934239 0.066433743 similarity to hypothetical S. pombe protein YIL109C 0.225821452 0.679128241 0.464963928 0.006775498 SEC24 vesicle coat component YIL110W 0.201982042 0.603798713 -0.361079728 0.174167305 weak similarity to hypothetical C.elegans protein YIL111W 0.633350526 0.501976381 0.005507092 0.952886892 COX5B Cytochrome-c oxidase chain Vb YIL113W -1.38486426 0.004289748 -0.055777469 0.769007829 strong similarity to dual-specificity phosphatase Msg5p YIL114C 0.912503634 0.135480833 0.404241521 0.138673789 POR2 voltage dependent anion channel (YVDAC2) YIL115C -0.34718902 0.247472894 0.504168517 0.01499191 NUP159 159-kDa nucleoporin with coiled-coil domain and repeated motifs typical of nucleoporins YIL116W 0.187514462 0.674545131 -0.277233319 0.033555323 HIS5 histidinol-phosphate aminotransferase YIL117C 1.516940798 0.101375043 0.024926305 0.713797972 PRM5 hydrophobic transmembrane domain YIL118W 1.630968052 0.311394613 -0.22242045 0.274533916 RHO3 ras homolog--GTP binding protein YIL119C -1.24456463 0.048925774 -0.215637091 0.218553701 RPI1 inhibitor of ras YIL120W -1.56654126 0.002770402 -0.164024484 0.106609859 QDR1 MFS-MDR transporter YIL121W -0.00428032 0.977260137 0.363198331 0.045896467 similarity to antibiotic resistance proteins YIL122W -0.22022657 0.502705613 -0.036221751 0.795080178 similarity to antibiotic resistance proteins YIL123W 1.2710086 0.090769252 0.699773202 0.142491472 SIM1 (putative) invovled in control of DNA replication YIL124W -1.32666417 0.012304222 0.118509643 0.501518912 AYR1 1-Acyl dihydroxyacetone phosphate reductase YIL125W -1.35271825 0.004771046 0.375908348 0.171727046 KGD1 alpha-ketoglutarate dehydrogenase YIL127C 1.213314274 0.130083755 -0.723337855 0.096055624 weak similarity to Smy2p YIL128W 0.141887024 0.215537607 -0.149046895 0.195491511 MET18 regulator of TFIIH YIL131C 0.314151795 0.321259856 -0.095199964 0.630920249 FKH1 similarity to Drosophila fork head protein YIL132C 0.301458398 0.642493622 0.687817474 0.305285524 hypothetical protein YIL133C 1.094185355 0.015515901 0.329241219 0.020929948 RPL16A Ribosomal protein L16A (L21A) (rp22) (YL15) YIL134W 0.671914603 0.18595626 0.051956652 0.532000582 FLX1 mitochondrial inner membrane carrier protein for FAD YIL135C -0.21397154 0.464123132 0.556900759 0.097805567 similarity to Ymk1p YIL136W -1.81957216 0.006287962 -0.060663157 0.43986106 OM45 45-kDa mitochondrial outer membrane protein YIL137C -0.67189853 0.133407013 0.406151013 0.006377825 similarity to M.musculus aminopeptidase YIL138C 0.304733749 0.688703052 -1.020463738 0.011617351 TPM2 Tropomyosin isoform 2 YIL139C -0.22339426 0.324760866 -0.614911729 0.008093686 REV7 subunit of DNA polymerase-zeta (Pol-zeta), an enzyme whose sole function appears to be translesion synthesis YIL140W 1.747844295 0.066504228 0.64613776 0.185687898 AXL2 localizes to the plasma membrane YIL141W 1.197171674 0.09845512 0.525965435 0.223980348 questionable ORF YIL142W 0.667109452 0.172211264 0.366350601 0.127315837 CCT2 molecular chaperone YIL143C -0.09025988 0.604993148 -0.076993423 0.028109726 SSL2 DNA helicase homolog ; homolog of human XPBC, ERCC3 YIL144W 0.179428483 0.133567324 -0.814318943 0.042024179 TID3 Dmc1p interacting protein YIL145C 0.364074042 0.03246804 0.151606076 0.010242307 similarity to E.coli pantothenate synthetase YIL146C -1.2181541 0.004935778 0.027172842 0.76640703 ECM37 (putative) involved in cell wall biogenesis YIL149C 0.845436256 0.0682367 -0.428962907 0.045532108 MLP2 colied-coil protein (putative), similar to myosin and TPR YIL150C 0.108193507 0.642209734 -0.115366506 0.167387088 DNA43 (putative) involved in DNA replication YIL151C -0.38543849 0.078948777 -0.017097204 0.868237288 similarity to mitochondrial aldehyde dehydrogenase Ald1p YIL152W -0.29441563 0.178204527 0.173469074 0.004380275 hypothetical protein YIL153W -0.18469247 0.643742147 0.218527938 0.360592048 RRD1 Resistant to Rapamycin Deletion YIL154C 0.00685458 0.975494534 0.165754479 0.654403423 IMP2' transcription factor YIL155C -1.48882 0.008626493 0.456554154 0.085452526 GUT2 glycerol-3-phosphate dehydrogenase, mitochondrial YIL156W -0.7329803 0.036774182 0.200903459 0.382964222 UBP7 Ubiquitin-specific protease YIL157C 0.388819748 0.25816604 0.101496801 0.25704905 identified by SAGE expression analysis YIL158W 1.191930699 0.150059973 0.088574221 0.714964311 similarity to hypothetical protein YKR100c YIL159W -0.01157307 0.943965221 -0.055205391 0.830222974 BNR1 involved in actin filament organization YIL160C -0.79486803 0.210981007 0.432490744 0.240313753 POT1 peroxisomal 3-oxoacyl CoA thiolase YIL161W 0.512315747 0.073225422 -0.66291942 0.087927376 hypothetical protein YIL162W -1.08807063 0.012858199 0.246809872 0.092944469 SUC2 invertase (sucrose hydrolyzing enzyme) YIL163C -0.15042267 0.788899474 0.554037248 0.180449113 questionable ORF YIL164C 0.647161707 0.54740727 -0.163427552 0.145142981 NIT1 nitrilase YIL165C 1.073039522 0.384520837 0.222326888 0.353569934 putative pseudogene YIL166C -0.02919736 0.929191679 0.035971753 0.476785226 similarity to allantoate permease Dal5p YIL167W -0.15843803 0.660513267 -0.608026203 0.009096417 SDL1 serine dehydratase YIL168W -0.09092528 0.603457041 -0.073402226 0.765782405 SDL1 L-serine dehydratase YIL170W -0.95345352 0.023312834 0.393807286 0.300195604 HXT12 hexose permease YIL171W -0.18245219 0.523793688 0.518047926 0.255157617 HXT12 hexose permease YIL172C -1.35332777 0.005467206 -0.043264041 0.342901546 putative alpha glucosidase YIL173W 0.619774167 0.188374389 0.318155161 0.12910954 VTH1 potential membrane glycoprotein with strong similarity to Vth2 and Pep1 /Vps10 YIL174W -0.46645481 0.222167691 0.175861892 0.554220257 strong similarity to subtelomeric encoded proteins YIL175W -0.60386905 0.085415673 0.200205238 0.483513883 strong similarity to subtelomeric encoded proteins YIL176C -0.17742989 0.329223104 0.922850732 0.197739729 strong similarity to members of the Srp1p/Tip1p family YIR001C -0.18817803 0.041862692 -0.151161549 0.231137278 SGN1 Contains one RNA recognition (RRM) domain YIR002C -0.03016125 0.448496418 -0.401096038 0.010992559 MPH1 Mutator PHenotype ; Similar to ATP-dependent RNA helicases YIR003W -0.67893828 0.101841296 -0.280221623 0.273200418 weak similarity to mammalian neurofilament triplet H proteins YIR004W 0.466530259 0.225810731 -0.689953563 0.055944257 DJP1 involved in peroxisome biogenesis YIR005W -0.44489071 0.03834615 -0.912755582 0.039362456 IST3 similarity to RNA-binding proteins YIR007W -0.18404978 0.426107601 0.504928242 0.1820264 hypothetical protein YIR008C -0.00023744 0.999054932 -0.159501298 0.172093617 PRI1 p48 polypeptide of DNA primase YIR009W 0.607059162 0.054314767 0.0764621 0.802061076 MSL1 encodes YU2B, a component of yeast U2 snRNP YIR010W -0.19829331 0.3810131 -0.82561633 0.153739486 hypothetical protein YIR011C 0.744415504 0.008527846 -0.489595303 0.057582501 STS1 (putative) involved in control rRNA stability and protein transport YIR012W 1.857604084 0.134842258 -0.029324245 0.521243634 SQT1 contains multiple WD repeats and interacts with Qsr1p in two hybrid YIR013C -0.28339705 0.376788224 0.08880927 0.70361908 GAT4 very short and so far mRNA can't be detected YIR014W -0.90250004 0.02087956 -0.038420201 0.822649841 hypothetical protein YIR015W -0.14372826 0.770216971 0.22147769 0.402499568 RPR2 an integral subunit of RNase P but not RNase MRP YIR016W -0.95807034 0.011739989 0.422492836 0.398167002 weak similarity to YOL036w YIR017C -1.13956598 0.011237914 -0.108940563 0.184020006 MET28 transcriptional activator in the Cbf1p-Met4p-Met28p complex YIR018W -0.66381875 0.044497635 -0.005519473 0.94586291 YAP5 bZIP transcription factor YIR019C -0.14895823 0.674664293 0.997563654 0.044401356 MUC1 cell surface flocculin with structure similar to serine /threonine-rich GPI-anchored cell wall proteins YIR020C -0.84619489 0.024618852 0.449515198 0.238695179 hypothetical protein YIR021W 0.941688963 0.160787558 0.202251409 0.088498555 MRS1 mitochondrial RNA splicing YIR022W 0.432585353 0.047712877 0.417169917 0.050341754 SEC11 signal peptidase subunit YIR024C -0.16337098 0.618675063 -0.536183208 0.063264647 GIF1 (putative) involved in cell cycle control YIR025W -0.23491922 0.046811133 -0.109305824 0.521714492 hypothetical protein YIR026C 0.215410563 0.38469696 0.149715476 0.211536759 YVH1 nitrogen starvation-induced protein phosphatase YIR027C -0.7207958 0.178425973 0.29182961 0.013759536 DAL1 allantoinase YIR028W 0.115912662 0.802957301 0.160982931 0.520379069 DAL4 allantoin permease YIR029W -1.42219503 0.015620483 0.03705494 0.880731259 DAL2 allantoicase YIR030C -0.73104683 0.111679678 -0.47221861 0.049293707 DCG1 involved in nitrogen-catabolite metabolism YIR031C 0.903422622 0.535100925 -0.064357795 0.210286806 DAL7 Malate synthase 2 YIR032C -0.22076902 0.769578002 -0.037766984 0.838935783 DAL3 ureidoglycolate hydrolase YIR033W 0.608811868 0.186794166 -0.336126284 0.003249096 MGA2 may be involved in the remodeling chromatin structure YIR034C 4.251063246 0.195216284 0.510901494 0.132541784 LYS1 saccharopine dehydrogenase YIR035C 0.227704484 0.510663812 0.285782581 0.246611886 similarity to human corticosteroid 11-beta-dehydrogenase YIR036C -1.33757731 0.004258673 0.207345324 0.476502162 similarity to E.coli fabD YIR037W -1.09991182 0.003641536 0.442453544 0.188386072 HYR1 putative glutathione-peroxidase YIR038C -1.33525548 0.001507542 0.143023251 0.310028051 GTT1 Glutathione transferase YIR039C -0.78134911 0.059956416 0.106882839 0.522127631 YPS6 GPI-anchored aspartic protease YIR040C -0.71026221 0.096020525 0.135481416 0.480759488 strong similarity to subtelomeric encoded proteins YIR041W -0.31151923 0.110790615 0.5667012 0.028240598 similarity to members of the Srp1p/Tip1p family YIR042C -0.20542659 0.679170995 -0.71617391 0.000798361 weak similarity to B.licheniformi hypothetical protein P20 YIR043C -0.12918371 0.734926827 -0.213166333 0.313802586 strong similarity to family of COnserved Sequences COS YIR044C -0.10290154 0.81219307 0.081992648 0.542099952 strong similarity to family of COnserved Sequences COS YJL001W -0.02949041 0.90587783 -0.078201106 0.625860745 PRE3 Subunit of 20S proteasome YJL002C 0.735296874 0.280540166 0.666319541 0.101758278 OST1 64-kDa, alpha subunit of oligosaccharyltransferase complex ; homologous to mammalian ribophorin I YJL003W -0.22160675 0.238823886 -0.343683409 0.061279341 hypothetical protein YJL004C -0.09484277 0.491608377 -0.104505398 0.14927612 SYS1 Multicopy suppressor of ypt6 null mutation YJL006C -0.2082421 0.407495617 -0.181671328 0.229552098 CTK2 cyclin-like protein YJL007C -0.35654833 0.326950598 0.795578605 0.352319679 hypothetical protein YJL008C 0.389455301 0.178793397 -0.25125483 0.000514349 CCT8 Component of Chaperonin Containing T-complex subunit eight YJL009W 0.862530422 0.018033748 0.115909365 0.57115631 questionable ORF YJL010C 0.591406624 0.236781786 -0.494397726 0.071391862 weak similarity to C.elegans hypothetical protei ZK792.5 YJL011C 1.065633675 0.094651179 -0.333065417 0.162483737 weak similarity to chicken hypothetical protein YJL012C -0.38418281 0.560673419 -0.171215067 0.063939506 VTC4 polyphosphate synthetase (putative) YJL013C 0.323768838 0.122543013 -0.187692715 0.31655206 MAD3 spindle checkpoint complex subunit YJL014W 0.520967516 0.085221983 -0.122296449 0.093473542 CCT3 Cytoplasmic chaperonin subunit gamma YJL015C -0.41483993 0.020227539 0.374666887 0.314153478 questionable ORF YJL016W -0.6191085 0.032587254 0.110452221 0.609787021 weak similarity to hypothetical protein YNL278w and YLR187w YJL017W -0.66796477 0.031729448 -0.127998537 0.409049191 hypothetical protein YJL018W 0.022252911 0.925072395 0.33782487 0.040502915 questionable ORF YJL019W -0.16422617 0.694252774 -0.186538122 0.095664897 hypothetical protein YJL020C -1.08369838 0.01400947 0.075080582 0.258728548 similarity to P.falciparum glutamic acid-rich protein YJL022W -0.51727024 0.056366592 -0.002058405 0.989215536 questionable ORF YJL023C -0.4132773 0.280632097 -0.061325612 0.755620119 PET130 Nuclear gene encoding mitochondrial protein YJL024C 0.48062177 0.007748129 0.151262733 0.424022955 APS3 similar to Aps1p and mammalian small subunit (sigma-2 adaptin) of plasma membrane-associated clathrin assembly complex (AP-2) YJL025W 0.714167517 0.078394469 0.423103629 0.005423333 RRN7 member of yeast Pol I core factor (CF) also composed of Rrn11p, Rrn6p and TATA-binding protein YJL026W -0.47847276 0.10662536 0.543492237 0.160303541 RNR2 small subunit of ribonucleotide reductase YJL027C 0.200249844 0.659395685 0.597847829 0.412241979 hypothetical protein YJL028W 0.377432625 0.264666074 0.411291985 0.091169783 hypothetical protein YJL029C -0.02111419 0.747618548 0.104672432 0.518428028 VPS53 Vps53p is a hydrophilic protein that is peripherally associated with the late Golgi and forms a stable complex with Vps52p and Vps54p. YJL030W 0.092033147 0.804559144 -0.234675164 0.15600943 MAD2 spindle checkpoint complex subunit YJL031C 0.232029394 0.217041562 -0.720298355 0.022913908 BET4 Geranylgeranyltransferase Type II alpha subunit (PGGTase-II, alpha subunit) YJL032W 0.45457029 0.063300733 -0.252000045 0.005149723 questionable ORF YJL033W 0.477595382 0.207597439 -0.666317875 0.047958521 HCA4 putative RNA helicase YJL034W -0.58361615 0.140919055 0.060029871 0.720790229 KAR2 Homologue of mammalian BiP (GPR78) protein ; member of the HSP70 gene family YJL035C 0.616925081 0.293925517 -0.06031783 0.470437189 TAD2 tRNA-specific adenosine-34 deaminase subunit Tad2p YJL036W -0.26843652 0.114094945 -0.462049062 0.0209533 SNX4 Sorting NeXin YJL037W -0.86952447 0.063480579 0.242176028 0.512317479 strong similarity to hypothetical protein YJL038c YJL038C -0.16089034 0.588840437 0.505550241 0.3603331 strong similarity to hypothetical protein YJL037w YJL039C 0.013301016 0.938013586 -0.018088515 0.756736938 NUP192 large yeast nucleoporin YJL041W -0.28998946 0.179460904 0.233170519 0.219594726 NSP1 nuclear pore protein YJL042W -1.3054657 0.011000511 0.782416155 0.06299027 MHP1 Putative microtubule-associated protein (MAP) YJL043W -0.33244615 0.190412378 -0.094280437 0.470840627 similarity to hypothetical protein YKR015c YJL044C -0.37412457 0.069572339 -0.254549608 0.007651679 GYP6 GTPase-activating protein for Ypt6 YJL045W -0.72600801 0.179914258 0.024110435 0.900701261 strong similarity to succinate dehydrogenase flavoprotein YJL046W 0.317353578 0.175696541 0.10075472 0.530687083 similarity to E.coli lipoate-protein ligase A YJL047C -0.39602593 0.226897941 -0.279001232 0.006710743 RTT101 Regulator of Ty1 Transposition YJL048C -0.63843368 0.277413691 0.108175243 0.416022324 similarity to hypothetical protein YBR273c YJL049W -0.34200786 0.201016266 -1.091567962 0.02722376 hypothetical protein YJL050W 0.918190007 0.084112815 -0.389186482 0.15044737 MTR4 RNA helicase YJL051W -0.91850488 0.018503121 0.212560001 0.181831653 hypothetical protein YJL052W -0.91132411 0.005133797 0.658589263 0.233421705 TDH1 Glyceraldehyde-3-phosphate dehydrogenase 1 YJL053W -0.22142225 0.435965259 -0.181215628 0.344475603 PEP8 Vacuolar protein similar to mouse gene H58 YJL054W 0.383211678 0.191705349 -0.08190437 0.373815641 TIM54 Translocase for the insertion of proteins into the mitochondrial inner membrane. YJL055W 0.946653652 0.348357859 -0.054667157 0.321585604 similarity to R.fascians hypothetical protein 6 YJL056C -2.19939659 0.000100774 0.055985356 0.159779506 ZAP1 Metalloregulatory protein involved in zinc-responsive transcriptional regulation YJL057C -1.20237844 0.011439323 -0.250193604 0.146313521 IKS1 probable serine /threonine kinase YJL058C 0.65393938 0.007604514 -0.089498782 0.107674533 strong similarity to hypothetical protein YBR270c YJL059W -0.03925708 0.485232031 0.364344533 0.100937878 YHC3 Homolog of human CLN3 YJL060W -0.3831768 0.014650805 0.250352191 0.008897945 similarity to kynurenine aminotransferase and glutamine-phenylpyruvate transaminase YJL061W 0.297867423 0.180023136 -0.106601436 0.489633828 NUP82 82-kDa protein, with putative coiled-coil domain, has carboxy-terminal domain, containing heptad repeats, that binds Nsp1p ; nucleoporin YJL062W -0.23278587 0.346671281 0.804509909 0.082901167 LAS21 putative membrane protein, a member of the major facilitator super family YJL063C 0.26664135 0.376044709 0.151405447 0.327058468 MRPL8 Mitochondrial ribosomal protein MRPL8 (YmL8) (E. coli L17) YJL064W 0.166340231 0.207618303 0.243885248 0.071443748 hypothetical protein YJL065C 0.330462714 0.29351554 0.330719836 0.127843776 weak similarity to DNA-directed DNA polymerase II chain C YJL066C -0.36310733 0.396355385 0.178468264 0.262225394 hypothetical protein YJL067W -0.33764884 0.323716467 0.458087002 0.000167156 questionable ORF YJL068C -0.89939236 5.25072E-05 0.212761832 0.243231878 strong similarity to human esterase D YJL069C 1.506103839 0.050462898 -0.628091003 0.191222352 similarity to C.elegans hypothetical protein YJL070C -0.61364385 0.078759644 -0.278496821 0.048780935 similarity to AMP deaminases YJL071W 0.179897841 0.680553165 -0.223285971 0.039023283 ARG2 Acetylglutamate Synthase YJL072C 0.431288708 0.2790645 -0.073087049 0.56687045 hypothetical protein YJL074C 0.46620486 0.252696904 -0.265761047 0.233017831 SMC3 SMC chromosomal ATPase family member YJL075C 0.107255532 0.759593285 0.168630271 0.24568058 questionable ORF YJL076W -0.09694169 0.785005137 0.074367779 0.333827255 NET1 nucleolar protein involved in exit from mitosis YJL077C -0.33181354 0.362792386 0.157499847 0.43398006 ICS3 Increased Copper Sensitivity YJL078C 0.154116438 0.041624012 1.063668404 0.102357649 PRY3 Similar to plant PR-1 class of pathogen related proteins YJL079C -0.99013535 0.023860791 0.360504279 0.391336924 PRY1 Similar to plant PR-1 class of pathogen related proteins May be required during cell division for faithful partitioning of the ER-nuclear envelope membranes, involved in control of mitotic chromsome YJL080C 0.504637628 0.259446666 0.026516088 0.668985061 SCP160 transmission YJL081C -0.12636336 0.450582929 -0.119983037 0.458210081 ARP4 54.8 kDa actin-related protein YJL082W -0.53536161 0.00290892 0.147722958 0.39483318 IML2 Similar to Ykr018p YJL083W -0.32458606 0.329813996 0.309339369 0.064884493 similarity to hypothetical protein YKR019c YJL084C -0.28069523 0.506251191 0.397654831 0.036190973 similarity to hypothetical protein YKR021w YJL085W -0.43643914 0.048477104 -0.54695083 0.060222402 EXO70 70 kD component of the Exocyst complex ; required for exocytosis YJL086C -0.5005647 0.449046651 -0.022877845 0.833459754 questionable ORF YJL087C 0.436488888 0.179759056 -0.549746562 0.049756886 TRL1 tRNA ligase YJL088W 1.183406842 0.0116886 0.022363377 0.859308975 ARG3 Ornithine carbamoyltransferase YJL089W -0.67059191 0.140992604 -0.158407804 0.040772999 SIP4 shows homology to DNA binding domain of Gal4p, has a leucine zipper motif and acidic region ; lexA-Sip4p activates transcription YJL090C 0.13606119 0.477069687 -0.022728395 0.763492317 DPB11 DNA polymerase II complex YJL091C 0.096361374 0.753503923 0.31453532 0.238441455 weak similarity to human G protein-coupled receptor YJL092W 0.341290915 0.459349093 1.045108915 0.071560764 HPR5 DNA helicase YJL093C -0.11076251 0.755761378 0.013461854 0.879330013 TOK1 outward-rectifier potassium channel YJL094C -0.06343208 0.882036423 0.324156848 0.253269553 KHA1 K+/H+ exchanger YJL095W 0.337653883 0.597128064 0.367665638 0.072809549 BCK1 MEKK serine /threonine kinase YJL096W 0.565986909 0.102981957 -0.202965595 0.165209999 MRPL49 mitochondrial ribosomal protein of the large subunit YJL097W -0.08477293 0.77017544 0.51113566 0.136528549 similarity to hypothetical C. elegans protein T15B7.2 YJL098W 0.63389245 0.104246493 -0.647285667 0.02730682 SAP185 Sit4p-associated protein YJL099W 0.491837297 0.079104893 -0.299991873 0.116947698 CHS6 involved in chitin biosynthesis YJL100W -0.25488536 0.38620954 0.334245078 0.172898016 similarity to hypothetical C. elegans protein C56A3.8 YJL101C -1.07524575 0.020075446 0.006248708 0.942655563 GSH1 gamma-glutamylcysteine synthetase YJL102W -1.10226621 0.014695182 -0.205724023 0.185731642 MEF2 mitochondrial elongation factor G-like protein YJL103C -0.63942378 0.267141636 -0.005347288 0.941064297 putative regulatory protein YJL104W 0.730334996 0.078572377 -0.264631711 0.265096711 weak similarity to C.elegans hypothetical protein F45G2.c YJL105W -0.09888823 0.692863525 0.345250872 0.160893784 similarity to hypothetical protein YKR029c YJL106W 0.090808845 0.729942693 -0.078406983 0.432504471 IME2 Serine /Threonine protein kinase, positively regulated by IME1 YJL107C 0.987800132 0.037370084 -0.14412895 0.641942504 similarity to hypothetical S. pombe protein YJL108C 1.218563864 0.012002299 0.116712234 0.709043848 PRM10 Pheromone-regulated Membrane Protein YJL109C 0.555663697 0.138150684 0.282258736 0.007078574 weak similarity to ATPase Drs2p YJL110C -0.11653575 0.510590606 0.393466559 0.165829746 GZF3 GATA zinc finger protein 3 homologous to Dal80 in structure and function YJL111W 0.149230437 0.24948316 -0.166983446 0.030603957 CCT7 Component of Chaperonin Containing T-complex subunit seven YJL112W -0.85327379 0.021938309 -0.510803791 0.01894302 MDV1 Mitochondrial DiVision The TyB Gag-Pol protein. Gag processing produces capsid proteins. Pol is cleaved to produce protease, reverse transcriptase, and integrase YJL113W -0.73154087 0.0244113 -0.738300031 0.133029114 activities. YJL114W -0.64305895 0.161318198 -0.554210504 0.243023278 TyA gag protein. Gag processing produces capsid proteins. YJL115W 0.01189415 0.884302346 -0.071374127 0.648075835 ASF1 involved in silencing YJL116C -0.8212006 0.09262971 0.454684837 0.093684634 NCA3 involved in regulating expression of F0F1 ATPase subunits YJL117W -0.38147851 0.18604974 0.12317783 0.139131287 PHO86 Putative inorganic phosphate transporter YJL119C 0.285724479 0.29405693 0.550436155 0.19121747 questionable ORF YJL120W -0.09865841 0.72739488 0.252313267 0.455786016 questionable ORF YJL121C 0.364790487 0.562380038 0.645858934 0.132159485 RPE1 D-ribulose-5-Phosphate 3-epimerase YJL122W 1.145767617 0.024815539 0.068137898 0.208288559 weak similarity to dog-fish transition protein S2 YJL123C -0.31417115 0.045646928 -0.703749719 0.039927446 weak similarity to D.melanogaster troponin T and human nucleolin YJL124C 0.401534903 0.073790723 -0.078654318 0.727096122 LSM1 involved in mRNA stablity YJL125C 1.087072242 0.016326756 -0.017482459 0.940626298 GCD14 translational repressor of GCN4 YJL126W -0.42930364 0.005392038 -0.322267352 0.015669202 NIT2 nitrilase superfamily member YJL127C -0.13350118 0.618290342 -0.183355604 0.384848776 SPT10 negative transcriptional regulator YJL128C -0.28151571 0.113567495 0.115574948 0.067494363 PBS2 MAP kinase kinase (MEK), may act as a scaffolding protein for Sho1p, Ste11p, and Hog1p YJL129C -0.19977347 0.120447083 0.058023029 0.662226933 TRK1 180 kDa high affinity potassium transporter YJL131C -0.32621109 0.127997305 -0.374518998 0.096881264 weak similarity to nonepidermal Xenopus keratin, type I YJL132W -0.6959957 0.034541546 -0.264082393 0.237994887 weak similarity to human phospholipase D YJL133W 0.3968969 0.173123431 0.128474196 0.64623093 MRS3 mitochondrial carrier protein YJL134W 0.330535282 0.047234647 0.170787839 0.052810643 LCB3 putative plasma membrane transporter capable of transporting sphingoid long chain bases into cells YJL135W 0.003478217 0.989972349 -0.179808853 0.02119101 questionable ORF YJL136C 1.509979603 0.034059717 0.192101201 0.379496244 RPS21B Ribosomal protein S21B (S26B) (YS25) YJL137C -0.64499624 0.112490994 0.360906791 0.004262888 GLG2 glycogen synthesis initiator YJL138C 2.010440291 0.072335549 0.594122681 0.036604029 TIF2 translation initiation factor eIF4A YJL139C 0.311079341 0.436569653 0.185359543 0.560603847 YUR1 mannosyltransferase YJL140W -0.1981929 0.228229667 -0.203547993 0.312933857 RPB4 fourth-largest subunit of RNA polymerase II YJL141C -1.38700261 0.001063077 0.012790259 0.824194044 YAK1 Serine-threonine protein kinase YJL142C -0.77171431 0.024239236 0.82417608 0.002387846 questionable ORF YJL143W 1.109824772 0.085535186 0.792554249 0.056234836 TIM17 16.5 kDa inner membrane protein required for import of mitochondrial precursor proteins YJL144W -0.84468026 0.032901317 -0.016558276 0.910319534 hypothetical protein YJL145W 0.460828704 0.021613237 -0.085349488 0.049928213 weak similarity to T.pacificus retinal-binding protein YJL146W 0.116154393 0.770558761 0.120407693 0.350893675 IDS2 IME2-dependent signaling protein/(putative) involved in meiosis YJL147C 0.424098012 0.173143726 -0.25258675 0.230358035 weak similarity to C.elegans hypothetical protein C43G2.4 YJL148W 0.729518815 0.178859144 -0.991665188 0.057496254 RPA34 unshared RNA polymerase I subunit YJL149W 0.412291359 0.456979595 0.492437491 0.08203198 similarity to hypothetical protein YDR131c YJL150W -0.23951449 0.521652317 0.453699963 0.016414534 questionable ORF YJL151C 0.160102408 0.377871242 0.591647482 0.016507586 similarity to hypothetical protein YDL123w YJL152W 0.084282728 0.420265735 0.62523998 0.052805655 questionable ORF YJL153C 1.138862414 0.427654911 0.339732169 0.216227748 INO1 L-myo-inositol-1-phosphate synthase YJL154C -0.4072099 0.104844121 -0.084802936 0.457238409 VPS35 retromer complex component YJL155C -0.41079749 0.169673672 -0.028733741 0.867402378 FBP26 Fructose-2,6-biphosphatase YJL156C -0.34698012 0.010422901 0.032671809 0.662108725 SSY5 sensitive to sulfonylurea herbicides on complex media (YPD) YJL157C 0.688173016 0.00792884 0.066354458 0.5129597 FAR1 Cdc28p kinase inhibitor YJL158C 1.829422796 0.199445465 0.798960935 0.008671397 CIS3 Protein with homology to Hsp150p and Pir1p, Pir2p, and Pir3p YJL159W 0.908778252 0.036386499 0.765971074 0.050315803 HSP150 Heat shock protein, secretory glycoprotein YJL160C -0.04183662 0.817403649 -0.084884391 0.688699358 member of the Pir1p/Hsp150p/Pir3p family YJL161W -0.7696598 0.020373988 0.317177886 0.049327793 hypothetical protein YJL162C -0.03325211 0.879863098 -0.439270912 0.107285798 weak similarity to dnaJ proteins YJL163C -2.2277753 0.001250298 0.262220638 0.480179317 hypothetical protein YJL164C -1.22076587 0.009696841 0.137501246 0.18731737 TPK1 putative catalytic subunit of cAMP-dependent protein kinase YJL165C -0.26647788 0.365007952 -0.280426234 0.08952883 HAL5 (putative) protein kinase YJL166W -0.91824553 0.020056816 0.120496189 0.049868213 QCR8 Ubiquinol cytochrome-c reductase subunit 8 (11 kDa protein) YJL167W -0.14781752 0.645386679 0.024236514 0.689467313 ERG20 Farnesyl diphosphate synthetase (FPP synthetase) YJL168C 0.441177379 0.222800597 -0.498550996 0.064688937 SET2 transcription factor containing a SET domain YJL169W 0.388654109 0.300044813 0.227958244 0.237334639 questionable ORF YJL170C 0.051444113 0.837235847 0.25639326 0.145818536 ASG7 An a-specific gene that is induced to a higher expression level by alpha factor YJL171C 2.189295376 0.249663478 0.471459838 0.185342233 similarity to YBR162c YJL172W -0.92622568 0.008762831 0.865444812 0.047892604 CPS1 carboxypeptidase yscS YJL173C 0.547530204 0.009607251 0.406296253 0.019482591 RFA3 subunit 3 of replication factor-A YJL174W 0.804612516 0.184458055 0.503802921 0.018934261 KRE9 involved in beta-1,6-glucan assembly YJL175W -0.35684269 0.240638518 0.568209298 0.051992074 questionable ORF YJL176C -0.31112813 0.206893786 -0.180195827 0.278425354 SWI3 transcription factor YJL177W 1.348767919 0.002388861 0.282761947 0.074360115 RPL17B Ribosomal protein L17B (L20B) (YL17) YJL178C 0.606410697 0.033357829 0.275527103 0.154106607 hypothetical protein YJL179W 0.686416753 0.189752937 -0.532591986 0.176588302 PFD1 bovine prefoldin subunit 1 homolog (putative) YJL180C 0.218422014 0.381155592 -0.242467691 0.224088005 ATP12 (putative) involved F1F0-ATPase complex assembly YJL181W -0.23325344 0.614635065 -0.019913383 0.801291594 similarity to hypothetical protein YJR030c YJL182C 0.24188688 0.697920066 0.506764576 0.015495641 questionable ORF YJL183W -0.00513205 0.987602673 -0.10165023 0.399480541 MNN11 mannosyltransferase complex component YJL184W 0.747159193 0.015197391 0.128016472 0.173194098 hypothetical protein YJL185C -0.72572333 0.106258531 0.44736525 0.077033231 hypothetical protein YJL186W 0.83700361 0.009929443 0.507855252 0.007101279 MNN5 putative Golgi alpha-1,2-mannosyltransferase YJL187C -0.02264405 0.940444024 -0.016091525 0.791202849 SWE1 protein kinase homolog YJL188C 1.256255662 0.124313488 -0.278099842 0.329494572 protein kinase homolog//ser/tyr dual-specifity protein kinase YJL189W 1.383478986 0.097065658 -0.471087861 0.165259003 RPL39 Ribosomal protein L39 (L46) (YL40) YJL190C 2.572114824 0.090893172 0.523757623 0.005975725 RPS22A Ribosomal protein S22A (S24A) (rp50) (YS22) YJL191W 0.540641251 0.003421781 0.505068838 0.081178073 RPS14B Ribosomal protein S14B (rp59B) YJL192C 0.735249837 0.015546007 0.239382697 0.041979259 hypothetical protein YJL193W 1.24852081 0.174219252 0.618022137 0.040032084 similarity to Sly41p YJL194W 0.798681159 0.415628705 0.042386023 0.778515775 CDC6 pre-initiation complex component YJL195C 0.062560603 0.780334447 0.026742639 0.9180071 questionable ORF YJL196C 0.410981952 0.023600336 0.472359434 0.135307491 ELO1 Elongation enzyme 1 YJL197W -0.23624313 0.526349126 -0.130405522 0.280405354 UBP12 ubiquitin carboxyl-terminal hydrolase YJL198W 1.09232701 0.171736231 0.187527504 0.114255228 hypothetical protein YJL199C -0.37676142 0.001414447 -0.03365596 0.582726895 strong similarity to aconitate hydratase YJL200C 1.353397838 0.224335889 -0.254803714 0.055143699 ExtraCellular Mutant//involved in cell wall biogenesis and architecture YJL201W 0.259012812 0.346923747 0.274130002 0.101311986 ECM25 (putative) involved in cell wall biogenesis YJL202C 0.05006812 0.876880913 -0.54412642 0.127165718 questionable ORF YJL203W -0.12976813 0.144956258 -0.618772055 0.017741979 PRP21 RNA splicing factor YJL204C 0.436951533 0.234949765 -0.156568464 0.575848396 weak similarity to Tor2p YJL205C-A 0.065172237 0.780574737 0.734140854 0.046973899 NCE101 (putative) ubiquitin-protein ligase YJL208C 1.247755412 0.004479283 -0.071770765 0.483405948 NUC1 mitochondrial nuclease YJL209W 0.909911416 0.129467835 -0.370561964 0.068076235 CBP1 involved in control of mRNA stablility YJL210W 0.054652077 0.462023336 0.451260936 0.102696797 PEX2 CH3HC4 zinc-binding integral peroxisomal membrane protein YJL211C 0.033478407 0.842093633 0.526142945 0.105776753 questionable ORF YJL212C 0.458621974 0.606385924 0.833498675 0.027397557 OPT1 Oligopeptide transporter ; Opt1p transports tetra- and pentapeptides, including the endogenous opioid pentapeptide leucine enkephalin. YJL213W 2.508932437 0.110248499 -0.198654361 0.408612398 similarity to Methanobacterium aryldialkylphosphatase related protein YJL214W -0.47720149 0.209147957 0.657832739 0.00410577 HXT8 hexose permease YJL215C -0.38866014 0.18460127 -0.092321823 0.856955934 hypothetical protein YJL216C -1.05094538 0.048410979 -0.074810625 0.573779744 strong similarity to Mal62p YJL217W -0.87464825 0.069433187 0.079786721 0.559755874 hypothetical protein YJL218W -1.34622599 0.039218167 -0.105280755 0.177678048 strong similarity to E.coli galactoside O-acetyltransferase YJL219W -0.86220352 0.020118599 0.59549086 0.21057301 HXT9 hexose permease YJL221C -1.1438192 0.010954006 -0.05911246 0.751665287 FSP2 homology to maltase(alpha-D-glucosidase) YJL222W 0.750774902 0.17350071 0.055362528 0.676751427 VTH2 potential membrane glycoprotein with strong similarity to Vth1 and Pep1 YJL223C 0.10499675 0.772290124 0.566157581 0.197824343 PAU1 member of the seripauperin protein /gene family (see Gene_class PAU) YJR001W -0.05837176 0.713667081 0.293335009 0.103081286 weak similarity to A.thaliana aminoacid permease AAP4 YJR002W 0.261375868 0.129047235 -0.629244335 0.048576288 MPP10 U3 snoRNP protein YJR003C 0.75912097 0.071589805 -0.298274466 0.156675684 hypothetical protein YJR004C 0.147686465 0.644309225 0.538179112 0.15052276 SAG1 alpha-agglutinin YJR005W 0.067702618 0.733009287 -0.072430895 0.498157047 APL1 beta-adaptin, large subunit of the clathrin-associated protein complex YJR006W 0.29919936 0.261996177 -0.054627782 0.74930127 HYS2 DNA polymerase delta 55 KD subunit YJR007W 0.635276308 0.011136429 0.157234079 0.153311494 SUI2 Translation initiation factor eIF-2 alpha subunit YJR008W -0.93035639 0.082092443 -0.205962302 0.081814681 similarity to S.pombe hypothetical protein YJR009C 0.921700878 0.183301533 0.852468021 0.119271378 TDH2 glyceraldehyde 3-phosphate dehydrogenase YJR010C-A 0.047158907 0.744171957 -0.046796464 0.821652939 SPC1 signal peptidase subunit YJR010W 0.038880623 0.906941258 0.320450287 0.023939853 MET3 ATP sulfurylase YJR011C -0.13803529 0.753459071 -0.813992662 0.006718816 hypothetical protein YJR012C -0.07990179 0.799600225 -0.088156305 0.066910482 hypothetical protein YJR013W 0.267895483 0.171296074 0.386052367 0.019021242 similarity to C.elegans B0491.1 protein YJR014W 0.075762007 0.592038441 -0.368674003 0.105575279 strong similarity to S.pombe hypothetical protein SPBC16C6.05 YJR015W -0.4047907 0.025751853 0.393826962 0.147066664 strong similarity to Sng1p YJR016C -0.1162245 0.350013585 0.161160376 0.392431991 ILV3 dihydroxyacid dehydratase YJR017C -0.12773808 0.725564541 0.058431362 0.618671519 ESS1 Peptidyl-prolyl cis /trans isomerase (PPIase) YJR018W -0.11838427 0.624690823 0.382717855 0.106123683 questionable ORF YJR019C -1.18159735 0.017580148 0.195190468 0.28241051 TES1 peroxisomal acyl-CoA thioesterase YJR020W -0.665322 0.268673624 0.398408819 0.170955513 questionable ORF YJR021C -0.79840261 0.026943952 0.117247356 0.630276243 REC107 ds break formation complex subunit YJR022W 0.175029724 0.754661923 -0.504526231 0.026608137 LSM8 Sm-like protein YJR024C -0.22168254 0.3964084 0.294872385 0.262305474 weak similarity to C.elegans Z49131_E ZC373.5 protein YJR025C 0.121637821 0.705185613 -0.012039208 0.92770278 BNA1 3-hydroxyanthranilic acid dioxygenase YJR026W 1.261299003 0.139798611 0.470896 0.033972063 TY1A TY1A protein YJR028W 1.279560856 0.063820786 0.476744268 0.013957566 TY1A TY1A protein YJR029W 1.459544328 0.077088521 0.451375246 0.009995415 TY1B TY1B protein YJR030C 0.017105539 0.916338821 0.006318004 0.912958296 similarity to hypothetical protein YJL181w YJR031C -0.07635733 0.018737532 -0.167817215 0.372571115 GEA1 GDP /GTP exchange factor YJR032W 0.824708291 0.176084738 -0.509843014 0.055112426 CPR7 peptidyl-prolyl cis /trans isomerase YJR033C -0.7757196 0.045077808 0.018434855 0.840727437 RAV1 Regulator of (H+)-ATPase in vacuolar membrane YJR034W 0.069306443 0.554750609 -0.264857886 0.168662923 PET191 involved in cytochrome c oxidase assembly YJR035W -0.39821739 0.215625477 -0.289926618 0.17234336 RAD26 DNA-dependent ATPase, homologous to human Cockayne syndrome B gene ERCC6 YJR036C -1.04732691 0.037424176 -0.182114295 0.276135113 HUL4 ubiquitin-protein ligase (E3) YJR037W -0.24981416 0.557781669 0.153442307 0.247094085 questionable ORF YJR038C -0.55250937 0.139837243 0.335576525 0.43699235 questionable ORF YJR039W -0.7986336 0.052912061 0.232808102 0.035294912 hypothetical protein YJR040W -0.43761218 0.00891278 0.212760027 0.246000064 GEF1 putative transport protein involved in intracellular iron metabolism YJR041C 0.820296559 0.174746091 0.181526537 0.09435126 hypothetical protein YJR042W 0.306886477 0.227943583 -0.491090666 0.001736795 NUP85 nuclear pore protein YJR043C 0.491139138 0.023930363 -0.324337168 0.358932395 POL32 third (55 kDa) subunit of DNA polymerase delta YJR044C 0.404292013 0.189267317 0.745484472 0.075100567 weak similarity to putative transport protein YKR103w YJR045C -0.11317163 0.726839023 0.087678248 0.287795921 SSC1 Mitochondrial matrix protein involved in protein import ; subunit of SceI endonuclease YJR046W -0.30431015 0.077303908 0.220122243 0.178284221 TAH11 weak similarity to Xenopus vimentin 4 YJR047C 0.506910598 0.141006628 0.607717154 0.023740989 ANB1 anaerobically expressed form of translation initiation factor eIF-5A YJR048W 0.28355772 0.6401656 0.24353891 0.054749628 CYC1 iso-1-cytochrome c YJR049C -0.61044398 0.020387862 -0.315197143 0.174257963 UTR1 involved in ferric reductase activity YJR050W -0.59040225 0.009127498 -0.647491351 0.006995779 ISY1 interacts with the spliceosome YJR051W 0.198870211 0.494711444 -0.29661146 0.028961823 OSM1 osmotic growth protein YJR052W -0.13509779 0.714866355 -0.481187981 0.020091955 RAD7 nucleotide excision NEF4 component YJR053W 0.192404651 0.368130686 -0.162355263 0.543753964 BFA1 similar to Byr4 YJR054W 0.860698402 0.019668332 -0.521892984 0.146208093 similarity to hypothetical protein YML047c YJR055W 0.275596197 0.344998461 -0.491808868 0.065922504 HIT1 involved in growth at high temperature YJR056C 0.960074053 0.031241973 -0.114199668 0.238894335 hypothetical protein YJR057W 0.305115124 0.203868777 -0.038001192 0.707236992 CDC8 thymidylate kinase YJR058C 0.178732454 0.062207552 0.439613743 0.09157185 APS2 Clathrin-associated protein, small subunit YJR059W -1.25098247 0.014573006 0.097464404 0.335834858 PTK2 putative serine) /threonine kinase involved in spermine metabolism YJR060W -0.3089179 0.27921703 -0.252841183 0.06513224 CBF1 basic helix-loop-helix protein YJR061W 0.450090407 0.59268172 0.344548919 0.083289485 similarity to Mnn4p YJR062C 0.453455366 0.210303283 -0.112371778 0.520099288 NTA1 52-kDa amidase specific for N-terminal asparagine and glutamine YJR063W 1.578929176 0.069943831 0.586382161 0.012897985 RPA12 A12.2 subunit of RNA polymerase I YJR064W 0.606259712 0.041953713 -0.013706424 0.798862213 CCT5 subunit of chaperonin subunit epsilon YJR065C -0.47036904 0.041263162 -0.105157276 0.091974477 ARP3 involved in the function of the actin cytoskeleton YJR067C 0.593659872 0.178867648 -0.197298911 0.317211461 YAE1 Essential protein of unknown function YJR068W 0.303784225 0.225032888 0.075355909 0.644760759 RFC2 Subunit 2 of Replication Factor C ; homologous to human RFC 37 kDa subunit YJR069C 0.621068455 0.313138855 -0.041758243 0.750562426 HAM1 controls 6-N-hydroxylaminopurine sensitivity and mutagenesis YJR070C 1.312825 0.085972549 0.2799629 0.048629425 similarity to C.elegans hypothetical protein C14A4.1 YJR071W 0.641752639 0.135242034 0.377697025 0.118581795 questionable ORF YJR072C 0.309833954 0.050815736 -0.411446894 0.153554363 strong similarity to C.elegans hypothetical protein and similarity to YLR243w YJR073C -0.25231876 0.531071518 0.335823254 0.192181159 OPI3 Methylene-fatty-acyl-phospholipid synthase (unsaturated phospholipid N-methyltransferase) YJR074W 0.276359989 0.66205372 0.01575014 0.800059323 MOG1 nuclear protein that interacts with GTP-Gsp1p YJR075W 0.338475264 0.470428769 0.437349253 0.030893156 HOC1 putative mannosyltransferase YJR076C 0.603866342 0.301726241 -0.13928712 0.356718696 CDC11 Component of 10 nm filaments of mother-bud neck Mir1p has been purified as a mitochondrial import receptor (p32) which can bind to signal sequence regions of mitochonidrial preproteins. In YJR077C -0.44488449 0.229681722 0.388175139 0.17529554 MIR1 addition, it has been purified as PTP (PiC), a mitochondrial phosphate transport protein. Mir1p localizes between the inner and outer mitochondrial membranes//phosphate transport protein, mitochondrial (MCF) YJR078W -1.03597069 0.012742028 -0.265437245 0.394918468 similarity to mammalian indoleamine 2,3-dioxygenase YJR079W -0.62069254 0.034254755 -0.113242736 0.182375057 questionable ORF YJR080C -1.19840164 0.004093408 -0.100999441 0.075709031 hypothetical protein YJR082C 0.07932158 0.794861612 -0.608429417 0.053667356 hypothetical protein YJR083C -0.2195162 0.038861746 -0.273919616 0.02936711 hypothetical protein YJR084W -0.72696301 0.013968366 -0.188461409 0.090262214 weak similarity to S.pombe hypothetical protein SPAC1B3.08 YJR085C -0.50044892 0.105891512 0.574711592 0.173209006 hypothetical protein YJR086W 0.098490599 0.811757028 -0.0211372 0.867939121 STE18 gamma subunit of G protein coupled to mating factor receptors YJR087W 0.085792639 0.772203887 0.155542883 0.161681229 questionable ORF YJR088C -0.08303129 0.741255477 -0.26749988 0.137027087 weak similarity to S.pombe hypothetical protein SPBC14C8.18c YJR089W -0.04837209 0.702121674 -0.707525313 0.036341525 BIR1 Baculoviral IAP Repeat-containing protein YJR090C -0.10991465 0.498176364 -0.120501373 0.206670051 GRR1 cyclin F box protein YJR091C 0.103014713 0.668323376 0.812721868 0.03261593 JSN1 Benomyl dependent tubulin mutant YJR092W 0.312803919 0.375461892 -0.07216589 0.861191454 BUD4 involved in bud site selection YJR093C 0.014311119 0.942954902 0.131513244 0.264403124 FIP1 interacts with poly(A)polymerase YJR094C 0.282872955 0.529108547 0.179843681 0.227882654 IME1 transcription factor involved in meiosis YJR095W -0.606215 0.226230026 0.083535562 0.654775546 SFC1 mitochondrial succinate-fumarate transport protein YJR097W 1.324074454 0.000943392 -0.04091446 0.885077991 weak similarity to Caj1p YJR098C -0.01876528 0.963604008 -0.345016332 0.144532768 weak similarity to Bacillus licheniformis esterase YJR099W -0.15159757 0.293663485 -0.302653595 0.023453189 YUH1 ubiquitin hydrolase YJR100C -0.36503884 0.02420022 -0.320689741 0.00816597 weak similarity to Bud3p YJR101W 1.004956547 0.007892322 -0.203185139 0.120944581 RSM26 protein of the small subunit of the mitochondrial ribosome YJR102C -0.42010047 0.011956935 -0.171221339 0.032038697 hypothetical protein YJR103W -1.08124782 0.01525027 -0.178675465 0.274014397 URA8 CTP synthase YJR104C 0.522185621 0.352221131 0.746064654 0.051120644 SOD1 Cu, Zn superoxide dismutase YJR105W 1.631154272 0.210521202 0.573411818 0.201361153 ADO1 adenosine kinase YJR106W -0.05671282 0.783675734 0.332019271 0.099174425 ECM27 (putative) involved in cell wall biogenesis YJR107W -0.08387809 0.619599123 0.529014833 0.045328821 weak similarity to acylglycerol lipase YJR108W -0.265431 0.238784614 -0.017396832 0.85821425 ABM1 ABerrant Microtubules YJR109C 0.966578347 0.142666275 0.231077447 0.364692269 CPA2 carbamyl phosphate synthetase Gene product shows sequence similarity to conserved myotubularin dual specificity phosphatase (PTP /DSP) gene family (Laporte et al. (1998) YJR110W 0.105079849 0.770541557 -0.586139858 0.034303011 Hum Mol Gen 7:1703) YJR111C 0.761289699 0.00181351 0.140131618 0.019468849 YJR112W -0.18526344 0.497511437 -0.02454567 0.896599542 NNF1 nuclear envelope protein YJR113C -0.18158908 0.338259687 -0.018845976 0.853953975 RSM7 protein of the small subunit of the mitochondrial ribosome YJR114W -0.36202916 0.229962355 0.169473592 0.44702745 questionable ORF YJR115W -0.51366923 0.13236017 0.712405797 0.109927382 similarity to hypothetical protein YBL043w YJR116W 0.668890769 0.359193604 0.860466104 0.065589204 similarity to hypothetical protein YPR114w YJR117W 0.706993776 0.017091491 0.988499596 0.036724203 STE24 zinc metallo-protease that catalyzes the first step of N-terminal processing of the yeast a-factor precursor YJR118C -0.38770974 0.550274247 -0.018953076 0.429484916 ILM1 weak similarity to Helicobacter pylori UreD protein YJR119C 0.125040075 0.694732872 -0.28559965 0.039569775 similarity to human retinoblastoma binding protein 2 YJR120W -0.06819868 0.900094164 0.728947338 0.011862195 hypothetical protein YJR121W -0.90289995 0.029726974 0.433816571 0.079863648 ATP2 F(1)F(0)-ATPase complex beta subunit, mitochondrial YJR122W 0.653784027 0.297217141 0.054644317 0.003533161 CAF17 component of CCR4 transcriptional complex YJR123W 1.901269634 0.035313686 0.739036829 0.000987969 RPS5 Ribosomal protein S5 (S2) (rp14) (YS8) YJR124C 1.749418 0.207165244 0.029531544 0.793662498 weak similarity to Staphylococcus multidrug resistance protein YJR125C -0.81294112 0.024195914 -0.14976104 0.05070616 ENT3 cytoskeletal adaptor YJR126C -0.33946886 0.119396273 0.036476575 0.7401869 similarity to human prostate-specific membrane antigen and transferrin receptor protein YJR127C -0.68119662 0.022101489 0.468600476 0.005368797 ZMS1 similarity to regulatory protein Ard1p YJR128W -0.16364224 0.681267306 -0.311985371 0.49175982 questionable ORF YJR129C -0.15823561 0.413318574 -0.001256269 0.995281672 weak similarity to hypothetical protein YNL024c YJR130C -0.02569389 0.950423179 -0.293812957 0.235639235 STR2 Cystathionine gamma-synthase YJR131W -0.72034853 0.020416771 0.195344874 0.056305882 MNS1 specific alpha-mannosidase YJR132W 0.124745708 0.736155518 0.029635446 0.72034111 NMD5 importin beta homolog, Kap119p ; Upf1p interacting protein YJR133W 0.452763161 0.58934309 0.130083319 0.192655676 XPT1 Xanthine Phosphoribosyl Transferase YJR134C -0.4079171 0.047512868 -0.971515978 0.019690595 SGM1 similarity to paramyosin, myosin YJR135C -0.28704374 0.010789789 -0.89902373 0.014705383 MCM22 Required for maintenance of chromosomes and minichromosomes YJR135W-A 0.519361972 0.03472051 0.258778696 0.004297255 TIM8 Subunit of mitochondrial protein import machinery YJR136C 0.197280302 0.350043014 -0.109341497 0.046070416 weak similarity to human 3',5'-cyclic-GMP phosphodiesterase YJR137C -0.54577615 0.142938334 0.108595215 0.113254838 ECM17 Putative sulfite reductase YJR138W -0.55319259 0.115377582 0.169393413 0.396149061 IML1 decreases stability of artificial minichromosomes YJR139C 0.429992154 0.157528014 0.461350487 0.162058366 HOM6 Homoserine dehydrogenase (L-homoserine:NADP oxidoreductase) YJR140C 0.035813566 0.909560387 -0.256814079 0.043060393 HIR3 regulator of histone transcription YJR141W -0.1370518 0.494518091 -0.543944826 0.036895668 hypothetical protein YJR142W 0.095243105 0.863454805 0.07862931 0.626068959 similarity to thiamin pyrophosphokinase YJR143C 0.533797474 0.204276036 0.724035058 0.054934685 PMT4 dolichyl phosphate-D-mannose:protein O-D-mannosyltransferase YJR144W 0.020292935 0.896148658 -0.118856165 0.204285526 MGM101 (putative) nucleic acid interactor YJR145C 1.773813298 0.048126769 0.406672043 0.003345234 RPS4A Ribosomal protein S4A (YS6) (rp5) (S7A) YJR146W 0.548646624 0.277139439 0.48049992 0.084601027 questionable ORF YJR147W 0.036708725 0.908173858 0.709665123 0.132952041 HMS2 heat shock transcription factor homolog YJR148W 1.852905118 0.222376465 0.243587429 0.060131662 BAT2 Branched-Chain Amino Acid Transaminase YJR149W 0.386462809 0.297203642 0.062113664 0.542028528 similarity to 2-nitropropane dioxygenase YJR150C 2.95767984 0.169443356 1.021318986 0.06104843 DAN1 Protein induced during anaerobic growth YJR152W -0.97706728 0.010042618 -0.432931293 0.038571227 DAL5 allantoate permease YJR153W 0.301496294 0.37969447 0.258830519 0.157972197 PGU1 Endo-polygalacturonase YJR154W 0.094461761 0.807983699 -0.57843197 0.013999887 hypothetical protein YJR155W -0.90030802 0.002143941 0.070088772 0.586564923 AAD10 Hypothetical aryl-alcohol dehydrogenase (AAD) YJR156C 5.019900936 0.383354158 0.837939823 0.177493266 THI11 Thiamine biosynthetic enzyme YJR158W -1.25378648 0.008115389 -0.338632727 0.365311462 HXT16 hexose permease YJR159W -0.72850217 0.022403509 -0.501136046 0.052291567 SOR1 sorbitol-induced sorbitol dehydrogenase YJR160C 0.304673245 0.221011018 0.227203087 0.285971578 strong similarity to Mal31p YJR161C 0.151038127 0.721248502 -0.17840216 0.315016134 COS5 Protein with similarity to members of the Ybr302p /Ycr007p /Cos8p /Cos9p family, coded from subtelomeric region YJR162C -0.36055419 0.152033104 0.912569358 0.314330552 strong similarity to subtelomeric encoded proteins YKL001C -0.06624441 0.635072548 -0.185839043 0.449693734 MET14 adenylylsulfate kinase YKL002W -0.26897333 0.20982731 -0.222341073 0.174287233 similarity to hypothetical protein YKL041w YKL003C 0.526780015 0.002645327 -0.132731965 0.534688759 MRP17 Mitochondrial ribosomal protein MRP17 YKL004W 0.795853561 0.194946369 1.034207241 0.043326922 AUR1 involved in phospolipid metabolism YKL005C -0.33446056 0.108689227 -0.307499142 0.321125573 weak similarity to YKR029c and D.melanogaster transcription elongation factor DmS-II YKL006C-A 0.257665658 0.130457183 -0.085920777 0.310391283 SFT1 intra-Golgi v-SNARE YKL006W 1.711216572 0.023311062 0.275826444 0.029594461 RPL14A Ribosomal protein L14A YKL007W -0.29668794 0.063744952 -0.285091868 0.136907658 CAP1 alpha subunit of capping protein YKL008C -0.02643714 0.92408285 0.078549724 0.450301012 LAC1 Homolog of the LAG1 longevity gene. YKL009W 1.837564379 0.167351169 -0.388605255 0.097671576 MRT4 involved in mRNA decay YKL011C -0.02714438 0.924797494 -0.32724246 0.223358871 CCE1 cruciform cutting endonuclease YKL012W 0.25309108 0.493306836 -0.490670746 0.116161503 PRP40 U1 snRNP protein YKL013C 0.652300304 0.14385354 0.130268958 0.096410657 ARC19 involved in cortical actin patch integrity YKL014C 0.978877288 0.040344469 0.35424565 0.075803853 hypothetical protein YKL015W 0.135771555 0.68992772 -0.592970962 0.014563026 PUT3 zinc-finger transcription factor of the Zn(2)-Cys(6) binuclear cluster domain type YKL016C -1.09026173 0.002536105 0.118609362 0.179796274 ATP7 ATP synthase d subunit YKL017C 0.322186127 0.209407092 -0.250401281 0.085739693 HCS1 DNA helicase A YKL018W -0.30614456 0.295326493 0.294525337 0.011757952 similarity to C.elegans hypothetical protein YKL019W -0.05153356 0.733096808 0.21092303 0.499114392 RAM2 CAAX farnesyltransferase alpha subunit YKL020C -0.48547897 0.061505889 0.239460578 0.064257054 SPT23 suppressor protein YKL021C 0.368294866 0.222347359 -0.658726249 0.006365974 MAK11 contains four beta-transducin repeats YKL022C -0.1336636 0.783106189 -0.090780234 0.494048497 CDC16 putative metal-binding nucleic acid-binding protein, interacts with Cdc23p and Cdc27p to catalyze the conjugation of ubiquitin to cyclin B YKL023W -0.52662208 0.011503435 -0.520033374 0.097234883 weak similarity to human cylicin II YKL024C -0.07443908 0.308600958 -0.24553789 0.008549596 URA6 uridine-monophosphate kinase (uridylate kinase) YKL025C -0.4639666 0.185606897 0.255141908 0.017119426 PAN3 76-kDa subunit of Pab1p-dependent poly(A) ribonuclease (PAN) YKL026C -1.56977101 0.009045084 -0.33214416 0.027117745 GPX1 Glutathione peroxidase paralogue YKL027W 0.97783004 0.022859995 -0.18823835 0.07069863 similarity to E.coli molybdopterin-converting factor chlN YKL028W 0.289336281 0.062868488 -0.312954862 0.171055581 TFA1 Large subunit of transcription factor tfIIE YKL029C 0.824005035 0.283134369 0.123624828 0.095010487 MAE1 mitochondrial malic enzyme YKL031W 0.064360473 0.906646542 0.494032987 0.056783612 hypothetical protein YKL032C -0.01919191 0.949516251 0.107924137 0.120513123 IXR1 intrastrand crosslink recognition protein YKL033W 0.001186756 0.996116502 -0.416585795 0.020653419 strong similarity to holacid-halidohydrolase YKL034W -0.63603026 0.081065069 0.647956835 0.112175691 weak similarity to YOL013c YKL035W -1.11839608 0.006958505 0.431863895 0.17919376 UGP1 Uridinephosphoglucose pyrophosphorylase YKL036C -0.74525506 0.073652088 0.573199909 0.033425984 questionable ORF YKL037W -0.07604954 0.759529318 0.329014802 0.180445699 weak similarity to C.elegans ubc-2 protein YKL038W -0.58488374 0.176349679 0.467276307 0.147546832 RGT1 transcriptional repressor and activator YKL039W 0.025005385 0.866064236 0.441315743 0.046532884 PTM1 Putative membrane protein YKL040C 0.179682364 0.312908421 -0.585180098 0.057089902 NFU1 Nifu-like protein YKL041W 0.084648642 0.744618725 -0.512285628 0.095849302 VPS24 involved in secretion YKL043W -0.34770709 0.335641528 0.503744942 0.04317743 PHD1 putative transcription factor YKL044W 0.303530503 0.538104878 0.209025471 0.513844537 hypothetical protein YKL045W -0.08890625 0.713624509 -0.286662027 0.085926836 PRI2 p58 polypeptide of DNA primase YKL046C -1.23795369 0.015040898 -0.069221686 0.196898367 strong similarity to YMR238w YKL047W 0.240812485 0.090287186 -0.154353994 0.10183735 hypothetical protein YKL048C -0.20136587 0.387196654 -0.296381374 0.130457066 ELM1 protein kinase YKL049C -0.03798836 0.870991171 -0.465116539 0.047983416 CSE4 high similarity to histone H3 and to human centromere protein CENP-A YKL050C -0.63446858 0.25890052 0.216200979 0.155836004 similarity to YMR031c YKL051W 0.381569031 0.568771491 0.55743044 0.056123236 hypothetical protein YKL052C 0.125479267 0.269878797 -0.135890412 0.21373766 hypothetical protein YKL053C-A 1.061161098 0.000915556 -0.028914213 0.850930689 YKL053W 0.138536301 0.535834533 0.150517384 0.499299678 similar to C.elegans hypothetical protein T09A5.7 (12.5 kD) YKL054C 0.801163686 0.094834131 -0.038115133 0.251308534 VID31 similarity to glutenin, high molecular weight chain proteins and Snf5p/vacuole import and degradation YKL055C -0.47480849 0.023544284 0.343580091 0.102090352 OAR1 3-oxoacyl-[acyl-carrier-protein] reductase YKL056C 1.013563754 0.160439074 0.571255716 0.070359522 strong similarity to human IgE-dependent histamine-releasing factor YKL057C 0.342730094 0.296362699 0.411551053 0.162687505 NUP120 100-kDa protein (predicted molecular weight is 120 kDa) with two leucine zipper motifs, coiled-coil region, and some homology to Nup133p YKL058W -0.14636256 0.265547397 0.036169207 0.65823284 TOA2 Transcription factor IIA, small chain YKL059C 0.082156183 0.606049531 0.520753647 0.032916123 similarity to C.elegans hypothetical protein YKL060C 1.430001638 0.336693202 0.633791097 0.077719786 FBA1 aldolase YKL061W 0.107729687 0.292622301 -0.716242701 0.012854701 hypothetical protein YKL062W -0.16286022 0.771483964 0.031960437 0.759104607 MSN4 zinc finger protein YKL063C 0.057780344 0.499235497 -0.5950944 0.043286775 weak similarity to mammalian microtubule-associated protein MAP 1B YKL064W -0.31251173 0.122610109 -0.226199751 0.04595991 MNR2 overexpression overcomes manganese toxicity YKL065C 0.587630005 0.0699519 -0.163358626 0.05921811 YET1 Yeast endoplasmic reticulum 25 kDa transmembrane protein YKL067W -0.54993742 0.146706792 0.038117394 0.580443992 YNK1 Nucleoside diphosphate kinase YKL068W 0.281094355 0.541903622 0.27557148 0.066654592 NUP100 Nuclear pore complex protein homologous to Nup116p YKL069W 0.653934016 0.067074052 -0.034344523 0.790662606 strong similarity to hypothetical E.coli protein b1832 YKL070W -0.38821701 0.006380186 -0.069133418 0.516095275 similarity to B.subtilis transcriptional regulatory protein YKL071W -1.47585489 0.001672813 -0.210100678 0.260144954 weak similarity to A.parasiticus nor-1 protein YKL072W 1.126582619 0.308905119 -0.616444537 0.04056683 STB6 involved in transcription YKL073W 0.095516267 0.842508797 -0.065557211 0.299734977 LHS1 novel member of the Hsp70 family of molecular chaperones that localizes to the lumen of the endoplasmic reticulum: YKL074C 0.018916035 0.872650989 -0.291784959 0.146316985 MUD2 involved in early pre-mRNA splicing YKL075C 0.102308584 0.484715304 -0.38640143 0.010846748 hypothetical protein YKL076C 0.043600874 0.840945214 -0.137095073 0.04913606 questionable ORF YKL077W 0.057831045 0.769020377 0.002979048 0.953112176 hypothetical protein YKL078W -0.16058894 0.714495562 -0.172841993 0.168274138 JA2 probable ATP-dependent RNA helicase YKL079W 0.099751946 0.205973253 -0.427434067 0.048679957 SMY1 kinesin heavy chain homolog YKL080W 0.499698887 0.409843289 0.159099369 0.14990058 VMA5 vacuolar ATPase V1 domain subunit C (42 kDa) YKL081W 0.230160233 0.352198331 0.440157562 0.038876813 TEF4 Translation elongation factor EF-1gamma YKL082C 0.870444305 0.090861104 -1.300211764 0.034371703 weak similarity to C.elegans hypothetical protein YKL084W 0.383148767 0.373942886 0.483717046 0.116701285 strong similarity to S.pombe hypothetical protein SPAC29B12 YKL085W -1.30892411 0.000343745 -0.115897143 0.492783392 MDH1 mitochondrial malate dehydrogenase YKL086W -0.44435851 0.067902429 -0.142827727 0.4504944 hypothetical protein YKL087C 0.606437585 0.119053252 0.288577228 0.130447812 CYT2 cytochrome c1 heme lyase YKL088W -0.2516576 0.25632915 -0.460371496 0.156357049 similarity to C.tropicalis hal3 protein, to C-term. of Sis2p and to hypothetical protein YOR054c YKL089W 0.24428438 0.466225844 -0.345819655 0.212636068 MIF2 centromere protein YKL090W 0.004733844 0.989108386 0.119094408 0.198305274 hypothetical protein YKL091C -0.56148304 0.037957701 -0.086436307 0.412876601 strong similarity to Sec14p YKL092C -0.18887758 0.280297936 -0.280715719 0.133225971 BUD2 GTPase-activating protein (GAP) for Rsr1p /Bud1p YKL093W -1.22386201 0.020040857 0.286766056 0.099816015 MBR1 MBR1 protein precursor YKL094W -0.53652545 0.039118712 -0.172379847 0.036284741 YJU3 required for optimal growth on glycerol YKL095W 0.090403805 0.665606811 -0.483568555 0.018689464 YJU2 weak similarity to E.coli hypothetical protein YKL096W 1.26165999 0.072972169 0.760264719 0.066536724 CWP1 cell wall mannoprotein YKL097W-A 1.059344322 0.361528755 1.1353523 0.084503048 CWP2 cell wall mannoprotein YKL098W -0.04173127 0.679896087 0 #DIV/0! hypothetical protein YKL099C 1.010321576 0.184633596 0.07902007 0.483413885 similarity to C.elegans hypothetical proteins C18G6.06 and C16C10.2 YKL100C -0.70227518 0.011782099 -0.669890223 0.084576916 similarity to C.elegans hypothetical protein YKL101W 0.929291383 0.022430764 0.117418356 0.257428517 HSL1 Putative protein kinase homologous to S. pombe cdr1 /nim1 YKL102C 0.233334737 0.234009429 0.258026046 0.537215956 hypothetical protein YKL103C -1.09024936 0.029833011 0.248553297 0.457606366 LAP4 vacuolar aminopeptidase ysc1 YKL104C 1.23229052 0.084299827 0.261933061 0.295167281 GFA1 Glutamine_fructose-6-phosphate amidotransferase (glucoseamine-6-phosphate synthase) YKL106W 1.200551842 0.02867078 -0.075032964 0.297846717 AAT1 aspartate aminotransferase, mitochondrial YKL107W -1.16590968 0.014140346 0.333221877 0.159517928 weak similarity to S.antibioticus probable oxidoreductase YKL108W 0.184621486 0.108933431 -0.371285661 0.147694026 SLD2 Synthetically lethal with dpb11-1 ; required for DNA replication YKL109W -0.25440096 0.628190137 -0.652292273 0.041000516 HAP4 transcriptional activator protein of CYC1 (component of HAP2 /HAP3 heteromer) YKL110C 0.43786288 0.010838714 -0.280533962 0.135847525 KTI12 Protein involved in resistance to K. lactis killer toxin YKL111C -0.28499303 0.499472034 -0.143626431 0.441271309 questionable ORF YKL112W -0.33169212 0.236041192 -0.226097549 0.211653702 ABF1 transcriptional activator and ARS1 binding protein YKL113C 0.436295946 0.27553149 -0.28014225 0.10207912 RAD27 42 kDa 5' to 3' exonuclease required for Okazaki fragment processing YKL114C -0.21546564 0.17601892 -0.557544542 0.089442864 APN1 major apurinic /apyrimidinic endonuclease /3'-repair diesterase YKL115C 0.097731129 0.68053789 0.165457872 0.33651735 questionable ORF YKL116C 0.385449095 0.145436574 -0.039574083 0.775499031 probable serine /threonine-specific protein kinase (EC 2.7.1.-) YKL117W 0.273360213 0.495318183 -0.081579184 0.445560068 SBA1 Hsp90 (Ninety) Associated Co-chaperone YKL118W -0.09285532 0.777747572 -0.216885513 0.200206973 questionable ORF YKL119C 0.261957709 0.550089337 -0.290083452 0.080171648 VPH2 25.2 kDa protein involved in assembly of vacuolar H(+) ATPase YKL120W 1.510130181 0.178376382 -0.084949245 0.45232379 OAC1 mitochondrial oxaloacetate transport protein YKL121W -0.29574515 0.231240644 0.065485415 0.386130739 strong similarity to YMR102c YKL122C 0.644843279 0.216318133 -0.244348247 0.365367195 SRP21 component of signal recognition particle YKL123W -0.07241491 0.683148649 0.201928003 0.167518182 questionable ORF YKL124W -0.77961304 0.00013884 0.456997147 0.238597923 SSH4 (putative) involved in ER functions YKL125W 0.217639782 0.07810655 -0.247181098 0.246331226 RRN3 DNA-independent RNA Polymerase I transcription factor YKL126W 0.285306637 0.5845775 0.293531368 0.022251489 YPK1 76.5 kDa Serine /threonine protein kinase with similarity to protein kinase C, is 90 % identical to Ypk2p YKL127W 0.949664779 0.350730962 0.517282749 0.09214702 PGM1 phosphoglucomutase, minor isoform YKL128C 1.062874883 0.342284154 -0.038909467 0.729604038 PMU1 Phospo-mutase homolog YKL129C -0.47580676 0.086668629 -0.208831119 0.157650962 MYO3 myosin I YKL130C 0.514555723 0.032649432 -0.056506163 0.050002232 SHE2 involved in cell polarity YKL131W 0.156972392 0.766053665 0.041037243 0.704641245 questionable ORF YKL132C -0.52398522 0.018595076 0.191712226 0.166945516 RMA1 probable folyl-polyglutamate synthetase YKL133C -0.79383025 0.064201558 -0.435937633 0.114490646 probable purine nucleotide-binding protein YKL134C -0.12688882 0.825320745 -0.398893307 0.03141187 30-Sep mitochondrial intermediate peptidase, possesses octapeptidyl amino-peptidase activity YKL135C -0.19458033 0.129856101 -0.093349216 0.065334002 APL2 Beta-adaptin, large subunit of the clathrin-associated protein (AP-1) complex YKL136W 0.419472202 0.110660023 -0.100994763 0.436991685 questionable ORF YKL137W 0.710330854 0.012468131 -0.438843015 0.081218853 hypothetical protein YKL138C 0.851975298 0.018286109 -0.24869052 0.264150232 MRPL31 15.5 kDa mitochondrial ribosomal protein YmL31 YKL139W 0.517222117 0.030957371 -0.463582359 0.102381278 CTK1 alpha subunit of the kinase which phosphorylates the RNA polymerase largest subunit CTD (carboxyl-terminal domain) YKL140W 0.043274748 0.893685776 0.232972921 0.028891585 TGL1 triglyceride lipase-cholesterol esterase YKL141W -0.57864595 0.065141239 0.553453381 0.161457227 SDH3 succinate dehydrogenase cytochrome b YKL142W -0.96067314 0.005347515 -0.375814 0.067224041 MRP8 mitochondrial ribosomal protein YKL143W 0.352899511 0.049773356 -0.771190846 0.053543983 LTV1 low temperature viability protein YKL144C 0.400793493 0.10831078 -0.040192881 0.747675295 RPC25 Subunit of RNA polymerase III YKL145W -0.03084157 0.930338872 -0.384233459 0.010615707 RPT1 putative ATPase, 26S protease subunit component YKL146W -1.18186843 0.019977373 0.785084767 0.107792353 strong similarity to S.pombe hypothetical protein C3H1.09C YKL147C -0.2379731 0.558245863 0.326608387 0.41614289 questionable ORF YKL148C -1.87814855 0.004976028 0.368686109 0.038665138 SDH1 flavoprotein subunit of succinate dehydrogenase YKL149C -0.17539013 0.193830278 -0.424672882 0.106761034 DBR1 debranching enzyme YKL150W -1.00412685 0.001774409 0.104212447 0.619097019 MCR1 NADH-cytochrome b5 reductase YKL151C -1.2688541 0.00223639 0.166647565 0.281332086 similarity to C.elegans hypothetical protein R107.2 YKL152C 1.168612787 0.317985962 0.477191881 0.011518166 GPM1 Phosphoglycerate mutase YKL153W 0.668071549 0.130219446 0.472119439 0.029366567 questionable ORF YKL154W 0.626731828 0.213866998 -0.434209444 0.066661173 SRP102 Signal recognition particle receptor beta subunit YKL155C 0.766514682 0.012166569 -0.470873375 0.079846801 RSM50 protein of the small subunit of the mitochondrial ribosome YKL156W 0.906673867 0.032753132 0.142785112 0.097662666 RPS27A 40S ribosomal protein S27A (rp61) (YS20) YKL157W -0.6847016 0.090147867 0.206603291 0.437396875 APE2 aminopeptidase yscII YKL159C 0.083552528 0.720915494 0.226951278 0.176757975 hypothetical protein YKL160W -0.06959433 0.727700749 -0.451691672 0.171995434 RCN1 calcineurin inhibitor YKL161C 0.716224055 0.117203829 -0.290882664 0.065251746 probable serine /threonine-specific protein kinase (EC 2.7.1.-) YKL162C -0.6210334 0.09120907 0.192022393 0.027998419 identified by SAGE expression analysis YKL162C-A -0.22531324 0.496733537 0.419512351 0.452039302 YKL163W -0.78833651 0.01636549 0.591430054 0.108127255 PIR3 Protein containing tandem internal repeats YKL164C 0.620124463 0.159057926 0.763067678 0.021820402 PIR1 Protein containing tandem internal repeats YKL165C 0.536241426 0.583901465 0.316113788 0.32181623 MCD4 (putative) involved in cell polarity YKL166C 0.745011712 0.096615423 -0.157545765 0.53092009 TPK3 cAMP-dependent protein kinase catalytic subunit YKL167C -0.06991867 0.773944644 -0.112735547 0.316956282 MRP49 16 kDa mitochondrial ribosomal large subunit protein YKL169C 0.485197678 0.149433834 -0.208023563 0.144906852 questionable ORF YKL170W 0.429652666 0.196934422 -0.11986519 0.331621796 MRPL38 mitochondrial ribosomal protein L14 YKL171W -0.7281454 0.077254028 -0.103903905 0.027727541 probable serine /threonine-specific protein kinase (EC 2.7.1.-) YKL172W 1.020658135 0.159996816 -1.014971423 0.047993813 EBP2 Nucleolar protein YKL173W -0.10203874 0.045161391 0.152812445 0.079127924 SNU114 U5 snRNP-specific protein related to EF-2 YKL174C 0.068739935 0.83611968 0.289178084 0.367832055 probable transport protein YKL175W -0.23460639 0.391982444 0.703852213 0.183503834 ZRT3 weak similarity to E.coli hypothetical protein YKL176C -0.33725658 0.084272778 0.221986963 0.225170216 LST4 Required for amino acid permease transport from the Golgi to the cell surface YKL177W 0.125732788 0.878084747 0.246177465 0.422649731 questionable ORF YKL178C -1.40946637 0.00933776 -0.208723051 0.550946588 STE3 a factor recptor YKL179C 0.209250001 0.493162954 -0.845067471 0.050080315 kinesin-like protein YKL180W 1.451748954 0.002746471 0.322541961 0.038518029 RPL17A Ribosomal protein L17A (L20A) (YL17) YKL181W 1.044852788 0.013911773 0.247802535 0.158868639 PRS1 ribose-phosphate pyrophosphokinase YKL183W 0.408763917 0.025574769 0.062683423 0.717216277 hypothetical protein YKL184W 0.035745633 0.765953266 0.256773414 0.00514479 SPE1 Ornithine decarboxylase YKL185W -0.20567931 0.5458989 0.311641511 0.022705641 ASH1 probable purine nucleotide-binding protein YKL186C 0.34316142 0.091040315 0.105738668 0.441021112 MTR2 mRNA transport regulator YKL187C -0.69286015 0.171041947 0.26717446 0.063449854 strong similarity to hypothetical protein YLR413w YKL188C -0.56827197 0.090231894 -0.703484998 0.065981858 PXA2 peroxisomal ABC transporter 2 The homologue in Aspergillus nidulans, hymA, is involved in development, see Karos, M. and Fischer, R. (1996). hymA (hypha-like metulae), a YKL189W -0.28207006 0.046303424 -0.326882193 0.163885466 HYM1 new developmental mutant of Aspergillus nidulans. Microbiol. 142:3211-3218. YKL190W 0.705254173 0.211866325 -0.138454848 0.214175075 CNB1 Type 2B protein phosphatase ; regulatory B subunit of calcineurin YKL191W 0.104416107 0.801975094 0.19264006 0.086600599 DPH2 diphthamide synthesis protein YKL192C 0.714256268 0.019064119 1.048356819 0.086236045 ACP1 mitochondrial acyl carrier protein YKL193C -0.41353479 0.129438196 -0.207945711 0.048495752 SDS22 Glc7p regulatory subunit YKL194C 0.171925529 0.56416514 -0.506670164 0.027681464 MST1 mitochondrial threonine-tRNA synthetase YKL195W 0.344240493 0.295197001 -0.93362394 0.011323856 similarity to rabbit histidine-rich calcium-binding protein YKL196C 0.184655029 0.546373602 -0.220427708 0.121320597 YKT6 SNARE protein for Endoplasmic Reticulum-Golgi transport /v-SNARE YKL197C -0.45843689 0.166929058 0.23819781 0.56482341 PEX1 member of the AAA-protein family//peroxisomal assembly protein - peroxin YKL198C -0.16177673 0.804034621 0.43621605 0.059959303 PTK1 probable serine /threonine-specific protein kinase (EC 2.7.1.-) YKL199C -0.26681976 0.621551833 0.237344904 0.122664671 YKT9 Protein of unknown function YKL200C -0.73433895 0.029286463 0.171475208 0.506651643 MNN4 only writen on YKL201C (YKL200C is not found on MIPS) YKL206C 0.458836082 0.247957107 0.039452247 0.776095716 hypothetical protein YKL207W -0.22999452 0.438975772 0.315158687 0.153702212 hypothetical protein YKL208W -0.0674586 0.817598915 -0.513043229 0.015697437 CBT1 involved in RNA splicing YKL209C 0.372489821 0.319756802 0.135001954 0.142307002 STE6 ABC transporter, glycoprotein, component of a-factor secretory pathway YKL210W -0.03732441 0.923175366 0.416611973 0.130396032 UBA1 ubiquitin activating enzyme, similar to Uba2p YKL211C 0.168358205 0.473493622 -0.241073226 0.000602986 TRP3 anthranilate synthase Component II and indole-3-phosphate (multifunctional enzyme) YKL212W 0.674097663 0.369840067 0.201626842 0.092012704 SAC1 integral membrane protein localizing to the ER and Golgi YKL213C -0.21903082 0.493081781 -0.005670289 0.961613719 DOA1 phospholipase A2-activating protein YKL214C -0.52924104 0.035350447 -0.059571189 0.51974114 weak similarity to mouse transcriptional coactivator ALY YKL215C -0.61748634 0.065130433 0.168214019 0.437397834 similarity to P. aeruginosa hyuA and hyuB YKL216W -1.26953885 0.013662444 -0.307432391 0.050081805 URA1 dihydroorotate dehydrogenase YKL217W -1.29871032 0.027006152 0.311938315 0.026593502 JEN1 carboxylic acid transporter protein homolog YKL218C 0.573457746 0.490984719 -0.430263268 0.020808474 SRY1 Pyridoxal-5'phosphate-dependent enzyme homologous to mouse glial serine racemase YKL219W 0.394968226 0.354459021 0.416891593 0.072899285 COS9 Protein with similarity to subtelomerically-encoded proteins such as Cos5p, Ybr302p, Cos3p, Cos1p, Cos4p, Cos8p, Cos6p, Cos9p YKL220C -1.27023499 0.004334423 -0.32566595 0.03005564 FRE2 Ferric reductase YKL221W -1.37375953 0.007761115 0.25427728 0.448693137 weak similarity to human X-linked PEST-containing transporter YKL222C 0.482045932 0.036038105 0.056509279 0.097881284 weak similarity to transcription factors, similarity to finger proteins YOR162c, YOR172w and YLR266c YKL223W -0.45966129 0.350524262 -0.33173796 0.234324506 strong similarity to subtelomeric encoded proteins YKL224C 0.13374632 0.716764086 0.50081306 0.09519249 strong similarity to members of the Srp1p/Tip1p family YKR001C 0.027366087 0.839152546 0.037825004 0.726708893 VPS1 putative GTP-binding protein ; similar to mammalian Mx proteins YKR002W -0.5516119 0.101801247 0.050646518 0.194358877 PAP1 poly(A) polymerase YKR003W -0.52639791 0.018080081 -0.018236569 0.864480438 similarity to Kes1p, Hes1p and Osh1p YKR004C -0.16829972 0.350971269 -0.325047141 0.062218001 ECM9 (putative) involved in cell wall biogenesis YKR005C -1.34090101 0.004355409 -0.062772512 0.44322207 hypothetical protein YKR006C 0.523831552 0.158930834 -0.07315527 0.305924771 MRPL13 mitochondrial ribosomal protein YmL13 YKR007W -0.01716756 0.95957062 -0.18064256 0.450477403 weak similarity to Streptococcus protein M5 precursor YKR008W 0.392740799 0.071876993 -0.182142016 0.3297744 RSC4 Member of RSC complex. YKR009C -0.64017423 0.17999257 0.114502592 0.452379315 FOX2 peroxisomal multifunctional beta-oxidation protein YKR010C -0.16604793 0.598805486 -0.690065808 0.005361618 TOF2 topoisomerase I interacting factor 2 YKR011C -0.52481009 0.113876049 -0.253795166 0.052302794 TOS5 hypothetical protein YKR012C 0.365333896 0.495915608 0.75268534 0.167213054 questionable ORF YKR013W 1.318553959 0.109646258 0.971786075 0.019874932 PRY2 Similar to plant PR-1 class of pathogen related proteins YKR014C -0.44229917 0.057235694 -0.41780987 0.012165124 YPT52 probable purine nucleotide-binding protein YKR015C -0.0398874 0.818567621 0.659031281 0.064560602 similarity to hypothetical protein YJL043w YKR016W -0.28791238 0.280304478 -0.499611661 0.091387169 weak similarity to mysoin heavy chain proteins YKR017C -0.93161249 0.014798445 -0.390699982 0.002911607 similarity to human hypothetical KIAA0161 protein YKR018C -0.70987671 0.048028861 -0.098222236 0.445290962 strong similarity to hypothetical protein YJL082w YKR019C -0.24999027 0.046036268 -0.093986118 0.253508373 IRS4 involved in rDNA silencing YKR020W -0.46388574 0.070448908 -0.498502717 0.051131735 hypothetical protein YKR021W 0.07384982 0.630617227 -0.019532982 0.375985466 strong similarity to hypothetical protein YJL084c YKR022C -0.38031827 0.008058155 -0.996996437 0.040089533 hypothetical protein YKR023W 0.15504635 0.151425163 -0.719198358 0.046907606 similarity to S.pombe hypothetical protein SPAC23C4 YKR024C 0.952655285 0.011694832 -0.371893911 0.214703943 DBP7 putative RNA helicase YKR025W 0.713787146 0.072604771 -0.383374499 0.10949547 RPC37 RNA Polymerase C (III) 37 kDa subunit YKR026C 1.282963558 0.071648684 -0.051268257 0.638217107 GCN3 34 KD alpha subunit of eIF2B YKR027W 0.188344995 0.319466488 -0.086884419 0.323011301 strong similarity to Chs6p YKR028W 0.111289422 0.168427448 -0.120739608 0.156345003 SAP190 Type 2A-related protein phosphatase YKR030W 0.772790918 0.087572821 0.251815252 0.055573887 weak similarity to NADH dehydrogenases YKR031C -0.87798234 0.015191596 -0.207876572 0.212519768 SPO14 Phospholipase D YKR032W -0.32127529 0.149555724 0.265070394 0.637758301 hypothetical protein YKR033C -1.27231213 0.046635061 -0.099795047 0.75070561 questionable ORF YKR034W -1.68280915 0.021413837 -0.225835249 0.398016009 DAL80 negative regulator of multiple nitrogen catabolic genes YKR035C -0.36216467 0.222510281 -0.686314166 0.065704789 hypothetical protein YKR035W-A -0.39054883 0.1960221 -0.793572521 0.045273387 FTI1 Rad52p inhibitor YKR036C 0.336951272 0.30483442 -0.375856587 0.111439302 CAF4 component of CCR4 transcriptional complex YKR037C -0.37993098 0.015777449 0.016856179 0.946176928 SPC34 component of spindle pole YKR038C 0.53840654 0.212728334 0.135633692 0.363148013 probable calcium-binding protein YKR039W -1.44530277 0.050346152 0.111587271 0.599642094 GAP1 general amino acid permease YKR040C 0.705411989 0.106680602 0.46250165 0.531259904 questionable ORF YKR041W -0.27299009 0.42054618 0.108577879 0.630804809 hypothetical protein YKR042W -0.00316767 0.989151236 0.581249241 0.066078144 UTH1 involved in cell growth YKR043C 1.526145741 0.240215795 0.453247034 0.086491803 weak similarity to phosphoglycerate mutase YKR044W 0.437054158 0.192407059 0.245180327 0.057628159 hypothetical protein YKR045C -0.25778676 0.526172739 0.177315327 0.299072598 hypothetical protein YKR046C -0.30937359 0.25854617 0.573998661 0.290289093 hypothetical protein YKR047W -0.05120809 0.924705329 0.247209011 0.227678912 questionable ORF YKR048C -0.34878764 0.358347688 0.590293018 0.062235404 NAP1 nucleosome assembly protein I YKR049C -0.43681678 0.138034899 0.47784457 0.190916248 hypothetical protein YKR050W -0.89156617 0.127995545 0.433713734 0.067672289 TRK2 membrane protein ; low affinity potassium transport YKR051W -0.34873869 0.022817283 0.150551855 0.217769298 similarity to C.elegans hypothetical protein YKR052C -0.23412545 0.491177605 0.267198092 0.39917167 MRS4 mitochondrial carrier protein, highly homologous to Mrs3p YKR053C 0.755494076 0.333321589 0.672759255 0.052174352 YSR3 DHS-1-P phosphatase YKR055W -0.6882685 0.052482441 -0.113683333 0.158463935 RHO4 ras homolog--GTP binding protein YKR056W 1.137971619 0.081716681 -0.049831863 0.153419859 RNC1 Endo-exonuclease YKR057W 1.164659345 0.1987206 0.044276269 0.307570824 RPS21A Ribosomal protein S21A (S26A) (YS25) YKR058W -1.42485002 0.000773355 -0.075764431 0.583670127 GLG1 glycogen synthesis initiator YKR059W 1.917935933 0.072498989 0.674598298 0.040864322 TIF1 translation initiation factor eIF4A YKR060W 0.626938468 0.133350742 -0.179968496 0.452814052 hypothetical protein YKR061W 1.025834494 0.260051233 -0.141548127 0.228070693 KTR2 putative mannosyltransferase ; type 2 membrane protein YKR062W 0.238316837 0.02676467 -0.273860532 0.004849269 TFA2 Small subunit of TFIIE transcription factor YKR063C -0.04198362 0.856394828 -0.165749923 0.007024546 LAS1 May regulate expression of genes involved in bud formation and morphogenesis YKR064W 0.334263744 0.216999622 -0.376875363 0.067888351 weak similarity to transcription factors YKR065C -0.18962341 0.34474856 0.39295226 0.199922023 hypothetical protein YKR066C -0.21518368 0.31892766 0.366755609 0.284238295 CCP1 Cytochrome-c peroxidase YKR067W -0.92900037 0.007829301 -0.048495589 0.53452526 strong similarity to Sct1p YKR068C 0.341606784 0.413262474 0.12805006 0.245913672 BET3 transport protein particle (TRAPP) component YKR069W 0.051737355 0.870257754 -0.165268545 0.029787487 MET1 siroheme synthase YKR070W -0.50886692 0.027896513 0.16621015 0.101982202 strong similarity to S. pombe phosphatidyl synthase YKR071C 0.338856716 0.035473169 -0.174704645 0.211137039 weak similarity to C.elegans hypothetical protein YKR072C -0.17215476 0.706728634 0.063582103 0.425844048 SIS2 sit4 suppressor YKR073C 0.247404455 0.494426546 -0.153563845 0.665413298 hypothetical protein YKR074W 0.431480395 0.134755992 -0.054088783 0.688284765 strong similarity to hypothetical S. pombe protein YKR075C 3.156716372 0.357917136 0.176503153 0.418679954 weak similarity to negative regulator Reg1p YKR076W -1.60497256 0.012290096 -0.117498292 0.182207057 ECM4 (putative) involved in cell wall biogenesis YKR077W -0.19773238 0.329991912 0.661776438 0.141287652 hypothetical protein YKR078W -0.09235665 0.768004358 -0.506585557 0.078709009 similarity to Vps5p YKR079C 0.626430632 0.118615532 -0.25189779 0.199300201 similarity to S.pombe hypothetical protein SPAC1D4.10 YKR080W 1.019809499 0.269613789 -0.52897132 0.013061371 MTD1 NAD-dependent 5,10-methylenetetrahydrafolate dehydrogenase YKR081C 0.780446277 0.061404697 -0.532023855 0.130819204 hypothetical protein YKR082W 0.712661014 0.099269947 0.149494803 0.083146121 NUP133 nuclear pore protein YKR083C -0.31131821 0.47467842 -0.594301647 0.030400852 weak similarity to S.japonicum paramyosin YKR084C -0.20318563 0.287470594 -0.173080076 0.017921514 HBS1 Protein related to translation elongation factor EF-1alpha and to Suf12p /Sup2p /Gst1p /Sup35p YKR085C 0.754414499 0.020560872 -0.010787416 0.919307668 MRPL20 22.3 kDa mitochondrial ribosomal large subunit protein YmL20 ; homologous to L17 of E. coli YKR086W 0.284765872 0.223921945 -0.341019563 0.02894382 PRP16 putative ATP-binding protein YKR087C 0.052110698 0.842953053 -0.185582397 0.065563084 similarity to hypothetical Myxococcus xanthus protein YKR088C -0.50816105 0.051748149 0.238562114 0.284936086 weak similarity to b.subtilis spore germination protein II YKR089C -1.15122933 0.003904789 0.144912911 0.126523179 strong similarity to YOR081c YKR090W 0.22908683 0.208363062 0.260897239 0.08926697 similarity to chicken Lim protein kinase and Islet proteins YKR091W 0.806929099 0.214842848 0.351862341 0.017776193 SRL3 Suppressor of rad53 lethality YKR092C 1.202066229 0.012887121 -0.407454937 0.195566877 SRP40 nucleolar protein that is immunologically and structurally related to rat Nopp140, a nonribosomal protein of the nucleolus and coiled bodies. YKR093W 0.92607717 0.245853866 1.303718954 0.058670403 PTR2 Peptide transporter YKR094C 0.758839088 0.071383931 -0.038509012 0.866418261 RPL40B Ribosomal protein L40B YKR095W 0.145321253 0.542472892 -0.744007535 0.03683845 MLP1 colied-coil protein (putative), similar to myosin and TPR YKR096W -0.0890516 0.700642269 0.230325132 0.17650084 similarity to mitochondrial aldehyde dehydrogenase Ald1p YKR097W -1.37695929 0.022516553 -0.279861972 0.197324686 PCK1 phosphoenolpyruvate carboxylkinase YKR098C -0.25809396 0.35030466 -0.31281243 0.058969417 UBP11 Ubiquitin-specific protease YKR099W 0.729928377 0.172841323 -0.345004795 0.113147609 BAS1 transcription factor YKR100C -0.52221469 0.0636743 -0.551905272 0.024154839 cause growth inhibition when overexpressed YKR101W -0.30269533 0.265588768 -0.540708925 0.026953728 SIR1 repressor of silent mating loci YKR103W -0.2905511 0.220272828 -0.008035429 0.945166871 similarity to multidrug resistance proteins YKR104W -0.7820772 0.029810186 -0.009837786 0.924837186 similarity to multidrug resistance proteins YKR105C -0.51004085 0.193759092 -0.16289468 0.42261871 strong similarity to Sge1p and hypothetical protein YCL069w YKR106W -0.58643155 0.077052478 0.283288029 0.600799216 strong similarity to subtelomeric encoded proteins YLL002W 0.187813104 0.491741902 0.172845056 0.333865891 REM50 diepoxybutane and mitomycin C resistance YLL003W -0.06002072 0.772496479 -0.624358319 0.015989849 SFI1 suppressor of fil1 YLL004W 1.055764263 0.248790686 -0.552958851 0.003896285 ORC3 Third subunit of the origin recognition complex YLL005C -0.4849571 0.034012118 0.160752401 0.226284342 similarity to A.thaliana hyp1 protein YLL006W -0.40411861 0.156947299 0.036390966 0.54844885 MMM1 mitochondrial outer membrane protein YLL007C -0.5453703 0.007506186 -0.067472643 0.125538375 hypothetical protein YLL008W 0.782905538 0.068415657 -0.733712899 0.044065421 DRS1 putative ATP dependent RNA helicase YLL009C 0.588314385 0.092478958 -0.575827923 0.120909134 COX17 cysteine-rich cytoplasmic protein YLL010C 0.036066844 0.923021931 -0.055685311 0.606506594 PSR1 Plasma membrane Sodium Response 1 YLL011W 1.061152646 0.154882809 -0.43415855 0.178770658 SOF1 56 kDa nucleolar snRNP protein that shows homology to beta subunits of G-proteins and the splicing factor Prp4 YLL012W 0.829120013 0.216517974 0.17185853 0.046065715 similarity to triacylglycerol lipases YLL013C 0.240263014 0.626124692 0.067222814 0.429445867 similarity to Drosophila pumilio protein YLL014W 0.676216218 0.159965336 0.322109031 0.038285186 hypothetical protein YLL015W -0.19132798 0.414904461 0.503880516 0.111116321 BPT1 ABC-type transmembrane transporter ; highly homologous to human MRP1 and to C. elegans mrp-1 YLL016W -1.03748349 0.043886983 0.125089033 0.528283569 SDC25 GDP /GTP exchange factor for Ras YLL017W -0.07193924 0.795795489 0.558523804 0.44291279 maybe part of SCD25 YLL018C -0.16764974 0.705319309 0.420047272 0.164533913 DPS1 Aspartyl-tRNA synthetase, cytosolic YLL018C-A -0.01589536 0.969294489 0.582775046 0.097271813 COX19 Cox19p (under characterization) YLL020C -0.69577242 0.052535979 0.595513207 0.061307405 questionable ORF YLL022C -0.47602809 0.191710505 -0.073946275 0.291180743 HIF1 interacts with histone acetyltransferase YLL023C -0.51937677 0.142289279 0.655011656 0.091603982 similarity to hypothetical protein YLR064w YLL024C -0.80500238 0.093735699 0.315912366 0.196788362 SSA2 member of 70 kDa heat shock protein family YLL025W 0.061444426 0.633335635 0.771476277 0.120888663 strong similarity to members of the Srp1p/Tip1p family YLL026W -2.38722244 1.85441E-05 -0.376592612 0.014604914 HSP104 104 kDa heat shock protein YLL027W 0.708738821 0.047970101 0.237196101 0.014683439 ISA1 Iron Sulfur Assembly -- IscA /NifA homolog YLL028W -0.92872919 0.025442228 0.572577555 0.12729961 TPO1 polyamine transport protein YLL029W -0.96145228 0.01632965 -0.043078641 0.660078651 similarity to M.jannaschii X-Pro dipeptidase and S.pombe hypothetical protein YLL030C -0.02387846 0.895286382 -0.313233899 0.457933767 hypothetical protein YLL031C -0.0164626 0.94636783 0.543568489 0.056483307 GPI13 phosphoryltransferase that adds phosphoethanolamine to the third mannose residue of the GPI anchor precursor YLL032C 0.37599798 0.014510457 -0.035006916 0.580863131 hypothetical protein YLL033W -0.22594674 0.243224033 -0.159136059 0.112647297 hypothetical protein YLL035W 1.253182659 0.082677785 0.145215241 0.165428074 GRC3 hypothetical protein YLL036C 0.339319421 0.157592966 -0.062976779 0.693181656 PRP19 RNA splicing factor YLL037W 0.677114066 0.048031945 0.326183544 0.035166111 weak similarity to human platelet-activating factor receptor YLL038C -0.11036015 0.804915921 0.152504776 0.155635639 ENT4 Ent4p YLL039C -0.58327681 0.121119986 0.085869317 0.490112215 UBI4 ubiquitin YLL041C -1.54967525 0.01363837 0.093454998 0.657675459 SDH2 Succinate dehydrogenase (ubiquinone) iron-sulfur protein subunit YLL042C -1.45588053 0.004746453 -0.224803686 0.151506553 APG10 involved in autophagy ; protein-conjugating enzyme involved in the Apg12p-Apg5p conjugation pathway YLL043W -0.0876589 0.374440754 -0.22471987 0.166117729 FPS1 glycerol channel protein YLL044W 0.685721676 0.13904279 0.226439578 0.020584153 questionable ORF YLL045C 0.927534009 0.036665972 0.346942815 0.010682521 RPL8B Ribosomal protein L8B (L4B) (rp6) (YL5) YLL046C 0.265968777 0.019636831 0.060328521 0.839144726 RNP1 ribonucleoprotein 1 YLL047W 0.502499774 0.222153236 0.337041278 0.354762022 questionable ORF YLL049W -0.99490827 0.013943214 -0.028999633 0.699666768 hypothetical protein YLL050C -0.2180162 0.464299027 -0.181340805 0.128268738 COF1 Cofilin, actin binding and severing protein YLL051C 0.949840098 0.132468572 0.430521349 0.178176637 FRE6 similar to FRE2 YLL052C -2.25038306 0.000380073 0.489201864 0.378990243 AQY2 Aqy2p, putative aquaporin, member of MIP family YLL053C -1.89891642 0.000155246 0.745931738 0.285471307 similarity to water channel proteins YLL054C -0.06997781 0.777967682 -0.07597625 0.389638855 similarity to transcription factor Pip2p YLL055W -1.31809071 0.001922152 -0.044948262 0.778927101 similarity to Dal5p YLL056C -1.13070886 0.004856879 0.132884563 0.500396651 weak similarity to Y.pseudotuberculosis CDP-3,6-dideoxy-D-glycero-L-glycero-4-hexulose-5-epimerase YLL057C -0.21450727 0.669942415 0.301273017 0.03672612 similarity to E.coli dioxygenase YLL058W -0.33734647 0.255831936 0.348171591 0.186765058 similarity to N.crassa O-succinylhomoserine (thiol)-lyase YLL059C 0.525549022 0.087159336 -0.044360118 0.69306287 hypothetical protein YLL060C -1.05214609 0.002190082 0.020200425 0.868577552 GTT2 Glutathione transferase YLL061W 0.964773544 0.412995344 0.580753731 0.046321337 MMP1 High affinity S-methylmethionine permease YLL062C 0.34685131 0.64562602 0.440327577 0.023414675 MHT1 S-methylmethionine:homocysteine S-methyltransferase YLL063C 0.369094995 0.396943006 0.371108062 0.023653841 AYT1 transacetylase YLL064C -0.21228024 0.340952074 0.417951851 0.102360705 strong similarity to members of the Srp1/Tip1p family YLL065W -0.10749189 0.744424041 0.459513075 0.11347608 GIN11 growth inhibitor YLL066C -0.99365654 0.02235427 0.355020962 0.192512644 strong similarity to subtelomeric encoded proteins YLL067C -0.9980827 0.042315001 0.348372813 0.300877225 strong similarity to subtelomeric encoded proteins YLR001C -0.21718087 0.351093303 0.244737841 0.005696625 hypothetical protein YLR002C 1.112647011 0.033965909 -0.485425212 0.120229211 similarity to hypothetical C. elegans protein YLR003C 0.248786436 0.568410797 -0.489567247 0.145955189 hypothetical protein YLR004C 1.641644321 0.113717797 0.548962704 0.101761072 similarity to allantoate transport protein YLR005W -0.06074924 0.735965543 -0.104877027 0.046101049 SSL1 Component of RNA polymerase transcription factor TFIIH YLR006C -0.67614798 0.032598231 0.393923837 0.120533414 SSK1 Two-component signal transducer that with Sln1p regulates osmosensing MAP kinase cascade(suppressor of sensor kinase) YLR007W 0.045590535 0.807496159 -0.115056011 0.090663351 hypothetical protein YLR008C 1.255422418 0.000280156 0.155031961 0.131000609 similarity to hypothetical protein YNL328c YLR009W 1.155912692 0.025866894 -0.903308871 0.02243267 similarity to ribosomal protein L24.e.B YLR010C 0.195489202 0.210327151 0.026998658 0.896080867 weak similarity to Aquifex aeolicus adenylosuccinate synthetase YLR011W -0.41361623 0.114906364 -0.365013612 0.03724409 weak similarity to E.coli hypothetical 20.4 kDa protein YLR012C -0.74461412 0.056718395 -0.091286215 0.209577931 hypothetical protein YLR013W 0.155379032 0.848745352 0.037025457 0.949226209 GAT3 The amino acid sequence of this ORF is very homologous to that of GAT4 /YIR013C. YLR014C 0.238566055 0.192724979 -0.291224545 0.148684485 PPR1 zinc-finger transcription factor of the Zn(2)-Cys(6) binuclear cluster domain type YLR015W -0.0771461 0.656245492 -0.398972243 0.036416861 BRE2 weak similarity to S.pombe hypothetical protein SPBC13G1 YLR016C 0.201839148 0.488030013 -0.178593246 0.245667797 hypothetical protein YLR017W 0.858405861 0.098546164 0.351387277 0.16307015 MEU1 regulator of ADH2 expression YLR018C 0.65219935 0.241414251 0.424270813 0.012317176 POM34 nuclear pore integral membrane protein YLR019W 0.165585511 0.450998134 0.288648251 0.010990493 PSR2 Plasma membrane Sodium Response 2 YLR020C 0.70368982 0.204994641 -0.422159503 0.071127251 similarity to triacylglycerol lipase YLR021W 0.384856606 0.159161315 -0.199576735 0.248078241 hypothetical protein YLR022C 1.920877607 0.055566429 -0.131808629 0.641878726 similarity to C.elegans and M.jannaschii hypothetical proteins YLR024C 0.222982118 0.255668052 0.446991598 0.121898898 UBR2 ubiquitin-protein ligase (E3) YLR025W -0.28771527 0.026008502 -0.585530738 0.070325406 SNF7 involved in glucose derepression YLR026C 1.34294519 0.183860448 0.032167855 0.802565906 SED5 Sed5p is a t-SNARE (soluble NSF attachment protein receptor) required in ER to Golgi transport. YLR027C 0.364733613 0.005284733 0.75928288 0.067641904 AAT2 aspartate aminotransferase, cytosolic YLR028C -0.56296281 0.000247791 0.113412722 0.255962974 ADE16 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR) transformylase /IMP cyclohydrolase YLR029C 1.326933388 0.202301454 -0.012165812 0.873990441 RPL15A Ribosomal protein L15A (YL10) (rp15R) (L13A) YLR030W -0.89694647 0.119848404 0.616412628 0.074279432 hypothetical protein YLR031W -1.60056579 0.001751089 0.142991775 0.524546508 similarity to hypothetical protein YMR124w YLR032W -0.12457949 0.743374069 -0.42397724 0.055385667 RAD5 putative ATPase /DNA helicase YLR033W 0.123298944 0.446754565 -0.10058409 0.775013026 hypothetical protein YLR034C 0.546766818 0.048846844 0.982774593 0.056049852 SMF3 Putative metal transporter, Nramp homolog, homolog of SMF1 and SMF2 YLR035C -0.83684057 0.031607413 -0.280364709 0.09724032 MLH2 MutL Homolog YLR036C 0.220480223 0.416053703 0.003027129 0.985204797 similarity to YIL089w YLR037C -0.33917182 0.488074801 0.706345533 0.090791764 strong similarity to members of the Srp1p/Tip1p family YLR038C -1.25916452 0.003256079 -0.617246304 0.051489581 COX12 subunit VIb of cytochrome c oxidase YLR039C 0.020561366 0.918324416 -0.047128813 0.713957585 RIC1 involved in transcription of ribosomal protein genes and ribosomal RNA YLR040C 0.682795595 0.010694872 0.374742909 0.141246279 weak similartity to hypothetical protein YIL011w YLR041W -0.27913851 0.116181204 -0.191411789 0.525966629 questionable ORF YLR042C 0.491732841 0.390573598 0.546345117 0.063531085 hypothetical protein YLR043C 0.823303415 0.250115991 0.726670209 0.014966171 TRX1 thioredoxin YLR044C 0.72262174 0.130555713 0.694899785 0.037477523 PDC1 pyruvate decarboxylase YLR045C 0.549081723 0.166012128 -0.067278984 0.697445981 STU2 spindle pole body component YLR046C -0.03382356 0.914253877 0.374978854 0.446005914 strong similarity to Rta1p and Rtm1p protein YLR047C 0.000870512 0.994975639 0.515499797 0.012636179 similarity to hypothetical protein YGL160w YLR048W 1.277592787 0.000666966 0.367912657 0.015997253 RPS0B Ribosomal protein S0B YLR049C 0.41830486 0.527811874 -0.263602997 0.200265366 hypothetical protein YLR050C -0.57378613 0.221568453 0.382910132 0.237980284 weak similarity to human MAC30 C-terminus YLR051C 1.007371342 0.201808298 -0.957978215 0.047318418 similarity to human acidic 82 kDa protein YLR052W 0.144375952 0.392730378 -0.06764209 0.714918169 hypothetical protein YLR053C -1.5604793 0.008148175 0.141640816 0.547185935 hypothetical protein YLR054C -0.61517478 0.173007197 0.071772937 0.616699816 hypothetical protein YLR056W 0.591782094 0.237487572 0.698349401 0.026039781 ERG3 C-5 sterol desaturase YLR057W 0.555942655 0.10238351 -0.057299849 0.230520615 weak similarity to mouse alpha-mannosidase YLR058C 0.584692595 0.153490279 0.564009526 0.079679997 SHM2 serine hydroxymethyltransferase YLR059C 0.022818162 0.839421808 0.32864709 0.205707202 REX2 RNA exonuclease YLR060W 1.119889062 0.141676066 0.085082096 0.233366777 FRS1 Phenylalanyl-tRNA synthetase, alpha subunit, cytoplasmic YLR061W 0.728940999 0.121321702 -0.08532118 0.674349486 RPL22A Ribosomal protein L22A (L1c) (rp4) (YL31) YLR062C 0.651618954 0.174587808 -0.05400718 0.810260098 weak similarity to mouse alpha-mannosidase YLR063W 0.421632623 0.407596224 -0.214786257 0.067733703 weak similarity to mouse alpha-mannosidase YLR064W 0.84214251 0.050201657 0.502888963 0.030523624 weak similarity to mouse alpha-mannosidase YLR065C 0.777859049 0.228072849 0.173917554 0.267179516 weak similarity to mouse alpha-mannosidase YLR066W 0.217235162 0.147118836 -0.238412555 0.121549836 SPC3 signal peptidase subunit YLR067C 0.566053064 0.17764458 -0.314636884 0.225042951 PET309 involved in COX1 mRNA stability YLR068W 0.06635817 0.70409095 -1.364723362 0.015646388 hypothetical protein YLR069C 0.600487949 0.302484509 -0.350401236 0.010442078 MEF1 mitochondrial elongation factor G-like protein YLR070C -1.45628896 0.02182067 0.314793771 0.271689656 strong similarity to sugar dehydrogenases YLR071C -0.24742223 0.479070281 0.097409525 0.56347111 RGR1 component of RNA polymerase II holoenzyme /mediator complex, interacts with Sin4p, Gal11p, and a 50 kd polypeptide YLR072W -0.67656783 0.021338428 -0.065467274 0.435249559 similarity to YFL042c, YDR326c and YHR080c YLR073C 1.355374229 0.087840442 0.473686727 0.002570373 hypothetical protein YLR074C 1.389197735 0.052856932 -0.112240812 0.636756673 weak similarity to human zinc finger protein YLR075W 1.576571863 0.017433948 0.112996687 0.233670477 RPL10 Ribosomal protein L10 ; Ubiquinol-cytochrome C reductase complex subunit VI requiring protein YLR076C 1.036152701 0.02303655 0.05678016 0.321449814 questionable ORF YLR077W -0.29882257 0.13600848 -0.202585249 0.200435747 weak similarity to Xenopus RCC1 protein YLR078C -0.16428018 0.248465689 -0.17227994 0.431207981 BOS1 ER-to-Golgi v-SNARE YLR079W -0.97225743 0.003999463 -0.532652618 0.007703218 SIC1 Cdc28p-Clb5 protein kinase inhibitor YLR080W -1.91837816 0.000464137 -0.229330279 0.055155436 strong similarity to Emp47p YLR081W -0.655038 0.19609248 0.441272556 0.107285854 GAL2 galactose permease YLR082C -0.92406852 0.006428262 -0.523431948 0.093798011 SRL2 Suppressor of rad53 lethality YLR083C 1.087859358 0.188534159 0.269859814 0.265130965 EMP70 endosomal membrane protein YLR084C 1.19553994 0.131503041 0.359587356 0.040061521 RAX2 YLR084C YLR085C -1.06373554 0.002670094 0.109938487 0.375078115 ARP6 Actin-related protein YLR086W -0.09795317 0.724251253 -0.567606225 0.019706661 SMC4 SMC chromosomal ATPase family member YLR088W 0.264417858 0.293057805 0.028545903 0.72695955 GAA1 Possible component of GPI:protein transamidase YLR089C 0.624829055 0.339747585 0.374929959 0.130597051 strong similarity to alanine transaminases YLR090W 1.380389954 0.160607522 -0.117632713 0.110164274 XDJ1 Homolog of E. coli DnaJ YLR091W -0.03266821 0.790900477 0.284595251 0.03160769 hypothetical protein YLR093C -0.49341613 0.073182617 -0.509660921 0.044590391 NYV1 vacuolar v-SNARE YLR094C 0.139869845 0.765030167 0.300360771 0.331977866 GIS3 GIG3 suppressor YLR095C -0.16040979 0.583862375 -0.014973748 0.882963782 IOC2 ISWI One Complex YLR096W 0.044570894 0.923359512 -0.123378355 0.294832215 KIN2 Serine /threonine protein kinase YLR097C -1.47515079 0.000210664 -0.550883534 0.029011991 hypothetical protein YLR098C 0.017993667 0.880841891 -0.206096157 0.004502376 CHA4 DNA-binding transcriptional activator or CHA1 YLR099C -0.7626759 0.018531967 0.181907625 0.468312049 ICT1 Increased Copper Tolerance ; Similar to Ecm18p YLR100W 0.123474989 0.767688062 0.173968661 0.076996171 ERG27 3-keto sterol reductase YLR101C 0.50290395 0.113498905 0.352289148 0.222545342 questionable ORF YLR102C -0.5638925 0.024155991 0.022275299 0.886962233 APC9 subunit of the anaphase promoting complex (APC) YLR103C 0.230852326 0.541398484 -0.189102827 0.276946902 CDC45 omosomal DNA replication initiation protein YLR104W 0.243091644 0.446220478 0.252572131 0.024537558 hypothetical protein YLR105C 0.327093467 0.244369963 0.027034192 0.809760818 SEN2 tRNA splicing endonuclease subunit YLR107W 0.727960066 0.230094889 -0.471320747 0.062651604 REX3 RNA EXonuclease ; part of family of 3'-to5' exonucleases. See Moser et al. 1997 Nucleic acids Res. 25:5110-5118 YLR108C -0.19414281 0.133180084 -0.060758656 0.577893263 strong similarity to YDR132c YLR109W -0.48224416 0.110658838 0.390827312 0.140801858 AHP1 alkyl hydroperoxide reductase YLR110C 1.486700821 0.033345235 1.025041389 0.095554223 strong similarity to Flo1p YLR111W 0.611714717 0.098515724 -0.466283343 0.229324972 hypothetical protein YLR112W 0.067228475 0.498879236 0.275345534 0.180617794 hypothetical protein YLR113W 1.016576786 0.339528311 0.021528653 0.781621829 HOG1 mitogen-activated protein kinase (MAP kinase) YLR114C 0.270124991 0.209078391 -0.175341257 0.047950995 EFR4 PHO _E_ighty _F_ive _R_equiring YLR115W 0.328247053 0.588493877 -0.252260293 0.153036532 CFT2 Component of cleavage factor II (CF II) ; 105-kDa protein associated with polyadenylation factor 1 (PF I) YLR116W 0.039680222 0.892822362 0.507860092 0.099542691 MSL5 Branchpoint bridging protein YLR118C -0.256015 0.138762809 0.056550411 0.311885564 similarity to several esterases YLR119W -0.48238498 0.044048465 -0.240968778 0.318635026 SRN2 may be involved in RNA export from nucleus YLR120C 0.255968233 0.701522702 0.597253202 0.163416355 YPS1 GPI-anchored aspartic protease YLR121C 0.335404733 0.167026159 0.45220048 0.282729826 YPS3 GPI-anchored aspartic protease YLR122C 0.227036836 0.608297531 0.126484263 0.13790561 hypothetical protein YLR123C 0.075605137 0.770842537 0.318019013 0.157553123 questionable ORF YLR124W 0.127460806 0.722888729 0.63198676 0.118637295 hypothetical protein YLR125W -0.38543727 0.168356271 -0.10944476 0.579041667 hypothetical protein YLR126C -0.33994902 0.136002091 -0.549392926 0.075538733 weak similarity to P.aeruginosa anthranilate synthase component II YLR127C -0.08070213 0.759066947 -0.129928831 0.10181628 APC2 subunit of the anaphase promoting complex (APC) YLR128W -0.06540114 0.755576404 0.000797218 0.988479336 similarity to S.pombe hypothetical protein SPBC24E9 YLR129W 0.892349483 0.06671036 -0.212236984 0.192289502 DIP2 interacts with Dom3p YLR130C 0.008127368 0.957512377 0.444125334 0.063951978 ZRT2 Low-affinity zinc transport protein YLR131C -0.66092758 0.07518778 0.273026488 0.341143714 ACE2 zinc finger transcription factor YLR132C 0.311460322 0.608579765 0.090349534 0.449388227 hypothetical protein YLR133W -0.0680165 0.858251002 0.438765907 0.037951043 CKI1 choline kinase YLR134W 2.555690975 0.260507728 0.578070326 0.177962955 PDC5 pyruvate decarboxylase YLR135W 0.261189793 0.072683921 -0.312277834 0.131813173 hypothetical protein YLR136C -0.61823173 0.283335844 0.068876596 0.428695529 TIS11 homolog of mammalian TIS11 YLR137W 0.369905822 0.500116186 0.4595984 0.172046198 weak similarity to hypothetical S.pombe protein SPCC4G3 YLR138W -0.05239784 0.72818393 0.08746196 0.370311983 NHA1 Putative Na+ /H+ antiporter YLR139C 0.658248159 0.292366966 0.657284207 0.266786036 SLS1 73 kDa mitochondrial integral membrane protein YLR140W 0.075474808 0.873539514 0.906839272 0.045064837 questionable ORF YLR141W -0.13258866 0.654159196 0.582520254 0.158862389 RRN5 transcription factor, member of UAF (upstream activation factor) along with Rrn9p and Rrn10p YLR142W -0.92020733 0.174737119 0.119712832 0.3234073 PUT1 proline oxidase YLR143W 0.790817486 0.118108134 -0.279177258 0.119730409 weak similarity to Pyrococcus horikoshii hypothetical protein PHBJ017 YLR144C -0.32238404 0.465288721 0.081267571 0.219529426 ACF2 involved in cortical actin cytoskeleton assembly YLR145W 0.205108576 0.5334841 -0.405345906 0.229311265 hypothetical protein YLR146C 0.957438152 0.297944045 -0.164566036 0.021241016 SPE4 Spermine Synthase YLR147C 0.999681273 0.096121734 0.212177552 0.447655663 SMD3 encodes a core snRNP protein YLR148W -0.28319899 0.045022253 -0.706303571 0.088437087 PEP3 vacuolar membrane protein YLR149C -1.40445931 0.022543136 -0.119390291 0.402944662 hypothetical protein YLR150W 1.216577881 0.027682854 0.288014778 0.204502188 STM1 gene product has affinity for quadruplex nucleic acids YLR151C 0.119118719 0.527787418 -0.098287382 0.603985087 PCD1 coenzyme A diphosphatase YLR152C -0.87205892 0.007066275 0.377924262 0.290710649 similarity to YOR3165w and YNL095c YLR153C 0.792057723 0.385716819 0.145249351 0.299698337 ACS2 acetyl-coenzyme A synthetase YLR154C -0.38779523 0.463555585 0.232207536 0.19250788 hypothetical protein YLR155C 0.600363402 0.234355472 -0.158337028 0.422649731 ASP3-1 nitrogen catabolite-regulated cell-wall L-asparaginase II YLR156W -0.34870196 0.291579617 0.15724498 0.804020943 identical to hypothetical proteins YLR161w and YLR159w YLR157C 0.381423592 0.603157364 0.576069289 0.523435046 ASP3-2 nitrogen catabolite-regulated cell-wall L-asparaginase II The TyB Gag-Pol protein. Gag processing produces capsid proteins. Pol is cleaved to produce protease, reverse transcriptase, and integrase YLR157C-B 1.482686016 0.047678046 0.522099287 0.039953023 activities. YLR158C -0.76575478 0.051097215 0.86271007 0.237522738 ASP3-3 nitrogen catabolite-regulated cell-wall L-asparaginase II YLR159W 0.638983825 0.338994717 0.137004554 0.758087531 identical to hypothetical proteins YLR161w and YLR156w YLR160C -0.26824972 0.512760429 -0.417363971 0.285833696 ASP3-4 nitrogen catabolite-regulated cell-wall L-asparaginase II YLR161W -0.01329688 0.988186235 0.604180261 0.548304316 identical to hypothetical proteins YLR156w and YLR159w YLR162W 0.305189629 0.397537816 0.830184644 0.060191602 hypothetical protein YLR163C -0.13984866 0.531587131 -0.183812677 0.001683679 MAS1 mitochondrial processing protease subunit YLR164W -1.90277808 0.002775789 0.396975948 0.17328353 strong similarity to Sdh4p YLR165C -0.45987406 0.010609324 -0.436615882 0.050662034 weak similarity to H.influenzae hypothetical protein HI0176 100 kD component of the Exocyst complex ; required for exocytosis. The Exocyst complex contains the gene products encoded by SEC3, YLR166C -0.55351696 0.007966755 -0.709838825 0.010778582 SEC10 SEC5, SEC6, SEC8, SEC10, SEC15 and EXO70. YLR167W 2.061228552 0.086881979 0.330792457 0.225867271 RPS31 Ribosomal protein S31 (S37) (YS24) YLR168C 0.232411404 0.475444538 -0.513644537 0.07835314 MSF1' possibly involved in intramitochondrial sorting YLR169W -0.23654404 0.045897669 -0.208273229 0.257762487 questionable ORF YLR170C -0.23880255 0.431110549 -0.553795871 0.040413392 APS1 clathrin-associated protein complex, small subunit YLR171W 0.030521247 0.862101829 -0.499021402 0.102288928 questionable ORF YLR172C 0.838659024 0.190469604 0.058585275 0.062334523 DPH5 S-adenosylmethionine (AdoMet)-dependent methyltransferase of diphthamide biosynthesis YLR173W -0.87817051 0.034914887 0.231584479 0.344487756 hypothetical protein YLR174W -1.41920815 0.014052163 0.146930676 0.100510233 IDP2 Cytosolic form of NADP-dependent isocitrate dehydrogenase YLR175W 0.657227775 0.248534023 -0.683678496 0.092707747 CBF5 major low affinity 55 kDa Centromere /microtubule binding protein YLR176C -0.49039948 0.252867603 0.292531911 0.152472494 RFX1 DNA binding protein, homologous to mammalian RFX1-4 proteins YLR177W -0.07575745 0.918873591 0.114809644 0.51446809 similarity to suppressor protein Psp5p YLR178C -2.47107588 0.000100362 0.250761486 0.506288851 TFS1 (putative) lipid binding protein ; supressor of a cdc25 mutation YLR179C 0.507175448 0.008347848 0.594576993 0.024315414 similarity to Tfs1p YLR180W 0.530929085 0.056784286 -0.064885628 0.497308491 SAM1 S-adenosylmethionine synthetase YLR181C 0.138448868 0.348549903 -0.407363814 0.07266475 hypothetical protein YLR182W 0.460891648 0.015832792 0.333287784 0.398948783 SWI6 transcription factor YLR183C 1.062447577 0.257836856 -0.039558115 0.869848338 TOS4 similarity to YDR501w YLR184W 1.15884907 0.010670504 -0.173622472 0.253840384 weak similarity to ribulose-bisphosphate carboxylase YLR185W 1.831915496 0.034272318 0.449438989 0.071399531 RPL37A 60S ribosomal protein L37A (L43) (YL35) YLR186W 1.285457307 0.191883891 0.048140962 0.367111367 strong similarity to S.pombe hypothetical protein C18G6.07C YLR187W -0.11324315 0.767644846 0.225432952 0.309341915 similarity to hypothetical protein YNL278w YLR188W -0.41192208 0.046484293 0.17191432 0.270444949 MDL1 ATP-binding cassette (ABC) transporter family member YLR189C -1.05773669 0.006493426 -0.48014967 0.09165766 UGT51 UDP-glucose:sterol glucosyltransferase YLR190W -0.23432409 0.089628744 -0.203700663 0.092807345 hypothetical protein YLR191W -0.08262475 0.838435058 -0.104490736 0.069065617 PEX13 Peroxisomal membrane protein that contains Src homology 3 (SH3) domain YLR192C 0.578308438 0.174242666 -0.130802459 0.286412637 HCR1 High Copy suppressor of RPG1 YLR193C -0.14511885 0.57720554 0.008244331 0.942991521 similarity to G.gallus px19 and Msf1p YLR194C 2.686730853 0.214838316 0.558652313 0.129050284 hypothetical protein YLR195C 0.076105297 0.66008747 -0.164582566 0.236377453 NMT1 N-myristoyl transferase YLR196W 1.290984151 0.141350104 -0.178688331 0.326215039 PWP1 similar to beta-transducin superfamily YLR197W 1.006050725 0.272917717 -0.635530042 0.052355951 SIK1 homology to microtubule binding proteins and to X90565_5.cds YLR198C 0.784633631 0.37865232 -1.132669465 0.003291523 questionable ORF YLR199C -0.02801335 0.775506628 0.016928744 0.79794805 hypothetical protein YLR200W 0.489184375 0.201780005 -0.987800987 0.03111468 YKE2 Polypeptide 6 of a Yeast Non-native Actin Binding Complex, homolog of a component of the bovine NABC complex YLR201C 0.061750488 0.334840025 0.346842254 0.085649608 similarity to hypothetical S. pombe protein YLR202C 0.322118922 0.399925007 0.330728763 0.029975028 questionable ORF YLR203C -0.09672683 0.834575083 0.453314674 0.132570646 MSS51 involved in maturation of COX1 and COB mRNA YLR204W 0.527871254 0.115929591 -0.0902866 0.371109251 QRI5 protein of unknown function YLR205C 0.464108476 0.324762132 -0.007176245 0.982197074 hypothetical protein YLR206W -0.32545809 0.032402951 0.224378517 0.24434238 ENT2 Ent2p YLR207W -0.55858022 0.005813392 0.259634674 0.204541717 HRD3 involved in HMG-CoA reductase degradation YLR208W 0.198535733 0.395390755 -0.012223086 0.844349075 SEC13 cytoplasmic protein involved in release of transport vesicles from the ER YLR209C 0.343037933 0.073388499 0.256102418 0.03951876 PNP1 Purine Nucleoside Phosphorylase YLR210W 0.172525151 0.182108343 -0.106616354 0.726480123 CLB4 G(sub)2-specific B-type cyclin YLR211C -0.54452159 0.118024984 -0.313342577 0.130396447 hypothetical protein gamma tubulin-like protein, interacts with Spc98p and Spc97p, the Tub4p-Spc98p-Spc97p complex may be part of the microtubule attachment YLR212C -0.15486951 0.457722858 0.151508458 0.119041061 TUB4 site at the spindle pole body YLR213C -0.61739268 0.178309765 0.033440979 0.424031706 CRR1 CRH-Related YLR214W 0.116506404 0.644642499 0.127587526 0.346461902 FRE1 Ferric (and cupric) reductase YLR215C 0.561698635 0.175706422 -0.148303643 0.38296542 CDC123 strong similarity to rat cell cycle progression related D123 protein YLR216C -0.40884265 0.171256596 -0.474097186 0.043538355 CPR6 cyclophilin related to the mammalian CyP-40 YLR217W -0.21343027 0.402923555 -0.305346346 0.234891582 questionable ORF YLR218C 0.659992605 0.044986137 -0.117170437 0.627370264 hypothetical protein YLR219W -1.06243448 0.019833918 0.544306903 0.049724363 hypothetical protein YLR220W -0.21425795 0.263332368 -0.117737335 0.38893031 CCC1 Possible transmembrane Ca2+ transporter YLR221C 0.883159647 0.069851764 -0.870451728 0.086932492 hypothetical protein YLR222C 0.973091297 0.157495335 -0.588461378 0.029809488 similarity to Dip2p YLR223C 1.105480146 0.145995768 -0.047114547 0.829099651 IFH1 has a weak RNA-dependent ATPase activity which is not specific for rRNA YLR224W 1.004192937 0.312190611 0.052763884 0.303690781 hypothetical protein YLR225C 0.776366135 0.302093218 -0.484049312 0.012704802 strong similarity to YDR222w YLR226W 0.468077959 0.072155238 -0.224609017 0.120302907 BUR2 involved in transcriptional regulation YLR227C 0.350635861 0.15207606 -0.168788836 0.06646538 hypothetical protein YLR227W-A 1.244104139 0.062291594 0.490006404 0.036995148 TyA gag protein. Gag processing produces capsid proteins. YLR228C 0.127891766 0.413657112 0.063704566 0.543398483 ECM22 involved in cell wall biogenesis (putative) YLR229C 0.6670327 0.020071226 0.365862101 0.026472232 CDC42 member of the Rho subfamily of Ras-like proteins YLR230W 0.557021283 0.044420562 0.269857924 0.09630524 questionable ORF YLR231C -1.42342626 0.005628 -0.077918693 0.805473415 strong similarity to rat kynureninase YLR232W -0.61412513 0.362903877 -0.093833816 0.684947496 questionable ORF YLR233C -0.69369271 0.003957084 -0.269264355 0.058230217 EST1 involved in telomere length regulation YLR234W 0.436404108 0.629829741 0.513050281 0.079953486 TOP3 DNA Topoisomerase III YLR235C -0.2847004 0.450870272 0.41303953 0.187351948 questionable ORF YLR236C -0.22799241 0.767719435 -0.832890522 0.221257905 hypothetical protein YLR237W 1.375228798 0.006152092 0.959699772 0.090241528 THI7 thiamine transporter YLR238W -0.57293788 0.044977013 -0.570108896 0.105146709 similarity to YDR200c YLR239C 0.257362819 0.443562827 -0.35350404 0.08069867 weak similarity to H.influenzae lipoate biosynthesis protein B YLR240W -0.31354493 0.058275903 0.043096389 0.616290508 VPS34 phosphatidylinositol 3-kinase YLR241W 0.091978192 0.850705465 0.257671089 0.319436625 similarity to hypothetical S.pombe protein SPAC2G11.09 YLR242C 0.214692444 0.036162259 -0.01557999 0.825372226 ARV1 similar to Nup120p and C.elegans R05H5.5 protein and Nup120p YLR243W 0.902429799 0.005203537 -0.070619183 0.773289144 strong similarity to YOR262w YLR244C 0.128695745 0.575390251 0.015857674 0.809689219 MAP1 methionine aminopeptidase YLR245C 0.184263633 0.390611084 0.247170408 0.068886115 CDD1 Cytidine deaminase YLR246W -0.04997218 0.924689372 0.091735628 0.588594698 ERF2 Mutation has an Effect on Ras Function YLR247C 0.04427978 0.879265638 -0.06567681 0.784008814 similarity to S.pombe rad8 protein and Rdh54p YLR248W -1.01196059 0.002798547 -0.066595966 0.216975247 RCK2 Serine /threonine protein kinase YLR249W 1.985686621 0.175311145 0.154361861 0.145786216 YEF3 EF-3 (translational elongation factor 3) YLR250W 0.047261305 0.780332915 -0.421430009 0.008083383 SSP120 secretory protein YLR251W -1.38529519 0.000459042 0.041966352 0.789711013 similarity to peroxisomal rat membrane protein PMP22 YLR252W -0.95356316 0.001147043 0.167601652 0.445081621 questionable ORF YLR253W 0.223778657 0.477858505 -0.062862691 0.13678833 weak similarity to bacterial aminoglycoside acetyltransferase regulators YLR254C -0.63658287 0.017361069 -0.631721621 0.077090311 hypothetical protein YLR255C 0.039125785 0.956444023 0.278729131 0.105288593 hypothetical protein YLR256W-A 0.677334996 0.07850685 0.474046278 0.005682137 TyA gag protein. Gag processing produces capsid proteins. YLR257W 1.01927497 0.428491045 -0.389221256 0.065300847 hypothetical protein YLR258W -1.8714879 0.000278277 0 #DIV/0! GSY2 Glycogen synthase (UDP-gluocse--starch glucosyltransferase) YLR259C 0.080305473 0.819719455 0.060261282 0.523080842 HSP60 mitochondrial chaperonin, homolog of E. coli groEL protein YLR260W 0.542720208 0.074811537 -0.444852606 0.001807531 LCB5 sphingoid long chain base (LCB) kinase YLR261C 0.534519994 0.149497707 -0.653609753 0.045271844 questionable ORF YLR262C 0.279067597 0.511046216 -0.948975 0.023401886 YPT6 highly homologous to the human GTPase, Rab6 YLR262C-A 0.639303833 0.076267983 -0.205143564 0.426907669 strong similarity to F49C12.11 (Z68227_K) from C. elegans (This ORF is only writen in MIPS) Meiosis-specific protein involved in homologous chromosome synapsis and chiasmata formation ; localizes to chromosome cores YLR263W 0.229831284 0.126218027 -0.032393511 0.757106453 RED1 independently of Mei4p and Spo11p ; mRNA is induced in meiosis YLR264W 1.727777615 0.01815399 0.103972173 0.026067351 RPS28B Ribosomal protein S28B (S33B) (YS27) YLR265C -0.8422583 0.00093846 -0.422246668 0.144050723 hypothetical protein YLR266C -1.01680505 0.005860326 -0.517756624 0.001090439 weak similarity to transcription factors YLR267W -0.52299518 0.218710187 0.248105658 0.337090775 BOP2 Bypass of PAM1 YLR268W -0.0008389 0.99245815 0.371281599 0.029146318 SEC22 Synaptobrevin (v-SNARE) homolog YLR269C -0.18800813 0.423112701 0.382447747 0.012103064 hypothetical protein YLR270W -1.22048493 0.004422981 -0.318783949 0.043168637 Synaptobrevin (v-SNARE) homolog present on ER to Golgi vesicles//synaptobrevin (V-SNARE) YLR271W -0.33140109 0.237101023 -0.936155153 0.011318719 questionable ORF YLR272C 0.095328776 0.67879167 -0.157972625 0.176230149 YCS4 Loss of cohesion YLR273C -0.66813813 0.009383407 -0.014632719 0.872415881 PIG1 Protein similar to Gac1p, a putative type 1 protein phosphatase targeting subunit YLR274W -0.03749027 0.706773051 0.230096077 0.070522539 CDC46 MCM initiator complex protein YLR275W 0.17255152 0.207682399 -0.417468044 0.06281881 SMD2 U1 snRNP protein of the Sm class YLR276C 0.736644497 0.153327202 -0.739722984 0.06027829 DBP9 putative RNA helicase YLR277C 0.11858216 0.511850623 -0.160518438 0.2821779 YSH1 subunit of Polyadenylation factor I (PF I) YLR279W 0.116403861 0.817544673 0.307855747 0.180135131 questionable ORF YLR280C -0.90841032 0.045930331 -0.005016333 0.985948316 questionable ORF YLR281C -0.00121723 0.997468815 0.246044997 0.272922298 similarity to polypeptide chain release factors YLR282C -0.58645449 0.154374327 -0.166022874 0.403676893 questionable ORF YLR283W -0.32411866 0.117152544 -0.114863507 0.104812759 weak similarity to Smc2p YLR284C -1.99075469 0.004281835 -0.20397634 0.016706272 ECI1 Peroxisomal d3,d2-Enoyl-CoA Isomerase YLR285W -0.18094703 0.267396229 -0.153545899 0.117254032 weak similarity to A.thaliana hypothetical protein YLR286C 0.86147787 0.477485276 1.173890247 0.068405782 CTS1 Endochitinase YLR287C 0.262529013 0.377554417 -0.56998094 0.059008041 weak similarity to S.pombe hypothetical protein SPAC22E12 YLR288C -0.12206313 0.191725657 -0.296348115 0.050303661 MEC3 DNA damage checkpoint protein YLR289W 0.375960543 0.292751171 -0.41842015 0.046028878 GUF1 GTPase YLR290C -0.57660201 0.033567123 -0.498761748 0.010970331 hypothetical protein YLR291C 0.228479513 0.130749081 0.220721259 0.170382049 GCD7 translation initiation factor eIF2b, 43 kDa subunit ; negative regulator of GCN4 expression YLR292C 0.723674903 0.210180877 -0.016918441 0.71709303 SEC72 protein involved in membrane protein insertion into the ER YLR293C 1.01539018 0.028271384 0.472970042 0.03958082 GSP1 GTP-binding protein YLR294C -1.05545279 0.018738266 0.192634478 0.061543996 questionable ORF YLR295C -0.97145141 0.01469983 0.339984675 0.011890444 ATP14 ATP synthase subunit h YLR296W 0.80158423 0.344937725 1.192332351 0.095382488 hypothetical protein YLR297W -0.6797118 0.026529327 -0.396467924 0.040059872 weak similarity to Vibrio vulnificus VvpC protein YLR298C -0.07766141 0.331343164 -0.330760267 0.105805085 YHC1 U1 snRNP protein YLR299W -0.75276825 0.053368617 0.417939975 0.292973777 ECM38 gamma-glutamyltransferase homolog YLR300W 1.067509054 0.400464462 -0.148717392 0.445451739 EXG1 Exo-1,3-beta-glucanase YLR301W 0.578732648 0.38523386 -0.044166249 0.676020941 hypothetical protein YLR302C -0.11198177 0.746147189 0.673990094 0.087700254 questionable ORF YLR303W -0.54907626 0.007231533 0.370674195 0.246760735 MET17 O-Acetylhomoserine-O-Acetylserine Sulfhydralase YLR304C -0.97811774 0.006025617 -0.02278738 0.911959277 ACO1 Aconitase, mitochondrial YLR306W -0.47304579 0.088391789 -0.318920576 0.027878678 UBC12 Ubiquitin-conjugating enzyme YLR307W -0.63440235 0.318413632 -0.568005249 0.075228338 CDA1 Chitin Deacetylase YLR308W 0.131947983 0.605293482 -0.048743841 0.902278356 CDA2 Chitin Deacetylase YLR309C -0.31131888 0.405049395 -0.742171865 0.025327915 IMH1 involved in vesicular transport YLR311C -1.67478941 0.006145741 0.422080101 0.327363104 weak similarity to S.tarentolae cryptogene protein G4 YLR312C -2.12226745 0.003004849 -0.270861889 0.378093026 hypothetical protein YLR312W-A 0.422579771 0.080507534 -0.428477007 0.150498764 MRPL15 Mitochondrial ribosomal protein MRPL15 (YmL15) YLR313C 0.113074918 0.839513322 0.63303386 0.098073727 SPH1 homologous to Spa2p, localizes to sites of polarized growth YLR314C 0.913926612 0.081623523 -0.566704674 0.109378572 CDC3 Septin ; component of 10 nm filaments of mother-bud neck YLR315W -0.20346685 0.608269844 0.332818727 0.088793904 weak similarity to rat apolipoprotein A-IV YLR316C 0.607234048 0.013395343 0.196370007 0.048832693 TAD3 tRNA-specific adenosine-34 deaminase subunit Tad3p YLR317W 0.106456209 0.781906001 0.263256118 0.227364947 questionable ORF YLR319C -0.26211988 0.301235403 0.011461155 0.859817322 BUD6 Actin Interacting Protein YLR320W -0.27142231 0.392664136 0.429526075 0.178432657 hypothetical protein YLR321C -0.56766135 0.015972987 -0.195429251 0.38576936 SFH1 homolog of Snf5p, member of the chromatin remodeling complex, RSC YLR322W 1.266781578 0.460799566 0.602399709 0.146353353 questionable ORF YLR323C -0.46075657 0.067624172 -0.411279094 0.01212793 weak similarity to N.crassa uvs2 protein YLR324W -0.78806514 0.051809899 -0.331745196 0.142051314 strong similarity to YGR004w YLR325C 0.958288036 0.193460941 -0.056435274 0.809187635 RPL38 Ribosomal protein L38 YLR326W 0.45880248 0.402481894 0.113099289 0.033707199 hypothetical protein YLR327C -1.0224769 0.136970895 0.251846566 0.223147007 strong similarity to Stf2p YLR328W -0.04405546 0.919736437 0.11091526 0.256049688 strong similarity to YGR010w YLR329W 0.138510272 0.603041536 0.412579724 0.076731908 REC102 23 kDa protein containing a putative leucine zipper ; meiosis specific recombination protein ; mRNA is induced early in sporulation YLR330W 0.129443795 0.469631832 -0.36440813 0.082150986 CHS5 involved in cell wall biogenesis YLR331C 1.03357018 0.031009078 0.546558095 0.039370402 questionable ORF YLR332W 1.383073087 0.043173393 0.648595059 0.019194692 MID2 Protein required for mating YLR333C 0.744924166 0.033454689 0.276893329 0.054096625 RPS25B Ribosomal protein S25B (S31B) (rp45) (YS23) YLR334C 0.542121511 0.159395153 0.22010615 0.207516655 questionable ORF YLR335W 0.060242494 0.885985637 -0.201832093 0.257309782 NUP2 nuclear pore complex protein with central repetitive domain similar to that of NSP1 and NUP1 YLR336C 0.103319604 0.556884705 -0.560695211 0.078912163 SGD1 may be involved in high osmolarity signaling pathway YLR337C 0.081232403 0.789845185 0.825774115 0.077594075 VRP1 Proline-rich protein verprolin YLR338W -0.09523714 0.758787425 0.34948883 0.277528074 questionable ORF YLR339C -0.8606022 0.013203359 0.336981235 0.022338979 questionable ORF YLR340W 0.025499589 0.9495506 0.634196687 0.015277129 RPP0 60S ribosomal protein P0 (A0) (L10E) YLR341W 1.018172327 0.006495259 0.200317407 0.17726827 hypothetical protein YLR343W 0.05986078 0.563174256 0.114422987 0.525629016 strong similarity to Gas1p and C.albicans pH responsive protein YLR344W 0.973505719 0.139205774 0.137073308 0.211779795 RPL26A Ribosomal protein L26A (L33A) (YL33) YLR345W -1.53276507 0.001892643 -0.354125077 0.166741354 similarity to Pfk26p and other 6-phosphofructo-2-kinases YLR346C -1.32062478 0.001678528 -0.098652815 0.494911032 weak similarity to YGR035c YLR347C -0.09466991 0.487794685 0.318920392 0.048087154 KAP95 95 kDa structural and functional homolog of vertebrate karyopherin beta (importin 90) YLR348C -0.02440919 0.949987959 -0.065907541 0.029240939 DIC1 mitochondrial dicarboxylate transport protein YLR349W 0.153555193 0.311112304 0.229985658 0.231765599 questionable ORF YLR350W 0.188363198 0.65984251 0.818150865 0.096100173 strong similarity to YGR038w YLR351C -0.16644251 0.427514595 0.029403887 0.65178647 NIT3 nitrilase superfamily member YLR352W -0.6761447 0.025695273 0.16553115 0.199132659 hypothetical protein YLR354C -0.20011146 0.331045144 0.184112278 0.296661381 TAL1 Transaldolase, enzyme in the pentose phosphate pathway YLR355C 0.286453376 0.275223638 -0.03640953 0.939487647 ILV5 acetohydroxyacid reductoisomerase YLR356W -0.69148325 0.11856357 0.422579868 0.129173189 similarity to SCM4 protein YLR357W -0.11840151 0.671909327 -0.172262663 0.446206453 RSC2 Member of RSC complex. YLR358C -0.10586578 0.801465681 0.096254764 0.288907937 questionable ORF YLR359W 1.925895503 0.214733517 -0.095075761 0.622917121 ADE13 Adenylosuccinate Lyase YLR360W 0.047221882 0.626582079 -0.050893099 0.433350663 VPS38 involved in vacuolar protein targeting YLR361C -0.31586467 0.15440356 0.297653329 0.124287219 similarity to YOR3329c YLR362W -0.4872658 0.094347421 0.37305143 0.090664063 STE11 Ser /Thr protein kinase ; MEKK homolog YLR363C -0.15601156 0.202003118 -0.369067273 0.08017826 NMD4 putative Upf1p-interacting protein YLR364W 0.880827711 0.166447764 0.305874246 0.071455596 hypothetical protein YLR365W 0.895923532 0.393380084 0.382807507 0.101744746 weak similarity to Udf2p YLR366W 0.554821457 0.355071221 0.165516371 0.642334099 hypothetical protein YLR367W 1.269342224 0.235430992 0.518766245 0.021357709 RPS22B Ribosomal protein S22B (S24B) (rp50) (YS22) YLR370C -0.03547056 0.894600066 0.599141988 0.024723008 ARC18 Arp2 /3 Complex Subunit YLR371W 0.024481523 0.951430737 1.317616321 0.320545857 ROM2 GDP-GTP Exchange Protein (GEP) for Rho1p YLR372W 2.33906914 0.25047104 0.680079177 0.047664742 SUR4 involved in fatty acid biosynthesis YLR373C -0.13594277 0.199862228 -0.208622789 0.264519854 VID22 vacuole import and degradation YLR374C -0.37342941 0.410098636 0.27064011 0.157523245 questionable ORF YLR375W -0.59537316 0.059713354 0.273233798 0.21156085 STP3 Involved in pre-tRNA splicing YLR376C 0.274041836 0.13353389 -0.215293501 0.289510728 hypothetical protein YLR377C -0.98444897 0.07661164 0.214991204 0.309597435 FBP1 fructose-1,6-bisphosphatase YLR378C 0.505108584 0.469876631 0.878147966 0.040500215 SEC61 membrane component of ER protein translocation apparatus YLR379W 0.21025299 0.736942417 0.626611833 0.046180361 questionable ORF weak similarity to SEC14 protein/chs5 spa2 rescue ; isolated as a multicopy suppressor of the lethality of chs5 spa2 double mutant at 37 YLR380W 0.158398657 0.657668375 0.522084447 0.023215166 CSR1 degrees. YLR381W 0.07697586 0.543595119 0.147946901 0.311372361 hypothetical protein YLR382C 0.024877835 0.942844215 -0.283282016 0.147493476 NAM2 mitochondrial leucyl tRNA synthetase YLR383W -0.31718438 0.231338908 -0.490925145 0.071372953 RHC18 involved in recombination repair YLR384C -0.03809767 0.894701431 0.172381854 0.135670459 IKI3 required for killer toxin sensitivity YLR385C 0.104667234 0.804994766 0.051099082 0.474380844 hypothetical protein YLR386W 0.173794585 0.458994344 -0.021950548 0.840758076 similarity to hypothetical S. pombe protein YLR387C 0.896720478 0.048102419 -0.498906277 0.020517129 similarity to YBR267w YLR388W 0.713353266 0.118570613 0.65984373 0.058852725 RPS29A Ribosomal protein S29A (S36A) (YS29) YLR389C -0.41937151 0.000508197 0.249746257 0.115187047 STE23 involved in a-factor processing YLR390W 0.967635102 0.082807271 0.547627943 0.087650748 ECM19 involved in cell wall biogenesis YLR390W-A 0.829521071 0.035168434 0.9828603 0.065115918 SSR1 cell wall structural protein /Secretory Stress Response protein YLR392C 0.241203671 0.515000572 -0.259956689 0.242255992 hypothetical protein YLR393W -0.56854449 0.216142731 -0.55560723 0.01933577 ATP10 essential for functional mitochondrial ATPase complex assembly YLR394W -0.39783823 0.299780343 -0.263060427 0.018798469 CST9 required for synapsis YLR395C -1.35733259 0.001516369 -0.05148729 0.78896176 COX8 Cytochrome-c oxidase chain VIII YLR396C -0.18432303 0.485714034 -0.18450573 0.171494817 VPS33 involved in vacuolar protein targeting YLR397C 0.409295939 0.251244349 0.113645004 0.343990081 AFG2 homology to the CDC48 gene product YLR398C 0.270163633 0.056075514 0.271145072 0.111670819 SKI2 antiviral protein, putative helicase YLR399C -0.92835548 0.023014107 -0.60455637 0.037891439 BDF1 Bdf1p contains two bromodomains, localizes to the nucleus and to chomosomes in spread meiotic nuclei but is excluded from the nucleolus YLR400W 0.017154785 0.972428836 0.165822047 0.321723304 hypothetical protein YLR401C 0.670051622 0.129819192 -0.055527938 0.772061694 similarity to A.brasilense nifR3 protein YLR402W -0.04309278 0.88556977 0.293253677 0.071226223 hypothetical protein YLR403W 0.159930383 0.284283249 0.067541405 0.561827279 SFP1 split zinc finger protein//zinc finger protein YLR404W -0.08642366 0.651350787 -0.212337211 0.079933839 hypothetical protein YLR405W 0.582415123 0.125933271 0.195722296 0.284212757 similarity to A.brasilense nifR3 protein YLR406C 1.25091373 0.075413742 -0.041507497 0.894930265 RPL31B Ribosomal protein L31B (L34B) (YL28) YLR407W 1.008814646 0.208810444 0.038369171 0.410172851 hypothetical protein YLR408C -0.04133122 0.884044974 0.021859102 0.913086364 hypothetical protein YLR409C 0.582480061 0.170179569 0.063083326 0.402883658 strong similarity to S. pombe beta-transducin YLR410W -0.48858325 0.06684769 0.084659076 0.177339364 VIP1 Homologous to S. pombe asp1+ YLR410W-A -0.25121122 0.60878085 0.056061712 0.591349609 TyA Gag protein. Gag processing produces capsid proteins. YLR411W -0.4906643 0.011555159 0.047401179 0.654253187 CTR3 Copper Transporter YLR412W 0.12040752 0.621586115 -0.090043875 0.748518713 weak similarity to Candida maltosa cytochrome P450 YLR413W 2.403055011 0.06667081 0.567564604 0.125170114 strong similarity to YKL187c YLR414C 2.288689325 0.259902984 0.151894969 0.17914353 weak similarity to YLR413w YLR415C 0.244627554 0.476632961 -0.254452668 0.244313278 questionable ORF YLR416C 0.350576274 0.667497991 0.370500638 0.66115486 hypothetical protein YLR417W 0.715461639 0.355928881 -0.000959922 0.993553261 VPS36 involved in vacuolar protein targeting YLR418C 0.102030464 0.459472178 -0.283387975 0.180794192 CDC73 RNA polymerase II accessory protein YLR419W 0.55254472 0.038199907 0.039614775 0.47759942 similarity to helicases YLR420W -0.20941897 0.409857346 0.058552559 0.780536255 URA4 dihydrooratase YLR421C 0.168841419 0.495951588 -0.529634173 0.023178616 RPN13 New 26S proteasome subunit YLR423C -1.38528875 0.000664686 -0.55673454 0.042123422 APG17 involved in autophagy YLR424W 0.39200069 0.574376321 -0.186089035 0.42304119 weak similarity to Stu1p YLR425W -0.33146617 0.410903037 -0.12372619 0.460252203 TUS1 1307 AA, hydrophilic protein. YLR426W -0.18285208 0.444824521 0.223127768 0.033288709 weak similarity to 3-oxoacyl-[acyl-carrier-protein] reductase from E. coli YLR427W -0.16701035 0.309817017 0.213149872 0.018274493 weak similarity to human transcription regulator Staf-5 YLR428C 0.074778516 0.888453471 0.160839914 0.177054024 questionable ORF YLR429W -0.03606201 0.877195631 -0.017090905 0.842500183 CRN1 has homology to the Dictyostelium and human actin-binding protein coronin YLR431C -0.06773101 0.404448154 -0.704930162 0.030764155 weak similarity to rabbit trichohyalin YLR432W 1.186581406 0.123020129 -0.218663408 0.163431317 IMD3 IMP dehydrogenase homolog YLR433C 0.222784874 0.066262349 -0.024931728 0.27309595 CNA1 Calcineurin subunit A ; type 2B protein serine /threonine phosphatase catalytic subunit A1 ; cytoplasmic YLR434C 0.786284392 0.161306258 0.057707607 0.724490911 questionable ORF YLR435W 1.061476725 0.235799796 -0.676765256 0.033362733 hypothetical protein YLR436C 0.226858988 0.063702514 2.824969395 0.328386043 ECM30 involved in cell wall biogenesis YLR437C 1.00989684 0.122830258 0.243361202 0.222053416 hypothetical protein YLR438W -0.02118002 0.978147503 0.813164386 0.040836054 CAR2 ornithine aminotransferase YLR439W 0.870184871 0.240878067 -0.010098813 0.982710692 MRPL4 Mitochondrial 60S ribosomal protein L4 YLR440C -0.24990075 0.527483913 -0.311464617 0.078837979 hypothetical protein YLR441C 1.554494625 0.166890011 -0.404773963 0.090185628 RPS1A Ribosomal protein S1A (rp10A) YLR442C -0.12146249 0.465315508 -0.434219224 0.178693126 SIR3 regulator of silencing at HML, HMR, and telomeres YLR443W 0.354019719 0.333612711 0.084809711 0.577080358 ECM7 involved in cell wall biogenesis YLR444C 0.740624487 0.155095604 0.120618944 0.151785498 questionable ORF YLR445W -0.34948591 0.443231992 -0.227009282 0.186292471 hypothetical protein YLR446W -0.15629927 0.381895532 0.374262603 0.000151981 weak similarity to hexokinases YLR447C -0.28196025 0.415193815 -0.170688793 0.104168446 VMA6 vacuolar ATPase V0 domain subunit d (36 kDa) YLR448W 0.870035304 0.077988032 0.277268059 0.052808158 RPL6B 60S ribosomal subunit protein L6B (L17B) (rp18) (YL16) YLR449W 1.272211877 0.041818171 -0.345148152 0.034568181 FPR4 60 kDa nuclear FK506 binding protein YLR451W -0.05415747 0.84904538 -0.004177496 0.981859837 LEU3 zinc-finger transcription factor of the Zn(2)-Cys(6) binuclear cluster domain type YLR452C 0.098745115 0.535350608 0.51419758 0.106250621 SST2 member of the RGS (regulator of G-protein signalling) family ; GTPase-activating protein YLR453C -0.00529984 0.974931769 -0.214328495 0.218257953 RIF2 Nuclear protein YLR455W -0.15726437 0.350692531 -0.474707766 0.004841575 weak similarity to human G/T mismatch binding protein YLR456W 0.077168527 0.905667407 -0.43018684 0.1004765 strong similarity to YPR172w YLR457C 0.060765819 0.752365655 -0.658317065 0.036360832 NBP1 Nap1p binding protein YLR458W 0.129850325 0.862311827 0.010115448 0.908065435 questionable ORF YLR459W 0.199123346 0.505787011 0.824455849 0.039457194 CDC91 member of major facilitator superfamily YLR460C -0.45708849 0.114967343 0.23187614 0.049313948 similarity to C.carbonum toxD protein YLR461W -0.34126172 0.471029289 0.639316659 0.178979018 PAU4 member of the seripauperin protein family YLR462W -0.67165214 0.032688482 0.439791677 0.08377855 strong similarity to subtelomeric encoded proteins YLR463C -0.80390583 0.008341984 0.45365435 0.114968976 strong similarity to subtelomeric encoded proteins YLR465C -0.84844932 0.028872535 0.877053649 0.098255457 questionable ORF YML001W -0.17913904 0.591479437 -0.099383303 0.024000243 YPT7 GTP-binding protein, rab family YML002W -0.62371201 1.02476E-05 0.058782964 0.281709084 hypothetical protein YML004C -0.39911618 0.166626642 0.018961872 0.755975492 GLO1 lactoylglutathione lyase (glyoxalase I) YML005W 0.113689256 0.273682442 -0.002110181 0.928898972 similarity to hypothetical S.pombe protein YML006C -0.18732896 0.30161409 -0.151962833 0.404349513 GIS4 CAAX box containing protein YML007W 0.073806663 0.781703538 -0.58535854 0.035669729 YAP1 jun-like transcription factor YML008C 0.034984887 0.859098914 0.079253316 0.80573747 ERG6 S-adenoslymethionine: delta 24-methyltransferase YML009C -0.02998587 0.894648614 -0.255482996 0.120237851 MRPL39 Mitochondrial ribosomal protein MRPL39 (YmL39) YML010C-B -0.3591597 0.410581343 0.159851253 0.324736435 Hypothetical ORF YML010W -0.2523226 0.478332644 -0.270656794 0.035155966 SPT5 transcription factor YML010W-A -0.13220377 0.756469546 -0.350486745 0.1151672 Hypothetical ORF YML011C -0.48580131 0.152627686 0.124669334 0.100392423 hypothetical protein YML012W 0.342256647 0.347143568 -0.091472795 0.187185934 ERV25 vesicle coat component YML013W -0.5153498 0.231957941 0.099861988 0.501943629 hypothetical protein YML014W 0.124150249 0.390909948 0.070372113 0.315360659 putative methyltransferase YML015C 0.710511689 0.002179013 -0.043279449 0.667677876 TAF40 TFIID subunit YML016C 1.39984691 0.127974696 0.275865477 0.251104843 PPZ1 serine-threonine phosphatase Z YML018C 1.966071835 0.156645639 0.76789123 0.01065662 similarity to YDR438w YML019W 0.006212465 0.970793396 0.161399642 0.02802899 OST6 Putative new 37kDa subunit of N-oligosaccharyltransferase complex YML020W 0.220000946 0.299362245 -0.064208148 0.753633108 hypothetical protein YML021C 0.605180254 0.159892873 0.136102475 0.105545193 UNG1 uracil DNA glycosylase YML022W 1.574821501 0.084876144 0.413895622 0.09729188 APT1 Adenine phosphoribosyltransferase YML023C 1.0873711 0.040604674 0.213812817 0.133897316 weak similarity to Nmd2p YML027W 0.062612704 0.88289699 0.587824944 0.10021165 YOX1 Homeobox-domain containing protein thioredoxin-peroxidase (TPx) ; reduces H2O2 and alkyl hydroperoxides with the use of hydrogens provided by thioredoxin, thioredoxin YML028W 0.389743088 0.376660716 0.74141634 0.189744697 TSA1 reductase, and NADPH YML029W -0.55491151 0.01279704 0.33106287 0.161429151 Thiol-specific antioxidant YML030W -0.30395456 0.106118109 -0.199857919 0.009464183 hypothetical protein YML031W 0.446050029 0.226233735 0.576624648 0.149410037 NDC1 Nuclear envelope protein with multiple putative transmembrane domains Required for X-ray damage repair and various types of intra-and interchromosomal mitotic recombination, including HO switching and plasmid YML032C 0.263644477 0.256494392 -0.151398652 0.09115112 RAD52 exchange. Dispensable for premeiotic DNA synthesis, double strand breaks, synaptonemal complexes, and heteroduplex fo YML033W -0.02133074 0.933649611 -0.022606579 0.892534543 similarity to YDR458c YML035C -0.05990664 0.79121999 0.02160646 0.759710663 AMD1 putative alpha-mannosidase YML036W 0.670560773 0.425063065 0.034144402 0.700928257 weak similarity to C.elegans hypothetical protein CELW03F8 YML037C 0.166460287 0.426708251 0.081910426 0.629468729 hypothetical protein YML038C 0.398437088 0.487918607 -0.003196669 0.933355923 YMD8 similar to vanadate resistance protein Gog5 YML040W 0.708662419 0.14338583 0.631069029 0.009887556 TY1A TyA Gag protein. Gag processing produces capsid proteins. YML041C -0.56126371 0.134492387 -0.154744946 0.500333073 hypothetical protein YML042W -0.73925188 0.140972479 0.09738589 0.531275076 CAT2 Carnitine O-acetyltransferase, peroxisomal and mitochondrial YML043C 1.72853698 0.225060033 -0.642207025 0.169712692 RRN11 component of rDNA transcription factor TyB Gag-Pol protein. Gag processing produces capsid proteins. Pol is cleaved to produce protease, reverse transcriptase and integrase YML045W 1.452862562 0.178711927 0.592817734 0.025292689 activities. YML046W 0.335614794 0.297705142 -0.60516554 0.03632376 PRP39 RNA splicing factor associated with U1 snRNP YML047C 1.451880683 0.250998179 0.938683712 0.422649731 PRM6 pheromone-regulated membrane protein YML048W 0.542032496 0.343361538 0.391983289 0.138252267 GSF2 involved in glucose repression YML050W -0.32868424 0.245821079 -0.193809648 0.061635602 weak similarity to potato sucrose cleavage protein YML051W 0.075255443 0.758275569 0.461049291 0.059799291 GAL80 transcriptional regulator YML052W 0.926880154 0.356572687 0.878563131 0.097734744 SUR7 putative integral membrane protein YML053C 0.971074495 0.20206976 -0.186057627 0.577163057 hypothetical protein YML054C -1.99351167 0.002825054 -0.227684377 0.065007387 CYB2 Cytochrome b2 [L--lactate cytochrome-c oxidoreductase] YML055W 0.038103565 0.857255246 -0.232187757 0.24527349 SPC2 subunit of signal peptidase complex, homologous to mammalian protein SPC25 YML057W -0.18106786 0.432762426 0.423861228 0.044551913 CMP2 Catalytic A subunit of calcineurin, type 2B protein serine /threonine phosphatase ; redundant with Cna1 ; cytoplasmic YML058C-A -0.04461605 0.914587867 0.451834016 0.459451961 Hypothetical ORF YML058W 0.622024612 0.054965586 0.975747282 0.067033996 SML1 Suppressor of mec lethality YML058W-A 1.09718438 0.144115737 0.973563159 0.151535202 HUG1 induced by DNA damage and replication arrest YML060W 0.686232617 0.242215046 -0.318688297 0.085137275 OGG1 43-kDa 8-oxo-guanine DNA glycosylase YML061C -0.15022032 0.281121276 -0.393515253 0.056268281 PIF1 5' to 3' DNA helicase YML062C 0.2140101 0.336015549 -0.557107445 0.04820627 MFT1 mitochondrial targeting protein YML063W 1.742679322 0.058802357 -0.16214849 0.452235157 RPS1B Ribosomal protein S1B (rp10B) YML064C 1.269831825 0.072338199 0.072034698 0.794026632 TEM1 GTP-binding protein, RAS superfamily 120-kDa (largest) subunit of origin recognition complex (ORC) ; shows homology to Cdc6p, Cdc18p, and Sir3p and to proteins from K. lactis, S. YML065W 0.065184979 0.862166624 -0.764565618 0.074352169 ORC1 pombe, and humans YML066C -0.16639679 0.542242845 0.029985063 0.816174212 hypothetical protein YML067C 0.199305346 0.656146905 0.057510164 0.62889889 ERV41 ER Vesicle protein YML068W 0.092511915 0.604796541 -0.280646307 0.060059947 similarity to C.elegans hypothetical protein YML069W 0.017602132 0.951982607 -0.874463763 9.44E-06 POB3 binds DNA polymerase delta YML070W -1.42012886 0.003647865 0.163342564 0.298338898 DAK1 putative dihydroxyacetone kinase YML072C -0.0257478 0.924515215 0.153448679 0.422649731 similarity to YOR3141c and YNL087w YML073C 1.026189219 0.00333147 0.273738884 0.143152681 RPL6A Ribosomal protein L6A (L17A) (rp18) (YL16) YML074C -0.43063724 0.164469105 -0.217056511 0.251394661 NPI46 Prolyl cis-trans isomerase, also called proline rotamase or peptidylprolyl cis-trans isomerase (PPIase) YML075C -0.21597775 0.042177271 0.437634012 0.090498638 HMG1 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) reductase isozyme YML076C 0.110721958 0.259397663 0.080015963 0.326281927 weak similarity to transcription factor YML077W 0.519084643 0.249409132 -0.195013625 0.444020089 BET5 Bet5p /18kD component of TRAPP YML078W 0.073136302 0.792818437 0.394296765 0.109102147 CPR3 cyclophilin-3 (cyclosporin-sensitive proline rotamase-3) YML079W 0.228951151 0.218961157 -0.021002629 0.84714055 weak similarity to Synechocystis sp. hypothetical protein sll1188 YML080W 0.356448914 0.322055742 -0.173162618 0.082759994 similarity to A.brasilense nifR3 protein YML081C-A -0.23829655 0.20478869 0.824421799 0.063093133 ATP18 protein associated to the ATP synthase YML081W 0.272170229 0.168866359 0.137791336 0.029456078 strong similarity to ZMS1 protein YML082W -0.01888022 0.959934838 -0.2359562 0.21083639 similarity to N.crassa O-succinylhomoserine (thiol)-lyase YML083C -0.46131347 0.414156298 0.228160965 0.3889877 hypothetical protein YML084W 0.741992709 0.502048966 0.082721683 0.484760325 hypothetical protein YML086C -0.85828701 0.005375727 0.270424195 0.269461147 ALO1 D-arabinono-1,4-lactone oxidase YML087C -0.14258093 0.764372578 -0.151979312 0.083240274 strong similarity to YML125c, similarity to cytochrome-b5- and nitrate reductases YML088W 0.225978427 0.496172258 -0.288139093 0.054595697 UFO1 F-box protein YML089C -0.10541552 0.831138162 0.10405335 0.742273551 questionable ORF YML090W 0.244645981 0.629805937 0.102525033 0.597641362 hypothetical protein YML091C 0.304527294 0.539788379 0.014392213 0.895607243 RPM2 subunit of mitochondrial RNase P YML092C 0.774221085 0.248383472 0.24789629 0.178843454 PRE8 proteasome component Y7 YML093W 1.267896157 0.092429826 -1.278820499 0.00656629 similarity to P.falciparum liver stage antigen LSA-1 YML095C 0.022990614 0.89256165 0.065850347 0.087532449 RAD10 ssDNA endonuclease YML096W 0.337267627 0.023436322 -0.134452403 0.310994732 similarity to asparagine synthases YML097C 0.49259067 0.026864619 -0.589729 0.070950204 VPS9 similar to mammalian ras inhibitors YML098W -0.21469587 0.293060727 -0.3126139 0.020033953 TAF19 TFIID subunit YML099C 0.511970542 0.007540614 -0.191627705 0.115493238 ARG81 zinc-finger transcription factor of the Zn(2)-Cys(6) binuclear cluster domain type YML100W -1.39430431 0.003301222 0.629663471 0.081678528 TSL1 123 kD regulatory subunit of trehalose-6-phosphate synthase /phosphatase complex ; homologous to TPS3 gene product YML101C 0.320959375 0.237682217 0.714347402 0.123606179 weak similarity to YMR264w YML102C-A 0.182679469 0.397776163 0.444962368 0.092347932 Hypothetical ORF YML102W -0.27570764 0.457492097 0.370147122 0.226328445 CAC2 p60 subunit of the yeast omatin Assembly Factor-I (CAF-I) YML104C 0.175988306 0.225768458 -0.271439094 0.154077167 MDM1 intermediate filament protein YML105C -0.16236289 0.507638138 -0.430193171 0.138337981 SEC65 signal recognition particle subunit, homologue of mammalian SRP19 YML106W 1.4014946 0.143723054 0.034297504 0.679782645 URA5 Orotate phosphoribosyltransferase 1 YML107C 0.581679171 0.354501413 -0.026307012 0.822150756 strong similarity to ubiquitination protein Bul1p YML108W 0.690435668 0.142755891 -0.242460248 0.373174834 hypothetical protein YML109W -0.17205833 0.32050189 -0.479897434 0.025808419 ZDS2 multicopy suppressor of sin4 /Zds1 homolog YML110C -0.52395172 0.144046549 -0.246558576 0.035967531 COQ5 ubiquinone biosynthesis, methyltransferase /Putative mitochondrial C-methyltransferase YML111W 0.291465016 0.158231168 -0.051339535 0.769022485 BUL2 (putative) ubiquitin-mediated protein degradation YML112W 0.101840686 0.687809651 0.296059825 0.003821768 CTK3 CTD kinase-I gamma subunit YML113W 1.062701869 0.036385521 0.091926788 0.433856181 DAT1 datin, an oligo(dA).oligo(dT)-binding protein YML114C 0.18030604 0.731972035 0.138586957 0.065585277 TAF65 TAF65, subunit of transcription factor TFIID YML115C 0.144812688 0.548154347 0.133249377 0.256488302 VAN1 mannosyltransferase YML116W 0.512826463 0.265331616 0.10248028 0.15759941 ATR1 predicted protein is very hydrophobic, has many membrane-spanning regions, several potential glycosylation sites, potential ATP-binding site YML117W -0.21351773 0.344655249 0.142006027 0.43367796 similarity to YPL184c YML117W-A -0.03986426 0.740671522 0.361054444 0.355091235 Hypothetical ORF YML118W -1.12769342 0.007358735 -0.016651271 0.883415616 similarity to YMR285c YML119W 0.684571484 0.01825862 -0.092839628 0.683674373 hypothetical protein YML120C -1.26208279 0.005664502 0.23156987 0.120564615 NDI1 NADH dehydrogenase (ubiquinone) YML121W -0.39489151 0.161017802 -0.658459851 0.030137611 GTR1 Putative small GTPase YML122C 0.456320187 0.372013429 0.230738407 0.609060993 hypothetical protein YML123C -0.97425551 0.119031649 0.376454618 0.144705054 PHO84 inorganic phosphate transporter, transmembrane protein YML125C 1.314895952 0.107027922 0.36137858 0.166280806 strong similarity to cytochrome-b5- and nitrate reductases YML126C 0.389358349 0.390914654 0.26446624 0.231596411 ERG13 3-hydroxy-3-methylglutaryl coenzyme A synthase YML127W 0.084621874 0.758117362 0.145768761 0.209999046 weak similarity to Los1p YML128C -2.95397054 0.000313955 -0.171021352 0.264149536 MSC1 weak similarity to S. pombe SPBC365.12c protein of unknown function YML129C 0.266342455 0.478017544 0.136636031 0.249299964 COX14 mitochondrial membrane protein YML130C 0.970733449 0.314965308 -0.289473701 0.023087232 ERO1 involved in protein disulfide bond formation in the ER YML131W -0.67623897 0.123307119 0.263657137 0.100851239 similarity to human leukotriene b4 12-hydroxydehydrogenase YML133C -1.09536934 0.000710625 0.589871037 0.126315322 hypothetical protein Y'.2 YMR001C 0.786287258 0.020155255 -0.446577854 0.187627665 CDC5 protein kinase which functions at the G(sub)2 /M boundary YMR002W 0.308481678 0.331741088 -0.145333258 0.23237947 similarity to hypothetical S.pombe and C.elegans proteins YMR003W 0.766400719 0.296336498 -0.052458276 0.814981525 hypothetical protein YMR004W -0.38407508 0.03202109 -0.933520048 0.095823939 MVP1 peripheral Golgi membrane protein YMR005W -0.17550974 0.313341188 -0.167303751 0.235663351 MPT1 involved in protein synthesis YMR006C -0.04747314 0.663511429 -0.350323224 0.007836703 PLB2 lysophospholipase /phospholipase B YMR007W 0.017765248 0.935103628 0.37191329 0.275682213 hypothetical protein YMR008C -0.42477485 0.236561387 0.311717462 0.30092876 PLB1 Phospholipase B (lypophospholipase) YMR009W 0.359699725 0.542908849 -0.297711039 0.087409462 weak similarity to P.aeruginosa regulatory protein mmsR YMR010W 1.148314898 0.163477143 0.064027186 0.001804158 weak similarity to hypothetical protein YDR352w YMR011W 2.356034442 0.269091659 0.664093563 0.02644634 HXT2 high affinity hexose transporter-2 YMR012W 0.501345408 0.184095151 0.263852243 0.063731285 CLU1 translation initiation factor eIF3 subunit YMR013C 0.189511047 0.750747205 -0.057467671 0.406774962 SEC59 membrane protein required for core glycosylation YMR014W 0.990230664 0.134311899 -0.86509536 0.08284003 BUD22 weak similarity to S.pombe hypothetical protein SPAC4F10 YMR015C -0.59891794 0.023072111 0.270856522 0.052831087 ERG5 cytochrome P450 involved in C-22 denaturation of the ergosterol side-chain YMR016C 0.720169274 0.162116945 -0.012628457 0.540846055 SOK2 displays homologies to several transcription factors YMR017W -0.36124793 0.38900067 0.199456002 0.340403619 SPO20 DBF2 Interacting Protein ; SNAP 25 homolog YMR018W 0.291704184 0.640237834 0.188489781 0.193582093 similarity to tetratricopeptide-repeat protein PAS10 YMR019W -0.28301766 0.471137886 -0.285493676 0.132050168 STB4 Binds Sin3p in two-hybrid assay YMR020W -1.15526406 0.001889637 -0.226619955 0.27920354 FMS1 Multicopy suppressor of fenpropimorph resistance (fen2 mutant), shows similarity to Candida albicans corticosteroid-binding protein CBP1 YMR021C 0.465235707 0.327276557 -0.167225505 0.072576523 MAC1 metal-binding transcriptional activator YMR022W 0.022382409 0.895490359 0.494500307 0.011353631 QRI8 ubiquitin conjugating enzyme YMR023C 0.165381528 0.184550876 -0.643106652 0.000714395 MSS1 putative mitochondrial GTPase YMR024W 1.20206789 0.027139418 -0.071102914 0.269530372 MRPL3 Mitochondrial ribosomal protein MRPL3 (YmL3) YMR025W -0.68559244 0.010327047 -0.739280218 0.036688186 hypothetical protein YMR026C -0.30499743 0.235852224 0.69941981 0.187173512 PEX12 required for biogenesis of peroxisomes - peroxin /C3HC4 zinc-binding integral peroxisomal membrane protein component of the Tor signaling pathway /42 kDa protein that pysically associates with the PP2A and SIT4 protein phosphatase catalytic YMR028W -0.1591052 0.45552882 -0.594321736 0.090223501 TAP42 subunits YMR029C -0.02762874 0.909786782 0.324029248 0.104794359 weak similarity to human nuclear autoantigen YMR030W -0.01264502 0.981027442 -0.152615051 0.649343527 hypothetical protein YMR031C -1.01763613 0.009452865 -0.397868554 0.068980882 similarity to YKL050c and human restin YMR031W-A -0.61295579 0.137996265 -0.055660387 0.623741278 questionable ORF YMR032W 0.191347146 0.555221069 -0.181752491 0.10044349 HOF1 SH3 domain containing-protein required for cytokinesis YMR034C -0.24439434 0.549990861 0.319374396 0.332534768 weak similarity to YPR201w YMR035W -0.64057332 0.179229189 0.082377911 0.647269383 IMP2 mitochondrial inner membrane protease YMR036C -0.04163075 0.885038424 -0.184046553 0.337780681 MIH1 homolog of S. pombe cdc25 YMR037C -0.15757751 0.333889018 0.342869817 0.020700236 MSN2 zinc finger protein YMR038C 0.473468429 0.214318344 0.357343664 0.077782492 LYS7 copper chaperone for superoxide dismutase Sod1p YMR039C -0.04209105 0.903668303 -0.788317139 0.036941918 SUB1 transcriptional coactivator YMR040W -1.00948233 0.02229135 -0.369187731 0.09717042 strong similarity to Yet1p YMR041C -0.51704103 0.001951217 0.230575113 0.168253457 weak similarity to Pseudomonas L-fucose dehydrogenase YMR042W 0.947013552 0.009583556 0.375038334 0.118909076 ARG80 transcription factor transcription factor containing the 56 amino-acid MADS (MCM1, AG, DEFAm SRF)-box motif within its DNA binding domain, plays a central YMR043W 0.166167207 0.539177093 0.16128175 0.105265217 MCM1 role in the formation of both repressor and activator complexes YMR044W -0.40029012 0.169804391 -0.565001006 0.036374342 IOC4 ISWI One Complex YMR046C 0.634736242 0.139684972 0.444062041 0.029753176 TyA Gag protein. Gag processing produces capsid proteins. YMR046W-A -0.07593446 0.737166714 0.372618992 0.122269809 YMR047C -0.14941374 0.693462869 -0.235881351 0.088582567 NUP116 Nuclear pore complex protein that is member of GLFG repeat-containing family of nucleoporins and is highly homologous to Nup100p YMR048W 0.02801237 0.801838167 -0.317797484 0.100676757 hypothetical protein YMR049C 0.698645644 0.18151835 0.064028334 0.712910014 weak similarity to A.thaliana PRL1 protein YMR051C 1.677752471 0.076818942 0.478739794 0.017706852 TyA Gag protein. Gag processing produces capsid proteins. YMR052C-A -0.09793033 0.200882376 0.067400644 0.573305945 questionable ORF YMR052W 0.33883818 0.0376798 -0.483982149 0.117085668 FAR3 involved in the cell cycle YMR053C -0.18846361 0.546498014 -0.114251306 0.551896589 STB2 Sin3p binding protein YMR054W 0.716700187 0.265496168 0.147095698 0.461829469 STV1 vacuolar ATPase V0 domain subunit a (110 kDa) YMR055C -0.20500848 0.350200852 0.563166355 0.027318262 BUB2 involved in cell cycle checkpoint YMR056C -0.70449183 0.04635895 0.188849573 0.554953943 AAC1 mitochondrial ADP /ATP translocator YMR058W 1.059121028 0.078604706 0.787857281 0.062223661 FET3 multicopper oxidase YMR059W 0.368133703 0.17476713 -0.18062873 0.202008378 SEN15 15kDa subunit of the tetrameric tRNA splicing endonuclease mitochondrial import receptor, heterodimerizes with Tom70p, preferentially recognizes the mature regions of precursor proteins associated with YMR060C -0.22438205 0.124609572 -0.563181695 0.037999993 TOM37 ATP-dependent cytosolic chaperones YMR061W -0.05869571 0.754455013 -0.614763236 0.090418683 RNA14 component of the cleavage and polyadenylation factor CF I involved in pre-mRNA 3'-end processing YMR063W -0.45861186 0.071598796 -0.077691183 0.46315177 RIM9 involved in sporulation YMR064W -0.21454589 0.286506088 -0.225755669 0.218924272 AEP1 basic, hydrophilic protein of 59 kDa YMR065W -0.48954364 0.098439666 -0.490550988 0.167931897 KAR5 coiled-coil membrane protein YMR066W 0.324732103 0.109930902 -0.817686432 0.038007597 SOV1 (putative) involved in respiration YMR067C 0.150920711 0.456751726 0.153754652 0.328479005 hypothetical protein YMR068W -0.00185462 0.997392698 0.473186628 0.039336267 weak similarity to mouse transcription factor NF-kappaB YMR069W 0.692708925 0.030059371 0.488769619 0.057009745 hypothetical protein YMR070W 0.182394671 0.554847054 0.015694499 0.907675923 MOT3 2 Cys2-His2 zinc fingers at c-terminus, glutamine and asparagine rich YMR071C -0.21223109 0.146728498 0.144735628 0.080993553 hypothetical protein YMR072W -0.52414262 0.074002248 -0.01135722 0.897056489 ABF2 HMG-1 homolog, mitochondrial YMR073C -0.12647255 0.308035731 0.040908269 0.671637268 weak similarity to C-terminal part of cytochrome b5 and b2 YMR074C 0.723712979 0.096274736 0.089925185 0.00961619 strong similarity to hypothetical S. pombe protein YMR075C-A -0.23489713 0.361783875 0.0549844 0.678855733 questionable ORF YMR075W -0.1149251 0.210450533 -0.353058092 0.040761959 weak similarity to human Mi-2 protein YMR076C 0.123873327 0.547348197 -0.087099598 0.632295977 PDS5 (putative) involved in sister chromosome cohesion during mitosis YMR077C -0.29344922 0.343416321 -1.04043854 0.035957558 similarity to SNF7 protein YMR078C -0.39086233 0.003953538 -0.094287538 0.489753402 CTF18 (putative) involved in chromosome transmission during mitosis YMR079W 1.106821306 0.132234662 0.67564863 0.036898024 SEC14 phosphatidylinositol transfer protein YMR080C 0.488119679 0.110510353 0.249789811 0.073386023 NAM7 putative helicase YMR081C -2.37712727 0.002231547 -0.047766292 0.68591227 ISF1 involved in mitochondrial RNA splicing YMR082C -0.04317643 0.837192085 -0.314769657 0.213843231 hypothetical protein YMR083W 1.522877191 0.215971118 0.111044286 0.323626353 ADH3 alcohol dehydrogenase isoenzyme III YMR084W -0.57297111 0.080883179 0.537388059 0.081255944 putative pseudogene YMR085W -0.68868315 0.036284321 0.317493764 0.006607448 putative pseudogene YMR086C-A -0.93219355 0.036203482 0.556479574 0.054812619 questionable ORF YMR086W -0.78668121 0.048195326 -0.060530111 0.496177199 similarity to YKL105c YMR087W -0.8627064 1.03192E-05 0.307447962 0.135084063 hypothetical protein YMR088C -0.50526198 0.227552027 0.277580965 0.307770543 similarity to multidrug resistance proteins YMR089C 0.1535597 0.631851674 -0.369947033 0.045716 YTA12 mitochondrial membrane ATPase of the CDC48 /PAS1 /SEC18 (AAA) family YMR090W -2.03723452 1.15313E-05 -0.020646092 0.912941956 strong similarity to B. subtilis conserved hypothetical protein yhfK YMR091C -0.05511771 0.64769867 -0.590098516 0.048654238 NPL6 involved in nuclear protein targeting YMR092C -0.50674192 0.192445275 -0.190746687 0.297331311 AIP1 actin cortical patch component YMR093W 1.672381212 0.11093893 0.332348619 0.097519441 weak similarity to Pwp2p YMR094W 1.115105193 0.199565855 0.217428869 0.308671245 CTF13 58 kd component (Cbf3c) of the multisubunit 'Cbf3' kinetochore protein complex, which binds to the CDE III element of centromeres YMR095C 1.517025638 0.319035525 -0.330511664 0.103536717 SNO1 SNZ1 proximal ORF, stationary phase induced gene YMR096W 1.746299457 0.30177541 0.30948747 0.264809251 SNZ1 encodes highly conserved 35 kDa protein that shows increased expression after entry into stationary phase YMR097C -0.0480728 0.786533703 0.018144127 0.869740997 weak similarity to M.genitalium hypothetical protein homolog MG442 YMR098C -0.30606868 0.180140327 -0.39158668 0.032354855 hypothetical protein YMR099C 0.176606943 0.636017987 -0.007494338 0.914255651 similarity to P.ciliare possible apospory-associated protein YMR100W -0.46150016 0.08792929 -0.276325413 0.105324053 MUB1 involved in bud site selection YMR101C -0.41725292 0.242316427 0.099514604 0.730283328 SRT1 cis-prenyltransferase homologue YMR102C 0.387781722 0.335204827 -0.234093463 0.112918541 strong similarity to YKL121w YMR103C -0.10324824 0.723863049 0.23036395 0.114276308 hypothetical protein YMR104C -0.32821171 0.423992029 -0.265165914 0.05873885 YPK2 protein kinase YMR105C -3.20889466 1.68939E-05 -0.157247468 0.741875336 PGM2 Phosphoglucomutase YMR106C -0.98013158 0.021341644 -0.43726866 0.02036878 YKU80 Exhibits DNA binding activity on its own, associates with Hdf1p to form major DNA end-binding complex YMR107W -2.67147897 0.001772375 0.681216898 0.343558111 hypothetical protein YMR108W 0.079927072 0.770570992 -0.104381395 0.223869979 ILV2 acetolactate synthase YMR110C -0.99584692 0.014763566 -0.109118868 0.370935378 similarity to aldehyde dehydrogenase YMR111C -0.01382479 0.94957492 -0.374534722 0.215476607 weak similarity to MSN1 protein YMR112C -0.00875443 0.970065018 -0.340975255 0.090840677 MED11 14 Kd mediator subunit of RNA polymerase II holoenzyme YMR113W 0.30171722 0.253740656 -0.48704156 0.053379861 FOL3 dihydrofolate synthetase YMR114C -1.50478562 0.003197175 -0.467242629 0.156679064 similarity to B. subtilis conserved hypothetical proteins yoqW and yoaM YMR115W 0.060758938 0.638957942 -0.095460067 0.290359614 similarity to YKL133c YMR116C 1.860177214 0.120634508 0.341759603 0.175312026 ASC1 G-beta like protein YMR117C 0.450255455 0.507143909 0.033873532 0.627183334 SPC24 component of spindle pole YMR118C -1.66249167 0.013425741 0.011088212 0.956504261 strong similarity to succinate dehydrogenase YMR119W 0.011845947 0.977218836 0.435967598 0.161000766 similarity to YNL008c YMR119W-A 0.050932168 0.803321272 0.57543957 0.055869149 questionable ORF YMR120C 0.885483661 0.319192822 0.391831079 0.130233593 ADE17 5-aminoimidazole-4-carboxamide ribonucleotide (AICAR) transformylase /IMP cyclohydrolase YMR121C 0.262738181 0.54140267 -0.251930545 0.055356559 RPL15B Ribosomal protein L15B (YL10) (L13B) (rp15R) YMR122C 0.962948554 0.359883889 0.208633189 0.034269708 hypothetical protein YMR122W-A 1.206514315 0.301432573 0.180422465 0.374430682 YMR123W 1.32870458 0.006737786 0.343344263 0.087375874 PKR1 Pichia farinosa killer toxin resistance YMR124W 0.367714979 0.137042432 -0.04046 0.675322144 weak similarity to YLR031w YMR125W -0.53549001 0.078165471 -0.413375343 0.022140303 STO1 transcriptional activator of glycolytic genes YMR126C -0.35113141 0.014110201 -0.26807916 0.040595887 hypothetical protein YMR127C 0.0724062 0.567069843 -0.284345164 0.092364051 SAS2 involved in silencing at HMR /zinc-finger protein YMR128W 0.529389148 0.075006145 -0.637239722 0.044674485 ECM16 (putative) involved in cell wall biogenesis YMR130W 0.367228984 0.36437055 -0.249940588 0.082907581 similarity to D.melanogaster Dreg-2 protein YMR131C 1.119812007 0.091654275 -0.45608874 0.012146845 RSA2 RiboSome Assembly 2 YMR132C 0.556578889 0.206300385 -0.323249632 0.393587917 similarity to hypothetical S. pombe protein YMR133W -0.51207553 0.129376501 0.150564397 0.449061785 REC114 mRNA is induced early in sporulation YMR134W 0.413072652 0.293595464 -0.198016333 0.413302805 hypothetical protein YMR135C -0.71697025 0.130552799 0.078670551 0.137484293 hypothetical protein YMR135W-A 0.078072174 0.777545839 -0.016086524 0.938941697 questionable ORF YMR136W -0.21423799 0.48979465 0.278184238 0.126298265 GAT2 GATA zinc finger transcription factor YMR137C -0.70039701 0.095407114 -0.63298344 0.079605635 PSO2 interstrand crosslink repair protein YMR138W -0.69999131 0.007631934 -0.32112459 0.177904349 CIN4 GTP-binding protein YMR139W -0.79867392 0.012824524 -0.065800693 0.553017564 RIM11 Serine /threonine protein kinase, phosphorylates the mitotic activator IME1 YMR140W -0.98659872 0.018477213 0.080245636 0.686524742 hypothetical protein YMR141C 0.15239395 0.559009573 0.18918428 0.279409511 hypothetical protein YMR143W 1.675148389 0.054405733 0.413165616 0.055348219 RPS16A Ribosomal protein S16A (rp61R) YMR144W 0.82117489 0.23341683 1.365630628 0.229661396 weak similarity to Mlp1p YMR145C -0.04916827 0.90498519 -0.120686468 0.328024297 mitochondrial cytosolically directed NADH dehydrogenase YMR146C 0.928998737 0.010588263 0.232605548 0.117364419 TIF34 p39 subunit of translation initiation factor eIF3 YMR147W -0.02640509 0.903536883 -0.220578872 0.335047278 hypothetical protein YMR148W -0.26059624 0.080944646 0.767130452 0.142448028 hypothetical protein YMR149W 0.454917453 0.052962441 0.505957993 0.048558409 SWP1 oligosaccharyl transferase glycoprotein complex, delta subunit YMR150C -0.87976781 0.000339102 -0.092139616 0.285106986 IMP1 Inner membrane protease (mitochondrial protein) YMR151W -0.07018535 0.911930052 -0.072723226 0.765929138 YIM2 hypothetical protein YMR152W -0.48641474 0.036063249 0.243819117 0.196154937 YIM1 Mitochondrial inner membrane protease, similar to E. coli leader peptidase YMR153C-A -0.3430803 0.340961393 0.062345666 0.222012181 questionable ORF YMR153W -0.34813312 0.076429876 -0.762382349 0.012853197 NUP53 Component of karyopherin docking complex of the nuclear pore complex YMR154C -0.0613831 0.643896833 0.045112284 0.278459841 RIM13 Cysteine protease similar to E. nidulans palB YMR155W -0.93174709 0.024161614 0.126904389 0.320637369 weak similarity to E.coli hypothetical protein f402 YMR156C -0.48373588 0.087892573 0.175678761 0.00682492 TPP1 similarity to mammalian polynucleotide kinase 3'-phosphatase /Three Prime Phosphatase 1 YMR157C -0.5103755 0.032869343 -0.134587325 0.178721696 hypothetical protein YMR158C-B -0.50566359 0.300928357 0.078417238 0.14653225 YMR158W 0.714607723 0.023281397 -0.305914431 0.278444322 weak similarity to E.coli ribosomal S8 protein YMR158W-A 0.510499811 0.549247664 -0.176100725 0.466536353 YMR159C -0.28127464 0.283338004 -0.017467855 0.937923518 APG16 Protein homologous to human Sin3 complex component SAP18, possible coiled-coil protein// coiled-coil protein required for autophagy YMR160W -0.73787114 0.014167128 -0.004031494 0.799313585 weak similarity to fruit fly ecdysone-inducible protein YMR161W 0.145373117 0.350907606 -0.08040655 0.229572097 HLJ1 similar to E. coli DnaJ YMR162C -0.44027319 0.068260235 0.228624966 0.148360295 similarity to ATPases YMR163C 0.182806024 0.253094033 -0.408067068 0.020310313 hypothetical protein YMR165C -0.91887237 0.0179073 -0.072696492 0.508116129 SMP2 involved in respiration and plasmid maintenance YMR166C 0.598452322 0.034841025 0.05759138 0.631066152 similarity to members of the mitochondrial carrier protein family YMR167W 0.171993369 0.400582789 -0.041168568 0.503492408 MLH1 MutL homolog, forms a complex with Pms1p and Msh2p to repair mismatched DNA YMR168C -0.10498024 0.602860867 -0.059842596 0.646121848 CEP3 contains an N-terminal Zn2Cys6 type zinc finger domain, a C-terminal acidic domain and a putative coiled coil dimerization domain YMR169C -2.35811947 5.4083E-05 -0.033455544 0.814897834 ALD3 aldehyde dehydrogenase YMR170C -2.0045815 1.67199E-05 -0.011858319 0.955950359 ALD2 Cytosolic aldeyhde dehydrogenase YMR171C -0.67677954 0.076758963 0.137394439 0.386103449 similarity to YKL124w YMR172C-A -0.30664369 0.451006896 0.143179619 0.337530271 questionable ORF YMR172W -0.14551841 0.73215977 -0.193810529 0.090449122 HOT1 nuclear protein YMR173W -0.97342644 0.01526903 0.121367271 0.277750778 DDR48 flocculent specific protein ; contains >35 repeats of the amino acid sequence NNNDSYGS YMR174C -1.65018715 0.00323982 0.134406128 0.313069019 PAI3 Cytoplasmic inhibitor of proteinase Pep4p YMR175W -2.94701745 0.001614263 0.018681928 0.840136408 SIP18 Salt-Induced Protein of 18 kDa YMR176W 0.054351983 0.900830466 0.009833994 0.868888534 ECM5 (putative) involved in cell wall biogenesis YMR177W 1.493712141 0.204229376 -0.145651751 0.451770064 MMT1 (putative) mitochondrial metal transporter YMR178W -0.41223474 0.166299979 -0.390059109 0.111162707 similarity to C.elegans hypothetical protein YMR179W 0.275636867 0.046748608 -0.154913311 0.441023502 SPT21 non-specific DNA binding protein YMR180C 0.408339891 0.205286049 -0.078597019 0.462160117 CTL1 RNA triphosphatase YMR181C -0.68856468 0.021550205 0.438914897 0.301414723 similarity to YPL229w YMR182C 0.357717445 0.448901645 0.218317991 0.337196956 RGM1 Putative transcriptional repressor with proline-rich zinc fingers YMR183C 0.137015942 0.415861122 -0.373599888 0.001594452 SSO2 post-Golgi t-SNARE YMR184W 0.697968419 0.478509309 -0.231976105 0.047086846 hypothetical protein YMR185W -0.26511261 0.242189526 -0.565551333 0.04355863 hypothetical protein YMR186W -0.4487653 0.158244003 -0.474632565 0.006435526 HSC82 constitutively expressed heat shock protein YMR187C -0.49375668 0.013654053 -0.307855734 0.046250671 hypothetical protein YMR188C 0.634588924 0.029432464 -0.947112423 0.022774574 weak similarity to bacterial ribosomal protein S17 YMR189W 0.547896154 0.299864446 0.399657113 0.229880169 GCV2 Glycine decarboxylase complex (P-subunit), glycine synthase (P-subunit), Glycine cleavage system (P-subunit) YMR191W -0.70843206 0.067049018 0.176898226 0.355474033 hypothetical protein YMR192W 0.803211638 0.071909523 -0.002759113 0.989681519 similarity to mouse Tbc1 protein YMR193C-A 0.236516712 0.057732975 -0.560866291 0.11754274 questionable ORF YMR193W -0.01753825 0.950271066 -0.860363767 0.028532231 MRPL24 Mitochondrial ribosomal protein MRPL24 (YmL24) YMR194C-A 0.449843046 0.640973055 0.325501062 0.217964292 YMR194W 0.713577359 0.1215553 -0.19266631 0.328706373 RPL36A Ribosomal protein L36A (L39) (YL39) YMR195W -0.88331001 0.02831225 0.397868884 0.007672479 ICY1 interacting with the cytoskeleton YMR197C -0.40729572 0.058279195 -0.11001432 0.530267457 VTI1 Vti1p is a v-SNARE that interacts with two t-SNARES, Sed5p and Pep12p YMR198W 0.081974894 0.452877049 -0.500158265 0.03217104 CIK1 spindle pole body associated protein YMR199W 1.105917909 0.434590315 0.110944728 0.606446951 CLN1 G(sub)1 cyclin YMR200W 0.990849222 0.160604103 0.319394129 0.131714592 ROT1 putative membrane protein YMR201C -0.19229148 0.431577253 -0.275463743 0.195440348 RAD14 human xeroderma pigmentosum group A DNA repair gene homolog YMR202W 1.475569934 0.182377035 0.697210814 0.054483565 ERG2 C-8 sterol isomerase YMR203W 0.867049037 0.049107578 0.282587965 0.29302375 TOM40 Mitochondrial outer membrane protein ; forms the outer membrane import channel YMR204C -0.17952542 0.538217932 -0.260501343 0.075363572 weak similarity to D.melanogaster hypothetical protein DMC39E1 YMR205C -0.21961878 0.54415763 0.262597116 0.281204971 PFK2 phosphofructokinase beta subunit YMR206W -2.62845373 0.001350041 -0.02904442 0.872764437 weak similarity to hypothetical protein YNR014w YMR208W 0.7016652 0.053280372 0.010694659 0.796017998 ERG12 mevalonate kinase YMR209C -0.20737253 0.491945511 -0.065553399 0.331498757 hypothetical protein YMR210W -0.16191099 0.285749047 0.006543252 0.944828915 similarity to P.glauca late embryogenesis abundant protein and YBR177c and YPL095C YMR211W 0.11896388 0.684917851 -0.297267851 0.082051217 weak similarity to beta tubulins YMR212C 0.361844458 0.279813956 -0.208044579 0.129021135 EFR3 PHO _E_ighty _F_ive _R_equiring YMR213W -0.04814362 0.881706748 -0.422240014 0.060051623 CEF1 Component of a protein complex associated with the splicing factor Prp19p. YMR214W -0.11813626 0.240388937 0.231896427 0.183577801 SCJ1 dnaJ homolog YMR215W 0.777823721 0.476201524 0.587704031 0.028294935 similarity to GAS1 protein YMR216C -0.22778144 0.186073283 -0.139125378 0.19601507 SKY1 Serine Protein Kinase YMR217W 1.399130794 0.030339965 -0.011874725 0.953429322 GUA1 GMP synthase YMR218C 0.424677051 0.016350209 -0.197624097 0.391016398 TRS130 Component of targeting complex (TRAPP) involved in ER to Golgi membrane traffic ; 130 kD subunit YMR220W 0.646670714 0.172290848 -0.140570033 0.231262315 ERG8 48 kDa Phosphomevalonate kinase YMR221C 0.494186417 0.421928482 0.456427605 0.192704054 weak similarity to photosystem II protein D2 YMR222C 0.077455217 0.728395155 0.386764848 0.054636178 similarity to S.pombe dihydrofolate reductase YMR223W 0.347242905 0.132923274 -0.520909729 0.046461205 UBP8 putative deubiquitinating enzyme localizes to discrete sites in rad50s mutants. Mre11p, Rad50p, Mer2p and Xrs2p function in a complex by immunoprecipitation and two-hybrid YMR224C -0.62384915 0.002496958 -0.225820258 0.047527809 MRE11 analyses ; mutations in these genes have similar phenotypes. mRNA is induced in meiosis YMR226C 0.185966278 0.652976115 0.279462946 0.238899259 similarity to ketoreductases YMR227C 0.221392792 0.056798953 -0.34873779 0.113720851 TAF67 TFIID subunit YMR228W 0.226418728 0.205959698 -0.408861114 0.02800304 MTF1 Mitochondrial RNA polymerase specificity factor YMR229C 0.828497765 0.030528755 -0.417504673 0.032224834 RRP5 Protein required for processing of pre-rRNA YMR230W 1.253409032 0.144050522 -0.159201712 0.194064455 RPS10B Ribosomal protein S10B YMR232W -0.59503966 0.014685847 -0.034910073 0.835405187 FUS2 involved in cell fusion YMR233W 0.021925739 0.942723097 -0.464417214 0.111902555 strong similarity to YOR295w YMR234W -0.04308863 0.870975675 0.128098474 0.623020405 RNH1 ribonuclease H YMR235C 0.520036699 0.132956318 -0.622522134 0.036355487 RNA1 GTPase activating protein for Gsp1p YMR236W 0.183686826 0.561718043 0.418783481 0.067053177 TAF17 TFIID subunit YMR237W 0.067004776 0.659205725 -0.040868988 0.466242692 similarity to CHS6 protein YMR238W 0.933899436 0.280054367 -0.016193482 0.925266431 DFG5 involved in pseudohyphal growth YMR239C 1.001267356 0.188497001 -0.79123316 0.065845536 RNT1 Ribonuclease III YMR240C -0.17995042 0.223599653 -0.77474685 0.030559825 CUS1 U2 snRNP protein YMR241W 0.94297007 0.360434027 -0.011194142 0.950356982 YHM2 DNA-binding protein, mtDNA stabilizing protein, mitochondrial inner membrane protein with low homology to RIM2 YMR242C 0.690366606 0.282041695 0.448165749 0.009202752 RPL20A Ribosomal protein L20A (L18A) YMR243C 0.190936057 0.605962651 0.06540108 0.669262761 ZRC1 involved in zinc and cadmium ion homeostasis YMR244C-A 0.633964223 0.048000913 -0.061781812 0.065670946 questionable ORF YMR244W -0.03789831 0.925941657 -0.692493181 0.206538238 similarity to Uth1p, Nca3p, YIL123w and Sun4p YMR245W 0.244387538 0.369033672 -0.007643779 0.873965789 weak similarity to mouse thyrotropin-releasing hormone receptor YMR246W 0.141574297 0.637533195 0.278009296 0.212416503 FAA4 long-chain fatty acid--CoA ligase and synthetase 4 YMR250W -2.82486835 0.000338168 -0.112010794 0.374456508 GAD1 glutamate decarboxylase YMR251W -1.32387133 0.008745212 0.458622511 0.156885879 strong similarity to YKR076w and YGR154c YMR251W-A -0.63766226 0.322111866 0.366452675 0.179136837 HOR7 hyperosmolarity-responsive gene YMR252C -0.24438 0.203250161 0.316221161 0.08176616 hypothetical protein YMR253C -0.40449511 0.231511586 -0.056924572 0.446605434 strong similarity to YPL264c YMR254C 0.103321316 0.801587269 0.130866678 0.397429126 hypothetical protein YMR255W -0.63105006 0.119176156 -0.683049716 0.005512455 GFD1 GREAT for FULL DEAD box protein activity YMR257C 0.153038445 0.226983831 -0.562290848 0.019088411 PET111 translational activator of cytochrome c oxidase subunit II YMR258C -0.22202284 0.400629501 0.210111763 0.065525361 hypothetical protein YMR259C 0.439044321 0.107527342 0.035123738 0.341250589 hypothetical protein YMR260C 1.506952063 0.131512678 -0.319108727 0.232941961 TIF11 Translation initiation factor eIF1A YMR261C -0.66154928 0.007219095 0.114383792 0.116456635 TPS3 115 kD regulatory subunit of trehalose-6-phosphate synthase /phosphatase complex YMR262W -1.06862824 0.000972507 0.164849064 0.148645878 similarity to S.pombe scn1 protein YMR263W 0.330643594 0.273526508 -0.31461056 0.114724721 subunit of the histone deacetylase B complex YMR264W -0.14538233 0.550232137 0.208395458 0.076041068 CUE1 Ubc7p binding and recruitment protein YMR265C -0.48758132 0.01686805 -0.096409991 0.453611451 hypothetical protein YMR266W -0.1775587 0.339172722 0.136102683 0.144985165 similarity to A.thaliana hyp1 protein YMR267W -0.15232448 0.260872662 -0.406424011 0.016810501 PPA2 mitochondrial inorganic pyrophosphatase YMR268C 0.509966445 0.142021909 -0.545011022 0.186256301 PRP24 U4 /U6 snRNP protein YMR269W 0.834859098 0.076211395 -0.527583909 0.168866817 weak similarity to C.elegans hypothetical protein CELT23B3 YMR270C 0.334926817 0.168285769 -0.81536728 0.057046266 RRN9 Upstream activation factor subunit YMR271C -1.6630321 0.006340478 -0.22064349 0.100941482 URA10 Orotate phosphoribosyltransferase 2 YMR272C -0.80745928 0.034302083 0.477963979 0.154789167 SCS7 desaturase /hydroxylase enzyme YMR273C -0.19295955 0.371075642 0.096495916 0.497420509 ZDS1 peripheral plasma membrane protein YMR274C -0.08709519 0.732366667 0.614525628 0.156156542 RCE1 protease, acts on Ras and a-factor C-termini YMR275C 0.205704448 0.337801544 0.383181528 0.087418645 BUL1 Rsp5p ubiquitin ligase binding protein YMR276W 0.141675275 0.7143774 0.128521556 0.58239703 DSK2 ubiquitin-like protein YMR277W 0.158608651 0.781335696 0.095213483 0.350070253 FCP1 TFIIF interacting component of CTD phosphatase YMR278W -0.595203 0.035049368 -0.340091162 0.000743532 similarity to phosphomannomutases YMR279C -0.50444024 0.278935198 0.143504928 0.578593924 strong similarity to aminotriazole resistance protein YMR280C -0.89097283 0.117900162 0.285846641 0.156592891 CAT8 Zinc-cluster protein involved in activating gluconeogenic genes ; related to Gal4p YMR281W 0.258433355 0.624570743 0.309790128 0.040690833 GPI12 N-acetylglucosaminylphosphatidylinositol de-N-acetylase YMR282C -0.80092726 0.00640304 -0.59064555 0.012407779 AEP2 basic, hydrophilic 67.5 kDa protein YMR283C -0.16985704 0.236965858 -0.608121527 0.003381935 RIT1 Initiator methionine tRNA 2'-O-ribosyl phosphate transferase YMR284W -0.931832 0.003888059 -0.662781546 0.010312083 YKU70 DNA binding protein YMR285C 0.026371081 0.907902787 -0.19570928 0.270837472 similarity to Ccr4p YMR286W 0.300755413 0.0663503 -0.087300211 0.418106588 MRPL33 Mitochondrial ribosomal protein MRPL33 (YmL33) (E. coli L30) YMR287C 0.157180113 0.545424274 -0.633156397 0.01297011 MSU1 component of 3'-5'exonuclease complex YMR288W -0.1451584 0.281330562 -0.22921973 0.075909341 strong similarity to hypothetical S.pombe and C.elegans proteins YMR289W 0.133903196 0.223253145 -0.604374506 0.021903221 hypothetical protein YMR290C 1.176820831 0.102585722 -0.140085361 0.131193762 HAS1 Putative RNA-dependent helicase YMR290W-A 0.726883781 0.061656736 0.375310914 0.48805879 questionable ORF YMR291W -0.52581571 0.016850498 0.54195245 0.000364547 similarity to ser/thr protein kinase YMR293C 0.426360761 0.096228916 -0.237954197 0.025289676 similarity to amidases YMR294W -0.41379762 0.033088525 -1.189362524 0.010842789 JNM1 Coiled-coil domain protein required for proper nuclear migration during mitosis (but not during conjugation) YMR294W-A 0.839570058 0.259272252 0.132377617 0.185602434 questionable ORF YMR295C 0.709352476 0.380672316 0.009524229 0.915541053 similarity to YGR273 YMR296C 0.83029703 0.03912607 0.403812264 0.149092825 LCB1 Probable component of serine palmitoyltransferase, which catalyzes the first step in biosynthesis of long-chain sphingolipids YMR297W 0.030144966 0.92195679 0.342757519 0.312271276 PRC1 carboxypeptidase Y (proteinase C) YMR298W -0.01387915 0.936999837 0.516286952 0.00874409 hypothetical protein YMR299C -0.13345516 0.705195557 -0.383630737 0.090612777 weak similarity to hypothetical protein YJL062w YMR300C 0.434717054 0.322414744 -0.29141378 0.129551578 ADE4 phosphoribosylpyrophosphate amidotransferase YMR301C -0.32672844 0.345040429 0.104006489 0.536045573 ATM1 mitochondrial ABC transporter protein YMR302C -0.6876529 0.036161886 -0.451051311 0.029360308 PRP12 Integral membrane mitochondrial protein YMR303C 1.010302507 0.055197185 0.227661964 0.07523218 ADH2 alcohol dehydrogenase II YMR304C-A 1.868713154 0.262080512 1.269038765 0.056332731 questionable ORF YMR304W -0.91183053 0.008165826 -0.088498752 0.315114148 UBP15 putative deubiquitinating enzyme YMR305C 2.661661036 0.342244254 0.958371251 0.025461935 SCW10 soluble cell wall protein YMR306W -0.53986388 0.168914053 0.40536044 0.256106105 FKS3 similar to glucan synthase-related proteins of unknown function YMR307W 2.241677948 0.370492394 0.365150849 0.111441546 GAS1 cell surface glycoprotein 115-120 kDa YMR308C 0.859187181 0.107025188 0.451492288 0.059736148 PSE1 Karyopherin YMR309C 0.981372722 0.012278285 0.064784152 0.556616656 NIP1 ~100 kDa cytoplasmic protein YMR310C 0.38224386 0.405472234 0.644312131 0.014639412 similarity to YGR283c YMR311C -0.47317241 0.037714357 -0.485555539 0.131297791 GLC8 Regulates activity of protein phosphatase 1, Glc7p, which is involved in proper chromosome segregation YMR312W -0.00035963 0.997777527 0.405961099 0.103138388 hypothetical protein YMR313C -0.17615188 0.134834316 -0.073926142 0.469328459 similarity to YKR089c and YOR081c YMR314W -0.11252083 0.599054711 0.036880731 0.22619964 PRE5 alpha-type of subunit of 20S proteasome YMR315W 0.006092376 0.990730923 0.237698207 0.188121197 similarity to hypothetical S. pombe protein YMR316C-A 1.148860073 0.388554671 -0.177384111 0.124625447 questionable ORF YMR316W 1.339460726 0.283240397 -0.777347077 0.03140271 DIA1 similarity to YOR385w and YNL165w/digs into agar YMR318C 1.431779736 0.0063212 0.133512199 0.14260822 strong similarity to alcohol-dehydrogenase YMR319C -0.04224138 0.949695464 -0.040538331 0.722575773 FET4 Low-affinity Fe(II) transport protein YMR320W -0.07076562 0.898388302 -0.127442257 0.02352755 hypothetical protein YMR321C 1.194918081 0.062286639 -0.022275689 0.319605644 strong similarity to hypothetical proteins YPL273w and YLL062c YMR322C -1.7183148 0.006944273 0.390993795 0.234049473 strong similarity to YPL280w, YOR391c and YDR533c YMR323W -1.10949375 0.036307571 -0.183149812 0.538277974 strong similarity to phosphopyruvate hydratases YMR325W -0.19002371 0.359870972 0.387771006 0.27915296 strong similarity to members of the Srp1p/Tip1p family YMR326C -0.03965711 0.928503739 0.141870056 0.407073498 strong similarity to subtelomeric encoded proteins YNL001W 0.182771294 0.485303794 -0.844763181 0.035110141 DOM34 Involved in protein translation YNL002C 1.162198433 0.015231411 -0.817195591 0.049562741 RLP7 Protein with similarity to ribosomal proteins including Rpl6p YNL003C 0.390568311 0.336672075 -0.008237278 0.845743714 PET8 mitochondrial carrier protein family YNL004W 0.486359099 0.007774233 -0.388940601 0.058825161 HRB1 hypothetical RNA-binding protein YNL005C 0.509146921 0.151607551 -0.795876022 0.018284624 MRP7 Mitochondrial ribosomal protein MRP7 (YmL2) (E. coli L27) YNL006W -0.19967025 0.480037777 -0.171423676 0.084976407 LST8 Protein required for transport of permeases from the Golgi to the plasma membrane YNL007C -0.81278474 0.009461281 -0.252812929 0.009354079 SIS1 sit4 suppressor, dnaJ homolog YNL008C -0.56922981 0.00931447 0.15843048 0.143832768 similarity to YMR119w YNL009W -0.36814058 0.338714138 -0.4176836 0.02288513 IDP3 peroxisomal NADP-dependent isocitrate dehydrogenase YNL010W 0.33070159 0.343918929 -0.165311512 0.098613778 weak similarity to B.subtilis hypothetical protein ykrX YNL011C -0.17990062 0.681959667 -0.504277778 0.00591521 similarity to hypothetical A. thaliana protein T14G11.21 YNL012W -0.47548266 0.002859363 0.311080197 0.407830032 SPO1 encodes a protein with high similarity to phospholipase B YNL013C -0.64457568 0.111760695 -0.020983388 0.788394214 questionable ORF YNL014W -0.8104348 0.181899505 -0.23899415 0.166812913 translation elongation factor eEF3 homolog YNL015W -1.87869386 0.000942375 0.061496999 0.591504284 PBI2 Proteinase inhibitor that inhibits protease Prb1p (yscB) YNL016W 0.337549233 0.26363554 -0.000157539 0.998667867 PUB1 poly(A)+ RNA-binding protein YNL017C -0.53429435 0.222279747 1.278337239 0.396717111 hypothetical protein YNL018C -0.62662711 0.011349422 -0.461773995 0.000420971 strong similarity to hypothetical protein YNL034w YNL019C 0.091849044 0.771223772 0.379571404 0.141791225 nearly identical to YNL033w YNL020C 0.58649616 0.230965934 0.210064536 0.219490617 ARK1 Predicted Ser /thr kinase YNL021W 0.154016295 0.547010394 -0.158699861 0.072679113 HDA1 histone deacetylase, shares sequence similarity with Rpd3p, Hos1p, Hos2p, and Hos3p YNL022C 0.850600604 0.054002068 -0.352673711 0.023728457 weak similarity to C.burnetii FMU protein Transcription factor homolog ; similarity to Drosophila melanogaster shuttle craft protein ; similarity to human NFX1 protein ; similarity to human YNL023C -0.00546341 0.985311384 -0.075327069 0.275846541 FAP1 DNA-binding protein tenascin YNL024C 1.791486714 0.351024885 -0.378279311 0.010569299 weak similarity to YBR271w and YJR129c YNL025C -0.00690124 0.973337406 0.290739036 0.002212372 SSN8 C-type cyclin associated with the Ssn3p cyclin-dependent kinase YNL026W 0.025125172 0.735143969 0.041187951 0.646769799 similarity to S.pombe hypothetical protein YNL027W 0.273544147 0.313076268 -0.286183998 0.023276786 CRZ1 putative transcription factor YNL028W -0.73432723 0.047054968 0.018108761 0.855255849 questionable ORF YNL029C 0.208373857 0.174260346 -0.107415582 0.475901586 KTR5 Putative mannosyltransferase YNL030W 0.957792085 0.085748974 0.026255373 0.927934154 HHF2 Histone H4 (HHF1 and HHF2 code for identical proteins) YNL031C 0.069774578 0.844761901 0.007905265 0.957266476 HHT2 Histone H3 (HHT1 and HHT2 code for identical proteins) YNL032W 0.333082971 0.038852227 -0.224944087 0.133265054 SIW14 Tyrosine phosphatase YNL033W -0.11240482 0.713753497 0.435531279 0.285864225 nearly identical to YNL019c YNL034W -0.44371109 0.220799252 0.298867138 0.431618864 nearly identical to YNL018c YNL035C 0.229338386 0.187307733 -0.203857867 0.358371248 hypothetical protein YNL036W 1.444847419 0.194501802 0.115448075 0.428972233 NCE103 involved in non-classical protein export pathway YNL037C 0.306352515 0.087374306 -0.187982654 0.460360835 IDH1 alpha-4-beta-4 subunit of mitochondrial isocitrate dehydrogenase 1 YNL038W 0.589285377 0.185194224 -0.49055367 0.127221301 hypothetical protein YNL039W 0.198356667 0.462073729 -0.519933992 0.034870361 TFC5 90 kd subunit of TFIIIB, also called TFIIIB90 or B'' or B''90 component YNL040W -0.75507986 0.00941377 -0.628715476 0.010885507 putative phospholipase A2 YNL041C 0.078220067 0.538139034 -0.313184272 0.034135549 weak similarity to Mlp1 YNL042W -0.09670413 0.255530645 -0.016073581 0.581050102 BOP3 Bypass of PAM1 YNL043C 1.811661291 0.147698709 0.789557728 0.04843651 questionable ORF YNL044W 2.418261865 0.200181446 0.669307129 0.080321182 YIP3 Interacts with YPT proteins YNL045W 0.263364189 0.401990689 0.382906233 0.049755592 strong similarity to human leukotriene-A4 hydrolase YNL046W 0.514297419 0.017972063 0.514106814 0.1211466 hypothetical protein YNL047C -0.67182053 0.052851207 -0.011220495 0.713712989 similarity to probable transcription factor Ask10p and hypothetical protein YPR115w, and strong similarity to hypothetical protein YIL105c YNL048W -0.5868847 0.005476697 -0.223162288 0.143427095 ALG11 Required for N-linked oligosaccharide assembly YNL049C 0.180745825 0.535157894 0.03058912 0.616659588 SFB2 putative zinc finger protein YNL050C 0.595747447 0.117434684 -0.852478743 0.071174404 hypothetical protein YNL051W -0.51726675 0.056536379 -0.440122355 0.035851121 hypothetical protein YNL052W -1.20868298 0.015396703 0.225737534 0.39653605 COX5A Cytochrome-c oxidase chain Va YNL053W 0.148337483 0.190454727 0.285400243 0.003132373 MSG5 Dual-specificity protein tyrosine phosphatase YNL054W-A 1.052879322 0.130739587 0.434337496 0.008197008 TyA Gag protein. Gag processing produces capsid proteins. YNL055C -0.30318754 0.033355675 0.832319163 0.104758697 POR1 Outer mitochondrial membrane porin (voltage-dependent anion channel, or VDAC) YNL056W 0.061044633 0.146691817 -0.066889659 0.662370956 similarity to YNL032w and YNL099c YNL057W 0.912566424 0.010449101 0.641688595 0.043316938 questionable ORF YNL058C 0.873523587 0.087165763 0.295743783 0.011819849 similarity to YIL117c YNL059C 0.519041353 0.066072464 -0.397808352 0.184418622 ARP5 Actin-related protein YNL061W 0.305522344 0.249859643 -0.482462122 0.085414031 NOP2 90-kDa protein, located in nucleolus, that is homologous to a human proliferation-associated nucleolar protein, p120 YNL062C 0.440567906 0.043435086 -0.118913942 0.604714082 GCD10 RNA-binding (zeta) subunit of translation initiation factor 3 (eIF-3) YNL063W -0.03576019 0.812427449 0.285997332 0.073094674 weak similarity to Mycoplasma protoporphyrinogen oxidase YNL064C 0.810876197 0.030324937 -0.130062652 0.389495833 YDJ1 yeast dnaJ homolog (nuclear envelope protein) ; heat shock protein YNL065W 2.322257864 0.304889139 -0.213796973 0.196226278 similarity to resistance proteins YNL066W 0.715296813 0.443257408 0.917528232 0.058412169 SUN4 Protein involved in the aging process YNL067W 1.360106999 0.204133244 0.202517895 0.320819612 RPL9B Ribosomal protein L9B (L8B) (rp24) (YL11) YNL068C -0.24625417 0.533992055 0.131299539 0.346689802 FKH2 Fork Head homolog two YNL069C 1.31015634 0.051690657 0.090396094 0.365962411 RPL16B Ribosomal protein L16B (L21B) (rp23) (YL15) YNL070W 0.93174307 0.026348921 0.817342246 0.03093382 TOM7 translocase of the outer mito. membrane YNL071W -0.40739843 0.171242339 0.191714694 0.269841545 LAT1 Dihydrolipoamide acetyltransferase component (E2) of pyruvate dehydrogenase complex YNL072W -0.22143736 0.44697757 0.236770446 0.178605347 RNH35 RNase H(35), a 35 kDa ribonuclease H YNL073W 0.491660468 0.136866533 -0.087530832 0.445145607 MSK1 mitochondrial lysine-tRNA synthetase YNL074C 0.007491457 0.973848617 0.778236809 0.095443777 MLF3 Serine-rich protein YNL075W 0.729143864 0.009235223 -0.448169401 0.069345095 IMP4 Interacts With Mpp10. Imp4p is a specific component of the U3 snoRNP and is required for pre-18S rRNA processing. YNL076W 0.457560739 0.208642521 -0.456833576 0.029906773 MKS1 negative regulator of Ras cAMP pathway, shares weak homology with Spt2p YNL077W -0.28003458 0.103935589 -0.156165156 0.085501912 similarity to dnaJ protein homolog YDJ1 YNL078W -0.13340877 0.525064892 0.383029213 0.039759907 hypothetical protein YNL079C 0.159646331 0.71671094 -0.548516218 0.014570429 TPM1 tropomyosin I YNL080C -0.01099536 0.948551321 0.281001145 0.205575447 hypothetical protein YNL081C 0.860697766 0.007236825 -0.047375718 0.785724589 similarity to ribosomal protein S13 MutL homolog, similar to Mlh1p, associates with Mlh1p, possibly forming a heterodimer, Pms1p and Msh1p act in concert to bind to a Msh2p- YNL082W -0.28383316 0.572169294 -0.329282982 0.170020019 PMS1 heteroduplex complex containing a G-T mismatch YNL083W -0.24285401 0.445240999 -0.374041895 0.067309356 weak similarity to rabbit peroxisomal Ca-dependent solute carrier/ INTRACELLULAR TRANSPORT YNL084C -0.50981729 0.012317621 -0.561923646 0.117180598 END3 Required for endocytosis and organization of the cytoskeleton YNL085W 0.344228924 0.404422727 0.497275444 0.016672424 MKT1 retroviral protease signature protein YNL086W 0.606326287 0.012753854 0.480412176 0.035757472 hypothetical protein YNL087W 0.544296552 0.260729342 0.58237542 0.008376636 weak similarity to synaptogamines YNL088W -0.18417708 0.402242525 -0.315971435 0.184573517 TOP2 topoisomerase II, Top2p localizes to axial cores in meiosis YNL089C 0.079668447 0.751028596 0.056277833 0.37769612 questionable ORF YNL090W 0.129135175 0.528046845 -0.170807725 0.08778583 RHO2 GTP-binding protein of the rho subfamily YNL091W -0.18849229 0.226452024 -0.337214678 0.050431603 similarity to chicken h-caldesmon, Uso1p and YKL201c YNL092W -1.09682102 0.016358755 0.36196019 0.202614401 similarity to hypothetical C. elegans proteins Y48E1C.2 and Y48E1C.c YNL093W -1.34077573 0.021240506 1.347596881 0.514049378 YPT53 GTP-binding protein of the rab family YNL094W -0.11707491 0.424210198 0.112787092 0.261429982 similarity to S.pombe hypothetical protein YNL095C 0.861894182 0.030608124 0.168384973 0.000566137 strong similarity to YOR092w YNL096C 0.949885526 0.040835327 -0.082916416 0.741138909 RPS7B Ribosomal protein S7B (rp30) YNL097C -0.88617034 0.057300008 -0.029989573 0.612360275 PHO23 Involved in expression of PHO5 YNL098C 0.050959143 0.874271274 -0.469052579 0.032977546 RAS2 Small, GTP-binding protein YNL099C 0.644162309 0.033512212 -0.187159963 0.285567459 similarity to YNL032w, YNL056w and YDR067c YNL100W -0.79170776 0.00671218 -0.385754277 0.053964739 hypothetical protein YNL101W -0.17141209 0.761048138 0.10745366 0.482470461 similarity to YKL146w YNL102W 0.004228597 0.987442918 -0.304555718 0.165960654 POL1 DNA polymerase I alpha subunit, p180 YNL103W 0.086447309 0.798186754 0.031215516 0.831882866 MET4 member of the leucine zipper family of transcriptional activators YNL104C 0.123191565 0.606012623 0.151403523 0.389972572 LEU4 alpha-isopropylmalate synthase (2-Isopropylmalate Synthase) YNL105W -0.54053657 0.100225008 -0.106598483 0.216838261 questionable ORF YNL106C 0.512689347 0.129806961 0.361773641 0.278542221 INP52 inositol polyphosphate 5-phosphatase YNL107W 0.070753837 0.635275298 -0.053843662 0.626062269 YAF9 Yeast homolog of the human leukemogenic protein AF9 ; member of a large protein complex YNL108C -0.29689627 0.181049062 0.14901296 0.019416701 strong similarity to YOR110w YNL109W -0.48299364 0.00550495 0.024119597 0.751147935 weak similarity to cytochrome-c oxidase YNL110C 1.171323881 0.203611441 -1.138231142 0.035696283 weak similarity to fruit fly RNA-binding protein YNL111C 1.106315736 0.35094191 0.191877715 0.181423348 CYB5 cytochrome b5 YNL112W 0.682407153 0.350378279 -0.007199176 0.923528785 DBP2 ATP-dependent RNA helicase of DEAD box family YNL113W 0.75344047 0.03823129 -0.250797661 0.182831343 RPC19 subunit common to RNA polymerases I (A) and III (C) YNL114C 0.236442673 0.579247702 -0.363539401 0.16419638 questionable ORF YNL115C -1.75577594 0.00184891 0.144351189 0.37937997 weak similarity to S.pombe hypothetical protein SPAC23C11 YNL116W -0.84772249 0.058183458 0.126784916 0.174985246 weak similarity to RING zinc finger protein from Gallus gallus YNL117W -1.26235908 0.050810517 0.441285022 0.120578953 MLS1 carbon-catabolite sensitive malate synthase YNL118C 0.093101213 0.371539125 -0.517669101 0.033395024 DCP2 mRNA Decapping. essential suppressor of the respiratory deficiency of a pet mutant YNL119W 0.711033148 0.030260539 -0.491954852 0.037637376 weak similarity to M.jannaschii hypothetical protein MJ1257 YNL120C 0.582418374 0.072428169 -0.569006234 0.102945228 questionable ORF YNL121C 0.46931454 0.047145438 -0.120990069 0.174929221 TOM70 70 kDa mitochondrial specialized import receptor of the outer membrane YNL122C 0.196119023 0.364470962 -0.330142913 0.258288724 hypothetical protein YNL123W 1.072151448 0.219672714 0.086162018 0.253201819 weak similarity to C.jejuni serine protease YNL124W 1.094082974 0.039863001 0.291304544 0.113694427 similarity to hypothetical S. pombe protein YNL125C -0.26987315 0.247834684 0.571156919 0.017796091 ESBP6 Putative monocarboxylate permease YNL126W -0.22107036 0.501349576 -0.147141006 0.320446177 SPC98 spindle pole body component, associates in a complex with Spc97p and Tub4p perhaps as part of the microtubule attachment site of the SBP YNL127W -0.15439633 0.566707686 -0.472791945 0.088609069 similarity to C.elegans hypothetical protein YNL128W 0.397503414 0.152597072 0.063964382 0.828360963 TEP1 Putative protein tyrosine phosphatase YNL129W 0.749459052 0.309806251 -0.760537946 0.056214425 weak similarity to M.pneumoniae uridine kinase udk YNL130C 0.50282931 0.269439832 0.613252564 0.04747932 CPT1 sn-1,2-diacylglycerol cholinephosphotransferase YNL131W 0.816103002 0.026729684 0.140433142 0.280317581 TOM22 Mitochondrial import receptor complex protein YNL132W 0.285292617 0.370891367 0.186850357 0.167506338 similarity to A.ambisexualis antheridiol steroid receptor YNL133C -0.57190798 0.030193305 -0.507211108 0.03807082 hypothetical protein YNL134C -1.82384472 0.000229217 0.024064605 0.806930589 similarity to C.carbonum toxD gene YNL135C 0.997604789 0.248840471 0.528117132 0.109429201 FPR1 peptidylprolyl cis-trans isomerase YNL136W 0.088632257 0.286793367 -0.401106558 0.111333284 similarity to neurofilament triplet M protein YNL137C 0.655955665 0.026527755 -0.155018847 0.023772571 NAM9 putative mitochondrial S4 ribosomal protein YNL138W -0.61950334 0.044993729 0.263096977 0.008893086 SRV2 70-kDa adenylyl cyclase-associated protein YNL139C 0.002799627 0.983277322 0.011744635 0.940666582 RLR1 Involved in transcription YNL140C -0.23717557 0.202675664 -0.177828048 0.127966504 questionable ORF YNL141W 0.774264928 0.222327085 0.055600356 0.713765499 AAH1 adenine aminohydrolase (adenine deaminase) YNL142W -0.77508313 0.291012797 0.152227439 0.616676048 MEP2 Ammonia transport protein YNL143C 1.10338739 0.043620247 0.529741069 0.470690839 hypothetical protein YNL144C -1.44587035 0.001351635 -0.250187751 0.045400147 similarity to YHR131c YNL145W 0.891511617 0.305042178 1.154374467 0.108720703 MFA2 mating a-factor pheromone precursor YNL146W 0.166841545 0.505804197 0.272647075 0.04465842 hypothetical protein YNL147W 0.608678086 0.116956485 -0.259910474 0.270058632 LSM7 Sm-like protein YNL148C -0.1928029 0.54037638 -0.039200586 0.690795936 ALF1 cofactor B YNL149C 0.446425505 0.158731013 -0.370653132 0.095192463 weak similarity to S.pombe hypothetical protein YNL150W 0.633253728 0.03140961 -0.183062749 0.118753715 hypothetical protein YNL151C 0.291554436 0.196386188 -0.529822795 0.148826271 RPC31 31-kDa subunit of RNA polymerase III (C) ; HMG1 like protein YNL152W -0.0523787 0.880833884 0.043596495 0.797154604 hypothetical protein YNL153C 1.378926865 0.144487093 -0.472366711 0.167975295 GIM3 bovine prefoldin subunit 4 homolog (putative) YNL154C 0.556364005 0.005716767 -0.265170411 0.154492208 YCK2 membrane-bound casein kinase I homolog YNL155W 0.296850275 0.521732805 -0.596805262 0.05748642 hypothetical protein YNL156C -0.24870683 0.484047928 -0.317998519 0.056559436 similarity to YHR133c YNL157W 0.183848799 0.619937679 -0.185758617 0.099792464 weak similarity to S.pombe hypothetical protein SPAC10F6 YNL158W 0.220997685 0.588052635 0.322207296 0.0296709 hypothetical protein YNL159C -0.62717997 0.097979643 -0.052721892 0.507863866 hypothetical protein YGP1 encodes gp37, a glycoprotein synthesized in response to nutrient limitation which is homologous to the sporulation-specific SPS100 YNL160W -1.80801737 0.000243813 0.35023358 0.374937959 YGP1 gene YNL161W -0.13546128 0.566861909 -0.246322335 0.074261881 CBK1 Protein kinase YNL162W 1.726442781 0.044789656 0.083662557 0.74203321 RPL42A Ribosomal protein L42A (YL27) (L41A) YNL163C 0.414405911 0.068205382 -0.260832471 0.031514391 translation elongation factor eEF4 YNL164C 0.615033914 0.03713598 -0.398509214 0.051861972 hypothetical protein YNL165W 0.586218757 0.35202659 0.014098555 0.837558348 similarity to YOR385w and YMR316w YNL166C 1.079926956 0.150329597 -0.748886336 0.038033143 BNI5 bud neck protein YNL167C 0.430058278 0.067586016 0.391578025 0.054945774 SKO1 CREB like repressor, bZIP protein that binds to CRE motifs, interacts with Mig1p YNL168C 0.107667015 0.788368111 0.410809147 0.122465721 similarity to C.elegans ZK688.3 protein and E.coli hpcEp YNL169C -0.00691486 0.986587367 0.327300333 0.089654744 PSD1 Phosphatidylserine Decarboxylase 1 YNL170W 0.231514679 0.335893237 0.521359942 0.009681438 questionable ORF YNL171C -0.00160369 0.996397858 0.520019805 0.022260275 questionable ORF YNL172W 0.056069459 0.921982582 0.198187069 0.031789522 APC1 subunit of ubiquitin- protein ligase YNL173C -1.88400314 8.10528E-05 -0.280042331 0.201829216 MDG1 Involved in G-protein mediated signal transduction YNL174W 0.770440872 0.088497388 -0.537485012 0.148884462 hypothetical protein YNL175C 1.372781011 0.108994026 -0.799973092 0.022269197 NOP13 nucleolar protein YNL176C 0.414863994 0.129008489 0.673862899 0.009391663 weak similarity to Hkr1p YNL177C -0.03161205 0.823885124 -0.627508323 0.029221486 hypothetical protein YNL178W 1.577656862 0.187456364 0.038613614 0.803836227 RPS3 Ribosomal protein S3 (rp13) (YS3) YNL179C 0.295826645 0.414303656 0.615201692 0.141586104 hypothetical protein YNL180C -0.01052456 0.928950659 -0.33695603 0.067618285 RHO5 Rho family GTPase YNL181W -0.06633393 0.594371695 -0.363796264 0.185482451 similarity to hypothetical S. pombe protein YNL182C 1.505773122 0.130849278 -0.5134049 0.094378515 weak similarity to S.pombe hypothetical protein YNL183C 0.204108131 0.704547932 0.382414754 0.039677326 NPR1 protein kinase homolog YNL184C 0.128985508 0.827876745 0.158678744 0.279989971 questionable ORF YNL185C 0.341806759 0.148189788 0.114019133 0.008883531 MRPL19 mitochondrial ribosomal protein of the large subunit YNL186W 0.515216172 0.231130506 -0.409929082 0.014565165 UBP10 predicted to encode a ubiquitin-processing protease YNL187W -0.05438 0.811230245 0.318165008 0.08337883 hypothetical protein YNL188W 0.55212031 0.201452064 -0.932093933 0.036302048 KAR1 Localizes to the spindle pole body YNL189W 0.43782989 0.085934334 -0.296508599 0.064919613 SRP1 karyopherin alpha homolog of 60 kDa YNL190W 0.191669715 0.623637748 1.22868925 0.041505285 hypothetical protein YNL191W 1.088102102 0.003395705 0.077686479 0.240827654 similarity to Synechocystis hypothetical protein YNL192W 1.404438271 0.210312047 -0.231218154 0.048524291 CHS1 chitin synthase 1 YNL193W -0.09745563 0.693712679 -0.146839151 0.023415872 hypothetical protein YNL194C -1.90705885 0.006955476 0.193498677 0.263129878 strong similarity to YDL222c and similarity to Sur7p; meiotically induced gene YNL195C -1.59032566 0.01657947 0.054340605 0.113639399 hypothetical protein YNL196C 0.203210668 0.574411599 0.670543939 0.223954136 SLZ1 Sporulation-specific protein with a leucine zipper motif YNL197C 0.398529629 0.082985506 0.59819923 0.200840603 WHI3 Putative RNA binding protein YNL198C 0.71451795 0.160831289 -0.248228227 0.06444709 questionable ORF YNL199C 0.562243988 0.0394912 -0.284730797 0.19604591 GCR2 Transcription factor YNL200C -1.57931022 0.000802319 0.439166159 0.317169147 strong similarity to human TGR-CL10C YNL201C 0.528920949 0.005160181 -0.586279889 0.0180815 involved in regulation of carbon metabolism YNL202W -1.1062462 0.018375521 -0.247692597 0.239355914 SPS19 peroxisomal 2,4-dienoyl-CoA reductase YNL203C -0.71344783 0.090545437 0.018729024 0.897348052 weak similarity to B.subtilis CDP-diacylglycerol--serine O-phosphatidyltransferase YNL204C -0.14428881 0.645008255 0.280839028 0.222519768 SPS18 Transcription factor YNL205C -0.44308777 0.161677048 0.281613852 0.382444484 questionable ORF Regulator of Ty1 Transposition - same phenotype as RTT101 - RTT105, disruption causes increase in Ty1 transposition. Isolated from the YNL206C -0.21523401 0.296467375 -0.576512689 0.035754908 RTT106 same screen as the other named RTT genes. YNL207W 1.101655656 0.040709574 -0.395921985 0.048700695 similarity to M.jannaschii hypothetical protein MJ1073 YNL208W 0.768291554 0.419903254 0.708510907 0.246905037 weak similarity to Colletotrichum gloeosporioides nitrogen starvation-induced glutamine rich protein YNL209W 1.659826751 0.062489416 0.333032583 0.113834893 SSB2 Heat shock protein of HSP70 family, homolog of SSB1 YNL210W 0.862120005 0.165754124 -0.024440371 0.773515222 MER1 encodes protein with RNA-binding motifs required for MRE2-dependent mRNA splicing YNL211C -0.09734251 0.716139316 -0.224497731 0.191598718 hypothetical protein YNL212W -0.54042441 0.049716857 -0.248892906 0.010560915 VID27 vacuole import and degradation YNL213C 0.069814128 0.595326271 -0.4573209 0.057531869 hypothetical protein YNL214W -0.34515866 0.00387542 -0.056572492 0.533870634 PEX17 23 kDa peroxisome associated protein, binds Pex14p YNL215W -0.19568381 0.411958566 -0.656597365 0.017538046 similarity to hypothetical S. pombe protein YNL216W -0.25586808 0.071987378 0.134422845 0.120880754 RAP1 repressor activator protein YNL217W -0.92563202 0.091111062 -0.313545681 0.002255289 weak similarity to E.coli bis(5'-nucleosyl)-tetraphosphatase YNL218W -0.34810829 0.043287906 -0.320989139 0.059801121 similarity to E.coli hypothetical protein in serS 5'region YNL219C -0.16119227 0.054291059 0.34670901 0.111966118 ALG9 mannosyltransferase YNL220W -0.04755203 0.793376706 -0.566420538 0.037180972 ADE12 adenylosuccinate synthetase YNL221C 0.437534865 0.031218014 -0.333706021 0.0232819 POP1 Component of nuclear RNase P and RNase MRP YNL222W -0.21883713 0.35026423 -0.012921682 0.911756761 SSU72 Nuclear zinc-finger motif containing protein. YNL223W -0.81535959 0.021737688 -0.190216439 0.024324452 AUT2 Anchor protein. Mediates attachment of autophagosomes to microtubules. YNL224C -0.04277151 0.682519797 -0.760486826 0.02791469 hypothetical protein YNL225C 0.215977634 0.385066934 -0.73060328 0.047853704 CNM67 Spindle pole body protein involved in nuclear migration YNL226W 0.174219137 0.478913094 -0.038194814 0.822244809 questionable ORF YNL227C 0.156483939 0.40336425 -0.409055819 0.007107205 similarity to dnaJ-like proteins YNL228W -0.16741231 0.299515059 -0.003513029 0.97739578 questionable ORF YNL230C -0.48370208 0.13616203 0.00714364 0.905618483 ELA1 elongin A YNL231C 0.283649424 0.226044307 -0.338905284 0.13526288 PDR16 homologous to Pdr17p and Sec14p YNL232W 0.684109197 0.009835403 0.012188363 0.885980312 CSL4 Involved in kinetochore-related function YNL233W 0.47365131 0.122430843 -0.274036116 0.159252815 BNI4 Is required to link Chs3p and Chs4p to the septins YNL234W -0.11385579 0.912744337 -0.628343815 0.023887538 weak similarity to mouse hemoglobin zeta chain YNL235C 0.173384706 0.635518553 0.036517086 0.410932052 questionable ORF YNL236W 0.548509399 0.020270379 0.205316992 0.011502353 SIN4 component of RNA polymerase II holoenzyme /mediator complex YNL237W -1.43500498 0.001474053 0.262511947 0.140860998 YTP1 Similar to mitochondrial electron transport proteins. YNL238W 0.31359464 0.118460348 0.257166991 0.042247205 KEX2 Ca2+-dependent serine protease YNL239W -1.3908776 0.001261268 0.042991531 0.706417878 LAP3 Aminopeptidase of cysteine protease family YNL240C -0.06324439 0.841844941 -0.222360409 0.139277775 NAR1 Nuclear architecture related protein with homology to human Narf (Nuclear prelamin A Recognition Factor) YNL241C -0.22694236 0.681949759 0.096599978 0.375537275 ZWF1 Glucose-6-phosphate dehydrogenase YNL242W -0.81447691 0.012439628 0.573492878 0.184107546 SPO72 Required for sporulation. YNL243W -0.00331411 0.959958628 0.201918328 0.149833399 SLA2 transmembrane protein YNL244C 1.056596204 0.049397296 0.465166692 0.075142152 SUI1 translation initiation factor 3 (eIF3) YNL246W 0.125784852 0.263128466 0.21012471 0.022774166 similarity to D.melanogaster SET protein; members of the NAP/SET family of proteins interact specifically with B-type cyclins YNL248C 1.432021992 0.161724942 -0.43869455 0.048295628 RPA49 49-kDa alpha subunit of RNA polymerase A YNL249C -0.16882545 0.53317106 -0.303642686 0.14262141 MPA43 Overexpression leads to increased levels of the lyase PDC1 YNL250W 0.42872505 0.206851191 -0.232430146 0.047571121 RAD50 Contains a purine-binding domain, two heptad repeats and a hydrophobic tail. YNL251C -0.18511361 0.176155722 0.665671691 0.018875923 NRD1 RNA binding protein involved in the regulation of RNA abundance YNL252C 0.44777599 0.128423194 -0.541257905 0.060748193 MRPL17 mitochondrial ribosomal protein of the large subunit YNL253W -0.33965419 0.144168681 -0.658462882 0.027459242 hypothetical protein YNL254C -1.21399559 0.00403128 -0.766786005 0.025968794 hypothetical protein YNL255C 1.529917435 0.018262964 0.360365699 0.115050974 GIS2 Contains seven cysteine rich zinc finger motifs of the 'CCHC retroviral-type' YNL256W 0.648375312 0.118486435 -0.304550597 0.058153175 FOL1 dihydroneopterin aldolase, dihydro-6-hydroxymethylpterin pyrophosphokinase, dihydropteroate synthetase YNL257C -0.35905084 0.035800775 -0.152411168 0.186287618 SIP3 Putative transcriptional activator YNL258C -0.62098807 0.01323306 -0.654356463 0.009456715 hypothetical protein YNL259C 0.776741203 0.299873815 -0.345981561 0.129887186 ATX1 Putative copper binding /homeostasis protein YNL260C 0.797198606 0.044381924 -0.258093995 0.314113831 hypothetical protein YNL261W 0.275221498 0.462577037 -0.195830655 0.057922414 ORC5 Fifth largest subunit of origin recognition complex ; contains possible ATP-binding site YNL263C 0.60686647 0.002327787 0.584210657 0.080287762 YIF1 Similar to NADH dehydrogenases YNL264C -0.08300249 0.649778014 -0.057232415 0.278454089 PDR17 homologous to Pdr16p and Sec14p YNL265C -0.3977681 0.053523444 -0.898121383 0.012678853 IST1 Similar to Nuf1p (spindle pole body component) YNL266W -0.30262024 0.027680891 -0.444202653 0.027892693 questionable ORF YNL267W 0.1580247 0.378933056 0.052713509 0.258551512 PIK1 Phosphatidylinositol 4-kinase YNL268W 1.073773953 0.154024239 0.289606761 0.25581623 LYP1 lysine permease YNL269W -0.1175606 0.826471091 0.220456258 0.532241351 hypothetical protein YNL270C 0.249154142 0.582374172 0.415002607 0.320996024 ALP1 Basic amino acid permease YNL272C 0.048441295 0.730943421 -0.298895038 0.071860917 SEC2 GDP /GTP exchange factor for Sec4p YNL273W -0.09388718 0.842771873 0.106793773 0.322912439 TOF1 Interacts with topoisomerase I YNL274C -0.52181333 0.295879982 -0.275828936 0.134353151 similarity to glycerate- and formate-dehydrogenases YNL275W 0.743775241 0.042212606 0.486158833 0.115093272 similarity to human band 3 anion transport protein YNL276C -0.47356342 0.251653513 0.465904608 0.043347266 questionable ORF YNL277W -0.43150658 0.463678225 0.374185016 0.021722991 MET2 homoserine O-trans-acetylase YNL278W -0.38996667 0.235860152 0.559262935 0.190171103 CAF120 CCR4 associated factor 120 kDa YNL279W -0.1475949 0.587254428 0.224980256 0.253454652 PRM1 pheromone-regulated membrane protein YNL280C -0.08424802 0.578155971 0.027877286 0.776189226 ERG24 sterol C-14 reductase YNL281W 0.644301579 0.021025906 -0.110699772 0.477655128 HCH1 high copy Hsp90 supressor YNL282W 0.528267406 0.096883099 -0.118165019 0.652697921 POP3 RNase P and RNase MRP subunit YNL283C 1.408984616 0.169754321 0.60061628 0.001965761 WSC2 Putative integral membrane protein containing novel cysteine motif. Similarity to SLG1 (WSC1), WSC3 and WSC4 YNL284C -0.18404232 0.422687026 -0.482269738 0.038310979 MRPL10 Mitochondrial ribosomal protein MRPL10 (YmL10) YNL285W 0.202612771 0.71315893 -0.034309364 0.700280615 hypothetical protein YNL286W -1.07831476 0.015555869 -0.413533112 0.050360366 CUS2 Contains two RNA recognition (RRM) domains YNL287W 0.04713628 0.860679082 -0.099535198 0.008312581 SEC21 non-clathrin coat protein involved in transport between ER and Golgi YNL288W 0.696199538 0.04933158 0.52566627 0.068916003 CAF40 CCR4 associated factor 40 kDa YNL289W 1.126739357 0.106983775 0.205205464 0.252068965 PCL1 G(sub)1 cyclin that associates with PHO85 YNL290W 0.679571596 0.081839759 0.057534351 0.380413833 RFC3 Subunit 3 of Replication Factor C ; homologous to human RFC 36 kDa subunit YNL291C 0.349411499 0.077006133 0.15710359 0.190550668 MID1 N-glycosylated integral plasma membrane protein YNL292W 0.168005531 0.480138362 -0.380339336 0.114060373 PUS4 Pseudouridine synthase YNL293W 0.263914497 0.277518782 -0.466229608 0.040481608 MSB3 Multicopy Suppressor of Bud Emergence YNL294C 0.61943148 0.277948731 -0.163066528 0.005959247 hypothetical protein YNL295W -0.17369604 0.595589241 -0.130172917 0.267486477 hypothetical protein YNL296W -0.20756833 0.408271975 0.278047925 0.216849808 questionable ORF YNL298W 0.619558951 0.380432643 0.174971912 0.06931457 CLA4 protein kinase, homologous to Ste20p, interacts with CDC42 YNL299W 0.542647438 0.097576584 -0.767762321 0.016565872 TRF5 exhibits homology to Trf4p and Top1p YNL300W 1.450995143 0.102028805 0.515302561 0.120456154 TOS6 probable cell wall protein YNL301C 1.224644755 0.036735933 0.219393383 0.113442069 RPL18B Ribosomal protein L18B (rp28B) YNL302C 1.123946631 0.041669051 -0.105847454 0.494486498 RPS19B Ribosomal protein S19B (rp55B) (S16aB) (YS16B) YNL303W 0.501712812 0.177218726 -0.332234313 0.034031239 hypothetical protein YNL304W -0.31957455 0.347155292 -0.235507898 0.124328799 YPT11 similar to Ypt1 and other Ras-like GTP-binding proteins YNL305C -0.35398315 0.311566158 0.422526423 0.122837897 similarity to C-term. of A.nidulans regulatory protein (qutR) YNL306W 0.305789246 0.312997863 -0.241569452 0.061594576 MRPS18 ribosomal protein of the small subunit, mitochondrial YNL307C 0.193849486 0.473787168 0.29330355 0.200716156 MCK1 43.1 kDa Serine /threonine /tyrosine protein kinase YNL308C 0.731730434 0.252333701 -0.818112531 0.004197249 KRI1 Binding Protein of Krr1p YNL309W 0.000652034 0.99881581 0.542236387 0.018671135 STB1 Interacts with the putative transcription factor Sin3p YNL310C 0.22644415 0.39405309 0.097929001 0.370511346 similarity to S.pombe hypothetical protein SPAC24H6.02c YNL311C 0.05459429 0.917732761 -0.218963468 0.218638044 hypothetical protein YNL312W 0.444271252 0.206749495 0.072874557 0.61072666 RFA2 subunit 2 of replication factor RF-A ; 29 % identical to the human p34 subunit of RF-A YNL313C 1.030426681 0.062958826 0.010321199 0.857397069 similarity to C.elegans hypothetical protein YNL314W -0.18642319 0.225048471 0.181084248 0.234891566 DAL82 positive regulator of allophanate inducible genes YNL315C 0.425417141 0.286541179 -0.351977057 0.022541885 ATP11 F1FO ATPase assembly protein YNL316C 0.370842439 0.203263828 0.083352453 0.099451143 PHA2 prephenate dehydratase YNL317W 0.007871235 0.975970357 -0.016809208 0.882039934 PFS2 Polyadenylation Factor I subunit YNL318C -0.01404419 0.954411608 0 #DIV/0! HXT14 Member of the hexose transporter family YNL319W 0.314671633 0.402695146 0.551077471 0.023448095 questionable ORF YNL320W 0.287381392 0.523090675 0.271719795 0.237042246 strong similarity to S.pombe Bem46 protein YNL321W -0.56444075 0.161298611 0.617951581 0.114330993 weak similarity to Vcx1p YNL322C 0.406945035 0.448533533 0.561651981 0.002312852 KRE1 putatively involved in side-chain addition to beta-1,6-glucan YNL323W -0.2784167 0.025425494 -0.255312084 0.037152471 LEM3 protein with similarity to Ycx1p, mutant is sensitive to brefeldin A YNL324W 0.925405456 0.457825804 0.006489773 0.973572029 hypothetical protein YNL325C -0.33580853 0.001826227 -0.178095058 0.43475141 FIG4 Homologous to the ATP /ADP exchanger Sac1p YNL326C -0.06170156 0.824626163 -0.304746497 0.031456341 similarity to YOL003c, YLR246w and C.elegans hypothetical protein ZK757.1 YNL327W 0.070760431 0.741490965 1.046507061 0.027773074 EGT2 Cell wall protein. Putatively involved in glucan metabolism YNL328C -0.31953593 0.026904732 0.026481119 0.808034001 MDJ2 Mitochindrial chaperonin YNL329C -0.90901092 0.078392071 0.105834418 0.118450106 PEX6 Member of the AAA-protein family that includes NSFp and PEX1p YNL330C -0.20300086 0.314681525 -0.162369628 0.194854091 RPD3 histone deacetylase YNL331C 0.003907149 0.981720288 -0.127139903 0.127683834 AAD14 Hypothetical aryl-alcohol dehydrogenase YNL332W 4.607825514 0.377955353 0.163739307 0.707854925 THI12 Involved in pyrimidine biosynthesis YNL333W 1.593769284 0.029214813 0.240843752 0.271124528 SNZ2 member of the stationary phase-induced gene family YNL334C 1.206495712 0.008265664 -0.129207753 0.435702023 SNO2 Induced in stationary phase YNL335W 0.819482644 0.014337627 0.100431584 0.053043611 similarity to M.verrucaria cyanamide hydratase, identical to hypothetical protein YFL061w YNL336W 0.756985599 0.358414534 -0.224548337 0.23675904 COS1 similar to subtelomerically-encoded proteins YNL337W 0.309175722 0.233514721 0.993646618 0.368816256 strong similarity to subtelomeric encoded proteins YNL338W -0.37385014 0.125019651 0.711957588 0.314946564 strong similarity to subtelomeric encoded poteins YNR001C -0.56974794 0.289147824 -0.001201906 0.993714946 CIT1 citrate synthase. Nuclear encoded mitochondrial protein. YNR002C -1.68802401 0.005887416 0.219058379 0.182062712 FUN34 Putative transmembrane protein YNR003C 0.453932378 0.033443947 -0.147959633 0.155832808 RPC34 34-kDa subunit of RNA polymerase III (C) YNR004W 0.865583512 0.091698607 0.347902996 0.163345797 weak similarity to bovine interferon gamma precursor YNR005C -0.41565219 0.14428421 0.071340496 0.560598725 questionable ORF YNR006W -0.11418616 0.320100588 -0.284831578 0.034541084 VPS27 hydrophilic protein ; has cysteine rich putative zinc finger esential for function YNR007C -0.93696475 0.016722444 -0.632844254 0.040214671 AUT1 Involved in autophagocytosis. YNR008W -0.11730609 0.643573855 0.053607972 0.44586269 LRO1 L = LCAT (Lecithin Cholesterol acyl transferase) R = related O = Open Reading Frame YNR009W 0.91266629 0.120358201 0.073131818 0.159416195 hypothetical protein YNR010W -0.05675959 0.711672031 0.194768601 0.212001912 CSE2 Component of RNA polymerase II mediator subcomplex YNR011C -0.22412477 0.576763531 -0.218942485 0.073240083 PRP2 RNA splicing factor RNA-dependent NTPase with DEAD-box motif YNR012W 0.624067641 0.232904447 -0.163324289 0.271390816 URK1 Uridine kinase YNR013C 0.187087864 0.56886276 0.826829313 0.038142234 similarity to Pho87p and YJL198w YNR014W 0.159044143 0.733486626 0.424815945 0.028487056 weak similarity to hypothetical protein YMR206w YNR015W 0.577920876 0.205813061 -0.074359069 0.613469383 SMM1 Suppressor of Mitochondrial Mutation in the tRNAasp gene YNR017W 0.363813936 0.175130047 0.266568925 0.23845954 MAS6 23 kDa mitochondrial inner membrane protein YNR018W -0.23393981 0.155212115 0.220107537 0.105845167 hypothetical protein YNR019W -0.40086478 0.085591168 0.115116469 0.244867368 ARE2 Acyl-CoA cholesterol acyltransferase (sterol-ester synthetase) YNR020C 0.357351646 0.001906246 0.041549798 0.678124052 hypothetical protein YNR021W 0.626016313 0.071668338 0.227708227 0.006513932 hypothetical protein YNR022C 0.296627869 0.170924068 -0.365785659 0.057458896 weak similarity to protein phosphatases YNR023W 1.269033 0.414312295 -0.317079897 0.130042861 SNF12 73 kDa subunit of the SWI /SNF transcription activation complex, homolog of Rsc6p subunit of the RSC chromatin remodeling complex YNR024W 0.446680479 0.26031972 -0.646746208 0.089175011 weak similarity to Rpc31p YNR025C 0.636268725 0.118976896 -0.230653434 0.007915341 questionable ORF YNR026C 0.973313688 0.299941521 -0.265214929 0.089009012 SEC12 Guanine nucleotide exchange factor for Sar1p. YNR027W 0.455339426 0.241935118 -0.303062061 0.015820494 similarity to human pyridoxal kinase YNR028W -0.01827332 0.944973845 0.042519895 0.732261411 CPR8 Cyclophilin YNR029C 0.025028451 0.951947983 -0.33383975 0.189097176 similarity to P.denitrificans cobW protein YNR030W 0.493164801 0.075096306 0.505993914 0.147470723 ECM39 Member of the major facilitator superfamily YNR031C -0.37475182 0.168455644 0.413431831 0.011854171 SSK2 A MAP kinase kinase kinase ; activator of Pbs2p YNR032C-A 0.297117739 0.055241566 -0.036703623 0.816689572 HUB1 ubiquitin-like modifier YNR032W 0.454878694 0.300888222 0.031395164 0.614453985 PPG1 Serine /threonine protein phosphatase type 2A YNR033W -0.15499385 0.589464939 -0.052166254 0.201600773 ABZ1 para-aminobenzoate synthase, PABA synthase YNR034W -0.40376761 0.38503624 -0.043461462 0.398858533 SOL1 shows similarity to glucose-6-phosphate dehydrogenase non-catalytic domains ; homologous to Sol2p and Sol3p YNR034W-A -4.32482843 5.08058E-06 0.18176186 0.269225781 YNR035C -0.55886118 0.021450791 0.189206593 0.069169819 ARC35 Arp Complex Subunit YNR036C 0.23152528 0.435133766 0.475102421 0.218926594 YNR037C 1.394047523 0.142184071 -0.197296607 0.119005629 RSM19 protein of the small subunit of the mitochondrial ribosome YNR038W 0.702262044 0.053586167 0.103726963 0.48374732 DBP6 putative RNA helicase YNR039C -0.34696842 0.254960629 -0.054447742 0.146628378 ZRG17 zinc-regulated gene YNR040W 0.546042157 0.18547511 0.031950675 0.749870965 hypothetical protein YNR041C 0.132106698 0.749430869 0.43786413 0.310797794 COQ2 para hydroxybenzoate: polyprenyl transferase YNR042W -0.38346193 0.031917649 0.096575135 0.144480294 hypothetical protein YNR043W 0.673154087 0.478201527 0.352743102 0.085200999 MVD1 mevalonate pyrophosphate decarboxylase YNR045W -0.23443053 0.528638843 -0.069746328 0.517730717 PET494 translational activator of cytochrome c oxidase YNR046W 1.069217315 0.077350167 0.637821039 0.00976523 strong similarity to S.pombe hypothetical protein SPAC31A2.02 YNR047W -0.69585035 0.089175499 0.361159798 0.024104137 similarity to ser/thr protein kinases YNR048W 0.626978055 0.1679433 0.246223527 0.027117657 strong similarity to YCR094w and YNL323w YNR049C 1.353539786 0.288163396 -0.045130511 0.731900146 MSO1 small hydrophilic protein, enriched in microsomal membrane fraction, interacts with Sec1p YNR050C 3.567823622 0.279612506 -0.106346634 0.50536719 LYS9 Saccharopine dehydrogenase (NADP+, L-glutamate forming) (saccharopine reductase) (EC 1.5.1.10) YNR051C 0.187183933 0.479427363 -0.088478797 0.148270578 BRE5 protein with an an RNA recognition (RRM) domain YNR052C 0.727299494 0.114305142 0.361060796 0.122655126 POP2 Putative transcription factor YNR053C 1.216716218 0.046853195 -0.370162745 0.057194943 strong similarity to human breast tumor associated autoantigen YNR054C 0.890474651 0.017510023 -0.401939971 0.188680393 similarity to C.elegans hypothetical protein CEESL47F YNR055C -0.12085629 0.47763302 0.240492971 0.210202388 HOL1 Putative ion transporter similar to the major facilitator superfamily of transporters YNR056C -0.70849885 0.1815009 0.031283168 0.847461243 BIO5 transmembrane regulator of KAPA /DAPA transport YNR057C 0.337957477 0.655673034 0.004236213 0.979238017 BIO4 dethiobiotin synthetase YNR058W -0.73452617 0.066133245 -0.088960996 0.58712784 BIO3 7,8-diamino-pelargonic acid aminotransferase (DAPA) aminotransferase YNR059W -0.13680831 0.75239214 -0.031687795 0.664287969 MNT4 mannosyltransferase (putative) YNR060W -0.41708765 0.085029883 -0.289456081 0.512785186 FRE4 Similar to ferric reductases Fre1p and Fre2p YNR061C 0.730930661 0.119491712 0.218919585 0.152324689 weak similarity to hypothetical protein YDL218w YNR062C -0.31793545 0.386187125 0.089556423 0.257255747 weak similarity to H.influenzae L-lactate permease (lctP) homolog YNR063W -0.10583319 0.61838396 -0.131366426 0.602961997 weak similarity to CYC1/CYP3 transcription activator YNR064C -0.28962162 0.325684942 0.364845751 0.058980795 similarity to R.capsulatus 1-chloroalkane halidohydrolase YNR065C 0.952235724 0.358707044 -0.074636239 0.664207662 strong similarity to YJL222w, YIL173w and Pep1p YNR066C 1.060294124 0.289825053 -0.097783743 0.553096073 strong similarity to Pep1p YNR067C 0.435604673 0.209832524 0.44330232 0.075266991 similarity to beta-glucan-elicitor receptor - Glycine max YNR068C -0.94082346 0.033916495 -0.429077528 0.110222027 similarity to Bul1p YNR069C -1.21052412 0.040441863 0.051307295 0.776890964 similarity to central part of Bul1p YNR071C -0.92189619 0.000387249 0.203399215 0.51777976 strong similarity to UDP-glucose 4-epimerase Gal10p YNR072W -0.61609491 0.153354055 0.152392994 0.418304935 HXT17 Putative hexose transporter YNR073C -1.07166682 0.011261357 0.244135192 0.195877566 strong similarity to E.coli D-mannonate oxidoreductase, identical to YEL070w YNR074C -0.20394724 0.439060287 -0.209274614 0.04320732 weak similarity to B.subtilis nitrite reductase (nirB) YNR075W 0.108647076 0.869987776 0.274514437 0.210746461 COS10 Protein with strong similarity to subtelomerically-encoded proteins such as Cos5p, Ybr302p, Cos3p, Cos1p, Cos4p, Cos8p, Cos6p, Cos9p YNR076W -0.43658085 0.000976186 0.506198064 0.175338495 PAU6 Member of the seripauperin family YNR077C -0.10246995 0.793793767 0.051868686 0.890158636 strong similarity to subtelomeric encoded proteins YOL001W -0.63879664 0.002980596 0.19479752 0.239617977 PHO80 The Pho80p Cyclin YOL002C -0.11328903 0.829973616 -0.133467859 0.53412283 strong similarity to YDR492w and S.pombe hypothetical protein YOL003C 0.353657387 0.130287941 0.19314625 0.030495331 similarity to C.elegans hypothetical protein, YDR126w, YNL326c and YLR246w YOL004W -0.08114502 0.848736563 0.10891656 0.440966135 SIN3 DNA binding protein involved in transcriptional regulation YOL005C 0.857894093 0.05621266 0.730839848 0.018474063 RPB11 RNA polymerase II subunit, homologous to S. pombe Rpb11p subunit YOL006C 0.195178592 0.395496228 -0.51206246 0.127970145 TOP1 topoisomerase I YOL007C 1.77230845 0.053765142 0.709011562 0.003745883 CSI2 Appears to be a structural component of the chitin synthase 3 complex YOL008W 0.073901892 0.383099881 0.320887224 0.014791622 hypothetical protein YOL010W 1.074091835 0.14344559 -0.078132845 0.714993895 RCL1 protein similar to the RNA 3' terminal phosphate cyclase (RNA 3' terminal phosphate Cyclase-Like) YOL011W -0.90919602 0.001047992 0.167015136 0.408831409 PLB3 phospholipase B /lysophospholipase YOL012C -0.40518221 0.007498736 0.362388631 0.080061063 HTZ1 An evolutionarily conserved member of the histone H2A F /Z family of histone variants YOL013C -0.41902307 0.132416857 -0.01904662 0.888114711 HRD1 required to degrade misfolded ER lumenal and integral membrane proteins YOL013W-A -1.64815325 0.067438091 0.674455094 0.278418525 YOL014W 1.889595407 0.034562724 0.315754368 0.071183139 hypothetical protein YOL015W 0.14675408 0.831937211 -0.204437216 0.044688803 weak similarity to YKR015c YOL016C 0.588985792 0.489457521 -0.563075779 0.01132949 CMK2 Calmodulin-dependent protein kinase YOL017W 0.062829585 0.811480031 -0.310857609 0.03610244 similarity to YFR013w YOL018C -0.57354939 0.00339602 -0.769763186 0.013867473 TLG2 tSNARE that affects a Late Golgi compartment YOL019W 1.743956065 0.349765809 0.528361045 0.155867038 TOS7 similarity to Rim9p and YFR012w YOL020W 0.670060485 0.091927351 0.363760512 0.100121918 TAT2 Tryptophan permease, high affinity YOL021C 0.277413535 0.552588223 -0.099767646 0.164905586 DIS3 3'-5' exoribonuclease complex subunit YOL022C 0.687183223 0.032568719 -0.292722586 0.054555117 weak similarity to rat apoptosis protein RP-8 YOL023W 0.534592435 0.148990414 -0.423138329 0.109895175 IFM1 mitochondrial initiation factor 2 YOL024W -0.1750685 0.656810162 0.313950477 0.387907043 hypothetical protein YOL025W -0.43543381 0.029963316 0.192080941 0.203995959 LAG2 involved in determination of longevity YOL026C 0.348314128 0.071963863 0.519428159 0.028073752 hypothetical protein YOL027C 0.107582696 0.571794562 -0.007423595 0.882042738 similarity to YPR125w YOL028C 0.467240686 0.014081326 -0.340671533 0.06662008 YAP7 basic leucine zipper (bZIP) transcription factor YOL029C 0.370623972 0.25362123 -0.069317933 0.234867574 hypothetical protein YOL030W 1.461308976 0.241809865 0.772290683 0.176267111 strong similarity to glycoprotein Gas1p YOL031C 0.518711953 0.603458246 -0.104832825 0.16020006 weak similarity to Y.lipolytica Sls1 protein precursor YOL032W -0.8545621 0.000950301 0.048790726 0.608706125 hypothetical protein YOL033W -0.18644757 0.414516733 -0.505152953 0.017158248 MSE1 Mitochondrial glutamyl-tRNA synthetase YOL034W -0.55692661 0.003993352 -0.321352126 0.269837676 similarity to S.pombe rad18 and rpgL29 genes and other members of the SMC superfamily YOL035C 0.183417657 0.401008682 0.290251251 0.034676969 questionable ORF YOL036W 0.278535395 0.139755005 0.193970097 0.002508801 weak similarity to YMR317w YOL037C 0.033292708 0.893383196 0.71423764 0.111989622 questionable ORF YOL038W 0.288312815 0.4394112 0.422337156 0.023776821 PRE6 alpha-type of subunit of 20S proteasome YOL039W 1.214419471 0.025383298 0.597341306 0.016506898 RPP2A 60S acidic ribosomal protein P2A (L44) (A2) (YP2alpha) YOL040C 1.633716594 0.079449594 0.753295478 0.012005814 RPS15 40S ribosomal protein S15 (S21) (rp52) (RIG protein) YOL041C 0.733378986 0.071474572 -1.023558966 0.038808621 NOP12 NucleOlar Protein ; isolated as a mutant exhibiting synthetic lethality with a nop2 ts allele. YOL042W -0.35525484 0.0331985 -0.453241612 0.003242244 similarity to CCR4 protein YOL043C -0.03539165 0.912666992 -0.490222376 0.028214771 NTG2 Endonuclease III-like glycosylase YOL044W -0.62388528 0.044254038 -0.302796711 0.044296798 PEX15 44 kDa phosphorylated integral peroxisomal membrane protein YOL045W 1.08710511 0.146629213 -0.068605597 0.368818846 similarity to ser/thr protein kinase YOL046C 0.531416347 0.036214843 0.306558646 0.400566859 questionable ORF YOL047C 0.135367476 0.395548277 0.350345339 0.109529705 weak similarity to hypothetical proteins YAL018c and YOL048c YOL048C -0.32636113 0.148867146 0.274668333 0.045079799 similarity to YAL018c and YOL047c YOL049W 0.206134441 0.212917715 -0.110704998 0.588427591 GSH2 Glutathione Synthetase YOL050C -0.35282021 0.439551976 0.0974044 0.079471284 questionable ORF Component of the RNA polymerase II holoenzyme complex, positive and negative transcriptional regulator of genes involved in mating-type YOL051W -0.22084184 0.593455773 -0.029570843 0.617468884 GAL11 specialization YOL052C 0.478210068 0.101937599 0.492581388 0.008653101 SPE2 S-adenosylmethionine decarboxylase YOL052C-A -4.15678992 2.4654E-06 0.64711971 0.077100794 DDR2 induced by DNA damage, heat shock, osmotic shock, and oxidative stress YOL053W -1.06948742 0.008588732 -0.432723851 0.05667226 hypothetical protein YOL054W 0.388622253 0.167966006 -0.257096978 0.043197871 weak similarity to transcription factors THI for thiamine metabolism. Transcribed in the presence of low level of thiamine (10-8M) and turned off in the presence of high level (10-6M) YOL055C 1.189535627 0.171599899 -0.204361923 0.140026288 THI20 of thiamine. Under the positive control of THI2 and THI3. YOL056W 1.028455836 0.324492718 -0.158455277 0.24210037 GPM3 phosphoglycerate mutase YOL057W -0.95310523 0.001502295 -0.092900257 0.189753748 similarity to hypothetical C. elegans protein F02E9.6 YOL058W 1.205173236 0.351306008 0.220897137 0.391433574 ARG1 arginosuccinate synthetase YOL059W 0.196791096 0.676581475 0.36122447 0.160445894 GPD2 Glycerol-3-phosphate dehydrogenase (NAD+) YOL060C -0.20267873 0.536801466 0.51241227 0.007009466 AMI3 protein required for normal mitochondrial structure YOL061W 0.38346736 0.17466204 -0.084289059 0.797767502 PRS5 Phosphoribosylpyrophosphate synthetase (ribose-phosphate pyrophosphokinase) YOL062C 0.180735388 0.575002388 -0.024215951 0.89108577 APM4 Clathrin associated protein, medium subunit YOL063C -0.22178909 0.052986304 -0.087661308 0.454602309 hypothetical protein YOL064C 0.20789955 0.631324712 -0.288826691 0.077907028 MET22 3'(2')5'-bisphosphate nucleotidase YOL065C -1.88442162 0.000219165 -0.128537209 0.356172962 INP54 inositol polyphosphate 5-phosphatase YOL066C -0.73571316 0.03261567 -0.064977715 0.710537863 RIB2 DRAP deaminase YOL067C -0.22803203 0.396640091 -0.203031361 0.062005278 RTG1 Transcription factor (bHLH) involved in interorganelle communication between mitochondria, peroxisomes, and nucleus YOL068C -0.22342869 0.434791594 -0.422418747 0.057717743 HST1 Homolog of SIR2 YOL069W -0.11648126 0.692496416 -0.46730856 0.107289276 NUF2 53-kDa coiled-coil protein YOL070C 0.421822636 0.157041368 -0.352720162 0.078923309 hypothetical protein YOL071W 0.254444022 0.406987525 0.029125468 0.810012012 similarity to hypothetical S. pombe protein YOL072W 0.289670036 0.141262803 0.090643418 0.069317823 THP1 weak similarity to hypothetical protein C. elegans /THO2 - HPR1 Phenotype YOL073C -0.51901831 0.164623561 0.212499008 0.028586743 hypothetical protein YOL076W 0.576455238 0.195526482 -0.153842004 0.347511478 MDM20 involved in mitochondrial inheritance and actin assembly YOL077C 1.347162227 0.059550916 -0.265635396 0.211624931 BRX1 Essential nucleolar protein required for biogenesis of the 60S ribosomal subunit ; homologue of BRIX (Biogenesis of ribosomes in Xenopus) YOL077W-A -0.56969252 0.042083887 0.24661593 0.124348746 ATP19 Subunit k homolog of ATP synthase YOL079W 0.285147557 0.559796439 -0.528481875 0.204309444 similarity to NADH dehydrogenases YOL080C 1.113244168 0.192659062 -0.486700158 0.131203118 REX4 RNA EXonuclease ; part of family of 3'-to5' exonucleases. See Moser et al. 1997 Nucleic acids Res. 25:5110-5118 YOL082W -1.05819391 0.046633431 -0.076706934 0.625583304 similarity to YOL083w YOL083W -2.21943178 0.000877614 -0.547222796 0.06101924 similarity to YOL082w YOL084W -2.00728818 0.004101085 0.362139102 0.274332978 PHM7 similarity to A.thaliana hyp1 protein YOL085C 0.355660004 0.367887296 0.862067822 0.125217257 hypothetical protein YOL086C 1.190660526 0.051221567 0.280787064 0.025249657 ADH1 Alcohol dehydrogenase YOL087C -0.52438553 0.076753238 -0.082174365 0.033453732 similarity to S.pombe hypothetical protein YOL088C -0.61260673 0.008760919 -0.325621179 0.000411706 MPD2 protein disulfide isomerase related protein YOL089C -0.22523184 0.546955792 -0.034552204 0.723930738 HAL9 putative transcription factor ; contains a zinc finger YOL090W 0.432885053 0.141025606 -0.588551496 0.035003586 MSH2 MutS homolog encoding major mismatch repair activity in mitosis and meiosis. YOL091W -0.32480065 0.254490869 -0.566636673 0.10476925 SPO21 involved in sporulation YOL092W 1.140539397 0.109119818 0.723799516 0.118019987 strong similarity to YBR147w YOL093W 1.011031268 0.050021912 -0.104189824 0.438964911 similarity to C.elegans hypothetical protein F25H8.1 YOL094C 0.69235707 0.122370075 -0.233056983 0.227996218 RFC4 Subunit 4 of Replication Factor C ; homologous to human RFC 40 kDa subunit YOL095C 0.151003822 0.640179594 -0.319098355 0.164522156 HMI1 mitochondrial DNA helicase (putative) YOL096C -1.00237085 0.008356645 -0.085557331 0.435278729 COQ3 3,4-dihydroxy-5-hexaprenylbenzoate methyltransferase YOL097C 1.308332899 0.154804266 -0.193787898 0.126488331 WRS1 cytoplasmic tryptophanyl-tRNA synthetase YOL098C 0.197351175 0.120368685 0.181111766 0.004883411 similarity to hypothetical S.pombe protein YOL099C 0.063656443 0.77918454 -0.040341681 0.864761399 questionable ORF YOL100W -0.10172728 0.578619411 -0.427772079 0.070657907 PKH2 Ser /Thr protein kinase YOL101C 0.749866639 0.482974401 -0.098547552 0.285179104 tRNA 2'-phosphotransferase YOL102C -0.82500767 0.03649582 -0.266591733 0.190929025 TPT1 tRNA 2'-phosphotransferase YOL103W 0.128461337 0.684670663 -0.091763663 0.321047169 ITR2 myo-inositol transporter YOL104C 1.009436021 0.062652416 -0.157659119 0.36228216 NDJ1 involved in meiotic chromosome segregation YOL105C 0.810442898 0.146845588 0.419652083 0.12691837 WSC3 Putative integral membrane protein containing novel cysteine motif. Similarity to SLG1 (WSC1), WSC2 and WSC4 YOL106W 0.237594934 0.306148215 0.277384176 0.150387199 identified by SAGE YOL107W 0.819929394 0.383404575 0.669202063 0.087466078 weak similarity to human PL6 protein YOL108C 0.012117291 0.980359635 -0.389276005 0.036303064 INO4 basic helix-loop-helix (bHLH) protein YOL109W 0.036275227 0.896877061 -0.634898093 0.139577495 ZEO1 Overexpression causes resistance to Zeocin YOL110W -0.06599379 0.766357427 0.467515203 0.058947016 SHR5 involved in RAS localization and palmitoylation YOL111C -0.35995184 0.345471516 0.37976261 0.121363941 weak similarity to human ubiquitin-like protein GDX YOL112W 0.105889724 0.710778018 -0.483698608 0.006788167 MSB4 multicopy suppressor of bud emergence defect YOL113W 0.764544994 0.199745454 -0.368201874 0.253201671 SKM1 serine /threonine protein kinase YOL114C 0.191365104 0.390792238 -0.240543324 0.443940968 similarity to human DS-1 protein YOL115W 0.386323015 0.368101816 -0.370186017 0.065895982 TRF4 homologous to Trf5p and Top1p, associates with Smc1p and Smc2p YOL116W -0.7108511 0.001156997 -0.234149547 0.169993148 MSN1 43 kDa protein, transcriptional activator YOL117W -0.98073814 0.002529251 -0.576613236 0.017750227 weak similarity to human sodium channel alpha chain HBA YOL118C 1.33998234 0.059693665 0.13827784 0.060570617 hypothetical protein YOL119C 0.790713088 0.297957254 0.123084879 0.444498022 similarity to monocarboxylate transporter proteins YOL120C 1.241364565 0.047718353 0.16866299 0.136178652 RPL18A Ribosomal protein L18A (rp28A) YOL121C 0.825853142 0.170781372 0.069472833 0.663066825 RPS19A 40S ribosomal protein S19A (S16aA) (rp55A) (YS16A) YOL122C -0.04474124 0.89768574 0.003989141 0.969849998 SMF1 has been localized to both the plasma membrane and the mitochondrial membrane YOL123W -0.08613888 0.736064634 -0.190318737 0.204449218 HRP1 putative polyadenylated-RNA-binding protein YOL124C 2.021086122 0.286715537 -0.27170521 0.167858746 weak similarity to M.jannaschii hypothetical protein YOL125W 0.405215627 0.245261925 -0.161686473 0.405742857 hypothetical protein YOL126C -1.78596336 0.000942265 0.091356144 0.472214505 MDH2 cytosolic malate dehydrogenase YOL127W 1.456429685 0.09342639 0.208395546 0.264660289 RPL25 Ribosomal protein L25 (rpl6L) (YL25) YOL128C 0.359595339 0.679343991 -0.299198624 0.131272259 strong similarity to protein kinase Mck1p YOL129W 0.315244999 0.270124678 0.508267717 0.065094509 similarity to hypothetical S. pombe protein YOL130W -0.43592939 0.010189503 0.024692774 0.47341697 ALR1 putative ion transporter YOL131W -0.78403078 0.060727 -0.119514375 0.809991368 hypothetical protein YOL132W -0.87897049 0.005957884 -0.171070581 0.37068337 similarity to glycophospholipid-anchored surface glycoprotein Gas1p YOL133W -0.09303598 0.087374376 -0.1387016 0.368375868 HRT1 subunit of Skp1-Cullin-F-box ubiquitin protein ligase (SCF) YOL134C -0.09806354 0.719327979 -0.249226529 0.361847844 questionable ORF YOL135C 0.143460451 0.781723001 0.150600899 0.173985689 MED7 Stoichiometric member of mediator complex YOL136C 2.468764372 0.308147836 0.007469872 0.946225748 PFK27 6-phosphofructo-2-kinase YOL137W 0.303730374 0.072523213 0.123423263 0.014040148 weak similarity to tetracycline resistance proteins YOL138C -0.50637034 0.19849347 0.080462745 0.261758122 hypothetical protein YOL139C 1.198805808 0.097220653 0.042647605 0.767445104 CDC33 mRNA cap binding protein eIF-4E YOL140W 0.997471573 0.114785432 -0.055924668 0.820777345 ARG8 Acetylornithine aminotransferase YOL141W -0.2717778 0.501157565 0.460665083 0.145802444 PPM2 carboxy methyl transferase ; homolog of PPM1 YOL142W -0.13885322 0.245125651 0.09927223 0.105694824 RRP40 Rrp40p YOL143C -0.30894732 0.078757143 0.501161145 0.071388948 RIB4 6,7-dimethyl-8-ribityllumazine synthase (DMRL synthase) YOL144W 0.52215242 0.134892785 -0.456717641 0.075513068 NOP8 Nucleolar protein required for 60S ribosome biogenesis YOL145C 0.207953088 0.446429953 -0.653724 0.054851343 CTR9 involved in mitosis and chromosome segregation YOL146W 0.942318285 0.147358705 -0.071426041 0.613332481 hypothetical protein YOL147C 1.115379338 0.279160372 0.569145012 0.254218463 PEX11 Peroxisomal membrane protein YOL148C -0.09704964 0.461286622 -0.493613728 0.007617919 SPT20 transcription factor, member of the histone acetyltransferase SAGA complex YOL149W 0.179145999 0.769527666 -0.750290176 0.045856337 DCP1 Decapping protein involved in mRNA degradation YOL150C -0.86096819 0.003031315 0.247178193 0.152682345 questionable ORF YOL151W -1.69873319 0.000271703 0.255639845 0.366631306 GRE2 putative reductase YOL152W -1.45100383 0.015190272 0.477311512 0.196245539 FRE7 similar to FRE2 YOL153C -1.57537663 0.001080399 0.105094129 0.517621185 strong similarity to Cps1p (Gly-X carboxypeptidase YSCS precursor ) YOL154W 0.28892457 0.786420884 0.127822503 0.810940368 similarity to S.fumigata Asp FII YOL155C -0.48508783 0.007376512 0.613335093 0.095811627 similarity to glucan 1,4-alpha-glucosidase Sta1p and YAR066w YOL156W -1.19638067 0.007851508 0.548852028 0.255338591 HXT11 Glucose permease YOL157C -1.31930473 0.00867573 0.13061564 0.438506717 strong similarity to alpha-glucosidases YOL158C 0.330697486 0.37002687 0.25230002 0.153922676 ENB1 Enterobactin transporter YOL159C 0.782229706 0.230087843 -0.045268718 0.784071097 hypothetical protein YOL160W -0.20959383 0.581128871 0.142738935 0.79735456 hypothetical protein YOL161C -0.24419245 0.23943822 0.74904455 0.049491489 strong similarity to members of the Srp1p/Tip1p family YOL162W 0.103916959 0.770575014 0.19496883 0.278306169 strong similarity to hypothetical protein YIL166c YOL163W -0.82071823 0.03954312 -0.248140422 0.136442174 similarity to P. putida phthalate transporter YOL164W -0.01504196 0.948566701 0.18523341 0.158832166 similarity to Pseudomonas alkyl sulfatase YOL165C -0.42465955 0.008302494 0.103682486 0.515684237 AAD15 Hypothetical aryl-alcohol dehydrogenase (AAD) YOR001W -0.17130112 0.631717455 -0.309036991 0.141237112 RRP6 involved in 5.8S rRNA processing YOR002W 0.213888389 0.50139879 0.5170084 0.093566358 ALG6 glucosyltransferase YOR003W -0.23235719 0.31444581 0.091014567 0.380600056 YSP3 subtilisin-like protease III YOR004W 0.710142743 0.01182255 -0.658185349 0.023183468 weak similarity to hypothetical protein YDR339c YOR005C -0.26123652 0.46741275 -0.000990534 0.983522592 DNL4 ATP dependent DNA ligase YOR006C -0.21230489 0.459403368 -0.570911267 0.063273673 similarity to M.jannaschii hypothetical protein MJ0708 YOR007C -0.01646039 0.918309187 -0.131144675 0.25642508 SGT2 small glutamine-rich tetratricopeptide repeat containing protein YOR008C -0.02097455 0.832308063 0.104624079 0.415699868 SLG1 involved in cell wall integrity and stress response YOR008C-A -0.03079396 0.956520093 0.224398197 0.621035235 KIM1 diepoxybutane and mitomycin C resistance YOR009W 0.667624061 0.080578322 0.155184307 0.300110032 similarity to Tir1p and Tir2p YOR010C 0.76737638 0.388727024 1.056643755 0.030406039 TIR2 induced by cold shock YOR011W -0.20683122 0.135713187 0.291619179 0.307365421 AUS1 ABC (ATP-binding cassette) protein involved in Uptake of Sterols. YOR012W -0.34902924 0.183225021 0.108046837 0.04770476 similarity to YDR391c YOR013W 0.208974967 0.490481842 0.120360585 0.119624359 strong similarity to YDR391c YOR014W -0.16928253 0.336996212 0.067016072 0.569688169 RTS1 B-type regulatory subunit of protein phosphatase 2A (PP2A) YOR015W 0.177070291 0.557417479 0.162215005 0.322921247 hypothetical protein YOR016C 0.302241101 0.068798189 0.45734451 0.01966058 ERP4 p24 protein involved in membrane trafficking YOR017W -0.18292976 0.536679561 -0.401961203 0.018414834 PET127 Mitochondrial membrane protein YOR018W -0.62995807 0.088867578 0.072491967 0.280648631 ROD1 involved in drug resistance YOR019W -0.60033707 0.089763183 0.245533855 0.075909165 similarity to YDR474c YOR020C 1.112635652 0.032763475 0.254861783 0.109260814 HSP10 10 kDa mitochondrial heat shock protein YOR021C 0.29034349 0.19476634 -0.425196829 0.148995754 similarity to Pyrococcus horikoshii hypothetical protein PHBQ041 YOR022C -0.21865561 0.114183471 -0.169678774 0.109274437 weak similarity to D.melanogaster probable Ca2+ transporter rdgB YOR023C 0.126534267 0.802356399 0.325590272 0.12298176 AHC1 protein of the Ada histone acetyltransferase complex YOR024W -0.00460519 0.984370103 0.409551578 0.535528523 hypothetical protein YOR025W -0.0039525 0.975505819 0.094257285 0.311998464 HST3 involved in telomeric silencing YOR026W -0.04514401 0.887862386 -0.050574811 0.446134243 BUB3 cell cycle checkpoint protein YOR027W -0.45383713 0.099442643 -0.030971129 0.798467446 STI1 Heat shock protein also induced by canavanine and entry into stationary phase YOR028C -1.13436031 0.033709229 0.013680853 0.868840821 CIN5 bZIP protein, can activate transcription from a promoter containing a Yap recognition site YOR029W 0.26357874 0.607981242 0.299499218 0.422649731 hypothetical protein YOR030W -0.30987465 0.240191049 0.233141958 0.150773897 DFG16 involved in filamentous growth YOR031W -0.8768601 0.001723351 0.051535523 0.929757111 CRS5 Metallothionein-like protein YOR032C -0.38624756 0.084589303 -0.168722323 0.140141032 HMS1 myc-family transcription factor homolog YOR033C -0.10767978 0.619488652 -0.426634027 0.029515244 DHS1 exonuclease YOR034C -0.17031749 0.404793042 0.120138984 0.235128417 AKR2 involved in constitutive endocytosis of Ste3p YOR035C -0.48977301 0.196993237 0.033211267 0.790242197 SHE4 Required for mother cell-specific HO expression YOR036W -0.36826226 0.373301333 -0.373053668 0.055158441 PEP12 integral membrane protein ; c-terminal TMD ; located in endosome YOR037W 0.137537689 0.306407745 -0.354455378 0.048052578 CYC2 cytochrome c mitochondrial import factor YOR038C -0.2063491 0.484058367 -0.169297407 0.219199069 HIR2 putative repressor protein ; contains nuclear targeting signal YOR039W -0.06091312 0.649933849 0.074638369 0.542530728 CKB2 Casein kinase II, beta' subunit YOR040W -0.69670921 0.0313679 -0.099024242 0.077658776 GLO4 Mitochondrial glyoxylase-II YOR041C -0.62504847 0.178625848 0.353692803 0.127389335 questionable ORF YOR042W -0.82181905 0.021325071 -0.185809401 0.381154677 weak similarity to YDR273w YOR043W -0.61988842 0.000337624 -0.064510032 0.118425639 WHI2 involved in growth regulation YOR044W 0.094301547 0.791433741 -0.057578315 0.229187476 weak similarity to YDR275w YOR045W 1.013044988 0.009164103 0.776019221 0.058703522 TOM6 outer mitochondrial membrane protein, component of the mitochondiral protein translocation complex, associates with TOM40 YOR046C 0.847696715 0.102026042 -0.40283155 0.110630322 DBP5 RNA helicase YOR047C 1.51050147 0.385636641 -0.330613767 0.139356052 STD1 homologous to MTH1 ; interacts with the SNF1 protein kinase and TBP in two-hybrid and in in vitro binding studies YOR048C -0.0268549 0.948102642 -0.034971109 0.784277455 RAT1 RNA trafficking protein ; transcription activator YOR049C -1.66116513 0.007814859 0.222918763 0.212707391 similarity to YER185w, Rta1p YOR050C 0.653730703 0.074920052 0.103805519 0.5301162 hypothetical protein YOR051C 1.322415586 0.346119005 -0.48555924 0.066178128 weak similarity to myosin heavy chain proteins YOR052C -0.01213931 0.980603155 -0.519950446 0.012244548 hypothetical protein YOR053W -0.63035115 0.059976975 0.272132796 0.059698392 similarity to protamines YOR054C -0.95995318 0.036941256 -0.155127063 0.08962215 similarity to Sis2p protein and C.tropicalis hal3 protein YOR055W -1.12250303 0.008917525 -0.263817298 0.289318611 questionable ORF YOR056C 0.4323584 0.03714858 -0.148140236 0.160555011 weak similarity to human phosphorylation regulatory protein HP-10 YOR057W -0.39907116 0.017405123 -0.175839181 0.173984177 SGT1 skp1 suppressor of skp1 YOR058C -0.04213449 0.775864302 -0.576929071 0.001019122 ASE1 encodes component of the spindle midzone YOR059C -0.59984767 0.016826395 -0.140243339 0.099333166 weak similarity to YGL144c YOR060C 0.172543584 0.417632264 -0.418082034 0.069190833 hypothetical protein YOR061W 0.63284262 0.180928286 -0.231325581 0.121143619 CKA2 alpha' subunit of casein kinase II YOR062C 1.106579325 0.484152489 -0.056094091 0.498559658 strong similarity to YKR075c YOR063W 0.892834569 0.084445822 0.110501298 0.486864495 RPL3 Ribosomal protein L3 (rp1) (YL1) YOR064C -0.81186585 0.027096058 -0.090148466 0.598135188 YNG1 histone acetyltransferase complex component YOR065W -1.50103183 0.005977743 0.110770104 0.13550998 CYT1 Cytochrome c1 YOR066W -0.52363898 0.266227988 0.559398372 0.049465384 hypothetical protein YOR067C 0.477828005 0.347684271 0.214154952 0.352593111 ALG8 glycosyl transferase YOR068C 0.167453601 0.517931315 0.148818507 0.844356773 hypothetical protein YOR069W -0.22541249 0.12102832 -0.653204329 0.005252159 VPS5 Sorting nexin I homologue YOR070C -0.39144723 0.16656837 0.328628498 0.189074829 GYP1 GTPase activating protein YOR071C 0.619062965 0.017820494 0.602641872 0.10978103 strong similarity to Thi10p YOR072W -0.22770613 0.631727258 0.062568223 0.548997319 hypothetical protein YOR073W 0.373527808 0.117593905 -0.340902754 0.205652358 hypothetical protein YOR074C 0.047880153 0.840336786 -0.232697356 0.135939906 CDC21 Thymidylate synthase YOR075W -0.5626729 0.043051182 -0.803657119 0.037697607 UFE1 endoplasmic reticulum t-SNARE, coprecipitates with Sec20p, Tip1p. and Sec22p YOR076C 0.044646158 0.792533221 -0.105702453 0.504670233 similarity to Hbs1p, Sup2p and EF1-alpha YOR077W 0.294961163 0.35144967 -0.332757717 0.083093816 RTS2 similar to mouse KIN7 protein YOR078W 0.715640844 0.139061513 -1.131114311 0.01773151 weak similarity to YMR172w YOR079C 2.023068313 0.253724843 0.234793924 0.119785119 ATX2 manganese-trafficking protein YOR080W 0.411791646 0.227644412 -0.588348327 0.053385935 DIA2 Digs Into Agar YOR082C 0.447132603 0.609098123 0.619736614 0.435307442 questionable ORF YOR083W -0.15824597 0.864180329 0.037844149 0.816315948 weak similarity to YKR091w YOR084W -0.22384405 0.71713418 0.204894826 0.428673847 hypothetical protein YOR085W 0.501577344 0.387100297 0.757324604 0.104317708 OST3 34-kDa, gamma subunit of oligosaccharyl transferase glycoprotein complex YOR086C -1.26446881 0.001917601 0.429014916 0.045942902 weak similarity to synaptogamines YOR087W 0.147865409 0.449686341 0.282471784 0.055545987 hypothetical protein YOR088W -0.03635603 0.775611389 0.014235654 0.835802336 weak similarity to human calcium influx channel small GTP-binding protein ; geranylgeranylated ; geranylgeranylation required for membrane association ; also involved in endocytosis post YOR089C -0.0151928 0.914881275 -0.316881604 0.139644178 VPS21 vesicle internalization YOR090C -0.6897274 0.077804855 -0.009089898 0.9699339 PTC5 Type 2C Protein Phosphatase YOR091W 0.743509626 0.233060184 -0.316794809 0.098866207 similarity to hypothetical S.pombe protein D83992_G YOR092W -0.73391262 0.005644255 -0.052692795 0.27851517 ECM3 involved in cell wall biogenesis (putative) YOR093C -0.07952696 0.718588053 -0.217702906 0.051473544 similarity to S.pombe hypothetical protein SPAC22F3.04 YOR095C 0.933786691 0.128349931 -0.326246059 0.195568583 RKI1 Ribose-5-phosphate ketol-isomerase YOR096W 1.513057506 0.030362232 -0.140771101 0.393280483 RPS7A Ribosomal protein S7A (rp30) YOR097C -0.38197335 0.133610465 -0.048956478 0.60233561 hypothetical protein YOR098C 0.161384444 0.62718317 0.167915429 0.063133893 NUP1 nuclear pore complex protein YOR099W 0.233284357 0.4452622 0.692533446 0.129742538 KTR1 type 2 membrane protein ; probable secretory protein YOR100C -0.0056473 0.991879392 0.142061366 0.04222499 CRC1 mitochondrial carnitine transport protein YOR101W 1.448620437 0.330520767 -0.377507543 0.010014222 RAS1 ras proto-oncogene homolog YOR102W 0.408943462 0.400908564 0.342724249 0.21328125 questionable ORF YOR103C 0.19552027 0.679611374 0.251192431 0.17316295 OST2 16-kDa, epsilon subunit of oligosaccharyltransferase complex ; 40 % identical to vertebrate DAD1 protein YOR104W 0.596686822 0.250924478 -0.601000672 0.003191087 hypothetical protein YOR105W 0.62328171 0.198119866 -0.369842078 0.053475983 questionable ORF YOR106W -0.60426734 0.015699222 -0.507274804 0.093118161 VAM3 member of the syntaxin family of proteins ; predicted C-terminal TMD YOR107W -0.72608427 0.001956691 0.232620794 0.309110734 RGS2 GTPase activating protein for Gpa2 YOR108W 0.430252404 0.007615371 -0.01035425 0.915911853 putative isoform of Leu4p YOR109W -0.07918662 0.674771492 0.217900708 0.363800686 INP53 inositol polyphosphate 5-phosphatase YOR110W -0.26016734 0.218302769 -0.530335616 0.000487572 TFC7 55 kDa subunit of TFIIIC (tau55) YOR111W -0.66307254 0.00279624 -0.363445511 0.025278875 weak similarity to B.subtilis maf protein YOR112W 0.522574815 0.010240964 0.167041876 0.197467058 similarity to C.elegans hypothetical protein YOR113W -0.2859183 0.290333226 0.063500942 0.545654931 AZF1 similar to Zn-finger transcription factors YOR114W -0.31530048 0.293851576 -0.026937424 0.632895345 hypothetical protein YOR115C 0.571747548 0.349395161 -0.748343884 0.017449164 TRS33 TRAPP subunit of 33 kDa YOR117W 0.549692539 0.252182611 -0.298074661 0.550457123 RPT5 26S protease regulatory subunit YOR118W 0.196913993 0.638865632 -0.043552146 0.234785789 hypothetical protein YOR119C -0.13453123 0.687922389 -0.204253125 0.294691983 RIO1 similar to a C.elegans ZK632.3 protein YOR120W -1.28290441 0.004142322 0.066641492 0.095105018 GCY1 Similar to mammalian aldo /keto reductases YOR121C -0.39976335 0.12302802 0.520381885 0.016286547 questionable ORF YOR122C 1.324355334 0.103107435 0.674728692 0.009118502 PFY1 profilin (actin-binding protein) YOR123C -0.40275174 0.164222935 -0.644224212 0.031427167 LEO1 extremely hydrophilic protein YOR124C -0.30637187 0.116500136 0.041969393 0.173887671 UBP2 Ubiquitin-specific protease YOR125C -0.4948551 0.15464045 -0.16987511 0.036276526 CAT5 may encode a protein involved in one or more monoxygenase or hydroxylase steps of ubiquinone biosynthesis YOR126C 0.484719218 0.134187155 0.08858706 0.382675058 IAH1 isoamyl acetate-hydrolyzing esterase YOR127W 0.415909687 0.024056714 -0.302408648 0.019121699 RGA1 rho type GTPase activating protein YOR128C 0.959034277 0.217468957 -0.261938929 0.05309481 ADE2 phosphoribosylamino-imidazole-carboxylase YOR129C 0.924731967 0.334586665 0.034535355 0.770871304 hypothetical protein YOR130C 0.337314301 0.370475945 -0.330810214 0.07412065 ORT1 amino acid transporter YOR131C -0.09254695 0.478661625 -0.20213072 0.445755204 weak similarity to E.coli hypothetical 27K protein //weak similarity to E.coli hypothetical 27K protein YOR132W -0.49619758 0.085849531 -0.138140334 0.315882528 VPS17 involved in vacuolar protein targeting YOR134W -0.77769086 0.063119684 -0.065042604 0.821229287 BAG7 GTPase activating protein (GAP) YOR135C 0.492292429 0.215509567 0.547447256 0.030451576 questionable ORF YOR136W 0.81929016 0.098320927 0.303629017 0.161076248 IDH2 NAD+-dependent isocitrate dehydrogenase YOR137C 0.609794177 0.366377448 -0.083801516 0.527943398 similarity to YLR361c YOR138C -0.29930571 0.184100668 -0.111010231 0.293698294 hypothetical protein YOR139C -0.38089689 0.189690853 0.523641436 0.02826209 questionable ORF YOR140W 0.088171479 0.797706389 0.368111898 0.144580327 SFL1 Transcription factor YOR141C -0.42826478 0.079165074 -0.398581921 0.072412541 ARP8 actin-related protein YOR142W 0.376770664 0.394687556 0.304885366 0.130846405 LSC1 Succinate-CoA Ligase (ADP-Forming) YOR142W-A 0.796233857 0.083739596 0.396843998 0.034503806 TyA gag protein. Gag processing produces capsid proteins. YOR143C 2.038163974 0.24419816 -0.409109356 0.222042755 THI80 Thiamin pyrophosphokinase YOR144C 0.33558121 0.123070807 -0.242129213 0.226036033 EFD1 Enhanced Frequency of Direct-repeat recombination YOR145C 1.543848212 0.057979079 0.227919141 0.096108337 strong similarity to hypothtical S. pombe protein and to hypothetical C. elegans protein YOR146W 1.19009097 0.020214762 0.07451202 0.544920313 questionable ORF YOR147W -0.39387243 0.125217483 -0.359380214 0.0685779 similarity to YHR194w YOR148C -0.4070853 0.006341618 -0.287187857 0.061229958 SPP2 spliceosome-associated protein YOR149C -0.41713056 0.035872725 0.374863721 0.08608278 SMP3 involved in plasmid maintenance YOR150W 0.217212039 0.364702907 -0.079324435 0.492200802 MRPL23 mitochondrial ribosomal protein of the large subunit YOR151C 0.350277262 0.055361594 -0.096519342 0.559558506 RPB2 second largest subunit of RNA polymerase II YOR152C -1.10335001 0.000192768 0.146319259 0.649659226 hypothetical protein YOR153W 0.47227928 0.189461443 0.321404417 0.620137355 PDR5 multidrug resistance transporter YOR154W 0.010585531 0.954403765 -0.418022399 0.096596526 similarity to hypothetical A. thaliana proteins F19G10.15 and T19F06.21 YOR155C -0.74469491 0.094147209 -0.067280561 0.65714035 similarity to 5'-flanking region of the Pichia MOX gene YOR156C -0.00044023 0.998915357 0.159497846 0.030876538 NFI1 interacts with C-terminus of CDC12 YOR157C 0.402539908 0.454846114 0.113900443 0.167054061 PUP1 putative proteasome subunit YOR158W 0.681479626 0.034435436 -0.204942567 0.157496463 PET123 Mitochondrial ribosomal protein of small subunit YOR159C 0.742740181 0.122759814 0.155690231 0.029199411 SME1 homologue of human E core protein YOR160W -0.15648107 0.319883037 0.304036259 0.050208125 MTR10 involved in mRNA transport from nucleus to cytoplasm YOR161C -1.80428796 0.002794397 0.634719053 0.198157097 similarity to C.elegans cosmid F35C8 YOR162C -0.1776332 0.106960842 -0.261156722 0.196790635 YRR1 transcription factor YOR163W -0.96738996 0.005277989 0.292926145 0.107814672 DDP1 diadenosine and diphosphoinositol polyphosphate phosphohydrolase YOR164C -0.25564442 0.192544118 -0.013530299 0.884338784 hypothetical protein YOR165W -0.21300126 0.035338878 -0.300229992 0.058540125 similarity to E.histolytica surface lectin YOR166C 0.166883899 0.389688971 -0.508365122 0.066249639 hypothetical protein YOR167C 2.18862899 0.036062185 0.784300702 0.001449006 RPS28A Ribosomal protein S28A (S33A) (YS27) YOR168W 0.392874572 0.244413909 -0.370431665 0.183315971 GLN4 glutaminyl-tRNA synthetase YOR169C 1.113831886 0.100677468 -0.074853296 0.293316947 questionable ORF YOR170W 0.143886489 0.685562254 0.303941858 0.032797546 questionable ORF YOR171C -0.44085156 0.046227984 -0.307977179 0.093432209 LCB4 sphingoid long chain base (LCB) kinase YOR173W -1.83737405 0.00094457 -0.211356256 0.422117539 strong similarity to YLR270w YOR174W -0.28536963 0.109274876 -0.582966459 0.015510579 MED4 Stoichiometric member of mediator complex YOR175C -0.20514989 0.121323702 0.125218151 0.232603816 similarity to human and murine C3f protein YOR176W -0.01214016 0.971855581 0.71535352 0.030209805 HEM15 ferrochelatase (protoheme ferrolyase) YOR177C -0.3503647 0.025481861 -0.44243592 0.422649731 weak similarity to rat SCP1 protein YOR178C -2.19502804 0.000768215 -0.149241365 0.488354387 GAC1 Regulatory subunit for Glc7p YOR179C -0.531338 0.055680762 -0.519093279 0.076793903 similarity to BRR5 protein YOR180C -0.67955127 0.176953961 -0.230239048 0.207676234 DCI1 Peroxisomal delta(3,5)-delta(2,4)-dienoyl-CoA isomerase YOR181W 0.107172906 0.665419072 0.377445694 0.349559407 LAS17 Actin assembly factor YOR182C 0.945503037 0.032809985 -0.120139795 0.648470329 RPS30B Ribosomal protein S30B YOR184W 1.20532657 0.19320959 0.335139782 0.062460557 SER1 phosphoserine transaminase YOR185C -1.02842329 0.00017331 0.395902397 0.025328807 GSP2 GTP binding protein, almost identical to Gsp1p YOR186W -2.38454666 0.000779494 0.161470527 0.514005544 hypothetical protein YOR187W 0.319470987 0.141948785 0.187852738 0.469359022 TUF1 Translation elongation factor Tu, mitochondrial YOR188W -0.02794498 0.897342281 0.086053674 0.486963559 MSB1 involved in polarized growth YOR189W -0.22089953 0.235462051 -0.469721559 0.162527644 weak similarity to chicken nonhistone chromosomal protein HMG-2 YOR190W -1.30899654 0.005157222 -0.00486717 0.952461212 SPR1 sporulation-specific exo-1,3-beta-glucanase YOR191W -0.40113805 0.22834418 -0.364478587 0.200153667 RIS1 contains motifs that are present in a family of DNA-dependent ATPases, the SWI2 /SNF2-like proteins YOR192C 0.531805379 0.173745684 0.600634613 0.162973498 strong similarity to Thi10p YOR192C-A 0.119142463 0.24686057 0.183794341 0.060406959 TyA gag protein. Gag processing produces capsid proteins. YOR193W -0.01207309 0.946816549 -0.566903432 0.018453154 weak similarity to YPL112c YOR194C 0.186122545 0.10659665 -0.369092599 0.190347962 TOA1 Transcription factor IIA, large chain YOR195W 0.928241484 0.224765372 -0.936388105 0.040137117 SLK19 possible leucine zipper YOR196C -0.08302721 0.813595062 -0.600773987 0.006352178 LIP5 lipoic acid synthase YOR197W -0.21388258 0.440073314 0.384818827 0.073771632 hypothetical protein YOR198C 0.986808857 0.339362422 -0.128065288 0.289277307 BFR1 involved in secretion YOR199W 1.187839587 0.157911125 0.631717215 0.025080855 questionable ORF YOR200W 0.972878226 0.01518669 0.006276495 0.9387294 questionable ORF YOR201C 0.850754406 0.081000133 -0.202812715 0.047114845 PET56 Ribose methyltransferase for mitochondrial 21S rRNA YOR203W 0.94407948 0.086793837 0.14813574 0.325460823 questionable ORF YOR204W 0.39682005 0.267273872 0.220604646 0.23761244 DED1 ATP-dependent RNA helicase of DEAD box family YOR205C 0.958051546 0.002414123 -0.331382572 0.076808901 hypothetical protein YOR206W 1.047454351 0.150874875 -0.570292702 0.056145105 similarity to Brettanomyces RAD4 and to S.pombe hypothetical protein YOR207C 0.789906808 0.071759438 -0.095554514 0.592386374 RET1 second-largest subunit of RNA polymerase III YOR208W 0.61559135 0.114707131 0.040621623 0.354745907 PTP2 protein tyrosine phosphatase YOR209C 0.25956921 0.598748464 -0.284559655 0.059283563 NPT1 nicotinate phosphoribosyl transferase (putative) YOR210W 1.510212688 0.142274469 -0.464313036 0.23510759 RPB10 RNA polymerase II subunit YOR212W 0.851052103 0.027121057 -0.16264108 0.278773212 STE4 beta subunit of G protein coupled to mating factor receptor YOR213C -0.39576987 0.268179615 -0.309264682 0.035113613 SAS5 involved in silencing at telomeres, HML and HMR YOR214C -0.09966136 0.707429435 0.03225912 0.427506316 hypothetical protein YOR215C -0.95414411 0.004783098 -0.720392575 0.033367498 similarity to M.xanthus hypothetical protein YOR216C 0.647523012 0.019540017 -0.806378032 0.090432352 RUD3 involved in secretion YOR217W 0.234206835 0.286809292 -0.059739413 0.280759011 RFC1 Subunit 1 of Replication Factor C ; homologous to human RFC 140 kDa subunit YOR218C -0.1190979 0.708621136 0.348377595 0.077820985 questionable ORF YOR219C 0.179366009 0.716213082 0.139885102 0.307304133 STE13 dipeptidyl aminopeptidase YOR220W -0.00796858 0.988627072 -0.14454516 0.032390499 hypothetical protein YOR221C 0.866977985 0.111455264 0.328318143 0.084240579 MCT1 malonyl-CoA:ACP transferase YOR222W 1.19972539 0.307483719 0.00797486 0.917900155 ODC2 mitochondrial 2-oxodicarboxylate transport protein YOR223W -0.61204497 0.099532555 0.227724788 0.301618367 protein of unknown function YOR224C 1.36132222 0.018535863 0.603741191 0.011156781 RPB8 16-kDa RNA polymerase subunit (common to polymerases I, II and III) YOR225W 0.350952552 0.538824387 -0.021298641 0.322896049 questionable ORF YOR226C 0.349151774 0.099482633 0.007870483 0.924011728 ISU2 Iron-sulfur cluster nifU-like protein YOR227W -0.57513768 0.199630876 0.453543609 0.124891937 similarity to microtubule-interacting protein Mhp1p YOR228C -0.94393381 0.009607948 -0.077379996 0.588148406 weak similarity to YNR013c YOR229W -0.00696769 0.964684342 0.025572212 0.899006864 WTM2 Transcriptional modulator YOR230W -0.90049963 0.000403073 0.357102243 0.083896097 WTM1 Transcriptional modulator YOR231W -0.46540643 0.026469894 -0.029013496 0.517200681 MKK1 protein kinase involved in protein kinase C pathway YOR232W 0.139105786 0.564368916 -0.545293337 0.027296032 MGE1 GrpE homolog, mitochondrial matrix protein YOR233W 0.295068977 0.352607571 0.000225183 0.973817062 KIN4 protein kinase YOR234C 1.878918969 0.081449834 0.448106535 0.051091459 RPL33B Ribosomal protein L33B (L37B) (rp47) (YL37) YOR235W 0.6002275 0.058631235 0.458657387 0.078906977 encodes snRNA U3, SNR17B also encodes snRNA U3//questionable ORF YOR236W 0.452043078 0.142513655 0.030012022 0.628754299 DFR1 dihydrofolate reductase YOR237W 0.623544068 0.055947609 0.504286521 0.002098278 HES1 homology to human oxysterol binding protein YOR238W 0.423259218 0.261165038 -0.258831967 0.183488916 similarity to hypothetical S. pombe protein YOR239W 0.063891603 0.625943234 -0.082313855 0.031307012 ABP140 actin filament binding protein YOR241W 0.682873243 0.19182626 -0.230500596 0.228632293 MET7 Folylpolyglutamate synthetase YOR242C 0.633099736 0.085799348 -0.237549386 0.020278006 SSP2 involved in sporulation YOR243C 0.824366856 0.098664736 -0.559764028 0.014610668 similarity to M.jannaschii hypothetical protein MJ0588 YOR244W -0.1840443 0.154033269 -0.659751285 0.029227115 ESA1 Acetyltransferase in the SAS gene family YOR245C -0.63029519 0.032765116 -0.19134522 0.061931152 similarity to hypothetical C. elegans proteins YOR246C 0.587499412 0.233223718 0.053880097 0.403462254 weak similarity to reductases YOR247W 2.31692833 0.063823505 0.634834889 0.022705688 SRL1 Suppressor of rad53 lethality YOR248W 2.185468251 0.043119473 0.716189143 0.040536108 TOS11 questionable ORF YOR249C -0.59394293 0.009885786 -0.44235706 0.053220757 APC5 subunit of the anaphase promoting complex YOR250C 0.046085278 0.794148138 0.289917071 0.143310611 CLP1 cleavage /polyadenylation factor IA subunit YOR251C -0.31154458 0.040688329 -0.049727196 0.433554969 similarity to thiosulfate sulfurtransferases YOR252W 0.413442451 0.182381814 -0.351440311 0.226108757 hypothetical protein YOR253W 0.296197743 0.279471245 -0.150029356 0.395090523 hypothetical protein YOR254C 0.873024441 0.207978548 -0.053636132 0.4868893 SEC63 ER protein translocation subcomplex subunit YOR255W 0.284646433 0.152218838 1.888885874 0.439899225 hypothetical protein YOR256C -0.13565941 0.428548112 0.118038269 0.03894197 strong similarity to secretory protein Ssp134p Required for spindle pole body duplication and mitosis in meiosis II ; calcium-binding protein component of spindle pole bodies, localizes to half- YOR257W 0.008235482 0.957558467 0.072258739 0.382076098 CDC31 bridges and interacts with KAR1 YOR258W -0.4764665 0.063912915 -0.251062207 0.080054328 hypothetical protein YOR259C 0.142111895 0.379206613 -0.274432469 0.050908912 RPT4 ATPase ; component of the 26S proteasome cap subunit YOR260W 0.738576654 0.034352726 -0.040442495 0.518487061 GCD1 translation initiation factor eIF2b gamma subunit ; negative regulator in the general control of amino acid biosynthesis YOR261C -0.48050937 0.038892448 -1.242074291 0.015714253 RPN8 Subunit of the regulatory particle of the proteasome YOR262W -0.68468503 0.003450875 -0.579539073 0.002842901 similarity to YLR243w YOR263C -0.3367399 0.262161377 0.127181005 0.116466897 questionable ORF YOR264W -0.32308856 0.462228507 -0.347326585 0.103279667 hypothetical protein YOR265W 0.184259709 0.638654127 -0.341276974 0.269987634 RBL2 beta-tubulin binding protein YOR266W -0.09552668 0.57758355 -0.370191644 0.032927152 PNT1 involved in pentamidine resistance protein YOR267C -0.54397464 0.2458769 0.212922607 0.070758015 similarity to ser/thr protein kinases YOR268C 0.254084768 0.656055657 0.003954711 0.422649731 hypothetical protein YOR269W 0.585853547 0.18741746 0.096424267 0.32352655 PAC1 Required for viability in the absence of Cin8p YOR270C 0.242373165 0.393552314 0.039308154 0.711112279 VPH1 vacuolar ATPase V0 domain subunit a (100 kDa) YOR271C 0.226133812 0.255091741 0.297099844 0.041585157 strong similarity to Rattus tricarboxylate carrier YOR272W 1.303047921 0.066408587 -0.058498027 0.420717282 YTM1 microtubule-associated protein YOR273C -1.43358445 0.019906609 0.539714193 0.123147678 similarity to resistance proteins YOR274W 0.200393645 0.169017869 -0.440267395 0.098765635 MOD5 transfer RNA isopentenyl transferase YOR275C 0.202996533 0.036162944 -0.370721133 0.018249099 similarity to A.nidulans palA protein YOR276W 1.373695173 0.193697211 -0.015651745 0.902611411 CAF20 mRNA cap-binding protein (eIF4F) 20K subunit YOR277C 1.321047046 0.187190261 0.141542489 0.27092619 questionable ORF YOR278W -0.01955419 0.893885149 0.117635324 0.403961205 HEM4 uroporphyrinogen III synthase YOR279C 0.116775514 0.261414212 -0.739180342 0.030291415 hypothetical protein YOR280C -1.71133799 0.000164668 -0.020823967 0.750021335 similarity to S.pombe dihydrofolate reductase YOR281C 0.512577607 0.250940836 -0.507926156 0.090531932 PLP2 phosducin-like protein YOR282W 0.551880601 0.194265251 -0.183654591 0.399835875 questionable ORF YOR283W 0.638661466 0.234566825 -0.33536072 0.045962211 weak similarity to phosphoglycerate mutases YOR284W -0.48049984 0.032419346 -0.646024586 0.234967863 weak similarity to M.jannaschii hypothetical protein MJ0694 YOR285W 0.316266773 0.428799095 0.709065389 0.087792907 similarity to D.melanogaster heat shock protein 67B2 YOR286W 0.540402108 0.10475803 0.346241325 0.007315745 similarity to D.melanogaster heat shock protein 67B2 YOR287C 0.782945387 0.163059014 -1.107349882 0.03294012 weak similarity to PITSLRE protein kinase isoforms YOR288C -0.25639789 0.556514419 0.347812931 0.092784737 MPD1 Disulfide isomerase related protein YOR289W -0.68826073 0.186294538 -0.2702559 0.012659235 similarity to C.elegans hypothetical protein YOR290C -0.52440616 0.295730714 0.34240865 0.21483643 SNF2 transcriptional regulator YOR291W -1.02885114 0.004969831 0.550893662 0.069394877 similarity to cation translocating ATPases YOR292C 1.574614379 0.031732254 0.864402921 0.023730172 similarity to human and mouse glomerulosclerosis protein Mpv17 YOR293W 1.414780311 0.164617553 0.012701869 0.952507416 RPS10A Ribosomal protein S10A YOR294W 1.134063878 0.058086062 -0.354421951 0.046889485 RRS1 Regulator for ribosome synthesis YOR295W -0.23713765 0.132115358 -0.371513071 0.130452301 weak similarity to SWI/SNF complex 60 KDa subunit from man and mouse YOR296W 0.00214118 0.995600753 -0.251042079 0.057499933 similarity to hypothetical S. pombe protein YOR297C 1.019329737 0.010901986 0.297003664 0.095832775 TIM18 mitochondrial inner memebrane translocase YOR298C-A -0.39724623 0.145134138 0.440123071 0.10983835 MBF1 multiprotein bridging factor YOR298W 0.211759425 0.331256203 0.155045276 0.265471541 required for meiosis YOR299W 0.60412605 0.358295709 0.068102425 0.734718425 BUD7 involved in bipolar bud site selection YOR300W 0.76563187 0.143973253 0.499910949 0.164149743 questionable ORF YOR301W 0.312785132 0.013005282 0.614627582 0.059292502 RAX1 Similar to B-chains of the insulin-related hormone superfamily. YOR302W 1.170691863 0.089895231 0.807266489 0.121227108 CPA1 leader peptide /protein involved in determination of budding pattern YOR303W 0.665609875 0.40476302 0.291495333 0.300788209 CPA1 Carbamoyl phosphate synthetase, arginine specific YOR304C-A -0.00738324 0.979603056 -0.151499764 0.213578882 similarity to mouse apolipoprotein A-IV precursor YOR304W -0.08055335 0.774800359 -0.553462181 0.114597612 ISW2 strong similarity to Drosophila ISW1 and human Snf2p homolog /ATPase component of a two subunit chromatin remodeling complex YOR305W 0.648057634 0.252707444 -0.323191311 0.226255137 weak similarity to hypothetical protein SPAC824.03c S. pombe YOR306C 3.309859315 0.209522959 0.294383036 0.142574915 similarity to human X-linked PEST-containing transporter YOR307C 0.066338556 0.537528659 0.226667305 0.026341652 SLY41 homolog of chloroplast phosphate transporter YOR308C -0.07905903 0.740489991 -0.10129368 0.10656505 SNU66 66kD U4 /U6.U5 snRNP associated protein YOR309C 1.046170827 0.022156283 -0.348782105 0.146700693 questionable ORF YOR310C 1.091331473 0.126898832 -0.53958084 0.039330092 NOP58 57 kDa nucleolar protein YOR311C 0.845348555 0.117718203 0.200902592 0.34176194 similarity to hypothetical S. pombe protein YOR312C 0.990083064 0.096464011 0.035950894 0.807549645 RPL20B 60S ribosomal protein L20B (L18B) YOR313C -0.04227286 0.949820216 -0.186251873 0.250802602 SPS4 sporulation-specific protein YOR314W -0.00344555 0.995724853 -0.201915842 0.533551916 hypothetical protein YOR315W 2.233135701 0.237151492 -0.108285589 0.550053625 hypothetical protein YOR316C 0.218784317 0.549735111 0.336260499 0.054855107 COT1 involved in cobalt accumulation YOR317W -0.60715618 0.032922646 -0.059000278 0.535247574 FAA1 long chain fatty acyl:CoA synthetase YOR318C 0.481902634 0.046890968 0.552376381 0.097692904 hypothetical protein YOR319W -0.21424747 0.098962808 -0.43939866 0.103261791 HSH49 homolog of mammalian splicing factor /U2 snRNP protein YOR320C 0.010302525 0.928401274 -0.278157941 0.076402873 hypothetical protein YOR321W -0.68862021 0.133996764 0.301016224 0.17595726 PMT3 dolichyl phosphate-D-mannose:protein O-D-mannosyltransferase YOR322C -0.10902732 0.782815895 0.061063783 0.422214203 similarity to hypothetical S.pombe protein SPAC1F12.05 YOR323C -0.13882168 0.508859878 -0.133455416 0.284048087 PRO2 gamma-glutamyl phosphate reductase YOR324C -0.34107951 0.139314759 -0.287665505 0.068851862 similarity to YAL028w YOR325W -0.54541568 0.184128803 0.148468847 0.37487537 questionable ORF YOR326W 0.498102071 0.037275166 -0.092932032 0.050600878 MYO2 class V myosin YOR327C 0.049117858 0.772800999 -0.278040589 0.220808765 SNC2 vesicle-associated membrane protein (synaptobrevin) homolog YOR328W -0.90630553 0.07198997 0.094883834 0.537049236 PDR10 Putative ABC transporter highly similar to Pdr5p YOR329C -0.24735925 0.376580808 0.448205749 0.052914414 SCD5 suppressor of clathrin deficiency YOR331C -0.70039575 0.000566112 -0.06830068 0.810566266 questionable ORF YOR332W -0.35159089 0.036142924 0.248675394 0.422134224 VMA4 vacuolar ATPase V1 domain subunit E (27 kDa) YOR333C 0.815207433 0.010602528 -0.247780225 0.086006026 questionable ORF YOR334W 0.898489491 0.042837765 0.154425098 0.181557351 MRS2 splicing factor YOR335C 0.358483671 0.291965968 0.275912869 0.34789107 ALA1 Cytoplasmic alanyl-tRNA synthetase gene YOR336W -0.91663247 0.004570076 0.032043274 0.410476382 KRE5 involved in cell wall biogenesis YOR337W 0.32305045 0.018864554 -0.742346679 0.024659833 TEA1 Ty1 enhancer activator YOR338W 0.959740485 0.185077549 -0.075737988 0.383631984 similarity to YAL034c YOR339C -0.50169577 0.06770465 -0.721463774 0.07385243 UBC11 homolog of ubiquitin carrier protein E2-C YOR340C 1.429380869 0.093196675 -0.153292836 0.029442927 RPA43 DNA-dependent RNA polymerase I subunit A43 YOR341W 0.931854884 0.005273417 0.330581489 0.17121483 RPA190 RNA polymerase I subunit 190 (alpha) YOR342C 1.227401414 0.049217347 0.865714089 0.150658187 weak similarity to YAl037w YOR343C -0.19263319 0.707512134 -0.063883832 0.558556558 hypothetical protein YOR343C-A -0.05289686 0.855264646 -0.429481904 0.008393623 TyA gag protein. Gag processing produces capsid proteins. YOR344C -0.80190851 0.010388152 -0.168461428 0.168876939 TYE7 TYE7, a 33 kDa serine-rich protein, is a potential member of the basic region /helix-loop-helix /leucine-zipper protein family YOR345C -0.2264514 0.759245171 0.108631513 0.707322386 questionable ORF YOR346W -0.25025264 0.082947511 0.20089656 0.166381517 REV1 deoxycytidyl transferase YOR347C -0.74668581 0.018777398 0.330233319 0.268830916 PYK2 pyruvate kinase YOR348C -1.13332729 0.065097675 0.545401071 0.040130538 PUT4 putative proline-specific permease YOR349W -0.01140465 0.976505522 0.380732138 0.000673804 CIN1 involved in chromosome segregation YOR350C -0.81810157 0.049321433 -0.446968341 0.065492133 MNE1 similar to Lucilia illustris mitochondria cytochrome oxidase mRNA is induced in meiosis, encodes a meiosis-specific serine /threonine protein kinase which interacts with and is believed to phosphorylate YOR351C 0.100126462 0.869687417 -0.146053037 0.799507301 MEK1 Hop1p YOR352W -1.30045656 0.0016443 -0.274946223 0.068430984 hypothetical protein YOR353C 0.745023849 0.147461929 -0.293813435 0.049206961 weak similarity to adenylate cyclases YOR354C 0.31707546 0.407775995 -0.213873983 0.100625628 hypothetical protein YOR355W -0.14270819 0.126576338 0.294035377 0.060884992 GDS1 Overexpxression suppresses NAM9-1 glycerol deficient phenotype /involved in nuclear control of mitochondria YOR356W -0.43932366 0.116260857 -0.075966049 0.493001538 strong similarity to human electron transfer flavoprotein-ubiquinone oxidoreductase Grd19p contains the PX domain found in human SNX1 (Sorting Nexin-1). Localized predominantly to the cytosol, however, a minor amount YOR357C 0.519266994 0.228754591 -0.364650382 0.130000273 GRD19 associates with membranes. In vps27 mutant cells, Grd19p-HA localizes in the prevaculoar compartment. YOR358W -0.49341206 0.251205321 0.32305636 0.150482884 HAP5 Component, along with Hap2p and Hap3p, of CCAAT-binding transcription factor YOR359W 1.2277728 0.130205774 0.185446328 0.150280835 hypothetical protein YOR360C 1.229621873 0.254744279 -0.322933423 0.005356704 PDE2 low-Km (high-affinity) cAMP phosphodiesterase YOR361C 0.771512219 0.209865478 -0.045516569 0.681978304 PRT1 translation initiation factor eIF3 subunit YOR362C 0.13942217 0.701021019 0.119053932 0.244352206 PRE10 proteasome component YC1 (protease yscE subunit 1) YOR363C -0.43332781 0.267538268 0.041711582 0.497791124 PIP2 activator of peroxisome proliferation YOR364W -0.06339845 0.783912667 0.245951883 0.266172278 hypothetical protein YOR365C -0.45412174 0.081235941 -0.295376076 0.173649887 strong similarity to YAL053w YOR366W -0.80063681 0.073765511 0.049380533 0.830422083 questionable ORF YOR367W 0.153012901 0.339485852 -0.060813603 0.126736724 SCP1 Calponin homolog YOR368W -0.07888108 0.592947394 -0.508093592 0.044295198 RAD17 encodes a putative 3'->5'exonuclease YOR369C 1.336069696 0.017229433 0.383564205 0.040907236 RPS12 40S ribosomal protein S12 YOR370C 0.199146629 0.36592809 -7.70333E-05 0.999552011 MRS6 Rab geranylgeranyltransferase regulatory subunit YOR371C -0.72249328 0.11428558 -0.068789905 0.124090183 GPE1 G protein effector YOR372C -0.06116552 0.839160885 -0.073655463 0.752422754 NDD1 Nuclear Division Defective 1 YOR374W -1.38429043 0.002473678 0.235077208 0.240617893 ALD4 mitochondrial aldehyde dehydrogenase YOR375C -0.13750169 0.7327769 -0.182004637 0.095229087 GDH1 NADP-specific glutamate dehydrogenase YOR376W 0.154513383 0.838797214 0.798349483 0.237897948 hypothetical protein YOR377W -0.58833233 0.101776551 0.01695651 0.847528037 ATF1 Alcohol acetyltransferase YOR378W -0.15171038 0.60122692 0.37567447 0.048281267 strong similarity to aminotriazole resistance protein YOR379C -0.52062635 0.196090594 0.570016693 0.024921304 questionable ORF YOR380W -0.29533173 0.147825762 0.194999851 0.419515503 weak similarity to Pdr3p YOR381W 0.705443353 0.156984981 0.053511246 0.535391452 FRE3 similar to FRE2 YOR382W 1.297839069 0.243545761 0.695762638 0.191707789 hypothetical protein YOR383C 0.271549301 0.657747362 0.961188213 0.061281644 weak similarity to L.mexicana secreted acid phosphatase 2 YOR384W -0.48103457 0.08545703 0.552679943 0.18921795 FRE5 similar to FRE2 YOR385W 1.86822009 0.287804081 -0.334432943 0.037411886 strong similarity to hypothetical protein YMR316w YOR386W -0.70626946 0.014664186 -0.439896749 0.033491609 PHR1 photolyase YOR387C -1.88913709 0.024872521 -0.272003452 0.732800972 strong similarity to YGL258w YOR388C 0.015569488 0.959321664 0.434784461 0.252115716 FDH1 similar to formate dehydrogenases YOR389W -0.63153241 0.012101 -0.155844528 0.070593382 strong similarity to putative pseudogenes YPL277c and YPL278c YOR390W 0.299642473 0.474316603 0.763076843 0.035783182 nearly identical to YPL279c YOR391C -1.63649056 0.007480148 0.034922385 0.922165653 identical to YPL280w, strong similarity to YMR322c and YDR533c YOR392W -0.29732062 0.605995339 -0.043519606 0.907740492 hypothetical protein YOR393W -1.59890677 0.007509576 0.084392311 0.11002224 ERR1 enolase homolog YOR394W -0.31000176 0.039402734 0.373802568 0.067401996 enolase homolog//enolase related protein YPL001W 0.360428049 0.518811477 -0.464044442 0.057444496 HAT1 histone acetyltransferase YPL002C -0.34539634 0.17802767 -0.167958166 0.00958361 SNF8 involved in glucose derepression YPL003W -0.1946234 0.419625843 0.046145965 0.456004561 ULA1 Rub1p activating protein YPL004C -1.3444212 0.004356421 0.212323002 0.159628423 strong similarity to YGR086c YPL005W -0.07663522 0.77856133 -0.477948543 0.109870375 weak similarity to Nup2p YPL007C -0.08606893 0.588955889 -0.631999786 0.017006306 TFC8 60 kDa subunit of TFIIIC (tau60) YPL008W 0.268252099 0.275947036 -0.204436066 0.281972792 CHL1 kinetochore protein in the DEAH box family YPL009C -0.26498862 0.129098127 -0.067697467 0.402825292 similarity to M.jannaschii hypothetical protein YPL010W 0.372944681 0.44851403 0.033945451 0.609515199 RET3 vesicle coat component YPL011C 0.405218241 0.094575455 -0.105826826 0.16207996 TAF47 component of TAF(II) complex YPL012W 1.272818125 0.069485999 0.552042618 0.019183434 hypothetical protein YPL013C 0.550213892 0.002167198 -0.299287302 0.208457851 ribosomal protein S16, mitochondrial YPL014W -0.82995026 0.059437391 0.389367459 0.026452943 hypothetical protein YPL015C -0.30861216 0.403778175 0.216163842 0.328671246 HST2 similar to Sir2p YPL017C -1.37893408 0.00247533 0.389072325 0.091758934 strong similarity to Lpd1p and other dihydrolipoamide dehydrogenases//involved in chromosome segregation YPL018W -1.28048644 0.004208547 -0.005991264 0.978302048 CTF19 kinetochore protein YPL019C -1.15366276 0.073550546 -0.084566614 0.455408761 VTC3 polyphosphate synthetase (putative) YPL020C 0.620510591 0.150260849 -0.870043195 0.048128082 ULP1 Smt3-processing enzyme YPL021W 0.089157369 0.681248215 0.190527017 0.254826273 ECM23 (putative) involved in cell wall biogenesis YPL022W 0.251432979 0.130659751 -0.294446264 0.059568441 RAD1 UV endonuclease YPL023C -0.17049722 0.542110762 -0.155985854 0.17086752 MET12 putative methylenetetrahydrofolate reductase (mthfr) YPL024W -0.23334313 0.225944762 -0.146014055 0.063403255 NCE4 involved in cell separation YPL025C 0.478794323 0.120636778 0.542421593 0.297286666 questionable ORF YPL026C 0.832380692 0.324376282 -0.479511155 0.035128163 SKS1 serine /threonine protein kinase homologous to Ran1p YPL027W -0.30213232 0.515320133 0.385927116 0.463192607 hypothetical protein YPL028W 0.600861484 0.368705182 0.339776984 0.164906888 ERG10 acetoacetyl CoA thiolase YPL029W 0.676602719 0.121595931 -0.285702242 0.063946167 SUV3 putative ATP-dependent helicase YPL030W 0.654815252 0.073216345 -0.059967353 0.421710701 similarity to C.elegans hypothetical protein YPL031C -0.24845166 0.557228931 0.716175428 0.063892091 PHO85 cyclin-dependent protein kinase YPL032C 0.378585421 0.110667782 0.399805876 0.052028204 SVL3 (putative) involved in vacuole function YPL033C 0.518614649 0.095302516 -0.248453958 0.351438313 weak similarity to YLR426w YPL034W 0.569662742 0.17844075 -0.473974131 0.041604312 questionable ORF YPL035C 0.155759723 0.637286312 -0.46883198 0.082960855 questionable ORF YPL036W -1.8958651 0.000771948 0.405141109 0.084743431 PMA2 plasma membrane ATPase YPL037C 1.374183767 0.03704304 0.535145717 0.006855055 EGD1 regulator of pol II transcribed genes YPL038W 0.568901182 0.154464797 0.154953954 0.321168111 MET31 zinc finger DNA binding factor, transcriptional regulator of sulfur amino acid metabolism, highly homologous to Met32p YPL039W -0.2267345 0.3790738 0.103094228 0.302252621 hypothetical protein YPL040C -0.01912104 0.947554488 -0.38432528 0.030896705 ISM1 nuclear encoded mitochondrial isoleucyl-tRNA synthetase YPL041C 0.765067386 0.024700449 0.410835825 0.033263073 hypothetical protein YPL042C 0.135634328 0.601458494 -0.105999446 0.012499482 SSN3 a cyclin(SSN8)-dependent serine /threonine protein kinase YPL043W 1.160303717 0.034633354 -0.726413395 0.03729697 NOP4 RNA recognition motif-containing protein YPL044C 1.473743565 0.037665493 -0.251884688 0.434738943 questionable ORF YPL045W -0.10395487 0.44870661 -0.54120392 0.057604865 VPS16 Vacuolar sorting protein YPL046C 0.236292277 0.310115179 0.135720935 0.129071183 ELC1 Elongin C transcription elongation factor YPL047W 0.368400576 0.044208795 0.199885123 0.197818264 hypothetical protein YPL048W -0.61843577 0.077993591 0.399666047 0.17904693 CAM1 Calcium and phospholipid binding protein homologous to translation elongation factor 1-gamma (EF-1gamma) YPL049C 0.211729514 0.332379769 0.106201611 0.371606624 DIG1 MAP kinase-associated protein YPL050C 1.013646538 0.066074235 -0.013729046 0.926713353 MNN9 Protein required for complex glycosylation YPL051W 0.0705916 0.874900413 -0.72214337 0.041314589 ARL3 Similar to ADP-ribosylation factor YPL052W 0.952095409 0.151989821 -0.577958996 0.01358703 hypothetical protein YPL053C 0.68285673 0.118866985 -0.204302822 0.039546264 KTR6 mannosylphosphate transferase YPL054W -2.56645214 0.000176949 0.215887268 0.093666097 LEE1 protein of unknown function YPL055C -0.23377847 0.528294999 0.118619539 0.014985306 hypothetical protein YPL056C -0.06563771 0.867296136 0.561330421 0.130238447 hypothetical protein YPL057C -0.47611411 0.377075144 -0.037397102 0.81904811 SUR1 integral membrane protein, exhibits homology to YBR161w, Hoc1p, and Och1p YPL059W 0.21571742 0.426445451 0.348467902 0.142596362 GRX5 Protein with glutaredoxin activity YPL060C-A -0.50130972 0.170307663 -0.624755345 0.056088439 TyA gag protein. Gag processing produces capsid proteins. YPL060W 0.147138666 0.626443166 -0.506090839 0.036284762 strong similarity to Mrs2p YPL061W -0.86851677 0.073194714 0.867719618 0.043625798 ALD6 Cytosolic Aldehyde Dehydrogenase YPL062W -0.05794949 0.963676738 0.285332924 0.457226481 hypothetical protein YPL063W 0.121710997 0.734671282 -0.233459279 0.014597435 similarity to hypothetical protein YLR019w, YLL010c and S.pombe hypothetical protein SPAC2F7.02c YPL064C 0.04601419 0.643561437 -0.69276623 0.099169844 weak similarity to S.pombe peptidyl-prolyl cis-trans isomerase YPL065W -0.34469145 0.093754841 -0.302879439 0.244847833 VPS28 involved in vacuolar protein targeting YPL066W -0.04194329 0.788571248 0.190122971 0.01550893 hypothetical protein YPL067C 0.441899469 0.163168484 0.119989266 0.402702329 hypothetical protein YPL068C 0.788512431 0.143853483 0.230475764 0.227679464 hypothetical protein YPL069C 0.574451686 0.110173738 0.119905858 0.054391812 BTS1 geranylgeranyl diphosphate synthase YPL070W 0.46179261 0.20492171 -0.370995236 0.057815463 weak similarity to Vps9p YPL071C 0.291439536 0.101031264 -0.331500058 0.207232347 hypothetical protein YPL072W 0.279768006 0.15025181 -0.297764996 0.111798767 UBP16 putative deubiquitinating enzyme YPL073C 0.552105624 0.135049331 -0.040631179 0.742676585 similarity to Vps4p and YER047c YPL074W -0.03486613 0.843271256 -0.364767224 0.031223679 YTA6 AAA family ATPase YPL075W -0.17744538 0.589106396 -0.133728231 0.131547413 GCR1 trans-acting positive regulator of the enolase and glyceraldehyde-3-phosphate dehydrogenase gene families YPL076W 0.178418934 0.536461958 0.318293212 0.099433713 GPI2 involved in N-acetylglucosaminylphosphatidylinositol synthesis YPL077C -0.49437214 0.021728795 -0.164130444 0.566215024 weak similarity to YBR197c YPL078C -1.01145567 0.023767069 -0.627087418 0.007624588 ATP4 F(1)F(0)-ATPase complex delta subunit, mitochondrial YPL079W 0.571266803 0.165667904 0.058829957 0.725960444 RPL21B Ribosomal protein L21B YPL080C 0.764996669 0.133526879 0.054652829 0.528829463 hypothetical protein YPL081W 0.961701165 0.036377962 0.079640792 0.628228217 RPS9A Ribosomal protein S9A (S13) (rp21) (YS11) YPL082C -0.32014663 0.502035458 0.125531837 0.288600285 MOT1 putative helicase YPL083C -0.14898337 0.09855869 -0.293567625 0.103529872 SEN54 54kDa subunit of the tetrameric tRNA splicing endonuclease YPL084W -0.28451045 0.346241872 -0.068852743 0.318318109 BRO1 BCK1-like resistance to osmotic shock YPL086C 0.536666612 0.037646682 -0.328740497 0.152610017 ELP3 RNA polymerase II-associated Histone acetyltransferase YPL087W -0.76479195 0.066931435 -0.007273146 0.972171838 YDC1 alkaline dihydroceramidase with minor reverse activity. YPL088W 0.052469045 0.931882176 -0.334656742 0.026258694 strong similarity to aryl-alcohol dehydrogenase YPL089C 0.100552767 0.730875074 0.276241638 0.126864694 RLM1 serum response factor-like protein YPL090C 1.388847488 0.106165412 -0.310677624 0.139494895 RPS6A Ribosomal protein S6A (S10A) (rp9) (YS4) YPL091W -0.18641422 0.181553682 -0.219375691 0.085906153 GLR1 Glutathione oxidoreductase YPL092W 0.64466355 0.250879829 -0.126763485 0.462789761 SSU1 major facilitator superfamily protein YPL093W 1.527314477 0.041177315 -0.037459215 0.670680386 NOG1 (putative) nucleolar G-protein ; homologs identified in human and Trypanosoma brucei YPL094C -0.05563375 0.751068741 -0.129321411 0.277490411 SEC62 membrane component of ER protein translocation apparatus YPL095C -1.57795781 0.010381381 -0.066085224 0.091155236 strong similarity to YBR177c YPL096W -0.52947089 0.077576597 -0.514693492 0.020363831 PNG1 peptide:N-glycanase YPL097W 1.093043546 0.085767478 -0.482236984 0.044145875 MSY1 Tyrosyl-tRNA synthetase YPL098C 0.596577763 0.150461174 0.451593704 0.182792643 similarity to S.pombe hypothetical protein YPL099C -0.21084467 0.329310017 -0.483446203 0.045760448 weak similarity to Sulfolobus hypothetical protein YPL100W -0.54811214 0.079785138 -0.101122176 0.062402349 similarity to YFR021w YPL101W -0.27938877 0.022511943 0.148413766 0.018466875 hypothetical protein YPL102C 0.37330581 0.553073254 -0.292457895 0.341350932 questionable ORF YPL103C 0.343765794 0.191476269 -0.151323827 0.059271614 similarity to hypothetical M. tuberculosis protein YPL104W 0.020450303 0.925562136 -0.285146085 0.038775998 MSD1 Aspartyl-tRNA synthetase, mitochondrial YPL105C 0.147269149 0.678880056 -0.06966114 0.264408521 similarity to Smy2p YPL106C -0.15226008 0.443420916 -0.030528663 0.803573865 SSE1 HSP70 family member, highly homologous to Ssa1p and Sse2p YPL107W -0.75387647 0.006112882 -0.599036464 0.014797051 hypothetical protein YPL108W 0.444229645 0.13998463 -0.028534203 0.869456109 hypothetical protein YPL109C -0.81061877 0.003087202 -0.201349995 0.006084792 similarity to aminoglycoside acetyltransferase regulator from P. stuartii YPL110C -0.63638776 0.002031695 -0.390529184 0.002395897 similarity to C.elegans hypothetical protein, weak similarity to Pho81p YPL111W 0.86068719 0.259084333 0.24557439 0.135318894 CAR1 arginase YPL112C 1.178294533 0.195571778 0.063501235 0.221077382 weak similarity to YOR193w YPL113C -0.36866002 0.346216059 0.090391858 0.335274634 similarity to glycerate dehydrogenases YPL114W -0.07682752 0.781681737 0.353156953 0.203385009 questionable ORF YPL115C -0.09461531 0.499486982 0.208816078 0.223762154 BEM3 GTPase-activating protein activity toward the essential bud-site assembly GTPase Cdc42 YPL116W -0.37423894 0.042380654 -0.00909294 0.829484582 HOS3 sequence similar to the histone deacetylase Hda1p YPL117C 0.124968119 0.638171249 -0.604997639 0.063091168 IDI1 Isopentenyl diphosphate:dimethylallyl diphosphate isomerase (IPP isomerase) YPL118W 0.250701289 0.228991318 -0.877397356 0.153197028 MRP51 Component of small subunit of the mitochondrial ribosome YPL119C 0.569440684 0.351463457 0.319038614 0.088157518 DBP1 putative ATP-dependent RNA helicase ; Dead box protein YPL120W -0.41018904 0.087460049 -0.579529958 0.032207106 VPS30 involved in vacuolar protein targeting YPL121C 0.368637649 0.406757921 0.270801287 0.422649731 MEI5 involved in meiosis, synapsis and recombination YPL122C 0.35472874 0.291213856 -0.380643876 0.032899319 TFB2 TFIIH subunit Tfb2 ; has homology to CAK and human IIH subunits YPL123C -1.49989253 0.000867039 -0.154418795 0.336374855 RNY1 Ribonuclease from the T2 family of ribonucleases YPL124W -0.4981048 0.19224449 -0.25760183 0.394457902 NIP29 spindle pole body associated protein YPL125W 0.092409533 0.337750961 -0.034322509 0.73747585 KAP120 karyopherin YPL126W 1.536344333 0.053991953 -0.0028796 0.986607909 NAN1 Net1-Associated Nucleolar protein 1 YPL127C 0.04392647 0.900605161 0.15093345 0.044124743 HHO1 histone H1 YPL128C 0.034010124 0.884345526 0.514443402 0.008678616 TBF1 TTAGGG repeat binding factor YPL129W 0.027106622 0.710762506 -0.070810649 0.21979499 ANC1 transcription initiation factor TFIIF small subunit YPL130W 0.327348176 0.517822229 -0.141627632 0.285527101 SPO19 meiosis-specific GPI-protein YPL131W 0.578322395 0.148144899 0.363739205 0.086329399 RPL5 Ribosomal protein L5 (L1a)(YL3) YPL132W -0.06915851 0.718627178 -0.145956746 0.042895687 COX11 mitochondrial membrane protein required for insertion of Cu(B) and magnesium during assembly of cytochrome c oxidase YPL133C -0.68358071 0.031220495 -0.268800519 0.10737279 YPL134C -1.16744467 0.063004364 0.117603292 0.57717173 ODC1 mitochondrial 2-oxodicarboxylate transport protein YPL135W 0.791553258 0.046912808 -0.397582229 0.159863467 ISU1 Iron-sulfur cluster nifU-like protein YPL136W 0.193755724 0.28263472 0.332057993 0.039411144 questionable ORF YPL137C 0.546502833 0.100439682 0.167844363 0.016507057 similarity to microtubule-interacting protein Mhp1p and to hypothetical protein YOR227w YPL138C 0.026429322 0.88437887 -0.495632651 0.001948551 weak similarity to fruit fly polycomblike nuclear protein YPL139C 0.015982585 0.898045766 -0.177811472 0.264524661 UME1 Transcriptional modulator YPL140C -0.0690729 0.642545886 -0.200481316 0.024088612 MKK2 protein kinase YPL141C 0.119848459 0.31564709 -0.111675615 0.490607488 strong similarity to protein kinase Kin4p YPL142C 1.539319329 0.12587052 0.84250466 0.001290465 questionable ORF YPL143W 1.653014178 0.126867438 0.651822312 0.006328347 RPL33A Ribosomal protein L33A (L37A) (YL37) (rp47) YPL145C 0.889063669 0.072951676 0.281575079 0.2392032 KES1 involved in ergosterol biosynthesis /sequence similar to Hes1p YPL146C 1.010792923 0.24433035 -1.103999311 0.014910197 weak similarity to myosin heavy chain proteins YPL147W -0.72392848 0.168694307 -0.286549239 0.085587812 PXA1 ABC family long-chain fatty acid transporter YPL148C 0.507322333 0.292397245 -0.255226872 0.080246866 PPT2 Phosphopantetheine:protein transferase (PPTase) YPL149W 0.124987511 0.821387738 -0.159043442 0.020558299 APG5 involved in autophagy YPL150W -0.16640572 0.538022121 -0.146874156 0.051853785 similarity to ser/thr protein kinases YPL151C -0.17293757 0.598665161 -0.229103401 0.05744134 PRP46 pre-mRNA splicing factor YPL152W -0.47349929 0.074369143 -0.096334027 0.603254958 RRD2 similar to hosphotyrosyl phosphatase activator (PTPA) from several organisms YPL153C -0.19708842 0.407451603 0.024583141 0.901706825 RAD53 protein kinase, Mec1p and Tel1p regulate rad53p phosphorylation YPL154C 0.351376033 0.188330667 0.737913071 0.147565419 PEP4 vacuolar proteinase A YPL155C 0.335829396 0.016620725 -0.134286942 0.09521291 KIP2 kinesin-related protein YPL156C -0.40418443 0.183593223 0.068497431 0.3059929 PRM4 pheromone-regulated membrane protein YPL157W 0.224347524 0.13448612 -0.250101379 0.294821994 putative methyltransferase YPL158C 0.499614935 0.394447527 0.078172997 0.025445143 weak similarity to human nucleolin YPL159C 0.735653595 0.247734732 -0.334747323 0.025443677 weak similarity to YPR151c YPL160W 0.635713095 0.021594334 0.037474757 0.695967061 CDC60 cytosolic leucyl tRNA synthetase YPL161C -0.41112337 0.125312228 -0.310020958 0.006131104 BEM4 Involved in polarity establishment and bud emergence YPL162C 0.138655262 0.652305056 -0.108923518 0.020913459 hypothetical protein YPL163C 1.766698224 0.011353859 0.752950847 0.032081727 SVS1 Serine and threonine rich protein. YPL164C -0.6898999 0.027224657 -0.195561552 0.295217988 MLH3 MutL Homolog YPL165C -1.015121 0.024904063 -0.220686725 0.083568426 weak similarity to YHR207c YPL166W -0.99248492 0.039084176 -0.371033025 0.152598966 weak similarity to paramyosins YPL167C -0.09979238 0.616054443 -0.05095039 0.81560474 REV3 DNA polymerase zeta subunit YPL168W 0.361435729 0.285290257 -0.310196039 0.11886012 weak similarity to E.coli bfpB protein YPL169C 0.989201511 0.018348463 0.167402735 0.070756261 MEX67 a poly(A)+RNA binding protein YPL170W -0.15444245 0.629280306 0.431869577 0.092455806 similarity to C.elegans LIM homeobox protein YPL171C -1.13236604 0.009115099 0.011864834 0.9244869 OYE3 NAD(P)H dehydrogenase YPL172C 1.028363023 0.167213328 -0.003042146 0.96848429 COX10 Putative farnesyl transferase required for heme A synthesis YPL173W 0.779089214 0.067353086 -0.517910133 0.024330911 MRPL40 Mitochondrial ribosomal protein MRPL40 (YmL40) YPL174C -0.01068479 0.904256402 -0.277272109 0.25625406 NIP100 (putative) large subunit of dynactin complex YPL175W 1.024627655 0.204333954 -0.204878282 0.038759079 SPT14 N-acetylglucosaminyl-phosphatidylinositol biosynthetic protein YPL176C -0.60749354 0.078910323 -0.056435569 0.585780888 SSP134 similarity to chinese hamster transferrin receptor protein YPL177C -0.96007417 0.032004434 0.309446668 0.01134043 CUP9 putative DNA binding protein which shows similarity in homeobox domain to human proto-oncogene PBX1 YPL178W 0.247013831 0.325648729 -0.577836683 0.005581408 CBC2 Small subunit of the nuclear cap binding complex YPL179W 0.189321575 0.423236127 0.308209607 0.102439673 PPQ1 protein phosphatase Q YPL180W -0.46938871 0.036833801 -0.109178472 0.765007387 weak similarity to human l-caldesmon I YPL181W -0.46241092 0.079003836 -0.783852132 0.075574567 weak similarity to YKR029c YPL182C 0.146241629 0.291725452 0.14001107 0.122322271 questionable ORF YPL183C 1.250237483 0.048818607 -0.069966009 0.573044621 similarity to Taf90p YPL183W-A 0.199842917 0.528750026 0.414511063 0.050579602 ribosomal protein L36, mitochondrial YPL184C -0.0922774 0.488081164 0.452094313 0.11826554 weak similarity to Pub1p YPL185W -1.98812099 0.001349764 0.101695158 0.514497022 questionable ORF YPL186C -2.16342129 0.000779863 0.107943818 0.03344495 weak similarity to Xenopus protein xlgv7 YPL188W 0.183566325 0.265225141 -0.094942741 0.299047126 POS5 involved in oxidative stress YPL190C 0.0502561 0.89053922 -0.174755635 0.09969918 NAB3 nuclear polyadenylated RNA /single strand DNA-binding protein YPL191C -0.60044857 0.010213647 -0.370230582 0.082724398 strong similarity to YGL082w YPL192C 0.555374537 0.341050855 0.124104319 0.635544829 PRM3 pheromone-regulated membrane protein YPL193W 0.516972103 0.248865197 -0.474250103 0.035152408 RSA1 RiboSome Assembly YPL194W -0.23879644 0.583167116 -0.415773265 0.033657967 DDC1 DNA damage checkpoint gene YPL195W -0.49174211 0.17530003 -0.426246649 0.107646069 APL5 delta-like subunit of the yeast AP-3 adaptin component of the membrane-associated clathrin assembly complex YPL196W -0.71295783 0.021726618 -0.214045671 0.10765695 weak similarity to S.pombe hypothetical protein SPAC8C9 YPL197C 0.941777412 0.070609594 0.551270023 0.004851605 questionable ORF YPL198W 1.127010707 0.055990742 0.282183649 0.057709776 RPL7B Ribosomal protein L7B (L6B) (rp11) (YL8) YPL199C -0.24779928 0.035667544 -0.55318011 0.123289387 weak similarity to T.cruzi p284 protein YPL200W -0.28662009 0.539835259 0.169212365 0.760490369 hypothetical protein YPL201C 0.272355226 0.635947501 -0.107536957 0.274717469 hypothetical protein YPL202C 0.65586269 0.135337133 -0.453818991 0.046768546 similarity to cell size regulation protein Rcs1p YPL203W -1.56174828 0.002128497 -0.125881985 0.407753543 TPK2 cAMP-dependent protein kinase catalytic subunit YPL204W 0.419419696 0.019012841 -0.260863295 0.112602913 HRR25 casein kinase I isoform YPL205C -0.01096722 0.94238504 0.162285627 0.532690547 questionable ORF YPL206C -0.82002727 0.01574944 0.161858003 0.508812434 weak similarity to glycerophosphoryl diester phosphodiesterases YPL207W 0.138960303 0.397735159 0.075622722 0.252517222 similarity to hypthetical proteins from A. fulgidus, M. thermoautotrophicum and M. jannaschii YPL208W -0.30169482 0.213479277 -0.122870123 0.362755543 similarity to YHL039w YPL209C 0.07060235 0.729311676 -0.129689338 0.557448324 IPL1 Protein kinase YPL210C 0.775288688 0.115369038 -0.49163004 0.113987264 SRP72 component of signal recognition particle YPL211W 1.024604289 0.159121634 -0.133822572 0.44715781 NIP7 involved in ribosome biogenesis YPL212C 1.167304099 0.072668916 -0.5497346 0.045427727 PUS1 intranuclear protein which exhibits a nucleotide-specific intron-dependent tRNA pseudouridine synthase activity YPL213W 0.368540721 0.489591558 -0.318004468 0.120416103 LEA1 similar to human U2A' snRNP protein YPL214C 2.55421388 0.262460691 0.166144779 0.181446392 THI6 TMP pyrophosphorylase, hydroxyethylthiazole kinase YPL215W 0.203607998 0.278923719 -0.314158074 0.030126729 CBP3 involved in cytochrome-c reductase assembly YPL216W -0.96702138 0.000835915 -0.07066796 0.548741646 similarity to YGL133w YPL217C 0.150052613 0.541533751 -0.610091105 0.056248547 BMS1 BMH1 sensitive YPL218W 0.30994059 0.12448515 0.405810664 0.045362276 SAR1 GTP-binding protein of the ARF family YPL219W -0.6724054 0.008337141 -0.087979059 0.561980191 PCL8 cyclin (Pho85p) YPL220W 1.64973779 0.034391114 0.377126871 0.031157561 RPL1A Ribosomal protein L1A, forms part of the 60S ribosomal subunit YPL221W -0.11751396 0.763941792 -0.043006464 0.721517614 BOP1 Bypass of PAM1 YPL222W -1.07637578 0.041903559 0.086115786 0.808999127 similarity to C.perfringens hypothetical protein YPL223C -2.41574259 0.00362573 0.328022782 0.331656044 GRE1 hydrophilic polypeptide with no known homology YPL224C -0.05177335 0.855528161 -0.187187108 0.060122646 MMT2 involved in mitochondrial iron accumulation YPL225W -0.20675132 0.264267612 -0.582245199 0.155951288 hypothetical protein YPL226W 0.629970137 0.138001709 0.115557702 0.055406736 NEW1 This gene encodes a protein with an Q /N-rich amino terminal domain that acts as a prion, termed [NU]+. YPL227C 0.783897964 0.478276177 -0.487703326 0.088699689 ALG5 UDP-glucose:dolichyl-phosphate glucosyltransferase YPL228W -0.31838028 0.008723678 -0.549940057 0.099430564 CET1 mRNA capping enzyme beta subunit (80 kDa), RNA 5'-triphosphatase YPL229W 0.258475869 0.276887734 0.286305266 0.25635304 weak similarity to YMR181c YPL230W -1.54547519 0.001485287 0.193988599 0.069898321 USV1 Up in StarVation YPL231W -0.25119623 0.097371999 0.633422341 0.210291051 FAS2 alpha subunit of fatty acid synthase YPL232W 0.591117058 0.258144543 -0.253596051 0.049334617 SSO1 post-Golgi t-SNARE YPL233W 0.333753727 0.298593327 -0.366591228 0.318175443 hypothetical protein YPL234C 0.782704916 0.001292806 0.89548148 0.073059649 TFP3 vacuolar ATPase V0 domain subunit c' (17 kDa) YPL235W 0.040017906 0.716062865 -0.54393412 0.000793472 RVB2 RUVB-like protein YPL236C -0.19072132 0.62294799 -0.084523831 0.352463627 similarity to Prk1p, and serine/threonine protein kinase homolog from A. thaliana YPL237W 0.688951149 0.15268848 -0.456313687 0.023849911 SUI3 beta subunit of translation initiation factor eIF-2 YPL238C 0.460816806 0.2965956 -0.498852567 0.089386823 questionable ORF YPL239W 0.746539065 0.064268552 -0.156100658 0.34742168 YAR1 YAR1 encodes a 200-amino-acid protein with two ANK repeat motifs and an acidic C terminus rich in PEST-like sequences YPL240C -1.07032892 0.000166405 -0.549564935 0.003970017 HSP82 82 kDa heat shock protein ; homolog of mammalian Hsp90 YPL241C 0.61755956 0.107714162 -0.177071131 0.154903439 CIN2 involved in microtubule function YPL243W 0.530652349 0.092840968 -0.45055206 0.077466444 SRP68 component of signal recognition particle YPL244C 0.831062294 0.188147426 0.139433717 0.337912035 HUT1 yeast homologue of UDP-galactose transporter-related gene YPL245W 1.012877631 0.30712969 0.056787948 0.107448243 weak similarity to human mutL protein homolog YPL246C 0.224880313 0.411508434 0.514365558 0.047816751 weak similarity to mouse proteinase activated receptor 2 YPL247C -0.98017221 0.061992605 0.438915578 0.194521121 similarity to human HAN11 protein and petunia an11 protein YPL248C -0.74696913 0.013371237 -0.081984626 0.615829327 GAL4 zinc-finger transcription factor of the Zn(2)-Cys(6) binuclear cluster domain type YPL249C 0.307788309 0.290417435 0.054585229 0.644289587 similarity to mouse Tbc1 protein YPL249C-A 0.355551874 0.029598733 0.170414026 0.159052711 RPL36B Ribosomal protein L36B (L39) (YL39) YPL250C 0.21635742 0.441075429 0.712097796 0.140934347 ICY2 interacting with the cytoskeleton YPL251W 0.949695983 0.158515928 0.427301556 0.028950759 questionable ORF YPL252C 1.12018178 0.06927939 0.251245369 0.027567527 YAH1 iron-sulfur protein homologous to human adrenodoxin YPL253C 0.587544801 0.038691226 -0.103993996 0.045934234 VIK1 Cik1p homolog YPL254W 0.119581821 0.385411779 -0.716460863 0.022410242 HFI1 transcription factor, member of Ada /Gcn5 protein complex YPL255W -0.10408374 0.674104726 -0.24850487 0.179317819 BBP1 Involved in mitotic and meitoic cell cycle YPL256C 1.171329951 0.091623917 0.348207841 0.010753117 CLN2 G(sub)1 cyclin YPL257W -0.48551991 0.064173769 -0.017789074 0.491885669 weak similarity to YIL029c YPL257W-A 0.993034163 0.251438622 0.385536219 0.059337986 TyA gag protein. Gag processing produces capsid proteins. THI for thiamine metabolism. Transcribed in the presence of low level of thiamine (10-8M) and turned off in the presence of high level (10-6M) YPL258C 1.914585389 0.181218849 0.002722317 0.983129561 THI21 of thiamine. Under the positive control of THI2 and THI3. YPL259C -0.01277907 0.958021606 -0.251649598 0.055393754 APM1 medium subunit of the clathrin-associated protein complex YPL260W -0.31446215 0.354085568 -0.441595649 0.030269929 hypothetical protein YPL261C 0.440873711 0.051743392 0.597602769 0.369485511 questionable ORF YPL262W -0.7940907 0.018939458 0.129958635 0.357261564 FUM1 mitochondrial and cytoplasmic fumarase (fumarate hydralase) YPL263C 0.464243498 0.066152271 -0.406071226 0.062706148 KEL3 Kelch-repeat protein, similar to Kel1 and Kel2 YPL264C -0.05256402 0.940077131 0.180842705 0.333712293 strong similarity to YMR253c YPL265W 0.379952026 0.685040208 0.211906831 0.003533145 DIP5 dicarboxylic amino acid permease YPL266W 0.755383383 0.015174825 -0.157009102 0.391906627 DIM1 dimethyladenosine transferase YPL267W 0.227321481 0.392287919 -0.027581188 0.930107852 weak similarity to C.elegans transcription factor unc-86 YPL268W -0.8169795 0.04508292 -0.171351433 0.521440131 PLC1 phosphoinositide-specific phospholipase C YPL269W -1.32791939 0.000384859 -0.255060264 0.062363895 KAR9 Component of cortical adaptor complex that orients microtubules YPL270W -0.43401124 0.078675262 0.365973454 0.235850576 MDL2 ATP-binding cassette (ABC) transporter family member YPL271W -0.07713448 0.544300386 1.11471053 0.043423746 ATP15 nuclear gene for ATP synthase epsilon subunit YPL272C 0.327791269 0.574123414 0.239074999 0.348696494 hypothetical protein YPL273W 0.79209927 0.282528464 -0.155705554 0.161169575 SAM4 S-adenosylmethionine:homocysteine S-methyltransferase YPL274W -0.82897746 0.054050379 0.266676461 0.215592077 SAM3 High affinity S-adenosylMethionine Permease YPL275W -0.33608086 0.248410148 0.500234157 0.049683281 putative formate dehydrogenase/putative pseudogene YPL276W -0.12681354 0.785490663 0.461152877 0.125894495 putative formate dehydrogenase/putative pseudogene YPL277C -0.97422013 0.009099557 -0.268708606 0.213296161 strong similarity to hypothetical protein YOR389w/putative pseudogene YPL278C -0.45618884 0.021854685 0.015400524 0.940396061 strong similarity to hypothetical protein YOR389w/putative pseudogene YPL279C 0.243109828 0.506368286 0.752771076 0.072948316 nearly identical to YOR390w YPL280W -1.44313296 0.010503727 -0.181619146 0.682996996 strong similarity to YMR322c and YDR533c YPL281C -1.07278553 0.046983025 0.083354506 0.636672634 ERR2 Similar to enolase YPL282C -0.07735765 0.742500523 0.551534458 0.201686495 strong similarity to subtelomeric encoded proteins YPR001W -0.28060463 0.474610118 0.145212208 0.44247596 CIT3 Mitochondrial isoform of citrate synthase YPR002C-A 0.237923907 0.20987849 0.147701776 0.186445323 protein possibly involved in propionate utilization prpD homolog (ie the propionate operon of many prokaryotes and specifically, the gene called prpD in that operon) This gene may be regarded YPR002W 0.264776532 0.609366257 -0.168912836 0.16141849 PDH1 as *real* in yeast by two criteria: it has close homologs (some known to be essential for propionate utilization) in YPR003C -0.26462554 0.341937639 -0.077364835 0.399507341 similarity to sulphate transporter proteins YPR004C 0.832328878 0.306031206 0.21320548 0.347788978 strong similarity to electron transfer flavoproteins alpha chain YPR005C 0.114110902 0.796719577 0.06634582 0.429119844 HAL1 polar 32k Da cytoplasmic protein YPR006C -0.87091868 0.001657023 -0.178268383 0.007028649 ICL2 Isocitrate lyase, may be nonfunctional YPR007C -0.09366139 0.895911319 0.083406814 0.778895722 SPO69 Required for sporulation ; highly induced during sporulation YPR008W 0.195598221 0.059159608 -0.37826435 0.039442579 similarity to transcription factor YPR009W 1.099629006 0.200489613 -0.419135326 0.046956112 similarity to sterol uptake protein Sut1p YPR010C 0.678575904 0.18289273 0.034025044 0.358847962 RPA135 RNA polymerase I subunit A135 YPR011C -0.39740765 0.101329781 -0.166782458 0.370948591 similarity to ADP/ATP carrier proteins and Graves disease carrier protein YPR013C -1.42233524 0.000264157 0.038708672 0.850067128 similarity to transcription factors YPR014C -0.21072731 0.751555946 -0.146764554 0.199976205 hypothetical protein YPR015C -1.88711527 0.000334202 0.211189812 0.344479284 similarity to transcription factors YPR016C 0.725510809 0.030287437 0.635970829 0.069570513 TIF6 similar to human translation initiation factor 6 (eIF6)//translation initiation factor 6 (eIF6) YPR017C -0.34693892 0.217325673 -0.2399393 0.066761156 DSS4 GDP dissociation factor for Sec4p YPR018W 0.412009362 0.008419235 -0.547237235 0.102893452 RLF2 p90 subunit of yeast omatin Assembly Factor-I (CAF-I) YPR019W -0.11452954 0.554830846 0.086894767 0.054072877 CDC54 Involved in initiation of DNA replication YPR020W -0.73808681 0.002665333 -0.330854581 0.01000595 ATP20 Subunit g homolog of ATP synthase YPR021C -0.27243192 0.336377356 -0.353665483 0.080516111 similarity to human citrate transporter protein YPR023C -0.84451404 0.022548994 0.049406518 0.272237109 EAF3 stable component of the NuA4 complex YPR024W 0.148631839 0.507976367 -0.055042527 0.633606445 YME1 Mitochondrial member of the CDC48 /PAS1 /SEC18 family of ATPases YPR025C 0.035752726 0.817290864 -0.356408784 0.220110856 CCL1 novel cyclin gene ; encodes subunits of TFIIK, a subcomplex of transcription factor TFIIH YPR026W -1.35425744 0.023950229 0.245362617 0.263848489 ATH1 Acid trehalase YPR027C -0.26142973 0.415545358 0.062972219 0.815270593 similarity to YNL019c and YNL033w YPR028W 0.022389369 0.923800909 0.290686785 0.20839172 YIP2 Similar to human polyposis locus protein 1 (YPD) YPR029C 0.262686302 0.575027962 -0.316012261 0.027980764 APL4 Gamma-adaptin, large subunit of the clathrin-associated protein (AP) complex YPR030W -1.35673549 0.010886971 0.128279374 0.153637072 CSR2 chs5 spa2 rescue ; overexpression rescues the lethality of chs5 spa2 at 37 degrees YPR031W -0.58491601 0.008208334 -0.556716332 0.058705565 similarity to human zinc-finger protein BR140 YPR032W -0.17667485 0.212291679 -0.123104369 0.234454027 SRO7 yeast homolog of the Drosphila tumor suppressor, lethal giant larvae YPR033C 1.341188549 0.241296977 -0.06418027 0.38601321 HTS1 cytoplasmic and mitochondrial histidine tRNA synthetases YPR034W 0.471175011 0.387326228 0.082400703 0.527631678 ARP7 actin related protein, subunit of the chromatin remodeling Snf /Swi complex YPR035W 1.676622892 0.308552483 -0.236697481 0.113542921 GLN1 glutamine synthetase YPR036W 0.26718885 0.446122272 0.426767632 0.092165149 VMA13 vacuolar ATPase V1 domain subunit H (54 kDa) YPR037C -0.14389639 0.663078205 0.275136344 0.340775777 ERV2 similarity to Erv1p and rat ALR protein YPR040W -0.29571334 0.448454298 0.120685584 0.204891625 similarity to C.elegans C02C2.6 protein YPR041W 1.052371444 0.001432182 -0.485069136 0.04462244 TIF5 Translation initiation factor eIF-5 YPR044C 1.342389958 0.036509952 0.564240673 0.004859106 questionable ORF YPR045C -0.29076016 0.01003009 -0.347177294 0.188044598 similarity to C.elegans hypothetical protein YPR047W 1.116113611 0.092775446 -0.40643196 0.017601885 MSF1 alpha subunit of yeast mitochondrial phenylalanyl-tRNA synthetase YPR048W 0.423514008 0.055786101 -0.501518816 0.056299304 TAH18 similarity to M.domestica NADPH--ferrihemoprotein reductase and mammalian nitric-oxide synthases YPR049C -0.05583928 0.862695778 0.004541454 0.93627821 similarity to Uso1p YPR052C 0.094635273 0.600309693 0.278045946 0.13656481 NHP6A 11-kDa nonhistone chromosomal protein YPR054W -0.61255464 0.110514498 0.353866814 0.206002862 SMK1 MAP kinase 121 kDa component of the Exocyst complex, which is required for exocytosis, and which also contains the gene products encoded by SEC3, YPR055W 0.055905025 0.787060796 -0.439453378 0.111400519 SEC8 SEC5, SEC6, SEC10, SEC15, and EXO70 YPR056W 0.061987714 0.765113153 -0.352855726 0.054964523 TFB4 Transcription initiation factor TFIIH subunit YPR057W -0.10357 0.155475101 -0.369081799 0.170893884 BRR1 Spliceosomal snRNP component YPR059C 0.088939168 0.79852443 -0.203175404 0.202252871 questionable ORF YPR060C 1.127877774 0.164797537 -0.221066947 0.395019135 ARO7 chorismate mutase YPR061C -0.52977415 0.178638265 -0.164411211 0.336448875 weak similarity to Synechococcus sp. DnaJ protein YPR062W 0.833753429 0.08637676 0.400544462 0.07437461 FCY1 cytosine deaminase YPR063C 0.225016187 0.418026674 0.451195158 0.04865765 hypothetical protein YPR064W 0.280800073 0.583835821 0.33590243 0.613312721 hypothetical protein YPR065W 1.022612473 0.169850513 -0.022527624 0.900757823 ROX1 HMG-domain site-specific DNA binding protein. YPR066W -0.30869539 0.045010089 -0.014474967 0.685953133 UBA3 ubiquitin-like protein activating enzyme YPR067W 0.113656231 0.601705868 0.181307309 0.03278004 ISA2 Iron Sulfur Assembly -- IscA /NifA homolog YPR068C 0.083366601 0.310737935 -0.190948598 0.336858024 HOS1 Similar to Hda1p, Rpd3p, Hos2p, and Hos3p YPR069C 0.461161527 0.176737501 0.203829235 0.015084525 SPE3 putrescine aminopropyltransferase (spermidine synthase) YPR070W 0.641607504 0.242301359 -0.218788098 0.283476886 MED1 Subunit 1 of the Mediator complex essential for transcriptional regulation YPR071W 0.12083026 0.717748774 0.025305327 0.722789394 strong similarity to YIL029c YPR072W 0.404314019 0.190678544 -0.327651855 0.202250915 NOT5 member of the NOT complex, a global negative regulator of transcription YPR073C 0.457156295 0.46251897 -0.457050062 0.102256817 LTP1 18-kDa phosphotyrosine phosphatase of unknown function YPR074C 0.969948291 0.336211159 0.512543456 0.108092413 TKL1 Transketolase 1 YPR075C -0.51028422 0.016772606 -0.153880289 0.109869805 OPY2 imparts Far- phenotype YPR076W -0.45643364 0.037193648 0.29040431 0.106349799 questionable ORF YPR077C 0.925855503 0.090087052 0.19600808 0.073994704 questionable ORF YPR078C 1.853746387 0.04715879 0.539054236 0.041161249 hypothetical protein YPR079W 0.458290888 0.146174388 0.003318864 0.977884385 weak similarity to human insulin-like growth factor 2 receptor YPR080W 0.89458119 0.114197414 0.389831494 0.089697215 TEF1 translational elongation factor EF-1 alpha YPR081C -0.75301543 0.001117338 -0.284744349 0.008816568 strong similarity to glycyl-tRNA synthetases YPR082C -0.06868208 0.471645914 -0.307243864 0.028951621 DIB1 17 kD U4 /U6.U5 associated protein YPR083W -1.1472236 0.010936439 -0.258077778 0.114311185 hypothetical protein YPR084W -0.30350505 0.231456063 0.022053929 0.756426528 hypothetical protein YPR085C -0.05069596 0.709043979 -0.241312511 0.009443753 hypothetical protein YPR086W 0.19660243 0.445793093 -0.215460817 0.230974328 SUA7 transcription factor TFIIB homolog YPR088C -0.23755584 0.189370842 -0.416195384 0.028229856 SRP54 Signal recognition particle subunit YPR089W -0.68519777 0.133955387 0.103691388 0.228705477 questionable ORF YPR090W -0.17884265 0.475382152 -0.120010419 0.381917729 hypothetical protein YPR091C -0.66503172 0.063886392 0.039686249 0.535493484 weak similarity to C.elegans LIM homeobox protein YPR092W 0.25980297 0.492636678 0.552060433 0.029983798 questionable ORF YPR093C 0.066702692 0.629018879 0.080236005 0.603992411 weak similarity to zinc-finger proteins YPR094W 0.573646703 0.153814216 -0.041570111 0.631525072 weak similarity to chicken lim-3 protein YPR095C -0.49346418 0.071527844 0.160223344 0.219639248 SYT1 Suppressor of Ypt3 YPR096C 0.001771202 0.995549363 0.552955565 0.231790591 hypothetical protein YPR097W 0.13314167 0.202653815 -0.443934559 0.040872525 hypothetical protein YPR098C -0.58269946 0.000434427 0.388583595 0.298664638 hypothetical protein YPR099C 0.449680702 0.1559621 -0.223403957 0.30121633 questionable ORF YPR100W 0.428831728 0.195564824 -0.209069006 0.498615024 weak similarity to C.elegans hypothetical protein CEC25A1 YPR101W 0.229668115 0.102139028 -0.508633709 0.131200145 SNT309 Component of a protein complex associated with the splicing factor Prp19p. YPR102C 1.503365541 0.086560082 0.039075134 0.816923943 RPL11A Ribosomal protein L11A (L16A) (rp39A) (YL22) YPR103W 0.583629665 0.189071559 0.239607191 0.136374904 PRE2 proteasome subunit Protein with a domain similar to the fork head DNA-binding domain found in the developmental fork head protein of Drosophila melanogaster YPR104C 0.269765323 0.03245077 -0.229723663 0.186267172 FHL1 and in the HNF-3 family of hepatocyte mammalian transcription factors. YPR105C -0.06152716 0.753067873 -0.434154061 0.070016524 hypothetical protein YPR106W -0.56963877 0.001390902 0.104592821 0.336015366 ISR1 protein kinase YPR107C -0.00021438 0.997652339 -0.270398715 0.022268309 YTH1 Polyadenylation factor subunit YPR108W 0.256833319 0.18265788 -0.35777691 0.092769947 RPN7 Subunit of the regulatory particle of the proteasome YPR109W 0.042539108 0.713260396 0.060241547 0.435669614 weak similarity to human nicotinic acetylcholine receptor delta chain YPR110C 1.183430378 0.086324253 -0.309959697 0.146752238 RPC40 RNA polymerase III (C) subunit YPR111W 0.015831604 0.958921576 -0.265156699 0.296183571 DBF20 kinase required for late nuclear division YPR112C 0.985785134 0.05811774 -0.745490427 0.058168951 MRD1 Multiple RNA Binding Domain YPR113W 1.954337818 0.339272596 0.455010895 0.138991797 PIS1 phosphatidylinositol synthase YPR114W 0.306935374 0.124282581 0.602708542 0.107886994 similarity to YJR116w YPR115W -0.79748586 0.001527308 0.051289063 0.770594028 similarity to probable transcription factor Ask10p, and to YNL047c and YIL105c YPR116W -0.30321942 0.247310654 0.116719277 0.727028035 hypothetical protein YPR118W 0.867367392 0.160735775 -0.129474052 0.131545538 similarity to M.jannaschii translation initiation factor, eIF-2B YPR119W 1.671242039 0.328193407 -0.261415455 0.529560947 CLB2 G(sub)2-specific B-type cyclin YPR120C -0.37592328 0.057536905 0.098422493 0.199191851 CLB5 B-type cyclin THI for thiamine metabolism. Transcribed in the presence of low level of thiamine (10-8M) and turned off in the presence of high level (10-6M) YPR121W 2.283473023 0.221240805 -0.105445624 0.573722241 THI22 of thiamine. Under the positive control of THI2 and THI3. YPR122W 0.323517473 0.109851018 0.153583681 0.04499859 AXL1 putative homolog of human insulin-degrading endoprotease YPR123C -1.18279806 0.029050041 -0.374903918 0.044965569 questionable ORF YPR124W -0.03011095 0.940911671 -0.236513824 0.052627762 CTR1 Copper transport protein YPR125W 1.127502457 0.144194536 -0.422887405 0.023544411 suppressor of mrs2-1 mutation YPR126C 1.209028106 0.018367736 0.154827937 0.534114523 questionable ORF YPR127W -1.21133954 0.008494638 0.011054001 0.834054733 similarity to C-term. of N.tabacum auxin-induced protein YPR128C 0.001468277 0.99401519 0.014701791 0.780365023 similarity to carrier protein FLX1 YPR129W -0.0249068 0.924283995 0.136646688 0.14805765 SCD6 multicopy suppressor of clathrin deficiency//suppressor of clathrin deficiency YPR130C 0.211544263 0.321680587 0.127812184 0.39986686 questionable ORF YPR131C 1.145333254 0.03148563 -0.128385452 0.353409291 NAT3 N-terminal acetyltransferase YPR132W 1.177776226 0.068429047 -0.212282965 0.138163103 RPS23B Ribosomal protein S23B (S28B) (rp37) (YS14) YPR133C 0.049807491 0.70585047 -0.726037806 0.036790349 similarity to C.elegans hypothetical protein YPR134W -0.56720851 0.008572705 -0.252411673 0.152178783 MSS18 Involved in splicing of mitochondrial COX1 transcript YPR135W -0.31505677 0.362907338 -0.200928285 0.080402109 CTF4 DNA polymerase alpha binding protein YPR136C 0.495351267 0.16419763 -0.451446676 0.121262814 questionable ORF YPR137C-A 0.792895968 0.087688013 0.354504548 0.042285364 TyA gag protein. Gag processing produces capsid proteins. YPR137W 1.347976709 0.049350789 -0.473718667 0.130779206 RRP9 U3 small nucleolar ribonucleoprotein-associated protein involved in pre-ribosomal RNA processing. YPR138C 0.628621317 0.228859516 0.39894713 0.364703044 MEP3 NH4+ transporter, highly similar to Mep1p and Mep2p YPR139C 0.255186345 0.354786135 -0.528773819 0.264221376 hypothetical protein YPR140W 0.400047303 0.19680455 0.156833946 0.11272649 similarity to human BTHS gene involved in Barth syndrome YPR141C 0.387796056 0.17763722 -0.501545921 0.047233269 KAR3 kinesin-like nuclear fusion protein YPR142C -0.12414138 0.676053365 -0.942940802 0.061241117 questionable ORF YPR143W 0.178903207 0.640090707 -1.055628405 0.062440429 hypothetical protein YPR144C 0.917531757 0.078899135 0.252621497 0.032221369 similarity to YDR060w and C.elegans hypothetical protein YPR145W 2.568704778 0.184333938 -0.183640435 0.173433714 ASN1 asparagine synthetase YPR146C -0.3219674 0.033025508 0.35789978 0.190198007 questionable ORF YPR147C -0.73574553 0.035116169 -0.135982511 0.356931735 hypothetical protein YPR148C 0.048235711 0.810163867 -0.809518919 0.009338721 hypothetical protein YPR149W -0.88602063 0.027756506 0.575268661 0.141927883 NCE102 Involved in secretion of proteins that lack classical secretory signal sequences YPR150W -1.19307504 0.013060097 0.380552598 0.004011977 questionable ORF YPR151C -1.57051717 0.001981138 0.130355295 0.741250354 weak similarity to YPL159c YPR152C -0.14860875 0.30520479 -0.790829736 0.004332659 hypothetical protein YPR153W -0.18163541 0.404882679 -0.083394324 0.647676368 hypothetical protein YPR154W -0.34250112 0.063334421 0.367657764 0.067440233 similarity to chicken growth factor receptor-binding protein GRB2 homolog YPR155C -0.59742592 0.128259871 -0.059022765 0.39075753 NCA2 Regulates expression of mitochondrial ATP synthase YPR156C -1.38645569 0.002454013 0.004985105 0.980647593 similarity to multidrug resistance proteins YPR157W -0.89960139 0.010824732 0.1643147 0.492223113 strong similarity to YGR141w YPR158C-C 0.835093275 0.044216368 0.448854333 0.010104287 TyA gag protein. Gag processing produces capsid proteins. YPR158W 0.350870008 0.029810826 0.019072095 0.71861197 similarity to YGR142w YPR159W 0.888680913 0.216786514 0.381732383 0.140870124 KRE6 potential beta-glucan synthase YPR160W -2.16779037 0.002769689 0.044671897 0.86954205 GPH1 Glycogen phosphorylase YPR161C -0.04085792 0.900017771 -0.17065989 0.13827119 SGV1 CDC28 /cdc2 related protein kinase YPR162C 0.07969343 0.728550476 -0.395320236 0.112162456 ORC4 56-kDa subunit of origin recognition complex (ORC) YPR163C 0.736724204 0.118473541 -0.575820728 0.005205727 TIF3 Translation initiation factor eIF-4B YPR165W 1.525478113 0.164310317 -0.090919811 0.586627851 RHO1 GTP-binding protein of the rho subfamily of ras-like proteins YPR166C 0.988091674 0.007601936 -0.176204473 0.154137755 MRP2 14 kDa mitochondrial ribosomal protein ; homologous to E. coli S14 protein YPR167C 0.461926705 0.328927185 -0.265312599 0.236448629 MET16 3'phosphoadenylylsulfate reductase YPR168W 0.166191546 0.583974551 -0.441957803 0.146352804 NUT2 21 kD mediator subunit of RNA polymerase II holoenzyme YPR169W 0.696644193 0.052878801 -0.486625588 0.098276576 hypothetical protein YPR170C 0.784367957 0.120807797 0.566939462 0.010462938 hypothetical protein YPR171W -0.19257785 0.54977974 0.184357928 0.199602284 hypothetical protein YPR172W -1.05485358 0.017387174 0.429180825 0.070179418 strong similarity to YLR456w YPR173C -0.25028717 0.038450504 -0.334340277 0.006214636 VPS4 AAA-type ATPase YPR174C 0.224762503 0.360788519 0.084191148 0.122043943 weak similarity to Nbp1p YPR175W 1.15309868 0.196547415 0.016668051 0.49223269 DPB2 DNA polymerase epsilon, subunit B YPR176C -0.39854856 0.035829749 -0.107958302 0.36832583 BET2 Geranylgeranyltransferase Type II beta subunit YPR177C -0.13580883 0.646609368 0.153810646 0.341021255 questionable ORF YPR178W 0.311709609 0.10263806 0.041999907 0.590171085 PRP4 associated with the U4 /U6 snRNP YPR179C -0.49855976 0.024055863 -0.485282621 0.139133313 PLO1 Ploidy-related YPR180W -0.1535186 0.210923351 -0.666741563 0.011708903 AOS1 Similar to ubiquitin activating proteins YPR181C 0.530499883 0.18206195 0.576832159 0.084035997 SEC23 cytoplasmic GTPase-activating protein YPR182W -0.02052766 0.906582589 1.040352432 0.035623156 SMX3 Sm or Sm-like snRNP protein YPR183W 0.934440336 0.0916903 0.933657061 0.088381775 DPM1 dolichol phosphate mannose synthase YPR184W -2.06667099 0.000441545 0.783486143 0.01606489 GDB1 the enzyme that debranches the glycogen having a glucanotranferase + 1-6amyloglucosidase activity YPR185W -0.54612965 0.032043693 -0.285174974 0.038611268 APG13 Involved in autophagy YPR186C 0.512342298 0.161239678 -0.418600568 0.206301753 PZF1 Transcription factor IIIA (TFIIIA) with putative Zn-fingers YPR187W 1.09247166 0.212771664 -0.068457397 0.628262128 RPO26 subunit common to RNA polymerases I, II, and III YPR188C 0.575002457 0.139957964 -0.057195765 0.709607206 MLC2 putative light chain for Myo1p YPR189W -0.16890261 0.516136021 -0.232272871 0.275022517 SKI3 Contains 8 copies of the TPR domain YPR190C 0.497167868 0.34290695 -0.173392044 0.443366549 RPC82 82-kDa subunit of RNA polymerase III (C) YPR191W -1.27524065 0.003631509 0.215489822 0.276981706 QCR2 40 kDa ubiquinol cytochrome-c reductase core protein 2 YPR192W -2.40488068 0.001289085 0.405182809 0.123646917 AQY1 Aquaporin YPR193C -0.77482152 0.082033038 0.33942354 0.585778056 HPA2 Histone acetyltransferase YPR194C -1.28598745 0.071658152 0.020022003 0.944948567 OPT2 peptide transporter YPR196W 0.081109487 0.377159412 0.017335076 0.89550671 strong similarity to regulatory protein Mal63p YPR197C 0.343706348 0.434487859 0.03589744 0.844382802 questionable ORF YPR198W 0.497876627 0.433369381 0.060466345 0.700045538 SGE1 Member of drug-resistance protein family YPR199C -0.4460005 0.004151016 0.123314929 0.292536104 ARR1 Putative transcription factor involved in arsenite and arsenate resistance YPR200C 0.73180613 0.122399837 0.223423818 0.035975598 ARR2 Required for arsenate resistance YPR201W -0.2581982 0.212627917 -0.268056775 0.033263922 ARR3 Putative membrane protein involved in arsenite transport YPR202W -0.80118489 0.012195359 0.316411914 0.090000987 strong similarity to subtelomeric encoded proteins YPR203W -0.51482072 0.095338156 0.511175754 0.109578326 strong similarity to subtelomeric encoded proteins YPR204W -1.16128291 0.011995059 0.572623138 0.074688889 strong similarity to subtelomeric encoded proteins Supplementary Table S3. Binding of Arp6 and Swr1 on ribosomal protein genes

Chr3 (1) Chr4 (18) Chr5 (6) Chr6R (2) Total (27)

Arp6 binding 1 (100%) 17 (94%) 6 (100%) 1 (50%) 25 (93%) SWR1 Swr1 binding 1 (100%) 16 (89%) 6 (100%) 1 (50%) 24 (89%)

swr1 Arp6 binding 1 (100%) 17 (94%) 6 (100%) 2 (100%) 26 (96%)

Supplementary Table S4

arp6 swr1 arp6 log2 ratio swr1 log2 ratio t-test p-value t-test p-value

YLR075W 1.576571863 0.017433948 0.112996687 0.233670477 RPL10 Ribosomal protein L10 YPR102C 1.503365541 0.086560082 0.039075134 0.816923943 RPL11A Ribosomal protein L11A YGR085C 1.143842256 0.033554383 0.055413968 0.803008706 RPL11B Ribosomal protein L11B YDR418W 0.718618587 0.036794052 0.039131475 0.493819128 RPL12B Ribosomal protein L12B YDL082W 1.546588088 0.00398878 -0.104410618 0.59360929 RPL13A Ribosomal protein L13A YKL006W 1.711216572 0.023311062 0.275826444 0.029594461 RPL14A Ribosomal protein L14A YHL001W 1.703989493 0.014953649 0.219833568 0.025672879 RPL14B Ribosomal protein L14B YLR029C 1.326933388 0.202301454 -0.012165812 0.873990441 RPL15A Ribosomal protein L15A YMR121C 0.262738181 0.54140267 -0.251930545 0.055356559 RPL15B Ribosomal protein L15B YIL133C 1.094185355 0.015515901 0.329241219 0.020929948 RPL16A Ribosomal protein L16A YNL069C 1.31015634 0.051690657 0.090396094 0.365962411 RPL16B Ribosomal protein L16B YKL180W 1.451748954 0.002746471 0.322541961 0.038518029 RPL17A Ribosomal protein L17A YJL177W 1.348767919 0.002388861 0.282761947 0.074360115 RPL17B Ribosomal protein L17B YOL120C 1.241364565 0.047718353 0.16866299 0.136178652 RPL18A Ribosomal protein L18A YNL301C 1.224644755 0.036735933 0.219393383 0.113442069 RPL18B Ribosomal protein L18B YBR084C-A 0.770050182 0.112341057 -0.104795619 0.566028018 RPL19A Ribosomal protein L19A YBL027W 1.076896847 0.044605028 -0.188299044 0.495992786 RPL19B Ribosomal protein L19B YPL220W 1.64973779 0.034391114 0.377126871 0.031157561 RPL1A Ribosomal protein L1A YGL135W 1.595980048 0.008230744 0.465602625 0.017986272 RPL1B Ribosomal protein L1B YMR242C 0.690366606 0.282041695 0.448165749 0.009202752 RPL20A Ribosomal protein L20A YOR312C 0.990083064 0.096464011 0.035950894 0.807549645 RPL20B Ribosomal protein L20B YBR191W 0.575714408 0.535778578 0.080457252 0.439970647 RPL21A Ribosomal protein L21A YPL079W 0.571266803 0.165667904 0.058829957 0.725960444 RPL21B Ribosomal protein L21B YLR061W 0.728940999 0.121321702 -0.08532118 0.674349486 RPL22A Ribosomal protein L22A YBL087C 1.69104705 0.026184735 0.387822345 0.047703769 RPL23A Ribosomal protein L23A YER117W 2.319339736 0.092618174 0.466867458 0.126093501 RPL23B Ribosomal protein L23B YGL031C 1.254458262 0.099772146 -0.056718833 0.792606769 RPL24A Ribosomal protein L24A YGR148C 0.818354508 0.047120709 -0.16705702 0.555549897 RPL24B Ribosomal protein L24B YOL127W 1.456429685 0.09342639 0.208395546 0.264660289 RPL25 Ribosomal protein L25 YLR344W 0.973505719 0.139205774 0.137073308 0.211779795 RPL26A Ribosomal protein L26A YGR034W 1.397907971 0.129421428 0.291451143 0.147152203 RPL26B Ribosomal protein L26B YHR010W 1.528535589 0.093482478 -0.034577612 0.875676605 RPL27A Ribosomal protein L27A YDR471W 1.407346931 0.127932715 0.080286664 0.720570589 RPL27B Ribosomal protein L27B YGL103W 2.029320192 0.097768807 0.135393296 0.213072135 RPL28 Ribosomal protein L28 YIL018W 2.978587365 0.194555902 0.507191111 0.161837926 RPL2B Ribosomal protein L2B YOR063W 0.892834569 0.084445822 0.110501298 0.486864495 RPL3 Ribosomal protein L3 YGL030W 2.178075603 0.02767725 0.512600129 0.038983735 RPL30 Ribosomal protein L30 YDL075W 1.734797453 0.059763772 -0.16965972 0.560638925 RPL31A Ribosomal protein L31A YLR406C 1.25091373 0.075413742 -0.041507497 0.894930265 RPL31B Ribosomal protein L31B YBL092W 1.359675889 0.089999806 0.242349467 0.22278823 RPL32 Ribosomal protein L32 YPL143W 1.653014178 0.126867438 0.651822312 0.006328347 RPL33A Ribosomal protein L33A YOR234C 1.878918969 0.081449834 0.448106535 0.051091459 RPL33B Ribosomal protein L33B YER056C-A 1.171852004 0.026749893 0.409069495 0.072603787 RPL34A Ribosomal protein L34A YIL052C 1.135289748 0.044008456 0.35202333 0.146665611 RPL34B Ribosomal protein L34B YDL191W 0.617598406 0.254340889 -0.560365742 0.036213696 RPL35A Ribosomal protein L35A YDL136W 0.519972334 0.169363829 -0.586988481 0.092290158 RPL35B Ribosomal protein L35B YMR194W 0.713577359 0.1215553 -0.19266631 0.328706373 RPL36A Ribosomal protein L36A YPL249C-A 0.355551874 0.029598733 0.170414026 0.159052711 RPL36B Ribosomal protein L36B YLR185W 1.831915496 0.034272318 0.449438989 0.071399531 RPL37A Ribosomal protein L37A YDR500C 0.866460723 0.052853159 0.097665805 0.419301977 RPL37B Ribosomal protein L37B YLR325C 0.958288036 0.193460941 -0.056435274 0.809187635 RPL38 Ribosomal protein L38 YJL189W 1.383478986 0.097065658 -0.471087861 0.165259003 RPL39 Ribosomal protein L39 YKR094C 0.758839088 0.071383931 -0.038509012 0.866418261 RPL40B Ribosomal protein L40B YDL184C -0.02689704 0.95241093 -0.175430861 0.572890186 RPL41A Ribosomal protein L41A YNL162W 1.726442781 0.044789656 0.083662557 0.74203321 RPL42A Ribosomal protein L42A YHR141C 1.518585016 0.071401945 0.362117748 0.070641919 RPL42B Ribosomal protein L42B YBR031W 1.613544394 0.07541802 0.301061615 0.252079647 RPL4A Ribosomal protein L4A YDR012W 1.365812533 0.064550535 0.217296272 0.215143703 RPL4B Ribosomal protein L4B YPL131W 0.578322395 0.148144899 0.363739205 0.086329399 RPL5 Ribosomal protein L5 YML073C 1.026189219 0.00333147 0.273738884 0.143152681 RPL6A Ribosomal protein L6A YLR448W 0.870035304 0.077988032 0.277268059 0.052808158 RPL6B Ribosomal protein L6B YGL076C 0.853779945 0.050831096 0.374890396 0.039602658 RPL7A Ribosomal protein L7A YPL198W 1.127010707 0.055990742 0.282183649 0.057709776 RPL7B Ribosomal protein L7B YHL033C 1.16890719 0.014402862 0.301355911 0.00110139 RPL8A Ribosomal protein L8A YLL045C 0.927534009 0.036665972 0.346942815 0.010682521 RPL8B Ribosomal protein L8B YGL147C 2.001154361 0.033862605 0.058206669 0.780159902 RPL9A Ribosomal protein L9A YNL067W 1.360106999 0.204133244 0.202517895 0.320819612 RPL9B Ribosomal protein L9B YLR340W 0.025499589 0.9495506 0.634196687 0.015277129 RPP0 Ribosomal protein P0 YDL081C 2.308299563 0.013332031 0.745970418 0.029550652 RPP1A Ribosomal protein P1A YDL130W 1.828980435 0.017651205 0.438306831 0.011905829 RPP1B Ribosomal protein P1B YOL039W 1.214419471 0.025383298 0.597341306 0.016506898 RPP2A Ribosomal protein P2A YDR382W 2.220277424 0.066689938 0.428438433 0.003750935 RPP2B Ribosomal protein P2B YGR214W 0.905528953 0.004652697 0.316660171 0.010957085 RPS0A Ribosomal protein S0A YLR048W 1.277592787 0.000666966 0.367912657 0.015997253 RPS0B Ribosomal protein S0B YOR293W 1.414780311 0.164617553 0.012701869 0.952507416 RPS10A Ribosomal protein S10A YMR230W 1.253409032 0.144050522 -0.159201712 0.194064455 RPS10B Ribosomal protein S10B YDR025W 1.14703072 0.119007804 0.332549467 0.167976165 RPS11A Ribosomal protein S11A YBR048W 0.603507542 0.135601762 0.102493926 0.627849268 RPS11B Ribosomal protein S11B YOR369C 1.336069696 0.017229433 0.383564205 0.040907236 RPS12 Ribosomal protein S12 YDR064W 1.542230434 0.055859956 0.376037692 0.013764765 RPS13 Ribosomal protein S13 YJL191W 0.540641251 0.003421781 0.505068838 0.081178073 RPS14B Ribosomal protein S14B YOL040C 1.633716594 0.079449594 0.753295478 0.012005814 RPS15 Ribosomal protein S15 YMR143W 1.675148389 0.054405733 0.413165616 0.055348219 RPS16A Ribosomal protein S16A YDL083C 1.912603939 0.019191167 0.226168195 0.025123929 RPS16B Ribosomal protein S16B YDR447C 1.055119248 0.089987338 -0.489944811 0.08489435 RPS17B Ribosomal protein S17B YDR450W 1.329530264 0.047370355 -0.073409286 0.687153255 RPS18A Ribosomal protein S18A YOL121C 0.825853142 0.170781372 0.069472833 0.663066825 RPS19A Ribosomal protein S19A YNL302C 1.123946631 0.041669051 -0.105847454 0.494486498 RPS19B Ribosomal protein S19B YLR441C 1.554494625 0.166890011 -0.404773963 0.090185628 RPS1A Ribosomal protein S1A YML063W 1.742679322 0.058802357 -0.16214849 0.452235157 RPS1B Ribosomal protein S1B YGL123W 1.47580959 0.176326389 0.298163085 0.176786808 RPS2 Ribosomal protein S2 YHL015W 0.874570837 0.062183127 -0.346054478 0.095767284 RPS20 Ribosomal protein S20 YKR057W 1.164659345 0.1987206 0.044276269 0.307570824 RPS21A Ribosomal protein S21A YJL136C 1.509979603 0.034059717 0.192101201 0.379496244 RPS21B Ribosomal protein S21B YJL190C 2.572114824 0.090893172 0.523757623 0.005975725 RPS22A Ribosomal protein S22A YLR367W 1.269342224 0.235430992 0.518766245 0.021357709 RPS22B Ribosomal protein S22B YGR118W 1.905998532 0.143971105 -0.055413475 0.723544445 RPS23A Ribosomal protein S23A YPR132W 1.177776226 0.068429047 -0.212282965 0.138163103 RPS23B Ribosomal protein S23B YER074W 1.118645861 0.072797967 -0.024958046 0.840624872 RPS24A Ribosomal protein S24A YIL069C 1.146720758 0.044086876 -0.070902167 0.675752713 RPS24B Ribosomal protein S24B YGR027C 0.639048422 0.02798567 0.129112644 0.028986798 RPS25A Ribosomal protein S25A YLR333C 0.744924166 0.033454689 0.276893329 0.054096625 RPS25B Ribosomal protein S25B YGL189C 1.432802172 0.091822196 0.132248912 0.42787916 RPS26A Ribosomal protein S26A YER131W 0.771749498 0.071319758 0.089119006 0.601657361 RPS26B Ribosomal protein S26B YKL156W 0.906673867 0.032753132 0.142785112 0.097662666 RPS27A Rribosomal protein S27A YHR021C 2.175756787 0.027671927 0.690090147 0.023466091 RPS27B Ribosomal protein S27B YOR167C 2.18862899 0.036062185 0.784300702 0.001449006 RPS28A Ribosomal protein S28A YLR264W 1.727777615 0.01815399 0.103972173 0.026067351 RPS28B Ribosomal protein S28B YLR388W 0.713353266 0.118570613 0.65984373 0.058852725 RPS29A Ribosomal protein S29A YDL061C 0.916519867 0.059769261 0.896321501 0.017545271 RPS29B Ribosomal protein S29B YNL178W 1.577656862 0.187456364 0.038613614 0.803836227 RPS3 Ribosomal protein S3 YOR182C 0.945503037 0.032809985 -0.120139795 0.648470329 RPS30B Ribosomal protein S30B YLR167W 2.061228552 0.086881979 0.330792457 0.225867271 RPS31 Ribosomal protein S31 YJR145C 1.773813298 0.048126769 0.406672043 0.003345234 RPS4A Ribosomal protein S4A YHR203C 1.426400066 0.003420178 0.455713295 0.040050033 RPS4B Ribosomal protein S4B YJR123W 1.901269634 0.035313686 0.739036829 0.000987969 RPS5 Ribosomal protein S5 YPL090C 1.388847488 0.106165412 -0.310677624 0.139494895 RPS6A Ribosomal protein S6A YBR181C 1.517480365 0.18681994 -0.277696415 0.046526669 RPS6B Ribosomal protein S6B YOR096W 1.513057506 0.030362232 -0.140771101 0.393280483 RPS7A Ribosomal protein S7A YNL096C 0.949885526 0.040835327 -0.082916416 0.741138909 RPS7B Ribosomal protein S7B YBL072C 2.202569138 0.067628298 0.170422683 0.317507363 RPS8A Ribosomal protein S8A YER102W 2.076633921 0.067946003 0.196567561 0.245329992 RPS8B Ribosomal protein S8B YPL081W 0.961701165 0.036377962 0.079640792 0.628228217 RPS9A Ribosomal protein S9A YBR189W 0.950615102 0.051056367 0.047228918 0.81597576 RPS9B Ribosomal protein S9B Supplementary Table S5. Genes markedly down-regulated in arp6 cells

arp6/wt ORF name Gene name Description log2 ratio YNR034W-A -4.32 Hypothetical protein YOL052C-A -4.16 DDR2 Induced by DNA damage, heat shock, osmotic shock, etc YDR070C -3.90 FMP16 Hypothetical protein YBR072W -3.85 HSP26 Heat shock protein 26 YHR139C -3.73 SPS100 Sporulation-specific wall maturation protein YGR088W -3.31 CTT1 Cytoplasmic catalase T YMR105C -3.21 PGM2 Phosphoglucomutase YGR052W -3.16 FMP48 similarity to ser/thr protein kinases YCR021C -3.11 HSP30 Induced by heat shock, ethanol treatment Unknown function, expression is regulated by phosphate YDR281C -3.09 PHM6 levels YGR248W -3.05 SOL4 Similar to SOL3 YML128C -2.95 MSC1 Unknown function YMR175W -2.95 SIP18 Induced by osmotic stress YFL014W -2.92 HSP12 12 kDa heat shock protein YMR250W -2.82 GAD1 Glutamate decarboxylase, involved in oxidative stress YBR050C -2.74 REG2 Putative Glc7 regulatory subunit YMR107W -2.67 SPG4 Required for survival at high temperature YBR285W -2.66 Hypothetical protein YMR206W -2.63 Weak similarity to hypothetical protein YNR014w YHR140W -2.61 Hypothetical protein YGR256W -2.60 GND2 Zink-finger 6-phosphogluconate dehydrogenase YPL054W -2.57 LEE1 Unknown function YEL011W -2.50 GLC3 1,4-glucan-6-(1,4-glucano)-transferase YLR178C -2.47 TFS1 Lipid binding protein (putative) YER103W -2.46 SSA4 Member of 70 kDa heat shock protein family YPL223C -2.42 GRE1 Hydrophilin of unknown function, stress-induced YPR192W -2.40 AQY1 Aquaporin YLL026W -2.39 HSP104 104 kDa heat shock protein YOR186W -2.38 Hypothetical protein YMR081C -2.38 ISF1 Involved in mRNA splicing YDL085W -2.37 NED2 Mitochondrial external NADH dehydrogenase YMR169C -2.36 ALD3 Aldehyde dehydrogenase YGL156W -2.31 AMS1 Vacuolar alpha mannosidase YLL052C -2.25 AQY2 Aqy2p, putative aquaporin, member of MIP family YGL256W -2.24 ADH4 Alcohol dehydrogenase isoenzyme IV YDL022W -2.24 GPD1 Glycerol-3-phosphate dehydrogenase YJL163C -2.23 Hypothetical protein YDR247W -2.22 VHS1 Cytoplasmic serine/threonine protein kinase YOL083W -2.22 Similarity to YOL082w YER067W -2.20 Strong similarity to hypothetical protein YIL057c

Supplementary Table S6. Strains used in this study

Name Genotype GA-426 MATa ade2::hisG his3-11 leu2 trp1 ura3-52 can1::hisG VR::ADE2-TEL GA-3353 GA-426 arp6::ARP6-3FLAG-Kan GA-3354 GA-3353 swr1::TRP1 GA-3153 GA-426 swr1::SWR1-3FLAG-Kan GA-3477 GA-426 sir4::SIR4-x3FLAG-Kan GA-1320 MATa ade2-1 can1-100 his3-11,-15::GFP-LacI-HIS3 trp1-1, ura3-1, leu2-3,-112 nup49::NUP49-GFP-URA3 GA-1461 GA-1320 PES4::lacO-lexA-TRP1 (integrated 272 bp 5’ of PES4). GA-3320 GA-1461 swr1::CaURA3 GA-2765 GA-1461 mlp1::KanMX6 mlp2::CaURA3 GA-2659 GA-1320 LYS2::lacO-lexA-TRP1 GA-4135 MATalpha hml::ADE1 hmr::ADE1 ade3::GALHO nup133::NUP133-13myc-Kan GA-5806 GA-4135 arp6::TRP1 GA-5807 GA-4135 swr1::TRP1 GA-5868 GA-3353 htz1::TRP1 GA-3150 arp6::ARP6-3FLAG-Kan ade2-1 can1-100 his3-11,-15 trp1-1 ura3-1, leu2-3,-112 GA-3203 GA-3150 swr1::CaURA3 GA-3426 GA-3425 arp6::KanMX6 GA-3427 GA-3425 swr1::CaURA3 GA-3428 MATa, ade2-1 can1-100 his3-11,-15 trp1-1 ura3-1 leu2-3,-122 ino80::INO80-13MYC-HIS3MX6 GA-3429 GA-3428 arp6::KanMX6 GA-3430 GA-3428 swr1::CaURA3 GA-4584 MATa ade2-1 ::GFP-LacI-ADE2 can1-100 his3-11,-15 trp1-1, ura3-1, leu2-3,-112 nup49::NUP49-CFP-URA3 LYS2::LacO-LexA-TRP1 nup133::HIS3 pUN100-nup133ΔN-KanMX6 GA-3635 GA-1320 with RPL9A::LacO-TRP1 GA-5113 GA-3635 with swr1::CaURA3 GA-5132 GA-3635 with arp6::CaURA3 GA-4098 GA-1320 with GAL10::LacO-TRP1 GA-6024 GA-4098 with arp6::CaURA3

Text S1. Supplementary Materials

Primer sequences For RPS16B: forward primer, TCACTGGTGGTGGTCATGTT; reverse primer, CGTTCTTGGATTGTTCGTCA For RPL13A: forward primer, GCACTGGCAAGAACGTGTTA; reverse primer, GCAGCAGCAGACAAAACTTG For RPP1A: forward primer, TGGCTGACTCTGAAATCGAA; reverse primer, CGTCCAAAGCCTTAGCAAAA For RPL31A: forward primer, GCTCCAGAATTGAACCAAGC; reverse primer, TGGCGTCTTCTTCTTCGTTT For RPL2A: forward primer, ACCTCCCACACCAGATTGAG; reverse primer, CTACCGGAGTCGTGGACAAT For RPL29: forward primer, AACCAAACCAGAAAGGCTCA; reverse primer, GTAGGGCATGCTTGTGGTTT For NUP2: forward primer, TAAGGTTGCGTCATCTGCTG; reverse primer, CTGCTTGGTTTCATCCGATT For FAB1: forward primer, GCGACGGATTTGAACACATT; reverse primer, ATATTCGCGCTCTTGCCTAA. For PES4: forward primer, CGAGCCATTCTGATTCACCT; reverse primer, TGTTTCATGGAGGTCACCAA. For GAL1: forward primer, GCGCAAAGGAATTACCAAGA; reverse primer, GGCGCAAAGCATATCAAAAT For SWR1: forward primer, GCTTCCTCTGGTTCAGATGC; reverse primer, AGACAAGGGTTCCGATGATG For UBX3: forward primer, GGGATGGACGCTTAAAATCA; reverse primer, AAACGGTTGTGCTTCCTCTG For RDS1: forward primer, GTGATAAACTGCGGCCTGCT; reverse primer, AACGACACCTTCAGGCACTT For RPL13A: forward primer, TCTGTTCGAAGGGGTTTGAG; reverse primer, TACGATTCCTGCTGTGCTGT For RPS16B: forward primer, TCACTGGTGGTGGTCATGTT, reverse primer, CGTTCTTGGATTGTTCGTCA