Title Development of Simple Detection Methods of Plant Pathogenic Oomycetes( 本文(Fulltext) ) Author(S) FENG, WENZHUO Report N

Development of Simple Detection Methods of Plant Pathogenic Title Oomycetes( 本文(Fulltext) )

Author(s) FENG, WENZHUO

Report No.(Doctoral Degree) 博士(農学) 甲第708号

Issue Date 2019-03-13

Type 博士論文

Version ETD

URL http://hdl.handle.net/20.500.12099/77944

※この資料の著作権は、各資料の著者・学協会・出版社等に帰属します。

Development of Simple Detection Methods of Plant Pathogenic Oomycetes

（植物病原性卵菌類の簡易検出法の開発）

2018

The United Graduate School of Agriculture Science, Gifu University Science of Biological Environment (Gifu University)

FENG WENZHUO

Development of Simple Detection Methods of Plant Pathogenic Oomycetes

（植物病原性卵菌類の簡易検出法の開発）

FENG WENZHUO

INDEX PREFACE ...... 1

CHAPTER 1 Establishment of simple LAMP procedures with detection of Pythium

irregulare in field samples ...... 12

MATERIALS AND METHODS ...... 13

RESULTS ...... 17

1. Primer design and specificity ...... 17

2. Sensitivity of LAMP ...... 18

3. Practical detection of P. irregulare in field samples ...... 18

DISCUSSION ...... 28

CHAPTER 2 Use of LAMP detection to identify potential contamination sources of plant-

pathogenic Pythium species in hydroponic culture systems of tomato and

eustoma...... 29

MATERIALS AND METHODS ...... 40

RESULTS ...... 34

1. Detection of P. aphanidermatum in tomato cultivation...... 34

2. Detection of P. irregulare in eustoma cultivation ...... 35

DISCUSSION ...... 44

CHAPTER 3 LAMP detection of four plant pathogenic oomycetes and its application in

lettuce fields ...... 49

MATERIALS AND METHODS ...... 50

RESULTS ...... 55 1. Specificity of the LAMP assay ...... 55

2. Sensitivity of the LAMP assay ...... 55

3. Optimization of the procedures for LAMP detection in field samples ...... 56

4. Infection sites in lettuce plants ...... 57

5. Detection of pathogens in soil samples from the field ...... 57

DISCUSSION ...... 74

CHAPTER 4 A simple LAMP detection of Phytophthora colocasiae in infected taro fields

...... 78

MATERIALS AND METHODS ...... 79

RESULTS ...... 83

1. Specificity and sensitivity of the LAMP primers ...... 83

2. Identification of isolates maintained on agar media ...... 83

3. Development of the Plant-LAMP assay ...... 84

4. Detection of the pathogen in field samples ...... 84

DISCUSSION ...... 95

OVERALL DISCUSSION ...... 99

SUMMARY ...... 103

ACKNOWLEDGMENTS ...... 107

REFERENCES ...... 109

PREFACE

Plant is the very precious part of our earth for it maintaining the atmosphere, supplying food and energy, cycling water and nurturing soils and so on. However, almost all species of wild and cultivated plants are subject to disease. The diseases are recognized by many symptoms, such as chlorosis, interveinal chlorosis, stunting, and purpling (McCauley et al. 2009), and can happen in a forest, a field, and even a greenhouse. The occurrence and prevalence of plant diseases depends on the presence of pathogens, environmental conditions, weather and crops and varieties grown. Pathogen is a major class of disease- causing agents that include viruses, bacteria, fungi, nematodes, parasitic plants, and especially, oomycetes.

Plant pathogenic oomycetes once classified as fungi, because of their filamentous growth, nutrition by absorption, and reproduction via spores, are now classified as a distinct group based on a number of unique characteristics (Rossman and Palm 2006). It has several hundred organisms that include some of the most devastating plant pathogens, particularly within the genera of Pythium and Phytophthora, and have colonized almost all ecosystems all over the world. This group causes devastating diseases of crop, ornamentals, and native plants including damping-off, seedling blight, root rot, foliar blight and downy mildew, and are thought to be not only the most important group of pathogens of dicotyledonous plants (Erwin et al. 1996), but also the source of yield reduction in cereal crop (Cook et al. 1987; Paulitz and Adams 2003; Harvey and

Lawrence 2008). Oomycete grows best in running surface water, so it also known as

“water molds”. One of its most distinguishing characteristics is the production of zoospores produced in sporangia that lead to the disease spreading rapidly (Fry and

Grünwald 2010). Zoospores can swim in water films on leaf surfaces, in soil water, in

1 hydroponic media and in natural water. When zoospores are attracted to exudates and extracts from roots, they begin to settle on the baits and in the vicinity of the baits, to round up, and to begin to germinate. Moreover, “Oomycota” means “egg fungus”, and refers to the large round structures containing the female gametes, the oogonia (Waggoner and Speer 1994). Usually, each individual produces antheridia and oogonia. Almost all

Pythium and some Phytophthora species are homothallic. In these species, sexual reproduction occurs in a single culture. The other Phytophthora species, in which two distinct mating types occur, and sexual reproduction requires the presence of both mating types, are heterothallic. The fertilized oogonia develop into sexual spores called oospores, which have a thick-walled structure shown to be able to survive for years in soil (Fry and

Grünwald 2010).

The genus Pythium includes more than 140 species with more than 40 new species having been described since 2000 (Kageyama 2014); Most of the Pythium members live in soil or aquatic environments and widely distributed all over the world. Many species cause seed, stem and root rot, and seedling damping-off in various crops, inflicting serious economic. While others are more restricted in the host and geographic range, or affect plants only under special environmental conditions (Hendrix and Campbell 1973).

Pythium irregulare Buisman is one of the most important Pythium species with regard to agriculture as it has a complex and extensive host range, and typically exhibits high virulence (van der Plaats-Niterink 1981; Chen et al. 1992; Barr et al. 1997; Garzón et al.

2005, 2007). It distinguished from other Pythium species on the basis of oogonium morphology, which has an irregular number (0-5) of projections, and spherical sporangia is highly pathogenic to a wide range hosts, and has been identified on over 200 host species, such as eustoma, pineapple, grasses, tobacco, pecan trees, cucumber, onion, carrot, pepper and a number of floricultural crops. Matsumoto et al. (2000) classified Py.

2 irregulare isolates into four DNA groups based on randomly amplified polymorphic

DNA-polymerase chain reaction (RAPD-PCR), PCR-restriction fragment length polymorphism analyses, and phylogenetic analysis of the ribosomal DNA internal transcribed spacer (rDNA ITS) regions. They demonstrated that among these groups I to

IV, groups III and IV were not important as plant pathogens and phylogenetically distinct from groups I and II. Groups I and II are generally regarded as a single species (Spies et al. 2011a), although Garzón et al. (2007) proposed group II as a new species, Py. cryptoirregulare. In this study, we treat group I and II as belonging to the same species,

Py. irregulare. Pythium spinosum Sawada, a cosmopolitan species, has a wide host range. It was originally isolated from seedlings of Anthirrhinum majus in Taiwan (Sawada and Chen

1926), and has been has been shown to cause diseases in many other plants, such as carrot, lettuce, tomato, radish and snapdragon (van der Plaats-Niterink 1981). It was recorded not only from numerous different plants but also from soil and water. Moreover, this pathogen has been reported in many countries, such as Japan, India, New Zealand,

Queensland, Argentina, England, Netherlands, and USA (van der Plaats-Niterink 1981).

Pythium spinosum differs from the other Pythium species by its fmger-like ornamentation, with mostly cylindrical, and no formation of sporangia and zoospores (van der Plaats-

Niterink 1981).

Pythium aphanidermatum (Edson) Fitz. is recognized as a principal causal agent of damping-off, root and stem rot and blight in a wide host range. It has been isolated form soil, water and many crops, such as peppers, papaya, tobacco, and tomato, in USA (Jones

1941; Sideris 1931), South America (Frezzi 1956), India (Grover and Dutt 1973),

Australia (Teakle 1957), China (Yu 1940), Japan (Fukuta et al. 2013) and Africa (Wager

1931). Pythium aphanidermatum as one of the high-temperature-growing Pythium

3 species, has a great influence on temperature for its infection and damage. The temperature of 30-35° C are most favourable for infection (van der Plaats-Niterink 1981).

Pythium uncinulatum Plaats-Niterink and Blok was first reported from Netherland

(Blok and van der Plaats-Niterink 1978), and is host specific to lettuce and does not infect other vegetable crops causing Pythium wilt and root rot. Pythium uncinulatum on lettuce has been reported in Netherlands, California, Arizona, USA (Davis et al. 1973) and Japan

(Matsuura et al. 2010). The pathogen is difficult to isolate from plant as well as soil, because the growth rate is slower than most Pythium species.

The genus Phytophthora literally means “plant destroyer”. It includes more than 150 species, most of which are deleterious to a broad range of economically and ecologically important plant species. Most Phytophthora species complete their life cycle in terrestrial ecosystems, as leaf, root, or stem pathogens (Hansen et al. 2012).

However, it also contains several species considered to be resident in aquatic ecosystems

(Brasier et al 2003; Hansen et al. 2012; Jung et al 2011). Phytophthora species in aquatic ecosystems are rarely isolated from terrestrial environments (Hansen et al. 2012), while terrestrial Phytophthora species are common in aquatic ecosystems (Català et al. 2015

Sims et al. 2015). The control of diseases caused by Phytophthora is difficult, and the development of resistant plant varieties is often the best long-term solution.

A new disease segregated from Hyogo Prefecture was called “lettuce Phytophthora wilt” by Kanto et al. (2004), and then the causal agent was identified as Phytophthora sp. based on complex morphological characteristics. This pathogen invades the pith of the head and leaf lettuce and reduces the yields with disease of wilt from January to March.

Some isolates obtained from diseased crowns of lettuce in Kagawa Prefecture were diagnosed as a new taxon, using morphological and physiological characteristics and a molecular phylogenetic analyses (Rahman et al. 2014). A phylogenetic tree based on

4 rDNA–ITS sequences suggested that this isolate is closely related to Phytophthora lactucae, however a tree based on mitochondrial cytochrome c oxidase subunit I (cox1) sequences and morphological characteristics demonstrated that the isolate is a new

Phytophthora species, and it was named Ph. pseudolactucae M.Z. Rahman, S. Uematsu,

Kanto, M. Kusunoki and Kageyama, sp. nov. (Rahman et al. 2015). Phytophthora colocasiae Raciborski was first described on taro in Java in 1900, and is widely distributed in tropical and subtropical areas. The pathogen was previously described as only existing heterothallic isolates, depending on the presence of opposite mating types (A1 and A2) to form oospores, until Lin and Ko (2008) found seven homothallic A1A2-type isolates in Taiwan. However, oospores seemed difficult to form in most of the areas because of non-coexistence between A1 and A2 type there (Ko 1979;

Narula and Mehrotra 1980; Ann et al 1986; Zhang et al 1994; Tyson and Fullerton 2007;

Mellow et al. 2018).

Hydroponic culture systems are used in horticultural production because they provide the advantages of high yields, convenient management, and are independent of local soil conditions. However, these practices involve high risks of plant diseases caused by zoosporic plant pathogens. For example, the oomycetes Pythium aphanidermatum and

Phytopythium helicoides, which cause root rot, can easily contaminate hydroponic culture systems and spread rapidly via the zoospores, resulting in serious crop losses (Li et al.

2014; Miyake et al. 2017; Stanghellini and Rasmussen 1994; Watanabe et al. 2008).

Pythium species are destructive pathogens with an extensive host range throughout the world (Domsch et al. 1980; Van der Plaats-Niterink 1981). Once these pathogens are introduced into hydroponic culture systems, their control is generally difficult and commonly requires the shutdown and intensive disinfestation of the entire system.

Therefore, it is extremely important to develop rapid diagnostic methods to identify

5 zoosporic plant pathogens due to their extremely rapid transmission. Appropriate and effective precautionary strategies can then be applied to hydroponic culture systems.

Since 2013, a wilting disease caused by Py. aphanidermatum resulted in enormous losses in the yields of tomatoes cultivated in hydroponic systems in Shizuoka Prefecture

(Li et al. 2014). These tomatoes are grown using the D-tray cultivation system that consists of a D-tray (60 cm length, 20 cm width, 10 cm height) characterized by 10 connected D-shaped pots (250 mL/pot) regularly arranged in two rows. This cultivation system results in fruit with a high sugar content while requiring low-cost nutrients, substrate materials, and labor inputs (Tamai 2014; Zhang et al. 2015). In Fukushima

Prefecture in 2011, the unprecedented accident at the nuclear power plant seriously contaminated the environment, including farmland. This event led to the introduction in

2014 of a hydroponic culture system named the nutrient film technique (NFT) to cultivate the cut flower eustoma. In this kind of culture system no soil is used and the oxygen-rich nutrient solution is recycled, so that plants can be grown without the addition of contaminated soil or water from the environment. Unfortunately, root rot caused by Py. irregulare has resulted in severe yield losses in the hydroponically-grown eustoma in

Fukushima Prefecture. In both the tomato and eustoma culture systems, heat sterilization is used after each cultivation period; however, this approach has not been adequate to eliminate the diseases.

Lettuce is the basic foundation of most salads and is one of the most popular leafy vegetables in Japan. According to the Ministry of Agriculture, Forestry, and Fisheries, the annual average consumption of lettuce was 450,000 tons per year in 1986 and has been increasing since then. Recently in Japan, there has been a rapid reduction in the numbers of agriculture workers due to aging and retirement (Ahrary et al. 2016). This has led to reductions in the areas under lettuce cultivation. Therefore, to meet increasing demand

6 for lettuce we need improvements in yield and output quality from each field.

Lettuce is susceptible to many diseases worldwide. These include several soil-borne diseases such as Verticillium wilt caused by Verticillium dahliae, Fusarium root rot caused by Fusarium oxysporum f. sp. lactucae, Phytophthora wilt caused by Phytophthora pseudolactucae, and Pythium damping-off caused by Pythium ultimum (Fradin and

Thomma 2006; Fujinaga et al. 2001; Lynch et al. 1991; Rahman et al. 2015).

The third largest cultivation area for winter lettuce in Japan is in Kagawa Prefecture, where huge losses have resulted from a damping-off caused by Pythium (since 2007) and a wilting disease caused by Phytophthora (since 2012). To identify the causal agents of lettuce damping-off in Kagawa Prefecture, oomycete species were collected from diseased roots and stem bases using a corn meal agar medium. Based on morphological characteristics and the internal transcribed spacer (ITS) region of rDNA (rDNA–ITS) homologies, three Pythium species were isolated and identified as Py. irregulare, Py. spinosum, and Py. uncinulatum (Kusunoki 2012). The causal agent of Phytophthora wilt in Kagawa Prefecture was isolated from diseased crowns and identified as Ph. pseudolactucae (Rahman et al. 2015).

Taro leaf blight caused by Phytophthora colocasiae is one of the most devastating diseases of taro. This disease leaded to a more than 30% crop loss in heavily infected taro fields in many locations, such as Southeast Asia, many Pacific territories and parts of

Oceania (Jackson and Gollifer 1975; Vasquez 1990). Phytophthora colocasiae produces zoospores from the asexual sporangia. These zoospores are carried in water, resulting in rapid dispersal of the disease during heavy rains and typhoons (Brooks 2005; Mbong et al.2013; Singh et al. 2012).

Taro is also one of the most popular staple crops in Japan because of its edible corms and leaves. The crop is mainly produced in Ehime, Miyazaki, Kagoshima, and Chiba

7 prefectures. The taro leaf blight disease occurred in Japan in 2014 and has been spreading rapidly since then, and caused 60% taro yield losses in Ehime prefecture in 2015 (Kurogi

2017). The disease usually occurs in late June to the end of September. The causal agent was isolated from diseased leaves and identified as the oomycete Phytophthora colocasiae by Miyaji et al. 2016.

The oomycetes have quite different sensitivity to a range of fungicides compared with fungi. A series of systemic fungicides has been introduced for oomycete control. These generally have high activity, low toxicity, and low residual action, and include phenylamides (FRAC code 4), quinone outside inhibitors (FRAC code 11), and carboxylic acid amides (FRAC code 40) (Gisi and Sierotzki 2015). Furthermore, the fungicides have more or less difference in effect for different tissues treatment. For example, almost all oomycete fungicides are used for foliar treatments, but some fungicides are not used especially for soil or seed treatments (Gisi and Sierotzki 2015).

To use fungicides under appropriate and effective precautionary strategies, it is extremely important to develop rapid diagnostic methods to identify particular plant pathogens.

Plant diseases often appear as nutrient deficiencies, resulting in visual symptoms.

There are many difficulties associated with interpreting visible symptoms. Disease symptoms can be caused by some abiotic stresses, including drought, salinity, heat, cold, chilling, freezing, nutrient, high light intensity, and ozone (O3) stresses (Agarwal and

Grover 2006; Baligar et al. 2015; Chaves and Oliveira, 2004; Lim et al. 2015; Mittler

2006; Wang et al. 2003). In addition to abiotic stresses, plants also must confront threats of infection by plant pathogens (including viruses, bacteria, fungi and oomycetes) and attack by herbivore pests (Atkinson and Urwin 2012; Tauzin et al. 2014). Although a diagnosis scheme to differentiate between classes of abiotic and biotic stress factors using visible symptoms has been proposed (Vollenweider et al. 2005), it remains difficult to

8 diagnose plant diseases caused by pathogens based on visual symptoms alone.

Furthermore, similar symptoms can be caused by different plant pathogens (Alejandro et al. 2017; Geraats et al. 2003; Samson et al. 2005). For instance, Fusarium root rot,

Pythium damping-off, Verticillium wilt, and Phytophthora wilt all cause similar wilting symptoms in lettuce (Fradin and Thomma 2006; Koike 2016; Nordskog et al. 2008), and the petiole lesions in taro caused by P. colocasiae are easily confused with the small lesions created by the taro planthopper (Tarophagus proserpina [Kirkaldy] Hemiptera:

Delphacidae) (Brooks 2005; Nelson et al. 2011). Thus, there are many difficulties associated with identifying Pythium and Phytophthora pathogens based on visible symptoms alone.

The traditional method for detecting and isolating Pythium species is based on the use of selective media containing antibacterial and antifungal agents, such as Pythium selective medium (Gamo et al. 2004). However, this approach will introduce the risk of misdiagnosis because that selective media are generally non-selective among Pythium and Phytophthora and cannot distinguish between pathogenic and nonpathogenic

Pythium or Phytophthora species that could be simultaneously present in the field or hydroponic culture systems (Watanabe et al. 2008). It is also difficult to isolate pathogens that grow more slowly than other species of the same genus using these media.

Morphological observation can improve the diagnostic accuracy, but it requires skilled taxonomists to reliably identify the pathogen.

Many studies have assessed the use of molecular methods for the initial and rapid detection of fungi, viruses, oomycetes and other microorganisms, including Pythium and

Phytophthora (Kageyama 2014; Reinhart et al. 2012). PCR-based techniques including conventional PCR (Kageyama et al. 1997), multiplex PCR (Asano et al. 2010; Ishiguro et al. 2013) and real-time PCR (Li et al. 2014; Schroeder et al. 2006) can be used to detect

Pythium species. However, PCR is time-consuming, requires specialized skills and equipment, and most importantly, it is difficult to use for on-site diagnosis in the field. To overcome the obstacles, recently, isothermal DNA amplification methods have been developed for replacing the tedious three-step thermal cycling PCR protocol, such as recombinase polymerase amplification (RPA) (Miles et al. 2015), helicase-dependent amplification (HDA) (Schwenkbier et al. 2015), and especially, loop-mediated isothermal amplification (LAMP) (Feng et al. 2015).

The LAMP assay was developed by Notomi et al. (2000) and is an alternative nucleotide amplification method combining rapidity, simplicity, and high specificity.

LAMP involves the use of Bst DNA polymerase, an enzyme that functions at a constant temperature and can, therefore, be completed without the use of a precision thermal cycler.

The assay can be carried out in the field simply by using a water bath or heat block to incubate samples at a single temperature. Four different primers are used to amplify six independent DNA regions, allowing for high specificity. The reaction can be visually monitored due to the precipitation of magnesium pyrophosphate during amplification, resulting in white turbidity (Mori et al. 2001, 2004). Alternatively, color indicators such as SYBR Green I and hydroxynaphthol blue (HNB) can be used to monitor the reaction

(Goto et al. 2009; Iwamoto et al. 2003). Moreover, the LAMP reaction is effective even with crude template DNA extractions (Feng et al. 2015; Kitamura et al .2016; Miyake et al. 2017; Shen et al. 2017). Therefore, LAMP is well suited for field diagnoses using only a simple water bath or heat block. The LAMP assay has used to detect a wide range of plant pathogens including viruses, viroids, fungi, bacteria, and oomycetes (Boubourakas et al. 2009; Fukuta et al. 2012; Hodgetts et al. 2015; Miyake et al. 2017; Rigano et al.

2010; Tomlinson et al. 2010).

The aims of this study were to design species-specific and sensitive primer sets for

10 amplification of some oomycete species that cause severe diseases in hydroponic culture systems of tomato and eustoma, lettuce or taro cultivation fields using the LAMP method, to establish simple and dependable approaches for detecting the pathogens in different carriers, to investigate the infestation status in connection with the cultivation, and to propose the some important strategies to prevent oomycete diseases.

CHAPTER 1

Establishment of simple LAMP procedures with detection of Pythium irregulare in field samples

Pythium irregulare causes damping off and root rot in a wide host range all over the world. In Japan, some ornamental plants such as geraniums, cyclamens and Eustoma exaltatum have always suffered losses, resulting from the disease caused by P. irregulare.

Oospores can be easily formed in P. irregulare. It is seemed that the pathogen can survive in the soil to withstand the toughest conditions, and has potential pollution in the fields with a long time. Therefore, we used P. irregulare as an indicator for evaluating the feasibility of using LAMP in the field. The purpose of this study was to develop a LAMP assay for species-specific amplification of P. irregulare DNA and to establish the simple

LAMP detection procedures in plant and soil.

MATERIALS AND METHODS

1. Primer design for LAMP

The rDNA ITS sequences were chosen as the target for LAMP primer design (Fig. 1-

1a). A multiple alignment of rDNA ITS sequences of P. irregulare and nine isolates of seven genetically related isolates of the molecular phylogenetic clade F proposed by

Lévesque and de Cock (2004), including P. irregulare III, P. irregulare IV (subdivided by

Matsumoto et al., 2000), P. mamillatum, P. paroecandrum, P. spinosum, P. sylvaticum, P. internmedium, P. macrosporum (strain+) and P. macrosporum (strain-) was constructed using BioEdit Sequence Alignment Editor software (Fig. 1-1b). The aligned sequences were used with PrimerExplorer V4 software (http://primerexplorer.jp) to design LAMP primers specific for P. irregulare.

2. Isolates and DNA extraction

The specificity of LAMP using the designed primers was tested using 69 isolates, including 50 isolates of 40 Pythium species, 11 Phytophthora isolates and 8 isolates of 7 other soil-borne pathogens (Table 1-1). The method using PrepMan Ultra Reagent

(Applied Biosystems Inc., CA, USA) described by Baten et al. (2014) was used for genomic DNA extraction.

3. LAMP reaction

The LAMP reaction was carried out in a total volume of 15 µl containing 1.6 µM of each FIP and BIP primer, 0.2 µM of each F3 and B3 primer, 20 mM Tris-HCL (pH 8.8),

10 mM KCl, 0.1% Tween20, 0.8 M betaine (Sigma-Aldrich), 8 mM MgSO4, 10 mM

(NH4)2SO4, 1.4 mM dNTPs (New England Biolabs Japan, Tokyo, Japan), 4.8 units of the

Bst DNA polymerase large fragment (Nippon Gene Co. Ltd, Toyama, Japan) and template

DNA (100 pg for specificity test). The mixture was incubated at approximately 65°C

(temperatures of 63, 64.5, 66 and 67.5°C were used) for 60 min to perform the LAMP reaction. Real-time changes in turbidity were recorded using a loopamp real-time turbidimeter (LA-200, Teramecs, Kyoto, Japan). Especially, in specificity test, color change was used for amplification detection. The visualization indicator was hydroxynaphthol blue; 0.12 mM in reaction mixture. The LAMP reactions were carried out in triplicate; the control contained distilled water in place of template DNA.

4. PCR

PCR was performed to compare the detection limit of the LAMP method using two kinds of primer sets. The two outer primers of LAMP (F3 and B3) were used for PCR.

The specific primers for P. irregulare, PirF1’ (GTTGTTAGTAGTGTGTGTRGCA) and

PirR3 (GATCAACCCGGAGTATACAAAAC), slightly modified versions of the primers developed by Spies et al. (2011b), were also used in this comparison.

The PCR mixture (25 µl total volume) contained 1× PCR buffer (10 mM, pH 8.3 Tris-

HCl, 50 mM KCl and 1.5 mM MgCl2), 0.2 mM dNTPs, 0.2 µM of each primer, 0.4 mg bovine serum albumin (Sigma-Aldrich, Tokyo, Japan) 2 unit FastStart Taq DNA polymerase (Roche Applied Science, Tokyo, Japan), and template DNA. The amplification was performed using a Gene Amp PCR system 2700 thermal cycler (ABI,

Tokyo, Japan) with the following conditions: denaturation at 95°C for 5 min, and 35 cycles of denaturation at 95°C for 30 s, annealing at 65°C for 30 s, and extension at 72°C for 20 s, followed by a final extension at 72°C for 10 min. The amplification products were separated on a 3% agarose gel and stained with GelRed, and photographed under

UV light. Each experiment was repeated three times.

5. Detection of P. irregulare from medium

Three isolates of P. irregulare and two isolates of genetically related species (P. mamillatum and P. paroecandrum) were tested using the LAMP reaction. The isolates were inoculated into the central region of a petri dish with Pythium selective medium consisting of nystatin, ampicillin, rifampicin and miconazole (NARM) in cornmeal agar medium (Morita et al. 2007) and cultured at 25°C for 1 day. For each inoculation, about

0.1 cm3 medium containing mycelia was excised and placed in a 1.5 mL conical tube with

100 µl distilled water, and the tube was placed on a mixer (MT-360 Multi-tube Fast Mixer,

Tomy Seiko Co. Ltd., Japan) for 1 min. The supernatant in the water suspension was used as the template DNA for the LAMP assay.

6. Detection of P. irregulare from plant and soil

Root samples from infected plants were collected from greenhouses in Gifu and

Fukushima prefectures, Japan. Three methods were used for detection of P. irregulare:

“Plant-LAMP”: for each infected plant, 5× 1 cm root sections were cut and placed into

1.5 mL conical tubes with 1 mL distilled water and after 1 min of rapid mixing, 4.5 µl of the supernatant was directly used in a LAMP assay.

“Plant culture-LAMP”: 5× 1 cm root segments were placed on NARM medium at 25°C for 1 day. Then, as for detection from medium, 1 µl of the supernatant from a mixed suspension of medium containing mycelia plus distilled water was used for a LAMP assay.

“Plant culture”: to confirm the utility of Plant-LAMP and Plant culture-LAMP for detection of P. irregulare, mycelia were transferred to a slant for identification by morphological characteristics.

Soils were collected from pots with infected plants from greenhouses in Gifu,

Yamanashi and Yamagata prefectures, Japan. Three detection methods were used:

“Bait-LAMP”: 50 g of each soil sample was added to 800 mL distilled water; a permeable envelope containing 50 autoclaved perilla seeds was placed in the soil suspension and incubated at 25°C for 1 week. The seeds were then taken out and placed in a 10 mL conical tube with 5 mL distilled water. After rapid mixing, 4.5 µl of the supernatant was used for a LAMP assay.

“Bait culture-LAMP”: the seeds from each sample were placed on NARM medium at

25°C for 1 day. Then, according to the method of detection from medium, about 0.1 cm3 medium containing mycelia was used for a LAMP assay.

“Bait culture”: to confirm the utility of Bait-LAMP and Bait culture-LAMP, mycelia were transferred to a slant for identification by morphological characteristics.

RESULTS

1. Primer design and specificity

At first, 43 primer sets were designed using the LAMP primer design software. To check the specificity of the primer sets, the LAMP reaction used 100 pg genomic DNA templates from an isolate of P. irregulare (GF722) or from 9 genetically related Pythium isolates from phylogenetic clade F, namely P. irregulare III, P. irregulare IV, P. mamillatum, P. paroecandrum, P. spinosum, P. sylvaticum, P. internmedium, P. macrosproum (strain +), and P. macrosporum (strain -); the reaction was performed at

65°C. Finally, one primer set was selected as the specific LAMP primer set for P. irregulare. However, the selected primer set was not stable or sensitive; we therefore modified the primers and two new primer sets were designed. The LAMP reactions were performed by these new primer sets at 63°C, 64.5°C, 66°C and 67.5°C for 60 min.

Because the higher temperature increased the specificity of the reaction (Sung et al. 2009;

Takahashi et al. 2014). Finally, one primer set, F3 (5’-CGTTTCTTCCTTCCGTGTAGT-

3’), B3 (5’-ACCGCGAATCGAGGTCC-3’), FIP (5’-

GCAATCATTGCAAACAACTAACTCC-GGTGGAGGAGAGTTGCAGAT-3’), and

BIP (5’-TCTTTTTTGTATGTGCGCGGTGC-TCACCGAAGTCGCCGAC-3’) was selected and the optimal reaction temperature was found to be 67.5°C (Fig. 1-2).

To confirm specificity of LAMP for P. irregulare detection, we analyzed a broad range of oomycetes and fungi, namely, 50 isolates of 40 Pythium species (including 6 isolates of P. irregulare), 11 Phytophthora isolates and 8 isolates of 7 other soil-borne pathogens.

Only P. irregulare isolates showed amplification (Table 1-1); the 6 P. irregulare isolates were all detected after 24 min (data not shown). The amplification was detected by a color change from violet to sky blue (data not shown).

2. Sensitivity of LAMP

A series of 10-fold dilutions of P. irregulare (GF722) genomic DNA was used to determine the sensitivity of the LAMP assay under optimized conditions. As shown in

Fig. 1-3a, the detection limit was 100 fg. The amplification was confirmed by running the products on an agarose gel (Fig. 1-3b). The same DNA concentration series was used to examine the sensitivity of PCR. The detection limit of conventional PCR using the F3 and B3 primer set was 100 fg (Fig. 1-3c), but was 1 pg using the PirF1’ and PirR3 primer set (Fig. 1-3d). Thus, in this study, the LAMP assay had a similar sensitivity as the PCR assay.

3. Practical detection of P. irregulare in field samples

To assess the ability to accurately detect P. irregulare under practical conditions, we examined the three dependable, simple and time-saving LAMP methods.

A suspension produced by mixing medium containing mycelia of P. irregulare or the genetically related species (P. mamillatum and P. paroecandrum) separately with water was used directly to perform the LAMP reaction. Only P. irregulare produced a positive result (data not shown).

Twenty-eight infected plant samples were collected from four locations; the sampled plants included geraniums, cyclamens and Eustoma exaltatum (Table 1-2). Using the

Plant-LAMP method, 11 samples gave a positive result; 14 samples (including the 11 previously mentioned samples) gave a positive result with Plant culture-LAMP.

Microscopic examination of the morphologies of the 14 isolates showed they were P. irregulare.

Twenty soil samples from four locations were collected and 8 samples gave a positive reaction using Bait-LAMP (Table 1-3). Thirteen samples (including these 8 samples) gave

18 a positive reaction with Bait culture-LAMP. These 13 isolates were confirmed as P. irregulare.

Fig. 1-1. Design of LAMP primers specific for Pythium irregulare based on ITS sequences. (a) Schematic representation of LAMP-amplified regions. (b) Nucleotide sequence alignment of ITS sequences from P. irregulare and closely related isolates.

Partial sequences of ITS and the location of four LAMP primers (F3, B3, FIP (F1c-F2),

BIP (B1c-B2) were showed. Arrows indicate the direction of extension. The three boxed bases in F1c were modified to other bases (see Results and Discussion).

0.7 (a) p. irregulare GF 722 0.6 P. irregulare III 0.5 P. irregulare IV P. mamillatum 0.4 P. paroecandrum P. spinosum 0.3 P. sylvaticum P. internmedium 0.2 P. ｍacrosproum (+) Turbidty 0.1 P. macrosporum (-) Blank 0 -0.1 0 10 20 30 40 50 60 Time(min)

0.7 (b) p. irregulare GF 722 0.6 P. irregulare III 0.5 P. irregulare IV P. mamillatum 0.4 P. paroecandrum P. spinosum 0.3 P. sylvaticum P. internmedium 0.2 P. ｍacrosproum (+) Turbidty 0.1 P. macrosporum (-) Blank 0 -0.1 0 10 20 30 40 50 60 Time(min) 0.7 (c) p. irregulare GF 722 0.6 P. irregulare III 0.5 P. irregulare IV P. mamillatum 0.4 P. paroecandrum P. spinosum 0.3 P. sylvaticum P. internmedium 0.2 P. ｍacrosproum (+)

Turbidty 0.1 P. macrosporum (-) Blank 0 -0.1 0 10 20 30 40 50 60 Time(min) 0.7 (d) p. irregulare GF 722 0.6 P. irregulare III 0.5 P. irregulare IV P. mamillatum 0.4 P. paroecandrum P. spinosum 0.3 P. sylvaticum P. internmedium 0.2 P. ｍacrosproum (+) Turbidty 0.1 P. macrosporum (-) Blank 0 -0.1 0 10 20 30 40 50 60 Time(min)

Fig. 1-2. Specificity of the LAMP reaction at different temperatures (a) 63°C, (b) 64.5°C,

Fig. 1-3. Comparison of the relative sensitivities of LAMP and PCR using two different primer sets. Genomic DNA from Pythium irregulare (GF722) was serially diluted from 1 ng to 1 fg. The LAMP reaction was monitored by measurement of turbidity (a) and confirmed by agarose gel electrophoresis (b). PCR was performed using the primer pair

F3 and B3 (c) and PirF1’ and PirR3 (d), and the amplification products were detected by gel electrophoresis. M: 100 bp DNA ladder.

Table 1-1. List of 50 isolates of 40 Pythium species, 11 Phytophthora isolates and 8 isolates of 7 other soil-borne pathogens used here and primer specificity.

Species Clade* Isolate Origin Detection

Pythium adhaerens A CBS 520.74 Soil - P. aphanidermatum A GUGC0354 Carrot field soil -

P. monospermum A CBS111349 Flooded soil - P. arrhenomanes B1 NBRC100102 Zoysia grass - P. graminicola B1 MAFF425415 Corn -

P. myriotylum B1 NBRC100113 Kidney bean - P. plurisporium B1 CBS 100530 Root - P. sulcatum B1 NBRC100117 Carrot -

P. torulosum B1 GUCC0422 Carrot - P. aquatile B2 NBRC107450 Water - P. dissotocum B2 MAFF305576 Soil -

P. pyrilobum B2 NBRC107365 Water - P. acanthicum D MAFF241099 Soil - P. periplocum D NBRC100114 Zoysia grass -

P. oligandrum D GUCC0830 Soil - P. hypogynum E1 CBS 234.94 Soil - P. rostratum E1 NBRC100115 Zoysia grass -

P. middletonii E2 CBS 528.74 Soil - P. parvum E2 GUCC0832 Soil - P. takayamanum E2 NBRC104223 Soil -

P. irregulare F EP-2 Carrot + S15 Linaria + CBS 263.30 Nicotiana tabacum +

GF722 Geranium + YNCY12-1 Cyclamen + YNCY13-1 Cyclamen +

P. irregulare Ⅲ F PY26 Sugarbeet - P. irregulare Ⅳ F PY61 Sugarbeet - P. mamillatum F CBS 251.28 Beta vulagaris -

P. paroecandrum F CBS 157.64 Soil - P. spinosum F NBRC100116 Carrot field soil - P. sylvaticum F NBRC100119 Carrot field soil -

P. intermedium F CBS 221.68 Soil - P. macrosproum （strain +） F CBS 574.80 Root of flower bulb - P. macrosporum （strain -） F CBS 575.80 Lilium -

P. nagaii G GUCC0828 Soil - P. paddicum G MAFF241108 Water -

Table 1-1. Continued

Species Clade* Isolate Origin Detection

P. anandrum H CBS 285.31 Rheum rhaponitium - P. senticosum H NBRC104222 Soil - P. undulatum H NBRC107363 Water - P. heterothallicum I GUCC0137 Soil - P. splendes I C101 Anigozanthus - P. ultimum I NBRC100122 Sugar beet - P. nunn J CBS 808.96 Soil - P. polymastum J CBS 811.70 Lettuce - P. chamaehyphon K CBS 259.30 Papaya - P. helicoides K NBRC100107 Rose - P. oedochilum K GUCC0829 Yacon - P. ostracodes K CBS 768.73 Soil - P. vexans K 2D111 Soil -

Phytophthora nicotiane 1 GF101 Kalanchoe - Ph. citricola 2 C94 Eustomagrandiflorum - Ph. capsid 2 IFO30696 Cucurbita - Ph. nemorosa 3 C71 Sarcandraglabra - Ph. palmivora 4 P0113 Papaya - Ph. heveae 5 P1102 Avocado - Ph. humicola 6 P3826 Soil, citrus orchard - Ph. cambivora 7 P6358 Almond - Ph. cryptogea 8 CH95PHE26 Eustomagrandiflorum - Ph. insolita 9 P6195 Soil in citrus orchard - Ph. chrysanthemi 10 GUCC5527 Chrysanthemum -

Aphanomyces ssp. GFHT2 - Fusarium oxysporum MAFF72510 Strawberry - Plasmodiophora brassicae HY Chinese cabbage - Plasmodiophora brassicae AH - Rhizoctonia solani SO1 Bacopa - Saprolegnia sp. IFO32708 Brown trout - Vertivillium alboatrum Vaal Potato - Scierotinia sclerotiorum AiTog Wax gourd - *Molecular phylogenetic clades for Pythium and Phytophthora were obtained from

Lévesque and de Cock (2004) and Blair et al. (2008), respectively.

Table 1-2. Detection of Pythium irregulare from plants using LAMP assay

Number Plant culture c Location and plant Plant-LAMP a Plant culture-LAMP b of plants (P. irregulare)

Gifu Prefecture 1

Geranium 6 1 2 2

Cyclamen 2 0 0 0

Gifu Prefecture 2

Geranium 18 8 10 10

Gifu Prefecture 3

Geranium 1 1 1 1

Fukushima Prefecture

Eustoma exaltatum 1 1 1 1

Total 28 11 14 14 a For each infected plant, 1 cm root sections were cut and placed into a conical tube with distilled water. The supernatant of the water suspension was used in the LAMP test. b Root segments of each sample were placed on NARM medium for 1 day. The supernatant of a water suspension containing medium plus mycelia was used for LAMP. c To confirm validity of the Plant culture-LAMP and Plant-LAMP results, the same mycelia were transferred to a slant for morphological identification.

Table 1-3. Detection of Pythium irregulare from soil using LAMP assay

Number of Bait culture c Location Bait-LAMP a Bait culture-LAMP b soil samples (P. irregulare)

Gifu Prefecture 1

Geranium d 6 2 2 2

Cyclamen d 2 0 0 0

Gifu Prefecture 2

Geranium d 8 4 8 8

Yamanashi Prefecture

Cyclamen d 2 1 1 1

Yamagata Prefecture

Eustoma exaltatum e 2 1 2 2

Total 20 8 13 13 a For each soil sample, autoclaved perilla seeds in a permeable envelope were incubated in the soil and distilled water suspension for 1 week. The supernatant was used in a LAMP test. b All the seeds of each sample were placed on NARM medium for 1 day. Then about 0.1 cm3 medium containing mycelia was used for LAMP. c To confirm the results of the Bait culture-LAMP and Bait-LAMP, the same mycelia were transferred to a slant for an morphological identification. d The pot soil was collected for the sample. e The field soil was collected for the sample.

DISCUSSION

The LAMP primers were designed from ITS region, and firstly screened by testing with

9 genetically related Pythium isolates. Then the primers that had basic specificity were further modified if necessary, and confirmed the specificity using totally 50 isolates of 40

Pythium species, 11 Phytophthora isolates, and 8 isolates of 7 other soil-borne pathogens.

In this study, three bases in F1c were modified and changed to others that differed from all kinds of genetically related species, also including the target species of P. irregulare.

This primer modification leaded to a relative lower sensitivity than the original ones.

However, a significant improvement of specificity was observed. Also, loop primers were attempt to design to accelerate reaction speeds, but we found here that they inhibited specificity of the LAMP amplification. Loop primers were therefore not used.

Temperature is an important factor in LAMP assay with its influence of the specificity and sensitivity. Variety of temperature were used to the specificity test of Py. irregulare.

A non-specificity amplification of Py. mamillatum occurred at reaction temperature of

63℃. Based on higher reaction temperatures decreasing nonspecific primer annealing, and a requirement of detection limit, 67.5 °C was chosen as the optimal reaction temperature with high sensitivity of 100 fg.

Without purified DNA extraction, a series of supernatant liquid in mixture of distilled water and culture medium, mixture of distilled water and plant roots, and mixture of distilled water and perilla seeds, were used as template DNA in LMAP method for the detection of the pathogen in medium, plant and soil samples, respectively. The results showed that the P. irregulare could be detected with high precision. Thus, the LAMP assay can be used for a complex mixture, as well as for solutions containing pure DNA, and was an accurate method for practical detection of P. irregulare.

The detection sensitivity of Plant/Bait culture-LAMP was higher than Plant/Bait-

LAMP. However, although the latter had lower sensitivity, Plant/Bait-LAMP was nevertheless found to be suitable for detection of P. irregulare due to its simplicity and rapidity. The Plant/Bait culture-LAMP could be of value when high reliability is particularly essential. The lower sensitivity of Plant/Bait-LAMP might be the result of a lower concentration of template DNA in the water suspension of the roots and bait materials. Fourteen representative plant samples, including 11 and 3 samples showing positive and negative reaction using Plant-LAMP or Plant culture-LAMP, respectively, were used to compare with the PCR reaction with the F3 and B3 primer set. Only four samples gave a positive reaction in the PCR (data not shown). The negative result of PCR would be due to the less tolerant to various components in the symptomatic plant than

LAMP assay (Kaneko et al. 2007; Fukuta et al. 2003; Takahashi et al. 2014).

In this study, a LAMP primer set for detection of P. irregulare with a specificity and sensitivity of 100 fg were designed. The LAMP assay had similar sensitivity to PCR, and a crude DNA template was sufficient to detect P. irregulare in roots and soils. Plant/Bait-

LAMP and Plant/Bait culture-LAMP were established and demonstrated to be reliable for diagnosis of pathogen in the field.

CHAPTER 2

Use of LAMP detection to identify potential contamination sources of plant-pathogenic Pythium species in hydroponic culture systems of tomato and eustoma

In Japan, the hydroponic culture systems with D-tray and nutrient film technique (NFT) has been applied for cultivation of some horticulture crops and ornamental plants.

However, the diseases caused by oomycetes usually occurred in the culture system, and it is difficult to control the diseases just based on the heat sterilization measures. The objectives of this study were to use the LAMP method to detect P. aphanidermatum in the tomato D-tray culture system and P. irregulare in the eustoma hydroponic culture system, and to identify potential contamination sources of these two pathogens. These studies will contribute to the development of more effective control strategies.

MATERIALS AND METHODS

1. Greenhouses for tomato cultivation.

Three greenhouses (A to C) were established in Shizuoka Prefecture to use the D-tray cultivation system. These greenhouses occupied an area of 4,000 square meters, which also included a seedling terrace for the axenic cultivation of seedlings (Fig. 2-1a). The planting density was approximately 3.6 to 5.4 plants/m2. During a one-year period, three cultivation cycles were carried out, each involving the stages of transplanting, harvesting, cleaning, and heat sterilization treatment. The timing of these cycles varied between greenhouses, and Greenhouse C was divided into separate east and west sections in which the timing differed. Seedlings were cultivated for two to three weeks on the seedling terrace in a pearlite and peat moss-based potting mix irrigated with the nutrient solution, then transplanted into D-trays with a peat moss-based potting mix. A small amount of nutrient solution (30 ml to 60 ml) was dripped into the D-trays every day, and the discharged solution was collected and re-circulated. The heat-treated nutrient solution and cultivation equipment were replaced before each new planting.

2. Greenhouses for eustoma cultivation.

Three greenhouses (1 to 3) were set up for eustoma cultivation using the NFT in

Fukushima Prefecture. Each greenhouse contained six cultivation blocks. The greenhouses occupied an area of 4,050 square meters, which also included a seedling terrace (Fig. 2-1b). Using the NFT, 2.5 cropping cycles per year were achieved that included the processes of transplanting, harvesting, cleaning, and heat sterilization. In this production system, the nutrient solution was re-circulated past the bare plant roots in a watertight gully. The nutrient solution and heat-treated cultivation equipment were

30 replaced between cropping cycles. Seedlings were cultivated on the seedling terrace in a peat moss-based potting mix irrigated with the nutrient solution.

3. Collection of nutrient solution, root and soil samples.

In the tomato greenhouses, nutrient solution samples were collected from the drainage recovery tanks before heat sterilization in the greenhouses and the seedling terrace every two weeks from March 2013 to March 2014. At the same time, we also collected water samples from the water supply well. In the eustoma greenhouses, the nutrient solution samples were collected from the drainage recovery tanks of each block and the seedling terrace before heat sterilization every month from March 2015 to February 2017. During the same monitoring periods in all greenhouses, diseased plants were identified by their symptoms of wilting and root discoloration. Root samples were collected from the diseased plants before the plants were discarded. In addition, from December 19, 2016 eustoma roots were collected together with nutrient solutions every month, even if no disease occurred. Soil samples (200 g) were collected from various locations both inside and outside the greenhouses, including the seedling terraces, from the refuse discard areas, and from the waste water outlet areas of both greenhouse complexes. (Fig 2-1). The soil samples were collected once, in March 2013, at the tomato greenhouses and five times at the eustoma greenhouses, from March 2015 to February 2017.

4. Primer sets and LAMP reaction.

We used specific LAMP primer sets that had been designed for P. aphanidermatum and

P. irregulare by Fukuta et al. (2013) and Feng et al. (2015), respectively (Table 2-1). The

LAMP reactions were carried out in total volumes of 15 μl for detection of P. irregulare and 25 μl for detection of P. aphanidermatum. Each contained 1.6 μM of each FIP and

BIP primer, 0.2 μM of each F3 and B3 primer, 0.8 μM of each F-loop and B-loop primer

(P. aphanidermatum only), 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 0.1% (v/v) Tween20,

0.8 M betaine (Sigma-Aldrich), 8 mM MgSO4, 10 mM (NH4)2SO4, 1.4 mM dNTPs (New

England Biolabs Japan, Tokyo, Japan), 4.8 units of the Bst DNA polymerase large fragment (Nippon Gene Co. Ltd, Toyama, Japan) and template DNA (100 pg for specificity test). The mixtures were incubated for 60 min at 67.5°C for P. irregulare and

68°C for P. aphanidermatum. Real-time changes in turbidity were recorded using a loopamp real-time turbidimeter (LA-200, Teramecs, Kyoto, Japan). The LAMP reactions were carried out in triplicate and controls contained positive DNA or distilled water in place of template DNA.

5. Detection of zoospores in nutrient solutions.

We used a membrane filter technique named Membrane culture-LAMP (MC-LAMP) to detect pathogens in the nutrient solutions. Each nutrient solution sample of 4 liter was filtered through a 5-μm-pore-size Durapore® membrane (Millipore, Billerica, MA, USA) to collect the pathogen spores (Hong et al. 2002). The membrane was then placed on a

Pythium selective medium containing nystatin, ampicillin, rifampicin, and miconazole

(NARM) in a cornmeal agar medium (Morita and Tojo 2007) and cultured at 25°C for one day to encourage mycelial growth. About 0.1 cm3 of the medium containing mycelia was then excised and placed in a 1.5 mL tube with 100 μl distilled water, and the tube was vortexed for 1 min using an MT-360 Multi-tube Fast Mixer (Tomy Seiko Co. Ltd,

Japan). The supernatant liquid (1 μl) was used directly as the template DNA in LAMP assays.

6. Detection of pathogens in roots.

The Plant culture-LAMP method developed by Feng et al. (2015) was used to detect pathogens in plant tissues. Root samples from diseased tomato and eustoma plants were collected, and rotted or brown 1 cm segments (five per sample) were placed on NARM medium and incubated at 25°C for one day. The samples were then analyzed as described above for zoospores in the nutrient solutions.

7. Detection of pathogens in soil samples.

The Bait culture-LAMP method was used to detect pathogens in the soil samples (Feng et al. 2015). Two hundred grams of each soil sample were mixed thoroughly to generate a homogenous sample. Fifty grams of each homogenous soil sample were mixed with

800 mL distilled water. A permeable envelope containing 50 autoclaved perilla seeds was added, and the mixture was incubated at 25°C for one week. The suspensions were shaken thoroughly every day. The seeds were then removed, washed under tap water, and placed on NARM medium and incubated at 25°C for one day. These samples were then analyzed by LAMP as described above.

RESULTS

1. Detection of P. aphanidermatum in tomato cultivation.

In order to identify the potential contamination sources of P. aphanidermatum in tomatoes grown under the D-tray hydroponic culture system, we used the LAMP method to monitor the presence of P. aphanidermatum zoospores in the water supply well and the nutrient drainage recovery tanks at the greenhouse complex in Shizuoka Prefecture, from

March 2013 to March 2014. We also monitored the presence of the pathogen in diseased plants and in ground soils at various sites throughout the complex.

Seven out of 13 sites throughout the greenhouse complex, where soil was sampled and tested by Bait culture-LAMP in March 2013, were contaminated with the pathogen (see the filled circles in Fig. 2-1a). These seven sites included just inside the entrance of greenhouse B, inside and outside the entrance of greenhouse C-west, the storage area for discarded rockwool, the waste water outlet area, and the front of the seedling terrace (Fig.

2-1a).

Twice per month, samples were taken from the water supply tank and the nutrient drainage recovery tanks in the greenhouses and the seedling terrace. Using the MC-

LAMP technique, we detected P. aphanidermatum zoospores in the seedling terrace nutrient supply only once, on July 19, 2013, and no zoospores were detected in the supply water during the study period (data not shown). On the other hand, P. aphanidermatum zoospores were frequently detected in the drainage recovery tanks of all four greenhouse areas throughout the study period (Table 2-2).

During the same study period, disease symptoms were observed four times in greenhouse A and twice in greenhouse C-east, but did not occur in greenhouses B or C- west (Table 2-2). All of the diseased tomato roots gave positive results for P.

34 aphanidermatum in the Plant culture-LAMP assays.

2. Detection of P. irregulare in eustoma cultivation.

We conducted a similar experiment at a greenhouse complex in Fukushima Prefecture where eustoma is cultivated under the NFT culture system. The LAMP method was used to monitor P. irregulare in the water supply well, seedling terrace, and each greenhouse from March 2015 to February 2017. Diseased plants and ground soils were monitored during the same period.

The soil samples collected from a total of nine out of 18 sites gave positive results with the Bait culture-LAMP method during the monitoring period (Fig. 2-1b). These nine sampling sites included surrounding farmlands, the discard area for plant residues, and the front of the seedling terrace.

Samples were collected once per month from the water supply well and the nutrient drainage recovery tanks of the seedling terrace and the 18 cultivation blocks (six per greenhouse). During the two-year monitoring period, P. irregulare was not detected by

MC-LAMP in either the water supply well or the seedling terrace (data not shown).

During the same period, the number of blocks where P. irregulare zoospores were detected in the drainage recovery tanks ranged from 0 to 4 blocks (Fig. 2-2). The zoospores were detected 14 times during the first year (March 2015 to February 2016) and 32 times during the second year (Fig. 2-2). Tables 2-3 and 2-4 show data for all 14 blocks where P. irregulare zoospores were detected in the nutrient supply at least once during the monitoring period. Included in the table are the dates for the cropping cycles in each block, the dates when P. irregulare was detected in the nutrient supplies, the dates when disease was detected, and the growth stages of the diseased plants. In 5 of the 16 blocks, the pathogen was detected in two successive cropping cycles. As shown in Fig.

2-3, a total of 22 transplantations were carried out during the two-year study period.

Pythium irregulare was detected in at least one block on 13 of these transplantations. The pathogen was detected in multiple blocks on six of the transplantations (Fig. 2-3).

Disease occurred five times in greenhouse 1 and five times in greenhouse 3 during the study period. Of these ten incidences, the disease occurred at the early growth stage of eustoma in two cases, the middle growth stage in one case, and the late growth stage in seven cases (Table 2-3, Table 2-4). The diseased plant roots were collected, and P. irregulare was detected in all of the roots. The time between detection of zoospores in the nutrient solution and detection of disease was usually one or two months when the disease occurred at a middle or late growth stage (Table 2-3).

From mid-December 2016 until the end of the study period (February 2017) the eustoma plant roots were sampled every month at the same time as the nutrient solutions.

Pythium irregulare was detected in plant roots in three blocks in December 2016, seven blocks in January 2017, and three blocks in February 2017. The zoospores were detected in the nutrient solutions in three blocks in December 2016, four blocks in January 2017, and three blocks in February 2017. The pathogen was detected in healthy roots in five blocks, but in two of those blocks the wilting disease occurred later (Table 2-4).

)LJ $UUDQJHPHQW RI JUHHQKRXVHV DQG VHHGOLQJ WHUUDFHV LQ D WRPDWR JUHHQKRXVH

FRPSOH[ D DQGHXVWRPDJUHHQKRXVHFRPSOH[ E 6RLOVDPSOHVZHUHFROOHFWHGIURPVLWHV

LQGLFDWHGE\FLUFOHV6LWHVZKHUHSDWKRJHQV 3DSKDQLGHUPDWXPIRU D DQG3LUUHJXODUH

IRU E ZHUHGHWHFWHGDUHLQGLFDWHGE\ILOOHGFLUFOHV Ɣ 7KHHXVWRPDJUHHQKRXVHFRPSOH[

LQFOXGHGDJUDVVILHOGDQGYHJHWDEOHFXOWLYDWLRQJURXQGERWKRIZKLFKKDG3LUUHJXODUH

GHWHFWHGLQ0DUFK7RSUHYHQWWKHSDWKRJHQIURPLQYDGLQJWKHK\GURSRQLFV\VWHP

DSURWHFWLYHVKHHWZDVXVHGWRFRYHUWKHDUHDLQFOXGLQJWKHFXOWLYDWHGJURXQG

Number of detected blocks Number 0 Jul-15 Jul-16 Jan-16 Jan-17 Jun-15 Jun-16 Oct-15 Oct-16 Sep-15 Feb-16 Sep-16 Feb-17 Apr-15 Apr-16 Dec-15 Dec-16 Mar-15 Mar-16 Aug-15 Nov-15 Aug-16 Nov-16 May-15 May-16 Nutrient solution sampling date

Fig. 2-2. Numbers of blocks in the eustoma greenhouses where P. irregulare was detected in the nutrient solution each month of the study period.

8 Number of transplanted blocks 7 Number of detected blocks within the recovery tank of the nutrient solution

2 Number blocks of Number 1

0 Jul-15 Jul-16 Jan-15 Jan-16 Jan-17 Jun-15 Jun-16 Oct-15 Oct-16 Feb-15 Sep-15 Feb-16 Sep-16 Feb-17 Apr-15 Apr-16 Dec-14 Dec-15 Dec-16 Mar-15 Mar-16 Nov-14 Aug-15 Nov-15 Aug-16 Nov-16 May-15 May-16 Transplanting period

Fig. 2-3. The numbers of blocks that were transplanted each month in the eustoma

greenhouses and the numbers of blocks that became infested with P. irregulare.

Table 2-1. LAMP primer sets of Pythium aphanidermatuma and P. irregulareb used in this study

Region Target species Primers Sequences (5’→3’) amplified

F3 GCGACTTCGGTTAGGACATT

FIP ACCACACTCTGTCAGCTGCAAC-

GAAGCAACCTCTATTGGCGG

B3 TGCCTCCTTTACCCTATCCG P. aphanidermatum ITS BIP TTGTGTGAGGCAATGGTCTGG-

GTCCAAGAGCAGCAAAACC

F-Loop CGGGCCGAAGCCTAACAT

B-Loop GGTTGCTGTGTAGTAGGG

F3 CGTTTCTTCCTTCCGTGTAGT

FIP GCAATCATTGCAAACAACTAACTC

C-GGTGGAGGAGAGTTGCAGAT P. irregulare ITS B3 ACCGCGAATCGAGGTCC

BIP TCTTTTTTGTATGTGCGCGGTGC-

TCACCGAAGTCGCCGAC

a LAMP primer set of P. aphanidermatum was designed by Fukuta et al. (2013). b LAMP primer set of P. irregulare was designed by Feng et al. (2015).

Table 2-2. Monitoring of Pythium aphanidermatum and disease occurrence in tomato cultivation from March 2013 to March 2014a

2013 2014 GH 3/6 4/9 4/23 5/7 5/21 6/3 6/18 7/4 7/19 7/30 8/13 8/27 9/10 9/24 10/8 10/26 11/9 11/23 12/12 1/4 1/19 2/1 2/15 3/1 3/15 Detection + NT +++-+++++--+-+++ + +-+++- A Disease - NT +------+-+----+------Detection+++++ - -++ + + + - + - + + + + +++ -++ B Disease ------Detection+-+-+++++ + + - - + + + + + + +++- - - Ce Disease -----++------Detection+-+++++++ + + + - + - + + + + + -+ - -+ Cw Disease ------a Symbols: + = P. aphanidermatum was detected or disease occurred; - = P. aphanidermatum was not detected or no disease occurred; NT = no test; GH = Greenhouse; Ce = greenhouse C east; Cw = greenhouse C west. Cropping cycles in each block are distinguished by alternating gray and white backgrounds.

Table 2-3. Monitoring of Pythium irregulare and disease occurrence in eustoma cultivation from March 2015 to November 2016a GH and 2015 2016 Block Mar Apr May Jun Jul Aug Sep Oct Nov Dec Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov 1-1 Detection - NT ------NT - NT - - - Disease - NT ------NT - NT - - - 1-2 Detection NT ------+ NT - - - + Disease NT ------NT - - - - 1-3 Detection NT + ------+ + + NT NT NT - + + 1 Disease NT + (L) ------+ (L) NT NT NT - - + (L) 1-4 Detection NT ------NT - - - - NT - NT - + + + Disease NT ------NT - - - - NT - NT - - - - 1-5 Detection NT NT ------NT - - - Disease NT NT ------NT - - - 1-6 Detection ------Disease ------2-1 Detection NT ------NT - - - - - Disease NT ------NT - - - - - 2-2 Detection NT NT ------+ NT - Disease NT NT ------NT - 2-3 Detection NT NT ------+ + - - - + + 2 Disease NT NT ------2-4 Detection NT - + ------Disease NT ------2-5 Detection NT + + + ------Disease NT ------2-6 Detection - - - - + - - - - NT ------Disease ------NT ------3-1 Detection NT NT ------NT - - - NT - - Disease NT NT ------NT - - - NT - - 3-2 Detection NT ------+ + + - - - NT - - Disease NT ------+ (M) - - - - NT - - 3-3 Detection ------+ - - + - - NT - - 3 Disease ------NT - - 3-4 Detection NT + ------NT - - Disease NT ------NT - - 3-5 Detection NT ------NT - - - NT - - Disease NT ------NT - - - NT - - 3-6 Detection + + + + - - + + + - - - + + ------Disease - - + (L) - - - - + (L) ------a Symbols: + = P. irregulare was detected or disease occurred; - = P. irregulare was not detected or no disease occurred; NT = no test; (M) = Disease occurred at the middle growth stage; (L) = Disease occurred at the late growth stage; GH = Greenhouse. Cropping cycles in each block are distinguished by alternating gray and white backgro

Table 2-4. Comparison of detection of Pythium irregulare between nutrient solutions and roots from December 2016 to February 2017a

2016/12/19 2017/1/16 2017/2/13 GH and Transplanting Nutrient Nutrient Nutrient Block time Roots Roots Roots solutions solutions solutions 1-1 2016/12/19 - NT - + (E) - - 1-2 2016/12/15 - NT - - - - 1-3 2016/12/19 + NT - - - - 1 1-4 2016/12/15 - NT - - - - 1-5 2016/12/19 - NT - - - - 1-6 2016/12/15 - NT - + (E) - - 2-1 2016/11/7 - - + + + + 2-2 2016/11/7 - - + + + + 2-3 2016/11/7 + + + + + + 2 2-4 2016/11/7 ------2-5 2016/11/7 ------2-6 2016/11/7 ------2016/9/30 - - - - 3-1 2017/2/2 - - 2016/9/30 - + - + (L) 3-2 2017/2/2 - - 2016/9/30 - - - - 3-3 2017/2/7 - - 3 2016/9/30 + + - + (L) 3-4 2017/2/13 - - 2016/9/30 - - + - 3-5 2017/2/1 - - 2016/9/30 - - - - 3-6 2017/2/1 - - a Symbols: + = detected; - = no detection; NT = no test; (E) = Disease occurred at the

early growth stage; (L) = Disease occurred at the late growth stage; GH = Greenhouse.

DISCUSSION

In this study, the LAMP method was used to monitor zoosporic Pythium plant pathogens in greenhouses where tomatoes and eustoma plants were grown in hydroponic cultures. Pythium aphanidermatum was monitored in a greenhouse complex in Shizuoka

Prefecture, where tomatoes were grown under the D-tray cultivation system, and P. irregulare was monitored in greenhouses in Fukushima Prefecture, where eustoma was grown under the NFT culture system. We used specific and sensitive LAMP primer sets designed by Fukuta et al. (2013) for P. aphanidermatum and Feng et al. (2015) for P. irregulare. The NARM selective medium was used to culture the pathogens from nutrient solution filtrates, diseased plant roots, and perilla seeds that had been mixed with soil suspensions and incubated for one week. The mycelial outgrowth from the NARM medium was mixed with distilled water and used directly for LAMP detection. This simple detection process did not require the extraction and purification of DNA. Our results indicate that the LAMP method is effective for detecting P. aphanidermatum and

P. irregulare in greenhouses where plants are grown under hydroponic conditions.

Some researchers reported that water temperature, zoospore concentration, application pressure, etc. have effects on the occurrence of disease caused by zoosporic plant pathogens (Banko et al. 2006; Granke et al. 2010). In terms of complex environmental factors in a hydroponic culture system, it is difficult to describe a quantitative threshold of disease based on the number of the pathogenic zoospores. Li et al. (2014) used real- time PCR to monitor and quantify three Pythium species under hydroponic culture systems. They found no obvious correlations between disease occurrence and the concentrations of the pathogenic zoospores evaluated by real-time PCR. This suggests

44 that the simple and qualitative LAMP method is sufficient and reliable for monitoring and identifying the potential contamination sources of pathogens in hydroponic culture systems.

We monitored P. aphanidermatum in the water supply well and the seedling terrace at the tomato greenhouse complex and detected P. aphanidermatum once during the sampling period in the seedling terrace. This result indicated that there is a risk of introducing the pathogen to seedlings before transplanting. We frequently detected P. aphanidermatum zoospores in the nutrient solutions in the drainage recovery tanks in the greenhouses. However, the wilting disease of tomato occurred rarely over the monitoring period, it usually occurred during the early growth stage. The pathogen was detected in 8 out of 13 soil samples collected inside and outside the greenhouses and in front of the seedling terrace. These results indicated that (i) there was no obvious correlation between the detection of P. aphanidermatum and the occurrence of the disease, (ii) the heat sterilization of cultivation equipment and the replacement of heat-treated nutrient solutions between growth cycles may not be effective in completely removing the pathogens, and (iii) the possibility of introducing P. aphanidermatum from the surrounding soil into the greenhouses is very high, especially during the transplanting period.

Based on our brief identification of the potential contamination sources of P. aphanidermatum in tomato greenhouses, we implemented a two-year study in a eustoma greenhouse complex infested with P. irregulare. Pythium irregulare was detected in the nutrient solutions in several blocks during most months of the study period. The P. irregulare infestations were not restricted to specific blocks; almost all of the blocks were infested at least once during the two-year period. Also, wilting disease occurred multiple

45 times in two of the greenhouses, and the pathogen was detected in all diseased plants. Our results indicated that the infestation of P. irregulare had become established and became more serious in the second year of the study period. Therefore, heat sterilization of the equipment between growth cycles was not effective in eliminating the pathogen.

Pythium irregulare was detected in soil samples collected both inside and outside the eustoma greenhouses and in front of the seedling terrace. Samples taken near the entrances to the greenhouses were not always contaminated, suggesting that the pathogen was not brought into the greenhouses on the feet of greenhouse workers. On the other hand, P. irregulare was not detected in either the water supply well or seedling terrace over the sampling period, and detected in multiple blocks at the same transplanting periods. These results suggested that the most likely timing for the introduction of the pathogen to the seedlings and the culture blocks was when the seedlings were transplanted to the greenhouses, and that the pathogen most likely came from the soil. Furthermore, the relationship between the transplanting dates and the timing of detection suggest that the culture system may become infested regardless of the season, even though the optimum growth temperature of P. irregulare is 24 to 26°C, corresponding to the spring and autumn in Fukushima, Japan.

In theory, the detection limit of the pathogen is one zoospore per four liters of nutrient solution using MC-LAMP. Therefore, the pathogen might have been present in some blocks where it was not detected. This hypothesis could explain why P. irregulare was detected in some nutrient solutions several months after the disinfestation of the cultivation equipment. This result also demonstrates that the sterilization method may not be sufficient, especially at high degrees of infestation. If residues of infected roots remain in the culture panels, the panels will be difficult to sterilize and may lead to successive

46 infestations.

Eustoma disease occurred infrequently during the early growth stage and much more frequently at the late growth stage. At the flowering stage in particular, eustoma requires large amounts of water for photosynthesis, so damaged roots will lead to wilting. Pythium irregulare was detected in the nutrient solution in all blocks where the disease occurred.

Also, the pathogen was sometimes detected in healthy roots before the disease symptoms were visible. The vulnerability of the host plants and environmental factors favorable to the pathogen, such as temperature, will strongly influence disease occurrence. Therefore, a latency or low-grade infection period can occur between pathogen infestation and the occurrence of the disease. Moreover, in January 2017, four and seven blocks with a positive detection for nutrient solutions and roots, respectively, suggests that the detection sensitivity in roots is higher than nutrient solutions. These results indicate that monitoring the roots of symptomatic and asymptomatic plants are essential steps for early diagnosis of disease occurrence.

Based on the results of this study, we propose the following important strategies to prevent diseases in hydroponic culture systems. (i) The complete isolation of greenhouses from the surrounding soil is necessary. Trolleys used for transplanting seedlings and the shoes worn by workers need to be sterilized frequently. (ii) Once the pathogens are detected in the nutrient solutions, it is necessary to replace the nutrient solutions with sterilized water until zoospore cannot be detected after replacing the solutions. (iii) After harvest, a high-level sterilization process involving repeated heat sterilization of cultivation equipment two or more times is needed, especially in blocks where disease has occurred.

In conclusion, the periodic monitoring of pathogens in the culture systems and ground

47 soils is very important for the management and prevention of diseases in hydroponic greenhouses.

CHAPTER 3

LAMP detection of four plant pathogenic oomycetes and its application in lettuce fields

In Kagawa prefecture, Japan, there are huge losses every year in lettuce (Lactuca sativa) caused by various pathogens, and the pathogens already had been identified and reported, including Phytophthora pseudolactucae, Pythium irregulare, Py. uncinulatum and Py. spinosum. The objectives of this study were to develop simple LAMP detection methods for species-specific identification of the four pathogenic oomycetes. We used the

LAMP assays to investigate the main pathogen species in plants and soils and the infectious sites of the pathogens in lettuce cultivation fields.

MATERIALS AND METHODS

1. Maintenance of isolates and mycelial DNA extraction.

Isolates were collected from several scientific resource institutions, the CBS-KNAW

Fungal Biodiversity Centre (CBS), Utrecht, the Netherlands, the NITE Biological

Resource Center, Kisarazu, Chiba Prefecture, Japan (NBRC), the NIAS Genebank,

Tsukuba, Ibaraki Prefecture, Japan (MAFF), the World Phytophthora Genetic Resource

Collection, University of California, Riverside, CA, USA (P), and the Gifu University

Cultures Collection, Gifu Prefecture, Japan (Table 3-1, 3-2 and 3-3). All isolates were maintained on corn meal agar or potato-dextrose agar media at 20°C in the dark. Genomic

DNA was extracted from the mycelia using the PrepMan Ultra Reagent (Applied

Biosystems Inc., CA, USA) as described by Baten et al. (2014). DNA concentration was estimated using the Qubit® 2.0 Fluorometer (Life Technologies, CA, USA). DNA was diluted to 100 pg/μl as the starting concentration for all assays.

2. LAMP and PCR primer design.

We designed new LAMP and PCR primers targeted to the rDNA-ITS region for Py. spinosum and Py. uncinulatum and to the cox1 region for Ph. pseudolactucae. Multiple alignments were constructed using these sequences and the same sequences from other species using the BioEdit Sequence Alignment Editor software. Based on the aligned sequences, the LAMP and PCR primers specific for each pathogen were designed and analyzed using the PrimerExplorer V5 software (http://primerexplorer.jp) and

Primer3web (http://bioinfo.ut.ee/primer3/), respectively.

3. LAMP reaction.

Each LAMP reaction was carried out in a total volume of 15 μl containing 1.6 μM FIP and BIP primers, 0.2 μM F3 and B3 primers, 0.8 μM B-loop primer (Py. spinosum and

Ph. pseudolactucae), 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 0.1% (v/v) Tween20, 0.8

M betaine (Sigma-Aldrich) (or 1M betaine for Py. spinosum only), 8 mM MgSO4, 10 mM

(NH4)2SO4, 1.4 mM dNTPs (New England Biolabs Japan, Tokyo, Japan), 4.8 units of the

Bst DNA polymerase large fragment (Nippon Gene Co. Ltd, Toyama, Japan), and template DNA (100 pg for specificity test). The mixtures were incubated for 60 min at different temperatures of 63, 64, 65, 66 and 67.5°C. The turbidity was recorded in real time using a loopamp real-time turbidimeter (LA-200, Teramecs, Kyoto, Japan). Each reaction was carried out in triplicate, and controls contained positive DNA or sterile distilled water (SDW) in place of template DNA.

4. LAMP specificity and sensitivity test.

In total, 55 isolates of 45 Pythium species, 47 isolates of 44 Phytophthora species, 5

Phytopythium isolates, and 8 isolates of 7 other soil-borne oomycetes were used to test the specificity and sensitivity of each primer set (Table 3-1, Table 3-2). Series of 10-fold dilutions of Py. spinosum (NBRC100116), Py. uncinulatum (MAFF240295) and Ph. pseudolactucae (MAFF239556) genomic DNA were used to determine the sensitivity of the LAMP assay, with SDW as the negative control. The LAMP assay was carried out as previously described with the optimal LAMP primers and reaction parameters. The primers selected for use in field tests are listed in Table 3-4.

5. PCR reactions.

In total, 36 isolates of 26 Pythium species, 31 isolates of 28 Phytophthora species, 3

Phytopythium isolates, and 8 isolates of 7 other soil-borne oomycetes were used to test the specificity and sensitivity of each primer set (Table 3-4). Each PCR mixture (25 μl total volume) contained 1× PCR buffer (10 mM, pH 8.3 Tris-HCl, 50 mM KCl and 1.5 mM MgCl2), 0.2 mM dNTPs, 0.2 μM of each primer (0.5μM for Py. spinosum only), 0.4 mg bovine serum albumin (Sigma-Aldrich, Tokyo, Japan), 2 units FastStart Taq DNA polymerase (Roche Applied Science, Tokyo, Japan), and template DNA (100 pg for specificity test). The amplification was performed using a Gene Amp PCR system 2700 thermal cycler (ABI, Tokyo, Japan) with the following conditions: 95°C for 5 min, 35 cycles of 95°C for 30 s, 65°C for 30 s, and 72°C for 1 min, then 72°C for 10 min. The negative controls contained SDW instead of template. The amplification products were separated on a 3% agarose gel, stained with GelRed, and photographed under UV light.

Each experiment was repeated three times.

6. Field sample collection.

In February 2016, a total of eight roots and 12 pith samples were collected from randomly selected diseased lettuce plants in two lettuce cultivation fields (A and B) in

Kagawa Prefecture (Table 3-5 and Fig. 3-1). In December 2016, five diseased plants from each of three lettuce fields (1 to 3) in Kagawa Prefecture were each divided into pith, root base, and root tip samples (Table 3-5 and Fig. 3-1). Soil samples (c. 200 g) from around the same plants were also collected. In field 3 where plastic-film mulching was used, soil samples were collected from above and below the mulch.

7. Detection of pathogens in lettuce.

We used the Plant-LAMP (P-LAMP) and Plant Culture-LAMP (PC-LAMP) detection methods developed by Feng et al. (2015) to analyze the pathogens in lettuce tissues. For

P-LAMP, rotted or brown tissue samples were cut into 1 cm long (0.2 cm3) segments. The segments were placed into 1.5 ml tubes with 0.5 ml SDW, vortexed for 1 min using an

MT-360 Multi-tube Fast Mixer (Tomy Seiko Co. Ltd, Japan), and then 4.5 μl of the supernatant was used directly for LAMP amplification. For PC-LAMP, each cut segment was placed on NARM (nystatin+ampicillin+rifampicin+miconazole) medium (Morita and Tojo 2007) and incubated at 25°C for 1–5 days. A sample of the medium (about 0.1 cm3) containing mycelia was excised and placed in a 1.5 ml tube with 100 μl SDW, vortexed as described above, and then 1 μl of the supernatant was used for LAMP amplification.

8. Soil DNA extraction methods.

We compared five soil DNA extraction methods: (i) the Soil DNA Isolation kit (Norgen

Biotek Corp., Thorold, ON, Canada), (ii) the Extrop soil kit plus ver.2 kit (Nippon Steel and Sumikin Eco-Tech., Tsukuba, Ibaraki, Japan), (iii) the Mightyprep reagent for DNA kit (TaKaRa Bio., Kusatsu, Shiga, Japan), (iv) Kageyama + Mag method (Li et al. 2015) and (v) the Soil DNA Isolation mini kit (Favorgen Biotech Corp., Ping-Tung, Taiwan,

China) (Table 3-7). A soil sample (200 g) collected from a lettuce cultivation field was autoclaved at 120°C for 60 min. Phytophthora pseudolactucae were inoculated on 10 ml liquid V8 medium (2 ml V8 juice, 0.025 g CaCO3, and 8 ml distilled water) at 20°C for 1 to 2 weeks until mass formation of oospores. The oospores were separated from the mycelia using a homogenizer at 15000 rpm on SDW for 5 min (Nissei AM-3, Nihonseiki

Kaisha, Tokyo, Japan), collected using 50 μm and 27 μm stemless mesh sieve, and then

53 counted under a microscope with a hemocytometer. The soil sample was inoculated with

Ph. pseudolactucae oospores to a concentration of 33 oospores per gram of soil. After mixing thoroughly, 0.2 g samples were subjected to DNA extraction and then 4.5 μl of the extracted solution was used for LAMP assays. Each kit was tested twice (Extractions

1 and 2, Table 3-7). The Norgen Biotek Corp. kit was chosen for pathogen detection in the soil samples shown in Table 3-7.

RESULTS

1. Specificity of the LAMP assay.

A specific primer set targeted to the rDNA-ITS region was already available for Py. irregulare (Feng et al. 2015) (Table 3-4). We designed new primers targeted to the rDNA-

ITS region for Py. spinosum and Py. uncinulatum and to the cox1 region for Ph. pseudolactucae. Multiple alignments were constructed using these sequences and the same sequences from other species in the same phylogenetic clades, as proposed by

Lévesque and De Cock (2004) for Pythium and Blair et al. (2008) for Phytophthora. We designed a total of 41 primer sets for Py. spinosum, 12 sets for Py. uncinulatum, and 13 sets for Ph. pseudolactucae. These primers were tested using isolates from the same phylogenetic clades as the target species (see Tables 3-1 and 3-2). The primers that showed the greatest specificity (Psp, Pun, and Phps for Py. spinosum, Py. uncinulatum, and Ph. pseudolactucae, respectively) were further tested using a broad range of oomycetes, as shown in Tables 3-1 and 3-2. Psp, Pun, and Phps (see Table 3-4) were highly specific for their target species and were selected for field testing. We further optimized the LAMP reactions for these primer sets using temperature gradients from 63 to 67.5°C (Fig. 3-2). Considering the high specificity, reactivity and stability, optimal temperatures of 64°C, 66°C, and 66°C were selected for specific amplification of Ph. pseudolactucae, Py. spinosum, and Py. uncinulatum, respectively.

2. Sensitivity of the LAMP assay.

To assess the sensitivity of the LAMP assay, we designed specific PCR primers for each species (Table 3-4) and tested the specificity using a broad range of oomycetes, as

55 shown in Table 3-3. The PCR and LAMP primers were tested using serial dilutions of Py. spinosum, Py. uncinulatum, and Ph. pseudolactucae DNA samples. As shown in Fig. 3-

3, the LAMP primer sets had high sensitivities, comparable with those of the PCR primers.

In both the LAMP and PCR assays the detection limits were 10 fg, 100 fg, and 100 fg for

Py. spinosum, Py. uncinulatum, and Ph. pseudolactucae respectively.

3. Optimization of the procedures for LAMP detection in field samples.

To identify the most efficient plant LAMP procedure for use in the field, we collected

8 root and 12 pith samples from diseased lettuce plants in 2 fields (A and B) in Kagawa

Prefecture, and analyzed them using both the P-LAMP and PC-LAMP methods (Table 3-

5). Each of the four pathogens was detected in at least one sample. Pathogens were found in a total of 10 samples using P-LAMP and 11 samples using PC-LAMP. To confirm the detection, all isolates were recovered from the NARM media and identified by morphological characteristics. Therefore, similar numbers of positive results were obtained with each method. We concluded that P-LAMP is suitable for detection of pathogens in the field, due to its simplicity and rapidity.

To develop a simple method for the detection of pathogens in soil samples using the

LAMP assay, we compared five soil DNA extraction methods using soil samples containing Ph. pseudolactucae. We obtained positive results from both extractions with the Norgen Biotek Corp. Soil DNA Extraction kit and from one extraction with the

Toyobo Co. MagExtractor-Plant Genome kit (Table 3-7). The Norgen Biotek Corp. kit uses a rapid spin-column format to capture pure DNA and requires only 40 min for DNA extraction. Therefore, we selected this kit as a simple method for detection of the pathogens in field soil samples.

4. Infection sites in lettuce plants.

To identify the sites where pathogens could be detected in diseased lettuce plants, we collected five diseased plants from each of three fields (fields 1–3). Each plant was separated into three tissue types: pith, root base, and root tip, and the samples were assayed for each pathogen species using P-LAMP (Table 3-6). Pythium spinosum and Py. irregulare were each found in only one root base sample in field 3. Pythium uncinulatum was found in all three fields with totals of eight root base samples, five root tip samples, and five pith samples. Ph. pseudlactuace was found only in pith samples: four samples in field 1, and 5 samples in in field 3. Overall, two or more pathogens were detected in one plant in field 1 and in four plants in field 3. Also, all isolates were recovered and identified by morphological characteristics.

5. Detection of pathogens in soil samples from the field.

To assess the prevalence of detectable pathogens in soil samples from the field, we collected soil samples from around each diseased lettuce in fields 1–3. Plastic-film mulching had been used in field 3, and soil samples were also collected from above the mulch in this field. Each sample was extracted twice using the Norgen Biotek Corp. Soil

DNA Isolation kit. All four pathogens were detected in multiple DNA extracts from fields

1 and 3, and the pathogens were detected in samples from above and below the mulch in field 3 (Table 3-6) In field 2, only one extract contained detectable amounts of Py. spinosum DNA and five extracts contained detectable Py. uncinulatum DNA. Neither Py. irregulare nor Ph. pseudlactuace were detected in any of the plant or soil samples from field 2 (Table 3-6). Overall the pathogens were detected much more frequently in soil

57 samples than in plant samples.

Pith Root base

Root tip

Fig. 3-1. The diseased lettuce plant used for detection. Sites where pith, root base, and root tip were sampled (◯).

Fig. 3-2. The LAMP tests at different temperatures of 63°C, 64°C, 65°C, 66°C and 67.5°C for 60 min to select optimal temperatures for specific amplification of Pythium spinosum

(a), Py. uncinulatum (b), and Phytophthora pseudolactucae (c).

Fig. 3-3. Comparison of the sensitivities of LAMP and PCR using species-specific primer sets for Pythium spinosum (a), Py. uncinulatum (b), and Phytophthora pseudolactucae (c).

Genomic DNA was serially diluted from 1 ng to 1 fg. The LAMP reaction was monitored by measurement of turbidity. PCR products were detected by gel electrophoresis. M: 100 bp DNA ladder.

Table 3-1. Specificity tests of the LAMP primers for Pythium spinosum and Py. uncinulatum

Amplificationc Species Cladea Isolateb Origin Psp Pun Pythium adhaerens A CBS 520.74 Soil - - Py. aphanidermatum A GUGC0354 Carrot field soil - - Py. monospermum A N02E2 3-4 Flooded soil - - Py. arrhenomanes B1 NBRC100102 Zoysia grass - - Py. graminicola B1 MAFF425415 Corn - - Py. myriotylum B1 NBRC100113 Kidney bean - - Py. plurisporium B1 CBS 100530 Root - - Py. sulcatum B1 NBRC100117 Carrot - - Py. torulosum B1 GUCC0422 Carrot - - Py. aquatile B2 NBRC107450 Water - - Py. dissotocum B2 MAFF305576 Soil - - Py. pyrilobum B2 NBRC107365 Water - - Py. acanthicum D MAFF241099 Soil - - Py. periplocum D NBRC100114 Zoysia grass - - Py. oligandrum D GUCC0830 Soil - - Py. hypogynum E1 CBS 234.94 Soil - - Py. rostratum E1 NBRC100115 Zoysia grass - - Py. middletonii E2 CBS 528.74 Soil - - Py. parvum E2 GUCC0832 Soil - - Py. takayamanum E2 NBRC104223 Soil - - Py. irregulare F CBS 263.30 Nicotiana tabacum - - EP-2 Carrot - - Py. irregulare Ⅲ F PY26 Sugarbeet - N Py. irregulare Ⅳ F PY61 Sugarbeet - N Py. mamillatum F CBS 251.28 Beta vulagaris - N Py. paroecandrum F CBS 157.64 Soil - N Py. spinosum F NBRC100116 Carrot field soil + - OD231 + - GUKan5 + - Py73 + - 07KST-2 + - 1D1S032 + - Py. sylvaticum F NBRC100119 Carrot field soil - - Py. intermedium F CBS 221.68 Soil - - Py. macrosproum （strain +） F CBS 574.80 Root of flower bulb - N Py. macrosporum （strain ‐） F CBS 575.80 Lilium - N Py. nagaii G GUCC0828 Soil -- Py. paddicum G MAFF241108 Water -- Py. anandrum H CBS 285.31 Rheum rhaponitium -- Py. senticosum H NBRC104222 Soil -- Py. undulatum H NBRC107363 Water -- Py. heterothallicum I GUCC0137 Soil -- Py. splendes I C101 Anigozanthus -- Py. ultimum I NBRC100122 Sugar beet -- Py. uncinulatum J MAFF240295 Lettuce - + CH97LAC1 Lettuce - + Py. buismaniae J CBS101356 Chrysanthemum N - Py. mastophorum J CBS 375.72 Apium graveolens N - Py. sp "jasmonium" J C10-1 N- Py. orthogonon J CBS 376.72 Root N- Py. perplexum J N02F2 1-1 Soil N- Py. nodosum J 02F5 12-2 Soil N- Py. acanthophoron J MAFF425319 Soil N- Py. nunn J CBS 808.96 Soil -- Py. polymastum J CBS 811.70 Lettuce -- 64

Table 3-1. Continued Phytopythium chamaehyphon CBS 259.30 Papaya - - PP. helicoides NBRC100107 Rose - - PP. oedochilum GUCC0829 Yacon - - PP. ostracodes CBS 768.73 Soil - - PP. vexans 2D111 Soil - - Phytophthora nicotiane 1 CBS 535.92 Kalanchoe - - Ph. citricola 2 CH95PHE28 Eustoma grandiflorum - - Ph. nemorosa 3 C71 - - Ph. palmivora 4 CH88-1 Oncidium - - Ph. heveae 5 P1102 - - Ph. humicola 6a P3826 - - Ph. cambivora 7a MAFF305918 Apple - - Ph. cryptogea 8a CBS 113.19 Anaphalis - - Ph. pseudolatucae 8b MAFF239556 Lettuce - - Kph2010-1-1 Lettuce - - Kph2010-3-2 Lettuce - - Kph2011-1-1 Lettuce - - Ph. insolita 9 P6195 Soil - - Ph. boehmeriae 10 - - Aphanomyces ssp. GFHT2 - - Fusarium oxysporum MAFF72510 Strawberry - - Plasmodiophora brassicae HY Chinese cabbage - - Plasmodiophora brassicae AH - - Rhizoctonia solani SO1 Bacopa - - Saprolegnia sp. IFO32708 Brown trout - - Vertivillium alboatrum Vaal Potato -- Scierotinia sclerotiorum AiTog Wax gourd -- a Molecular phylogenetic clades for Pythium and Phytophthora were obtained from Lévesque and

De Cock (2004) and Blair et al. (2008), respectively. b Isolates were collected from the CBS-KNAW Fungal Biodiversity Centre (CBS), the NITE

Biological Research Centre (NBRC), the NIAS Genebank (MAFF), the World Phytophthora

Genetic Resource Collection (P), and the Gifu University Cultures Collection. c Psp: Py. spinosum specific primer set; Pun: Py. uncinulatum specific primer set; symbols: + = amplified, – = no amplification, and N = no test.

Table 3-2. Specificity test of the LAMP primer for Phytophthora pseudolatucae

Species Cladea Isolateb Origin Amplificationc Pythium adhaerens A CBS 520.74 Soil - Py. arrhenomanes B1 NBRC100102 Zoysia grass - Py. dissotocum B2 MAFF305576 Soil - Py. acanthicum D MAFF241099 Soil - Py. hypogynum E1 CBS 234.94 Soil - Py. middletonii E2 CBS 528.74 Soil - Py. irregulare F CBS 263.30 Nicotiana tabacum - EP-2 Carrot - Py.spinosum F NBRC100116 Carrot field soil - OD231 - GUKan5 - Py73 - 07KST-2 - 1D1S032 - Py. paddicum G MAFF241108 Water - Py. anandrum H CBS 285.31 Rheum rhaponitium - Py. ultimum I NBRC100122 Sugar beet - Py.uncinulatum J MAFF240295 Lettuce - CH97LAC1 Lettuce - Py. polymastum J CBS 811.70 Lettuce - Phytopythium chamaehyphon CBS 259.30 Papaya - Pp. helicoides NBRC100107 Rose - Pp. oedochilum GUCC0829 Yacon - Pp. ostracodes CBS 768.73 Soil - Pp. vexans 2D111 Soil - Phytophthora nicotiane 1 CBS 535.92 Kalanchoe - Ph. cactorum 1a MAFF731066 Strawberry - Ph. tentaculata 1b C05 Gazania sp. - Ph. infestans 1c MAFF236324 - Ph. citricola 2 CH95PHE28 Eustoma grandiflorum - Ph. citrophthora 2a CBS 950.87 - Ph. colocasiae 2a NBRC30695 Colocasia antiquorum - Ph. meadii 2a CBS 219.88 - Ph. capsici 2b MAFF305920 Water melon - Ph. nemorosa 3 C71 - Ph. palmivora 4 CH88-1 Oncidium - Ph. heveae 5 P1102 - Ph. humicola 6a P3826 - Ph. megasperma 6b NBRC32176 White trumpet lily - Ph. asparagi 6c CBS 132095 - Ph. cambivora 7a MAFF305918 Apple - Ph. cajani 7b P3105 - Ph. cinnamomi 7b MAFF238144 St. Jone's wort - Ph. melonis 7b CH00ME1-1 Melo - Ph. sojae 7b MAFF237500 White trumpet lily - Ph. cryptogea 8a CBS 113.19 Anaphalis margaritacea - Ph. drechsleri 8a P1087 Potato - Ph. erythroseptica 8a CBS 129.23 Potato - Ph. medicaginis 8a P7029 Medicago sativa - Ph. richardiae 8a P7789 Zantedeschia aethiopica - Ph. sansomeana 8a CBS 117692 Silene latifolia - Ph. trifolii 8a CBS 117687 Trifolium - Ph. sp. kelmania 8a P10613 -

Table 3-2. Continued

Ph. pseudolatucae 8b MAFF239556 Lettuce + Kph2010-1-1 Lettuce + Kph2010-3-2 Lettuce + Kph2011-1-1 Lettuce + Ph. brassicae 8b CBS 179.87 Brassica oleracea - Ph. porri 8b CBS 688.79 Brassica chinensis - Ph. primulae 8b CBS 620.97 Primula acaulis - Ph. dauci 8b CBS 127102 Carota - Ph. lactucae 8b BPIC1985 Lettuce - Ph. foliorum 8c CBS 121655 Azalea sp. - Ph. lateralis 8c CBS 168.42 Lawson cypress - Ph. austrocedri 8d CBS 122911 Austrocedrus chilensis - Ph. obscura 8d CBS 129273 Soil - Ph. syringae 8d Fium1 - Ph. insolita 9 P6195 Soil - Ph. parsiana 9 R6 (1) Medicago sativa - Ph. polonica 9 P131445 Alnus glutinosa - Ph. boehmeriae 10 - Ph. kernoviae 10 P1751 - Aphanomyces sp. GFHT2 - Fusarium oxysporum MAFF72510 Strawberry - Plasmodiophora brassicae HY Chinese cabbage - Plasmodiophora brassicae AH - Rhizoctonia solani SO1 Bacopa - Saprolegnia sp. IFO32708 Brown trout - Vertivillium alboatrum Vaal Potato - Scierotinia sclerotiorum AiTog Wax gourd - aMolecular phylogenetic clades for Pythium and Phytophthora were obtained from Lévesque and

De Cock (2004) and Blair et al. (2008), respectively. b Isolates were collected from the CBS-KNAW Fungal Biodiversity Centre (CBS), the NITE

Biological Research Centre (NBRC), the NIAS Genebank (MAFF), the World Phytophthora

Genetic Resource Collection (P), and the Gifu University Cultures Collection. c Symbols: + = amplified, – = no amplification

Table 3-3. Specificity tests of the PCR primers for Pythium spinosum, Py. uncinulatum and Phytophthora pseudolatucae

Amplificationc Species Cladea Isolateb Origin Psp Pun Phps Pythium adhaerens A CBS 520.74 Soil - - - Py. arrhenomanes B1 NBRC100102 Zoysia grass - - - Py. dissotocum B2 MAFF305576 Soil - - - Py. acanthicum D MAFF241099 Soil - - - Py. hypogynum E1 CBS 234.94 Soil - - - Py. middletonii E2 CBS 528.74 Soil - - - Py. irregulare F CBS 263.30 Nicotiana tabacum - - - EP-2 Carrot - - - Py. irregulare Ⅲ F PY26 Sugarbeet - N N Py. irregulare Ⅳ F PY61 Sugarbeet - N N Py. mamillatum F CBS 251.28 Beta vulagaris - N N Py. paroecandrum F CBS 157.64 Soil - N N Py. spinosum F NBRC100116 Carrot field soil + - - OD231 + - - GUKan5 + - - Py73 + - - 07KST-2 + - - 1D1S032 + - - Py. sylvaticum F NBRC100119 Carrot field soil - N N Py. intermedium F CBS 221.68 Soil - N N Py. macrosproum （strain +） F CBS 574.80 Root of flower bulb - N N Py. macrosporum （strain ‐） F CBS 575.80 Lilium - N N Py. nagaii G GUCC0828 Soil --- Py. anandrum H CBS 285.31 Rheum rhaponitium --- Py. ultimum I NBRC100122 Sugar beet --- Py. uncinulatum J MAFF240295 Lettuce - + - CH97LAC1 Lettuce - + - Py. buismaniae J CBS101356 Chrysanthemum N - N Py. mastophorum J CBS 375.72 Apium graveolens N - N Py. sp "jasmonium" J C10-1 N-N Py. orthogonon J CBS 376.72 Root N-N Py. perplexum J N02F2 1-1 Soil N-N Py. nodosum J 02F5 12-2 Soil N-N Py. acanthophoron J MAFF425319 Soil N-N Py. nunn J CBS 808.96 Soil N-N Py. polymastum J CBS 811.70 Lettuce N-N Phytopythium chamaehyphon CBS 259.30 Papaya --- PP. helicoides NBRC100107 Rose --- PP. vexans 2D111 Soil ---

Table 3-3. Continued

Phytophthora nicotiane 1 CBS 535.92 Kalanchoe - - - Ph. citricola 2 CH95PHE28 Eustoma grandiflorum - - - Ph. nemorosa 3 C71 - - - Ph. palmivora 4 CH88-1 Oncidium - - - Ph. heveae 5 P1102 - - - Ph. humicola 6a P3826 - - - Ph. cambivora 7a MAFF305918 Apple - - - Ph. cryptogea 8a CBS 113.19 Anaphalis - - - Ph. drechsleri 8a P1087 Potato N N - Ph. erythroseptica 8a CBS 129.23 Potato N N - Ph. medicaginis 8a P7029 Medicago sativa N N - Ph. richardiae 8a P7789 Zantedeschiaaethiopica N N - Ph. sansomeana 8a CBS 117692 Silene latifolia N N - Ph. trifolii 8a CBS 117687 Trifolium N N - Ph. sp. kelmania 8a P10613 N N - Ph. pseudolatucae 8b MAFF239556 Lettuce - - + Kph2010-1-1 Lettuce - - + Kph2010-3-2 Lettuce - - + Kph2011-1-1 Lettuce - - + Ph. brassicae 8b CBS 179.87 Brassica oleracea N N - Ph. porri 8b CBS 688.79 Brassica chinensis N N - Ph. primulae 8b CBS 620.97 Primula acaulis N N - Ph. dauci 8b CBS 127102 Carota N N - Ph. lactucae 8b BPIC1985 Lettuce N N - Ph. foliorum 8c CBS 121655 Azalea sp. N N - Ph. lateralis 8c CBS 168.42 Lawson cypress N N - Ph. austrocedri 8d CBS 122911 Austrocedrus chilensis N N - Ph. obscura 8d CBS 129273 Soil N N - Ph. syringae 8d Fium1 N N - Ph. insolita 9 P6195 Soil - - - Ph. boehmeriae 10 - - - Aphanomyces ssp. GFHT2 - - - Fusarium oxysporum MAFF72510 Strawberry - - - Plasmodiophora brassicae HY Chinese cabbage - - - Plasmodiophora brassicae AH - - - Rhizoctonia solani SO1 Bacopa - - - Saprolegnia sp. IFO32708 Brown trout - - - Vertivillium alboatrum Vaal Potato --- Scierotinia sclerotiorum AiTog Wax gourd --- aMolecular phylogenetic clades for Pythium and Phytophthora were obtained from Lévesque and

De Cock (2004) and Blair et al. (2008), respectively. b Isolates were collected from the CBS-KNAW Fungal Biodiversity Centre (CBS), the NITE

Biological Research Centre (NBRC), the NIAS Genebank (MAFF), the World Phytophthora

Genetic Resource Collection (P), and the Gifu University Cultures Collection. c Psp: Py. spinosum specific primer set; Pun: Py. uncinulatum specific primer set; Phps: Ph. pseudolatucae specific primer set; symbols: + = amplified, – = no amplification, and N = no test.

Table 3-4. Primer sets used in this study

Primer Region Target species Primers Sequences (5’- 3’) setsa amplified F3 CTGCGTGGTGCTGTGTATG FIP ACTACCAGTACACCTCAAGGTCG GCTGGACAATGTTG rDNA- L-Psp B3 ACGCAGGATTAACCCACATG ITS Py. spinosum BIP AGTGCGTTGTCGTGGATGCATCC CAAATTCAAACTCCTCT B-Loop GTGCACTTTTGTGTGTGCAGT For TATCTGCGTGGTGCTGTGTA rDNA- P-Psp Rev ATCCACGACAACGCACTAC ITS F3 GAAGGTGAAGTCGTAACAAGG FIP GATGACGCTAAACTGGTTGGGTG AACCTGCGGAAGGATC rDNA- L-Pun B3 CCAAGCCGTCTCACTACG ITS Py. uncinulatum BIP TACATTGCGAGAGAGGGGAAAC AAAAACAGCTCGACCTTCGT For ACCCAACCAGTTTAGCGTCATC rDNA- P-Pun Rev CTTGTTTCCCCTCTCTCGCA ITS F3 CGTTTCTTCCTTCCGTGTAGT FIP GCAATCATTGCAAACAACTAACT CCGGTGGAGGAGAGTTGCAGAT rDNA- L-Pir B3 ACCGCGAATCGAGGTCC ITS Py. irregulareb BIP TCTTTTTTGTATGTGCGCGGTGCT CACCGAAGTCGCCGAC For GTTGTTAGTAGTGTGTGTRGCA rDNA- P-Pir Rev GATCAACCCGGAGTATACAAAAC ITS F3 ACCTGATATGGCATTTCCA FIP CGATTCAACAATAGCTGATGGGT TATTACCTCCAGCA L-Phps B3 TGCTAAATCTACAGAAGG cox1 Ph. pseudolactucae BIP GAGTACTGGTTGGACTGTTCCTG AATGTGCCTGTAC B-Loop TCCACCATTATCAAG For GTGCTTTTGCGGGTATTATAG P-Phps cox1 Rev AGAAGGTCCTGAATGTGCC a L: LAMP primer set; P: PCR primer set. b The Primer sets of P. irregulare were designed by Feng et al. (2015)

Table 3-5. Comparison of two plant LAMP detection methods

Py. spinosum Py. uncinulatum Py. irregulare Ph. pseudlactuace Fields Parts of lettucea Number P-LAMPb PC-LAMPc P-LAMP PC-LAMP P-LAMP PC-LAMP P-LAMP PC-LAMP

Root 6 0 0 3 1 0 1 0 0 A Pith 10 0 0 0 1 0 0 4 5

Root 2 2 2 1 0 0 0 0 0 B Pith 2 0 0 0 1 0 0 0 0

Total 20 2 2 4 3 0 1 4 5 a Figure 3-1. a P-LAMP: diseased samples were mixed with distilled water and the supernatant liquid was used directly for amplification. b PC-LAMP: the diseased samples were placed in a culture medium and incubated for one day, then the medium was mixed with water and used for amplification.

Table 3-6. Investigation of infection sites by four pathogens in lettuce using P-LAMP with species-specific primer sets

Fields Regions of samplesa Number Py. spinosum Py. uncinulatum Py. irregulare Ph. pseudlactuace Base 5 0 0 0 0 Root Tip 5 0 0 0 0 1 Pith 5 0 1 0 4 Soil Around the plant 5 5 4 4 3 Base 5 0 5 0 0 Root Tip 5 0 3 0 0 2 Pith 5 0 4 0 0 Soil Around the plant 5 1 5 0 0 Base 5 1 3 1 0 Root Tip 5 0 2 0 0 3 Pith 5 0 0 0 5 Below the mulch 5 4 2 5 5 Soil Above the mulch 5 1 2 5 2

Total 65 12 31 15 19

a Figure 3-1.

Table 3-7. Comparison of soil DNA extraction kits based on LAMP detection of Phytophthora pseudolactucae

Soil DNA extraction methods Extraction time required for a sample (min) Extraction Detection of LAMP

1 + Soil DNA Isolation kit 40 2 +

1 - Extrop soil kit plus ver.2 kit 50 2 -

1 - Mightyprep reagent for DNA kit 10 2 -

1 - Kageyama + Mag method 50 2 +

1 - Soil DNA Isolation mini kit 90 2 -

DISCUSSION

In this study, we developed a simple procedure for the detection of four plant pathogenic oomycetes using the LAMP assay. We designed primers and optimized the assay for three of the species: Py. spinosum, Py. uncinulatum and Ph. pseudolactucae.

The detection limits of each LAMP primer set were at most 100 femptograms. This high level of sensitivity is similar to that obtained with PCR. Feng et al. (2018) developed a

LAMP assay for detection of Py. irregualre in eustoma, and we confirmed the utility of the same primers and conditions for detection of Py. irregualre in lettuce. Thus, like PCR,

LAMP has the advantages of high specificity and sensitivity. It has the additional advantages of simplicity, speed, and low-cost, and skilled personnel are not required to perform the assay.

Multiplex PCR was developed by Chamberlain et al. (1988), and this method has been successfully applied in many areas of DNA testing, including the multiple diagnosis of plant pathogenic oomycetes (Ishiguro et al. 2014; Li et al. 2011; Rojas et al. 2017). In the

LAMP assay, a lack of simple, sequence-dependent detection techniques makes it difficult to implement a multiplex approach. Currently, multiplex LAMP detection has been used successfully in the laboratory detection and clinical diagnosis of infectious diseases.

These techniques involve one or more of the following: a fluorescence-based monitoring method, such as gel electrophoresis-based analysis with restriction enzyme digestion of the amplified DNA products (He and Xu 2011); measurement of amplicon annealing temperatures with a fluorometer (Mahony et al. 2013); fluorescence signal-based monitoring with assimilating probes (Kubota and Jenkins 2015); and the use of novel mediator displacement probes with universal reporters (Becherer et al. 2018). These high-

74 cost and time-consuming methods are not suitable for routine pathogen detection in field samples. Thus, more research is needed to develop appropriate multiplex LAMP detection methods for plant pathogens in the field.

The LAMP detection process does not require the extraction and purification of DNA from plant materials. To identify the most effective on-site detection method, we contrasted the procedures of P-LAMP and PC-LAMP. For P-LAMP, the plant sample is simply mixed with distilled water. In PC-LAMP a selective culture medium is used, to allow the pathogen to grow, thus increasing the probability of detection. This procedure is also simple, but a few days are required to obtain the results. Feng et al. (2015) demonstrated that the detection sensitivity of PC-LAMP was higher than P-LAMP in the diagnosis of Py. irregulare. However, in PC-LAMP the detection of a slow-growing pathogen such as Py. uncinulatum will be negatively impacted by fast-growing species that might be simultaneously present in the plant sample. In this study we obtained positive results in similar numbers of samples with P-LAMP and PC-LAMP. Therefore, for the pathogens examined in this study, P-LAMP is the most simple and time-saving procedure for the sensitive detection of pathogens in lettuce samples.

Bait-based methods that use bating materials to trap pathogens in the soil are not suitable for slow-growing species such as Py. uncinulatum and Ph. pseudlactuace, and in particular, they are not suitable for Py. spinosum, which does not form zoospores (Van der Plaats-Niterink 1981). For this reason we tested five soil DNA extraction kits and identified the one that showed the highest sensitivity. This kit also has the advantages of high extraction efficiency and simplicity.

We used the P-LAMP assay, with the species-specific primer sets for the four plant pathogenic oomycetes, to analyze diseased lettuce plants collected from three cultivation

75 fields. The wilting symptoms were visually similar in all of the plants. All four pathogens were detected in the fields with varying degrees, suggesting that even with the same wilting symptoms, the disease could be caused by species of Phytophthora and/or

Pythium. We independently analyzed three different tissues from each plant: the root base, root tip, and the above-ground pith. Our results suggested that Ph. psuedolacticae infects the pith in the above-ground parts, whereas Pythium mainly infects roots. This is supported by previous studies. Kanto et al. (2005) found that the browning caused by Ph. pseudolactucae occurs mainly along the conduit from the pith. Kusunoki (2012) and

Matsuura et al. (2010) surveyed the pathogenicity of the Pythium species in lettuce and found that all the pathogens caused browning and corruption of the roots.

The soil samples around the diseased lettuce were collected and analyzed using the

LAMP assay. In many cases the pathogens were detected more frequently in the soil samples than in the plant samples, suggesting that not all of the pathogens existing in the soil will infect the lettuce plants. On the other hand, Ph. pseudlactuace and Py. uncinulatum were both detected in similar numbers of soil samples as lettuce samples, and in higher numbers of lettuce samples than the other two species. These results suggest that Ph. pseudlactuace and Py. uncinulatum have higher disease incidence rates than Py. irregulare and Py. spinosum. Similarly, when Kusunoki (2012) compared the pathogenicity among Pythium species to lettuce, Py. irregulare and Py. spinosum were less pathogenic than Py. uncinulatum.

Based on the results of this study, we propose the following important strategies to prevent oomycete diseases in lettuce cultivation fields. (i) It is important to diagnose the soil prior to planting. If pathogens are found in the soil, it needs to be sterilized with fungicides effective against oomycetes. (ii) When plastic film mulch is used, the farmer

76 should not put soil over the film, to reduce the risk of pith infection. (iii) Once disease has occurred, the soil surrounding the diseased plants should be excluded and sterilized to prevent spread of the disease. Certainly, if an oomycete related disease occurs, soil sterilization is necessary after harvest.

It is clear from this study that the LAMP method can be effectively used for the diagnosis of pathogenic oomycetes in plants and soil. This method has the potential to greatly enhance the management and prevention of diseases in the field.

CHAPTER 4

A simple LAMP detection of Phytophthora colocasiae in infected taro fields

Taro (Colocasia esculenta), which has edible corms and leaves, is one of the most popular staple crops in Japan. The crop has suffered disease from 2014 in Ehime,

Miyazaki and Kagoshima prefectures, and the disease is expanding year by year. The pathogen was identified as the oomycete Phytophthora colocasiae Raciborski. Therefore, it is extremely urgent to develop appropriate and effective control strategies for this disease. The purposes of this study were to design specific and sensitive primers for amplification of P. colocasiae using the LAMP method, and to establish a simple and dependable approach for detecting the pathogen in taro fields.

MATERIALS AND METHODS

1. Collection and maintenance of isolates, and mycelial DNA extraction

Isolates were collected from the following institutions: the CBS-KNAW Fungal

Biodiversity Centre, Utrecht, the Netherlands (CBS); the NITE Biological Resource

Center, Kisarazu, Chiba Prefecture, Japan (NBRC); the NIAS Genebank, Tsukuba,

Ibaraki Prefecture, Japan (MAFF); the World Phytophthora Genetic Resource Collection,

University of California, Riverside, CA, USA (P); and the Gifu University Cultures

Collection, Gifu Prefecture, Japan (Table 4-1). In addition, 52 isolates were collected from diseased taro leaves and petioles in Kagoshima and Miyazaki prefectures using a selective cornmeal agar medium containing nystatin, ampicillin, rifampicin, and miconazole (NARM) (Morita and Tojo 2007) (Table 4-2). All isolates were maintained on cornmeal or potato-dextrose agar media at 20°C in the dark. Genomic DNA was extracted from the mycelia using the PrepMan Ultra Reagent (Applied Biosystems Inc.,

CA, USA) as described by Baten et al. (2014). The DNA concentration was estimated using a Qubit® 2.0 Fluorometer (Life Technologies, CA, USA) and the DNA was diluted to 100 pg/μl for LAMP assays.

2. Preparation of artificially infected samples, and field sample collection

For the experiment shown in Table 4-3, taro (‘Ishikawawase’) plants were cultivated in a climate incubator set at 25°C with a 12 h light-dark cycle, and fully expanded leaves were used in the experiment. Phytophthora colocasiae (isolate P6317) was grown on 5 ml of V8 medium (1 ml V8 juice, 12.5 mg CaCO3, 0.1 g agar, and 4 ml distilled water) at

25°C in the dark for 3 days. A circular area with a diameter about 0.5 cm was excised

79 from the V8 medium containing mycelia, soaked in a little sterile distilled water (SDW), and fixed on each of 10 leaves. Each inoculated leaf, with petiole, was placed in a 50 ml beaker with distilled water, covered with a plastic bag, and then incubated at room temperature for 2–3 days. Uninoculated areas on the same leaves were used as negative controls.

During July to September 2018, leaf samples were collected from randomly selected diseased taro plants. Twenty-four samples were collected from 15 fields in Chiba and 11 samples were collected from two fields in Ehime (Table 4-4).

3. LAMP primer design

The ras-related protein (Ypt1) gene that contains alternate conserved and variable regions and is highly variable in Phytophthora species (Schena et al. 2006) was chosen as the target sequence for LAMP primer design. A multiple alignment of Ypt1 sequences from P. colocasiae and other species was constructed using the BioEdit Sequence

Alignment Editor software. Regions specific for P. colocasiae were identified and used in primer design, especially in the 5' ends of FIP and BIP. All primers, including two loop primers, were designed and analyzed using the PrimerExplorer V5 software

(http://primerexplorer.jp).

4. LAMP reactions

Each LAMP reaction was carried out at 65°C for 60 min, followed by incubation at

80°C for 5 min to terminate the reaction. The 15 μl reaction mixture contained 1.6 μM

FIP and BIP primers, 0.2 μM F3 and B3 primers, 0.8 μM F-loop and B-loop primers, 20 mM Tris-HCl (pH 8.8), 10 mM KCl, 0.1% (v/v) Tween20, 0.92 M betaine (Sigma-Aldrich,

St Louis, MO, USA), 8 mM MgSO4, 10 mM (NH4)2SO4, 1.4 mM dNTPs (New England

Biolabs Japan, Tokyo, Japan), 4.8 units of the Bst DNA polymerase large fragment

(Nippon Gene Co. Ltd, Toyama, Japan), and template DNA (100 pg for specificity tests).

For the specificity and sensitivity tests, the turbidity of the reaction mixture was recorded in real time using a loopamp real-time turbidimeter (LA-200, Teramecs, Kyoto, Japan).

Changes in the color of the SYBR Green I dye were used to visually assess the results of reactions with field leaf samples. Before these reactions, 15 μl mineral oil (Sigma-Aldrich,

St Louis, MO, USA) was added to overlay the reaction mixture. After the reaction, 2 μl of 1:10 diluted SYBR Green I (10,000 x, Takara, Bio Inc., Shiga, Japan) was applied to the tube wall, then the tubes were sealed and vortexed. Each reaction was carried out in triplicate. Genomic DNA of P. colocasiae was used as a positive control and SDW in place of template DNA was used as a negative control.

5. LAMP specificity and sensitivity test

In total, 42 isolates of 39 Phytophthora species, 12 Pythium isolates, 5 Phytopythium isolates, and 8 isolates of 7 other soil-borne oomycetes, listed in Table 4-1, were used to test the specificity of each primer set. For the sensitivity assay, genomic DNA from P. colocasiae (P6317) was extracted, quantiﬁed, and diluted in a series of 10-fold dilutions from 1 ng/μl to 1 fg/μl.

6. Detection of P. colocasiae from leaf samples

We tested three methods for detecting the pathogen in taro leaves. Two were the Plant

Culture-LAMP (PC-LAMP) and Plant-LAMP (P-LAMP) methods developed by Feng et al. (2015). For PC-LAMP, isolates collected from diseased taro leaves and petioles, or

81 themselves, were placed on NARM medium and incubated at 25°C for 2–3 days. Then, a sample of the medium (about 0.1 cm3) containing mycelia was excised and placed in a

1.5 ml tube with 100 μl SDW and vortexed for 1 min using an MT-360 Multi-tube Fast

Mixer (Tomy Seiko Co., Ltd, Tokyo, Japan). The supernatant (1 μl) was used directly as the template DNA in LAMP reactions. For P-LAMP, a sample of diseased leaf (about 0.5 cm2 of brown tissue) was cut into small pieces, the pieces were collected in a 1.5 ml tube with 0.5 ml SDW, and the tube was vortexed for as above. Supernatant samples (4.5 μl) were either heated at 98°C for 8 min or were not heat treated, and then used as the template

DNA in LAMP reactions.

For the third method, genomic DNA was extracted from brown (infected) leaves using the Kaneka Easy DNA Extraction Kit version 2 (Kaneka Corp., Hyogo, Japan), and the extracted DNA was used as the template in LAMP reactions. We named this the Plant

Extraction-LAMP (PE-LAMP) method.

RESULTS

1. Specificity and sensitivity of the LAMP primers

We used the Ypt1 gene to find sequences specific for P. colocasiae. As proposed by

Blair et al. (2008), a multiple alignment was constructed using Ypt1 sequences from P. colocasiae and other species in the same phylogenetic clade (Clade 2). Three primer sets were then designed and tested using DNA extracted from isolates in the same clade.

Results for the set showing the greatest specificity are shown in Fig. 4-1a. This primer set

(Table 4-5) was further tested using a broad range of oomycetes and confirmed to be highly specific for P. colocasiae (Table 4-1). Serial dilutions of P. colocasiae genomic

DNA were then used to determine the sensitivity of the LAMP assay with this primer set.

As shown in Fig. 4-1b, the detection limit was 100 fg, indicating the feasibility of this assay for field testing.

2. Identification of isolates maintained on agar media

We first used PC-LAMP with inoculated media to assess the accuracy and simplicity of the LAMP assay for the identification of P. colocasiae isolates. Two isolates of P. colocasiae, 8 isolates of genetically related species, and 52 candidate isolates of P. colocasiae were used in this experiment. As shown in Table 4-2, positive results were obtained with the two P. colocasiae isolates and all the candidate isolates. None of the genetically related isolates displayed amplification. A microscopic examination indicated that all of the candidate isolates were P. colocasiae based on the morphological characteristics, such as formation of apical papillae, ovoid to ellipsoid sporangia (mostly

45-50 x 23 µm) and oospores (averaging 29 µm diameter). Ten out of the 52 candidate

83 isolates in a random way were confirmed the pathogenicity to taro leaves by inoculation test (data not shown).

3. Development of the Plant-LAMP assay

To determine whether P-LAMP could be used to detect P. colocasiae in taro leaf samples, we compared two approaches: one with, and one without treatment of the water- plant suspension at 98°C for 8 minutes (Table 4-3). We took leaves from healthy plants grown under controlled conditions and inoculated 10 of the leaves with P. colocasiae.

Uninoculated areas of the same leaves were used as controls. We then used the two P-

LAMP approaches to assay the inoculated and uninoculated samples, and found that all inoculated samples gave positive results with both approaches. No uninoculated samples gave positive results in assays that included the heat treatment, however 8 of the 10 uninoculated samples gave positive results in assays without the heat treatment (Table 4-

3). Samples of the inoculated and uninoculated tissues were also placed on NARM medium. Mycelium grew only from inoculated tissues, and gave positive results using

PC-LAMP (Table 4-3). Therefore, we selected the P-LAMP assay with heat treatment of the water-plant suspension as a simple method for detection of the pathogen in field samples.

4. Detection of the pathogen in field samples

To identify the most efficient plant LAMP procedure for use in the field, we compared

PC-LAMP, P-LAMP (with heat treatment), and PE-LAMP (see Materials and Methods for details) (Fig. 4-2). A total of 35 diseased leaf samples were collected from 17 fields in

Chiba and Ehime prefectures and tested with the three methods. These assays were

84 monitored using the turbidity of the reaction mixture. Phytophthora colocasiae was found in 29 samples using PC-LAMP, 32 samples using P-LAMP, and 33 samples using PE-

LAMP (Table 4-4). One sample from Shikokuchuo-2, Ehime prefecture gave no positive results with any of the three methods. Two samples in Shikokuchuo-1 that gave positive results with PC-LAMP gave negative results with P-LAMP, and one of these also gave a negative result with PE-LAMP. No colonies grew from five of the diseased samples from

Chiba prefecture, and this resulted in negative results with the PC-LAMP assay, even though the pathogen was detected in the same samples by P-LAMP and PE-LAMP.

We repeated the P-LAMP assays with the same diseased samples, using SYBR Green

I dye instead of turbidity to detect the presence of the pathogen. In this case, orange or brown represented no reaction and yellow-green represented a positive reaction. The same numbers of samples showed positive results as those monitored by turbidity (Fig.

4-3). To confirm the positive results, all isolates were recovered from the NARM medium and identified by morphological characteristics as P. colocasiae.

0.9 (a) P. colocasiae P. capensis P. citricola P. elongata 0.7 P. pini P. plurivora P. frigida P. multivora P. multivesiculata P. himalsilva 0.5 P. citrophthora P. botryosa P. meadii P. capsici P. tropicalis P. mengei P. siskiyouensis Blank 0.3 Turbidity

0.1

-0.1 0 6 12 18 24 30 36 42 48 54 60 Time (min)

(b) 0.9 1 ng 0.7 100 pg 10 pg 1 pg 0.5 100 fg 10 fg

Turbidity 0.3 1 fg Blank 0.1

-0.1 0 6 12 18 24 30 36 42 48 54 60 Time (min)

Fig. 4-1. Specificity (a) and sensitivity (b) of the LAMP reaction. (a) The LAMP reaction

was performed using the primers shown in Table 4-5 with genomic DNA from

Phytophthora colocasiae and 16 closely related Phytophthora species. Progress of the

reactions was monitored in real time using a turbidimeter. (b) A serial dilution of P.

colocasiae genomic DNA was used to test the sensitivity of the LAMP primers.

)LJ$W\SLFDOGLVHDVHGWDUROHDIVKRZLQJSDUWVRIGLVHDVHGWLVVXHVWKDWZHUHVDPSOHG

IRU3ODQW&XOWXUH/$03 ż DQGDERXWFPGLVHDVHGWLVVXHVVDPSOHGIRU3ODQW/$03

RU3ODQW([WUDFWLRQ/$03 տ

PC NC Chiba; Yachimi-Shiki

Chiba; Yachimi- Oki Chiba; Chiba

Ehime; Shikokuchuo-1 Ehime; Shikokuchuo-2

Fig. 4-3. Identification of Phytophthora colocasiae in 35 leaf samples with P-LAMP and color detection using SYBR Green I. The samples were collected from three regions of

Chiba prefecture and two regions of Ehime prefecture. In samples with no amplification of P. colocasiae DNA, the SYBR Green I remains brown/orange, whereas in samples with positive amplification the dye turns yellow-green. PC: positive control, NC: negative control.

Table 4-1. Isolates of Phytophthora, Pythium, Phytopythium, and other soil-borne oomycetes used in this study, with amplification results from LAMP assays using the primers shown in Table 4-5

Species Cladea Isolateb Origin Amplificationc Phytophthora nicotiane 1 CBS 535.92 Kalanchoe - P. cactorum 1a MAFF731066 Strawberry - P. tentaculata 1b C05 Gazania sp. - P. infestans 1c MAFF236324 - P. capensis 2 CBS 128319 - P. citricola 2 P0713 Eustoma grandiflorum - P. elongata 2 CBS 125799 Eucalyptus marginata - P. pini 2 CBS 18125 Pinus resinosa - P. plurivora 2 CBS 124093 Soil - P. frigida 2 CBS 121941 Eucalyptus smithii - P. multivesiculata 2 CBS 545.96 Cymbidium - P. multivora 2 NBRC31016 - P. botryosa 2a CBS 58169 - P. citrophthora 2a CBS 950.87 Zingiber officinale - P. colocasiae 2a NBRC30695 Colocasia antiquorum + MS28041 Colocasia antiquorum + EPC201522 Colocasia antiquorum + EPC2017KO1 Colocasia antiquorum + P. himalsilva 2a CBS 128767 Soil - P. meadii 2a CBS 219.88 - P. capsici 2b MAFF305920 Water melon - P. siskiyouensis 2b CBS122799 Alnus incana - P. tropicalis 2b CBS 43491 Albizia julibrissin - P. mengei 2b 42B2 Avocado - P. nemorosa 3 C71 - P. palmivora 4 CH88-1 Oncidium - P. heveae 5 P1102 - P. humicola 6a P3826 - P. megasperma 6b NBRC32176 White trumpet lily - P. asparagi 6c CBS 132095 - P. cambivora 7a MAFF305918 Apple - P. cajani 7b P3105 - P. cryptogea 8a CBS 113.19 Anaphalis margaritacea - P. erythroseptica 8a CBS 129.23 Potato - P. sansomeana 8a CBS 117692 Silene latifolia - P. brassicae 8b CBS 179.87 Brassica oleracea - P. dauci 8b CBS 127102 Carota - P. foliorum 8c CBS 121655 Azalea sp. - P. lateralis 8c CBS 168.42 Lawson cypress - P. syringae 8d Fium1 - P. insolita 9 P6195 Soil - P. kernoviae 10 P1751 -

Table 4-1. Continued

Pythium adhaerens A CBS 520.74 Soil - Py. arrhenomanes B1 NBRC100102 Zoysia grass - Py. dissotocum B2 MAFF305576 Soil - Py. acanthicum D MAFF241099 Soil - Py. hypogynum E1 CBS 234.94 Soil - Py. middletonii E2 CBS 528.74 Soil - Py. irregulare F CBS 263.30 Nicotiana tabacum - Py.spinosum F NBRC100116 Carrot field soil - Py. paddicum G MAFF241108 Water - Py. anandrum H CBS 285.31 Rheum rhaponitium - Py. ultimum I NBRC100122 Sugar beet - Py. polymastum J CBS 811.70 Lettuce - Phytopythium chamaehyphon CBS 259.30 Papaya - Pp. helicoides NBRC100107 Rose - Pp. oedochilum GUCC0829 Yacon - Pp. ostracodes CBS 768.73 Soil - Pp. vexans 2D111 Soil - Aphanomyces sp. GFHT2 - Fusarium oxysporum MAFF72510 Strawberry - Plasmodiophora brassicae HY Chinese cabbage - Plasmodiophora brassicae AH - Rhizoctonia solani SO1 Bacopa - Saprolegnia sp. IFO32708 Brown trout - Vertivillium alboatrum Vaal Potato - Scierotinia sclerotiorum AiTog Wax gourd - aMolecular phylogenetic clades for Pythium and Phytophthora were obtained from

Lévesque and De Cock (2004) and Blair et al. (2008), respectively. b Isolates were collected from the CBS-KNAW Fungal Biodiversity Centre (CBS), the

NITE Biological Research Centre (NBRC), the NIAS Genebank (MAFF), the World

Phytophthora Genetic Resource Collection (P), and the Gifu University Cultures

Collection. c Symbols: + = amplified, – = no amplification based on turbidity measurements

Table 4-2. Specific identification of Phytophthora colocasiae among isolates maintained on selective media using Plant Culture-LAMP

Amplificationa Species isolate (PC-LAMP)

P. colocasiae P6317 +

MS28041 +

Kagoshima isolates + (47/47)b

Miyazaki isolates + (5/5)b

P. capensis CBS128319 -

P. pini CBS18125 -

P. botryosa CBS58169 -

P. citrophthora CBS95087 -

P. himalsilva CBS128767 -

P. meadii CBS 21988 -

P. siskiyouensis CBS122799 -

P. tropicalis CBS 43491 - a For Plant Culture-LAMP (PC-LAMP), the diseased samples were placed on a selective medium and incubated for 2–3 days, then the medium was mixed with water and used for amplification. Symbols: + = amplified, – = no amplification based on turbidity measurements. b Number of amplified isolates/Number of tested isolates.

Table 4-3. Comparison of two Plant-LAMP approaches, one with and one without heat treatment of the plant-water suspension

Number of samples with positive resultsa Total P-LAMP P-LAMP Samples tested number of (without heat (with heat PC-LAMP samples treatment) treatment)

Uninoculated 10 8 0 Nb

Inoculated 10 10 10 10 a For Plant-LAMP (P-LAMP), leaf tissues were mixed with distilled water and the supernatant was used directly for amplification. We tested this method with and without heating the plant-water suspension to 98°C for 8 minutes before amplification. For Plant

Culture-LAMP (PC-LAMP), the leaf tissues were placed in a culture medium and incubated for 2–3 days, then the medium containing mycelium was mixed with water and used for amplification. b N, no mycelial growth.

Table 4-4. Detection of Phytophthora colocasiae in field samples using three LAMP methods

Number of positive samplesa Number Number of Location P-LAMP of fields samples PC-LAMPb PE-LAMP (with heat treatment)

Yachimi-Shiki 4 12 7 12 12

Chiba Yachimi-Oki 3 3 3 3 3

Chiba 8 9 9 9 9

Shikokuchuo-1 1 6 6 4 5 Ehime Shikokuchuo-2 1 5 4 4 4

Total 17 35 29 32 33 a For Plant Culture-LAMP (PC-LAMP), the leaf tissues were placed in a culture medium and incubated for 2–3 days, then the medium containing mycelium was mixed with water and used for amplification. For Plant-LAMP (P-LAMP) with heat treatment, leaf tissues were mixed with distilled water and the plant-water suspension was heated to 98°C for 8 minutes before the supernatant was used for amplification. For Plant Extraction-LAMP

(PE-LAMP), DNA was extracted from diseased leaf tissues using the Kaneka Easy DNA

Extraction Kit version 2 and then used for amplification. b For PC-LAMP, here was no colony growth in five samples that gave negative results.

Table 4-5. The primers selected in this study

Region Target species Primers Sequences (5’- 3’) amplified

PhyCol_F3 GGACTTTGTGAGTTTCAG

CTAGAGAATACCACCAAGTC PhyCol_FIP ATGAAGAGGTCCTGTGAGGT

PhyCol_B3 CCACGGTAGTAGCTGCTAGT P. colocasiae Ypt1

GTTGTGCCAACTCCCTTGTG PhyCol_BIP AATCGTGCGGAAACGCTC

PhyCol_LB CTCCTGTAGTGGGACACGG

PhyCol_LF GCAATCCTGATAGA

DISCUSSION

In this study, we explored the use of the LAMP method for detection and identification of P. colocasiae. We designed primers that were specific for this pathogen and highly sensitive, with a detection limit of 100 fg. Nath et al. (2014) designed three sets of PCR primers for the specific amplification of P. colocasiae. The detection limits of those primers were 50 pg of pure DNA in conventional PCR and 12.5 fg in real-time PCR.

However, LAMP has some advantages over PCR in terms of simplicity, rapidity, and low- cost. Skilled personnel are not needed to perform the LAMP assay. Therefore, we feel that the LAMP method is a suitable approach for analyzing the pathogen in the field.

Many research studies, such as analyses of mating-type distribution or population structure analyses, require the collection of large numbers of isolates from many sources.

Usually the isolates are collected using selective media, however, there is a high risk mis- identification with this approach because the long-term maintenance, transplantation, and transportation of an isolate can easily lead to contamination with non-target species.

Hence, the re-identification of each isolate becomes necessary. Sequence analyses or detailed morphological analyses are complex and time-consuming. In this study we explored the simple PC-LAMP method, which involves the short-term culture of the target species on selective media. Our results indicate that this method is very effective for the rapid and simple identification of the target species.

The LAMP method does not require the extraction and purification of DNA for detection of pathogens in plant materials. Feng et al. (2018a) used the P-LAMP method for the sensitive detection of pathogens in lettuce samples. In this study, we compared two approaches of P-LAMP: one with, and one without heat treatment for detection of P.

95 colocasiae in inoculated and uninoculated tissues of taro leaves that had been inoculated with the pathogen. False positive results were found by the latter approach; however, no false positive results were obtained by the former approach. It is possible that some ingredient(s) in the taro leaves caused turbidity in the LAMP assays, and that the heat treatment effectively eliminated this negative result.

To identify the most effective and dependable method for the on-site detection of P. colocasiae in taro fields, we compared three methods: PC-LAMP, P-LAMP with heat treatment, and PE-LAMP by testing them with 35 diseased leaf samples collected in the field. One sample from Shikokuchuo-2, Ehime prefecture gave negative results with all three methods, suggesting that the disease in this sample was not caused by P. colocasiae.

Five samples gave false negative results with the PC-LAMP method. These five leaves were held in cold storage at 4°C for two weeks before the assays were conducted.

Phytophthora colocasiae survives as mycelium in plant tissues or as encysted zoospores in soil (Brooks 2005). Hence, it was most likely that P. colocasiae in the samples had died during the cold storage period and was unable to grow colonies in the selective media.

Unconsidering these five leaves with human error, the total percentage of coincidental results between PC-LAMP and P-LAMP / PE-LAMP was 93.33% / 96.67% with a total

Cohen’s Kappa value of 0.47 / 0.65 and a BAK index of 0.46 / 0.65. These results showed a moderate / substantial agreement (Cohen 1960; Landis and Koch 1977; Byrt et al. 1993).

Two samples in Shikokuchuo-1 that gave positive results with PC-LAMP gave negative results with P-LAMP or PE-LAMP. These two samples each had only a few indistinct lesions, and this may explain the false negative results with P-LAMP and PE-LAMP. Such false negative results may be avoided by testing multiple 0.5 cm2 tissue samples from such indistinct diseased leaves. The methods of P-LAMP and PE-LAMP showed similar

96 detection capacity in the 35 samples, with a total percentage of coincidental results of

97.14%, a total Cohen’s Kappa value of 0.79 and a BAK index of 0.79. Although P-

LAMP had a slightly lower sensitivity than PC-LAMP and PE-LAMP, it was nevertheless found to be suitable for diagnosis of P. colocasiae in taro cultivation fields due to its simplicity, dependability, and especially, no extra time and cost. We also demonstrated that the color assay with SYBR Green I dye is effective for detection in the field samples with the P-LAMP method.

We also used LAMP assays to investigate the soil in infected fields, testing three DNA extraction kits that are often used for soil samples. However, it was very difficult to detect

P. colocasiae in the soil samples even with the most effective kit (data not shown). Other researchers have also been unable to detect P. colocasiae oospores in soils or naturally infected host tissues, although P. colocasiae A1 and A2 types have occasionally been found to coexist in some areas (Ko 1979; Zhang et al. 1994). Because oospores have rarely been found in soils, the zoosporangia might be the most important survival structure, even though they have lower viability (Lin and Ko 2008; Quitugua and Trujillo

1998). Gollifer et al. (1980) reported that P. colocasiae zoosporangia survived for less than 21 days in naturally infested soils. However, Quitugua and Trujillo (1998) found the zoosporangia survived for more than 107 days in soils at –1,500 J/kg matric potential.

Gómez (1925) reported that zoosporangia can last in taro leaves for 3 months. Thus, further research is needed to investigate the survival structures of P. colocasiae in the soil, and to develop more sensitive LAMP detection methods for detecting the pathogen in soil samples.

In conclusion, a LAMP primer set for detection of P. colocasiae with a specificity and sensitivity of 100 fg was designed. We have demonstrated that the PC-LAMP and P-

LAMP methods can be used to simply, effectively, and dependably identify P. colocasiae in agar media or taro fields. These methods have the potential to greatly enhance the management and prevention of the disease in the field.

OVERALL DISCUSSION

Plant pathogenic oomycetes cause many kinds of serious devastating diseases to various plants. These diseases have a rapid morbidity cycle, could easily spread to the surrounding environment with the movement of zoospore in water, resulting in a large area of crop getting a devastating loss. Once crop infested by plant pathogens, it may become a carrier and facilitate further spread of diseases. So there is a need for early diagnosis by a technique for detecting the plant pathogens from the plant and soil with a short time in agricultural field for disease prevention and control. The current “gold standard method” of detection of oomycetes uses conventional PCR and real-time PCR, but there are still some disadvantages, such as the need to use a thermal cycler for the reaction, the multiple and complex operation process and high-purity extraction of DNA

(Mori et al. 2001; Tomita et al. 2008). Because of requiring only a constant temperature and crude DNA, LAMP assay was chosen as the simple and rapid method for detection of plant pathogens.

For the diagnosis method to be used at the agriculture site, simplicity of the working process, inexpensiveness and reliability is required. Several monitoring methods for the

LAMP products have been reported: magnesium pyrophosphate turbidity, measurement of fluorescence using intercalating fluorescent dyes, and color change using a visualization indicator. For the method of measurement of fluorescence, a transilluminator is needed. It cannot be simply used in the field. Turbidity and color change are the practical ways that we can observe the reaction changes by naked eye during the LAMP assay without extra equipment and time. In addition, turbidity allowed to use in the LAMP assay with the data recording by a loopamp real-time turbidimeter.

Primer design is the most important and difficult step among the LAMP assay. In this study, the species-specific LAMP primer sets of Py. irregulare, Py. spinosum, Py. uncinulatum, Ph. pseudolactucae and Ph. colocasiae were designed from ITS, ITS, ITS, cox1 and Ypt1 regions, respectively. The rDNA–ITS region has most commonly been used for identification of oomycetes to the species level. The ITS sequences in oomycetes can easy to amplify for DNA sequencing in most species with PCR reaction (White et al.

1990; Ristaino et al. 1998). Although Lévesque and de Cock (2004) suggested that the database of ITS sequences can facilitate the identification of Pythium species, there are also some species showing the extremely similar ITS sequences (Kroon et al. 2004). The coxI is recognized as an extremely useful region for accurate species identification

(Hebert et al. 2004; Ward et al. 2005; Hajibabaei et al. 2006; Seifert et al. 2007), and also has been proven to be useful for phylogenetic studies of Phytophthora (Martin and Tooley

2003; Kroon et al. 2004). But coxI is a GC-low sequences, so it relatively difficult to design primers. In addition, the ras-related protein (Ypt1) gene that contains alternate conserved and variable regions is highly variable in almost all Phytophthora species

(Schena et al. 2006). Hence, these three DNA regions could be as the effective targets for the design of species-specific LAMP primers for many oomycetes.

The reaction temperature has a great influence on the specificity and sensitivity of the

LAMP. A series of temperature gradients were conformed to decide the optimum temperature for LAMP reaction of each pathogens. There are nonspecific reactions happened in the specificity test of Py. irregulare and Py. spinosum at the low temperature of 63℃. The amplification of LAMP appeared different speed. In most cases, the lower temperature could accelerate the reaction, however, the opposite result presented in the reaction of Py. uncinulatum specific primer set. These results suggested that the higher

100 temperature can reduce nonspecific reactions, although it has an influence on the reaction speed. Moreover, for different primer sets, the effect generated by temperature changes may be completely opposite. Usually, for the practical application in the field, a temperature error may occur easily in some simple facilities like water bath. Therefore, the selection of optimum temperature should avoid the critical point for the specificity. In this study, the second-best ones were choosed as the optimum temperature for each primer sets.

LAMP method was used into diagnosis of the plant-pathogenic oomycetes in several plants of tomato, eustoma, lettuce and taro. Two LAMP-based procedures of Plant-LAMP and Plant Culture-LAMP were used for diagnosis of the pathogens in plant samples.

Overall, the Plant Culture-LAMP has a little better sensitivity than Plant-LAMP. However, the culture media and a 1-5 extra days needed for Plant Culture-LAMP. Although, as long as the pathogen existed in the testing samples, the pathogen can grow largely in the media for easily detection with LAMP, the case that a multiple oomycetes coexists simultaneously in diseased tissues, the pathogens with slowly growth would to be difficult to isolate and detect with Plant Culture-LAMP. For Plant-LAMP, a big limitation is the pathogens quantity in the testing tissues. The misdiagnosis could be occurred due to the small amount of pathogens. Furthermore, some treatments such as heat treatment to the pre-reaction DNA mixture should be needed to consider for avoiding effects of some ingredient(s) in tissues. Another procedure of Plant Extraction-LAMP also has a good sensitivity detection, but it need a higher extra cost. In this study, we found Plant-LAMP is the best procedure in diagnosis of the pathogens in plants for its simplicity and reliability. The bait-based and DNA extraction-based methods were used for diagnosis of the pathogens in soil samples. We found that for the pathogens with considerable rate of

101 growth and zoospore formation, the bait-based method is better for its simplicity and low costs. In the diagnosis of the pathogens in nutrient solution, the Membrane culture-LAMP was used, and the results indicated that it could be the reliable method for monitoring the pathogens in hydroponic culture systems.

In conclusion, LAMP primer sets were designed for specific detection of the five plant- pathogenic oomycetes, with high detection sensitivity. LAMP-based methods can be effectively used for the diagnosis of pathogenic oomycetes in fields and hydroponic culture systems. The methods had greatly enhanced the management and prevention of diseases for tomato, eustoma, lettuce cultivation.

102

SUMMARY

Plant pathogenic oomycetes are globally distributed and can be considered to be one of the most pathogens, particularly in the species of Pythium which usually cause seed, stem and root rot, and seedling damping-off in various crops, and Phytophthora which usually cause extensive damage to economically important crops such as potatoes, tomatoes, peppers, soybeans, and some natural plant communities. Because most of oomycetes can spread rapidly through water, the cultivations of many crops in the fields or hydroponic culture systems have high risks of plant diseases. In order to effectively control these diseases, prevention of the invasion of the pathogens into cultivation facilities and detection of pathogens before diseases occur are extremely important to develop rapid diagnostic methods of the pathogens.

Pythium and Phytophthora species can be isolated and detected using selective media containing antibacterial and antifungal agents. However, this approach cannot distinguish between pathogenic and nonpathogenic Pythium and Phytophthora species that could be present in the same field. It is also difficult to isolate pathogens that grow more slowly than other species of the same genus using these media. Many studies have assessed the use of molecular methods for the initial and rapid detection of fungi, viruses, and other microorganisms, including Pythium and Phytophthora. Common approaches are conventional and real-time PCR. However, the techniques are time-consuming and require expensive specialized equipment that is usually only used in the laboratory. Since the loop-mediated isothermal amplification (LAMP) method was first developed by

Notomi et al. (2000), it has been widely used as an alternative to PCR due to its rapidity, simplicity, and practicality. Although the reaction has high specificity and unlike PCR, it

103 can be performed at a constant temperature. Amplification can be visually observed or measured using the turbidity of the reaction mixture, or by using color indicators.

Moreover, the LAMP reaction is effective even with crude template DNA. Therefore,

LAMP is applicable to field diagnoses using only a simple water bath or heat block. In this study, we developed the simple detection methods of some pathogenic oomycetes from field samples using the LAMP and investigated the ecology of the oomycetes in eustoma, tomato, lettuce and taro cultivation fields.

Pythium irregulare is an important soil-borne pathogen that causes seed, stem and root rot, and seedling damping-off in various crops. Here, we have developed a rapid and reliable method for detecting the pathogen using LAMP with primers designed from the sequences of the Py. irregulare ribosomal DNA internal transcribed spacer region. The specificity of the primers for Py. irregulare was tested using 50 isolates of 40 Pythium species, 11 Phytophthora isolates and 8 isolates of 7 other soil-borne pathogens. The assay showed that the limit of sensitivity of the LAMP method was 100 fg of pure DNA, a similar level to that of PCR. LAMP detected Py. irregulare from the supernatant after mixing culture medium (template DNA source) with distilled water. Similarly, positive results were obtained using a Plant-LAMP method applied to a suspension rotted roots in water. A Bait-LAMP method using the supernatant of autoclaved perilla seeds as bait material incubated in a soil/water mixture for 1 week at 25◦C successfully detected Py. irregulare from the soil. The LAMP assay described in this study is therefore a simple and effective way for practical detection of Py. irregulare.

Hydroponic culture systems are subject to high risks of diseases caused by zoosporic plant pathogens. Control is generally difficult because of the rapid spread of zoospores in the nutrient solutions. Tomato, which are cultivated using the D-tray production system,

104 are vulnerable to diseases caused by Py. aphanidermatum, resulting in a huge losses. We used LAMP to identify potential contamination sources of the pathogen by monitoring their presence in the water supply wells, seedling terraces, nutrient solutions, diseased plants, and ground soils of a tomato greenhouse complex and a eustoma greenhouse complex. The results indicated that the infestation of the pathogen had become established and became more serious, since it may enter the culture systems from the soils around the greenhouses. Invasion of the pathogen most likely occurs when seedlings are moved from the seedling terraces to the greenhouses and sterilization of the hydroponic systems is not sufficient. In addition, for the cultivation of eustoma using hydroponic culture system with nutrient film technique, the pathogenic oomycete Py. irregulare was detected using the LAMP method. The similar results to tomato culture were obtained. Moreover, The results indicate that monitoring the roots of symptomatic and asymptomatic plants are essential steps for early diagnosis of disease occurrence. Therefore, monitoring pathogens in the culture systems and ground soils is very important for the management and prevention of these diseases.

In Kagawa prefecture, Japan, the pathogens Phytophthora pseudolactucae, Py. irregulare, Py. uncinulatum, and Py. spinosum causing huge losses in lettuce production were reported. We used LAMP method is to analyze soils and plants in lettuce fields for the presence of these four pathogens. LAMP primer sets were designed for specific detection of the four pathogens. To develop an effective on-site detection method, we contrasted the Plant-LAMP and Plant Culture-LAMP procedures for plant samples, and five soil DNA extraction methods for soil samples. Plant-LAMP and a Soil DNA Isolation kit were selected to analyze three fields for the pathogen species presence, infected sites, and level of soil contamination. We found that the same wilting symptoms could be

105 caused by Phytophthora or Pythium, or a mixture of species from both genera. Ph. psuedolacticae infects the pith of the lettuce in above-ground parts, whereas Pythium spp. mainly infect roots. Ph. pseudolactucae and Py. uncinulatum caused disease more frequently than the other two pathogens. Furthermore, not all of the pathogens existed in the soil near infected lettuce plants. The results show that the LAMP method can be used to diagnose pathogenic oomycetes in the field, and will be useful in the development of control strategies in lettuce production.

In Japan, Phytophthora colocasiae causes leaf blight of taro and this has resulted in huge losses. We have developed a rapid and reliable method based on LAMP to effectively diagnose this pathogen in the field. Specific LAMP primers were designed to target the Ypt1 gene, and the primers were used to examine genomic DNA from 42 isolates of 39 Phytophthora species, 12 Pythium isolates, 5 Phytopythium isolates, and 8 isolates of another 7 soil-borne oomycetes. The primers were specific for P. colocasiae with a detection limit of 100 fg purified DNA. We tested the LAMP-based methods for detection of the pathogen in infected taro leaves. The approach, which involves mixing infected plant tissues with water, then takes a treatment of the water-plant suspension at 98°C for

8 minutes, followed by direct amplification from the supernatant, showed an accurate detection results in infected taro leaves. Also, it was been demonstrated as the simple and dependable method for the detection of P. colocasiae in taro cultivation fields.

106

ACKNOWLEDGMENTS

I would like to show my deep gratitude to those who give me the assistance and guidance to complete this research thesis. First and foremost, I want to express my special thanks to Prof. Koji Kageyama, my supervisors, for his helpful suggestions and encouragement in every stage of the research and writing of this paper. His keen and vigorous academic observation enlightens me not only in this thesis but also in my future study. Second, I am greatly indebted to my co-supervisor Prof. Haruhisa Suga and Prof.

Katsumi Suzuki for their kindly help and suggestion to his paper. Then, I am extremely thankful to all the members of Kageyama laboratory (Yasushi Ishiguro, Keisuke Hotta,

Hideki Watanabe, Ayaka Hieno, Kayoko Otsubo, Abdul MD Baten, Ziaur MD Rahman,

Auliana Afandi, Emi Murayama, Chasuna, Kensuke Yamada and Daisuke Iijima) for their cooperation, comments, and direct help during the all the time of the research.

For the study of chapter 1, we are grateful to Dr Shiro Fukuta for providing an efficient suggestion about primer design. The study of chapter 2 was funded by “The development of diagnostic manual of high-temperature tolerant Pythium species in hydroponic culture system” project and “The scheme to revitalize agriculture and fisheries in disaster area through deploying highly advanced technology” project of the Japanese Ministry of

Agriculture Forestry and Fisheries. The study of chapter 3 was supported by

“Development of detection and identification techniques of pests” project of the Japanese

Ministry of Agriculture Forestry and Fisheries (Grand No. 15650846). The study of chapter 4 was supported by grants from the Project of the NARO Bio-oriented

Technology Research Advancement Institution (Research program on development of innovative technology). We thank T. Matsuda, H. Shibata, S. Yorozu, T. Nakagawa, Y.

107

Murakami, K. Mouri and S. Yamamoto in Ehime Prefectural Government Agriculture,

Forestry, S. Kurogi, Y. Kushima, K. Kuno and K. Shimoozono in Miyazaki Prefectural

Agricultural Experiment Station, Y. Nishi, K. Nishioka and T. Yuda in Kagoshima

Prefectural Institute for Agricultural Development for providing the diseased taro leaf samples and isolates of Ph. colocasiae.

108

REFERENCES

Agarwal, S. and Grover, A. (2006) Molecular biology, biotechnology and genomics of flooding-associated low O2 stress response in plants. Crit Rev Plant Sci, 25: 1–21.

Ann, P. J., Kao, C. W., & Ko, W. H. (1986). Mating-type distribution of Phytophthora colocasiae in Taiwan. Mycopathologia 93:193-194.

Asano, T., Senda, M., Suga, H., and Kageyama, K. (2010) Development of multiplex PCR to detect five Pythium species related to turfgrass diseases. J

Phytopathol, 158: 609-615.

Atkinson, N. J., and Urwin, P. E. (2012) The interaction of plant biotic and abiotic stresses: from genes to the field. J. Exp. Bot, 63:3523-3543.

Baligar, V. C., and Fageria, N. K. (2015) Nutrient Use Efficiency in Plants: An Overview.

Pages 1-14 in: Nutrient use efficiency: From basics to advances. A. Rakshit, H.B Singh, and A. Sen, eds. Springer India.

Barr, D. J. S., Warwick, S. I. and Desaulniers, N. L. (1997) Isozyme variation, morphology, and growth response to temperature in Pythium irregulare. Can J Bot 75: 1927–1935.

Baten, M. A., Asano, T, Motohashi, K, Ishiguro, Y, Rahman, M. Z., Inaba, S, Suga, H and

Kageyama, K. (2014) Phylogenetic relationships among Phytopythium species, and re- evaluation of Phytopythium fagopyri comb. nov., recovered from damped-off buckwheat seedlings in Japan. Mycol Progress 13:1145–1156.

Becherer, L., Bakheit, M., Frischmann, S., Stinco, S., Borst, N., Zengerle, R., and von

109

Stetten, F. (2018) Simplified real-time multiplex detection of loop-mediated isothermal amplification (LAMP) using novel mediator displacement probes with universal reporters.

Anal. Chem. 90:4741-4748.

Blair, J. E., Coffey, M. D., Park, S. Y., Geiser, D. M. and Kang, S. (2008) A multi-locus phylogeny for Phytophthora utilizing markers derived from complete genome sequences.

Fungal Genet Biol 45: 266–277.

Blok, I. and van der Plaats-niterink, A. J. (978)Pythium uncinulatum sp. nov. and P. tracheiphilum pathogenic to lettuce. Neth J Pl Path 84:135-147.

Boubourakas, I. N., Fukuta, S., and Kyriakopoulou, P. E. (2009) Sensitive and rapid detection of peach latent mosaic viroid by the reverse transcription loop-mediated isothermal amplification. J Virol Methods, 160: 63-68.

Brasier, C. M., Cooke, D. E., Duncan, J. M., and Hansen, E. M. (2003). Multiple new phenotypic taxa from trees and riparian ecosystems in Phytophthora gonapodyides–P. megasperma ITS Clade 6, which tend to be high-temperature tolerant and either inbreeding or sterile. Mycol Res 107: 277-290.

Brooks, F (2005) Taro leaf blight. In: Oomycetes. The American Phytopathological

Society. http://www.apsnet.org/edcenter/intropp/lessons/fungi/Oomycetes/Pages/TaroLeafBlight. aspx. Cited day month 2018.

Byrt, T., Bishop, J., and Carlin, J. B. (1993) Bias, prevalence and kappa. J Clin Epidemiol

46:423-429.

110

Català, S., Pérez-Sierra, A., and Abad-Campos, P. (2015). The use of genus-specific amplicon pyrosequencing to assess Phytophthora species diversity using eDNA from soil and water in northern Spain. PloS one 10: e0119311.

Chamberlain, J. S., Gibbs, R. A., Rainer, J. E., Nguyen, P. N., and Thomas, C. (1988)

Deletion screening of the Duchenne muscular dystrophy locus via multiplex DNA amplification. Nucleic Acids Res. 16:11141-11156.

Chaves, M. M., and Oliveira, M. M. (2004) Mechanisms underlying plant resilience to water deficits: prospects for water-saving agriculture. J. Exp. Bot, 55.407: 2365-2384.

Chen, W, Schneider, R. W. and Hoy, J. W. (1992) Taxonomic and phylogenetic analyses of ten Pythium species using isozyme polymorphisms. Phytopathology 82: 1234–1244.

Cohen, J (1960) A coefficient of agreement for nominal scales. Educ Psychol Meas

20:37–46.

Cook, R. J., Sitton, J. W., Haglund, W. A. (1987) Influence of soil treatments on growth and yield of wheat and implications for control of Pythium root rot. Phytopathology 77:

1192–1198.

Domsch, K. H., Gams, W., and Anderson, T. H. (1980) Compendium of soil fungi. Volume

1. Academic Press (London) Ltd.

Erwin, D. C. and Ribeiro, O. K. (1996) Phytophthora diseases worldwide. APS Press, St.

Paul, MN, USA.

111

Feng, W., Hieno, A., Kusunoki, M., Suga, H.and Kageyama, K. (2018a) LAMP detection of four plant pathogenic oomycetes and its application in lettuce fields. Plant Dis. doi.org/10.1094/PDIS-05-18-0858-RE.

Feng, W., Ishiguro, Y., Hotta K., Watanabe, H., Suga, H.. and Kageyama, K. (2015)

Simple detection of Pythium irregulare using loop-mediated isothermal amplification assay. FEMS Microbiol Lett 362. doi.org/10.1093/femsle/fnv174.

Feng, W., Nukaya, A., Satou, M., Fukuta, N., Ishiguro, Y., Suga H. and Kageyama, K.

(2018b) Use of LAMP detection to identify potential contamination sources of plant- pathogenic Pythium species in hydroponic culture systems of tomato and eustoma. Plant

Dis 102:1357-1364.

Fradin, E. F., and Thomma, B. P. (2006) Physiology and molecular aspects of Verticillium wilt diseases caused by V. dahliae and V. alboatrum. Mol. Plant Pathol. 7:71-86.

Frezzi, M. J. (1956) Especies de Pythium fitopatógenas identificadas en la República

Argentina. - Revta Invest agric, B Aires 10:113-241.

Fry, W. E., and Grünwald, N. J. (2010). Introduction to oomycetes. The Plant Health

Instructor. DOI: 10.1094. The Plant Health Instructor.

Fujinaga, M., Ogiso, H., Tsuchiya, N., and Saito, H. (2001) Physiological specialization of Fusarium oxysporum f. sp. lactucae, a causal organism of Fusarium root rot of crisp head lettuce in Japan. J. Gen. Plant Pathol. 67:205-206.

Fukuta, S., Kato, S., Yoshida, K., Mizukami, Y., Ishida, A. and Ueda, J. (2003) Detection of tomato yellow leaf curl virus by loop-mediated isothermal amplification reaction. J

112

Virol Methods 112: 35–40.

Fukuta, S., Takahashi, R., Kuroyanagi, S., Miyake, N., Nagai, H., Suzuki, H., Hashizume,

F. and Tsuji, T. (2013) Detection of Pythium aphanidermatum in tomato using loop- mediated isothermal amplification (LAMP) with species-specific primers. Eur J Plant

Pathol 136:689–701.

Fukuta, S., Takeyama, K., Suzuki, M., Shichi, A., Ichikawa, K., Nakanishi, H. (2012)

Detection of Kyuri green mottle mosaic virus from soil by the immunocapture reverse transcription loop-mediated isothermal amplification reaction. Plant Pathol J 11:51-59.

Gamo, Y., Tojo M. and Ohki S.T. (2004). Evaluation of selective media using fluazinam or miconazole nitrate for quantitative isolation of Pythium spp. from soil. Japn. J.

Phytopathol., 70: 215-215.

Garzón, C. D., Geiser, D. M. and Moorman, G. W. (2005) Amplified fragment length polymorphism analysis and internal transcribed spacer and coxII sequences reveal a species boundary within Pythium irregulare. Phytopathology 95: 1489–1498.

Garzón, C. D., Yánez, J. M. and Moorman, G. W. (2007) Pythium cryptoirregulare, a new species within the P. irregulare complex. Mycologia 99: 291–301.

Geraats, B. P., Bakker, P. A., Lawrence, C. B., Achuo, E. A., Höfte, M., and Van Loon, L.

C. (2003) Ethylene-insensitive tobacco shows differentially altered susceptibility to different pathogens. Phytopathology. 93:813-821.

Gisi, U., and Sierotzki, H. (2015) Oomycete fungicides: phenylamides, quinone outside inhibitors, and carboxylic acid amides. Fungicide Resistance in Plant Pathogens, Springer,

113

Tokyo. pp:145-174.

Gollifer, D. E., Jackson, G. V. H. and Newhook, F. J. (1980) Survival of inoculum of the leaf blight fungus Phytophthora colocasiae infecting taro, Colocasia esculenta in the

Solomon Islands. Ann Appl Biol 94:379-390.

Goto, M., Honda, E., Ogura, A., Nomoto, A. and Hanaki, K. I. (2009) Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. Biotechniques 46:167-172.

Gómez, E. T. (1925) Leaf blight of gabi. Philipp Agric 14:429-440.

Grover, R K. and Dutt, S., (1973) Morphological and pathological variability in Pythium aphanidermatum. Indian Phytopath 26:237-244.

Hajibabaei, M., Janzen, D. H., Burns, J. M., Hallwachs, W., and Hebert, P. D. (2006) DNA barcodes distinguish species of tropical Lepidoptera. Proc Natl Acad Sci 103:968-971.

Harvey, P. and Lawrence, L. (2008) Managing Pythium root disease complexes to improve productivity of crop rotations. Outlooks Pest Manag 19: 127-129.

He, L., and Xu, H. S. (2011) Development of a multiplex loop-mediated isothermal amplification (mLAMP) method for the simultaneous detection of white spot syndrome virus and infectious hypodermal and hematopoietic necrosis virus in penaeid shrimp.

Aquaculture. 311:94-99.

Hebert, P. D., Stoeckle, M. Y., Zemlak, T. S., and Francis, C. M. (2004) Identification of birds through DNA barcodes. PLoS Biol 2:e312.

114

Hendrix, F. F., & Campbell, W. A. (1973). Pythiums as plant pathogens. Annu Rev

Phytopathol 11:77-98.

Hansen, E. M., Reeser, P. W., and Sutton, W. (2012). Phytophthora beyond agriculture. Annu Rev Phytopathol 50:359-378.

Hodgetts, J., Hall, J., Karamura, G., Grant, M., Studholme, D. J., Boonham, N., Karamura,

E. and Smith, J. J. (2015) Rapid, specific, simple, in-field detection of Xanthomonas campestris pathovar musacearum by loop-mediated isothermal amplification. J Appl

Microbiol 119:1651-1658.

Hong, C., Richardson, P. A., and Kong, P. (2002) Comparison of membrane filters as a tool for isolating pythiaceous species from irrigation water. Phytopathology, 92: 610-616.

Ishiguro, Y., Asano, T., Otsubo, K., Suga, H., and Kageyama, K. (2013) Simultaneous detection by multiplex PCR of the high-temperature-growing Pythium species: P. aphanidermatum, P. helicoides and P. myriotylum. J Gen plant pathol, 79: 350-358.

Ishiguro, Y., Otsubo, K., Watarai, M., Iwashita, T., Tomita, M., Suematsu, M., and

Kageyama, K. (2014) Seedling blight of Glycyrrhiza uralensis caused by Pythium myriotylum, P. aphanidermatum and P. spinosum and identifying primary inoculum sources using multiplex PCR detection. J. Gen. Plant Pathol. 80:230-236.

Iwamoto, T., Sonobe, T. and Hayashi, K. (2003) Loop-mediated isothermal amplification for direct detection of Mycobacterium tuberculosis complex, M. avium and M. intracellulare in sputum samples. J Clin Microbiol 41: 2616-2622.

Jackson, G. V. H. and Gollifer, D. E. (1975) Disease and pest problems of taro (Colocasia

115 esculenta L. Schott) in the British Solomon Islands. Pest Artic News Summ 21:45-53.

Jung, T., Stukely, M. J. C., Hardy, G. S. J., White, D., Paap, T., Dunstan, W. A., and

Burgess, T. I. (2011). Multiple new Phytophthora species from ITS Clade 6 associated with natural ecosystems in Australia: evolutionary and ecological implications. Persoonia: Molecular Phylogeny and Evolution of Fungi 26:13.

Kageyama, K. (2014) Molecular taxonomy and its application to ecological studies of

Pythium species. J Gen Plant Pathol 80: 15-20.

Kageyama, K., Ohyama A. and Hyakumachi M. (1997) Detection of Pythium ultimum using polymerase chain reaction with species-specific primers. Plant Dis 81:1155-1160.

Kaneko, H., Kawana, T., Fukushima, E. and Suzutani, T. (2007) Tolerance of loop- mediated isothermal amplification to a culture medium and biological substances. J.

Biochem. Biophys Method 70: 499-501.

Kanto, T., Usami, T., Uematsu, S., Aino, M., Maekawa, K. and lwamoto, Y. (2005) First report of lettuce Phytophthora wilt in Japan (abstract in Japanese). Jpn. J. Phytopathol.

71:74.

Kitamura, M., Aragane, M., Nakamura, K., Watanabe, K., and Sasaki, Y. (2016)

Development of loop-mediated isothermal amplification (LAMP) assay for rapid detection of Cannabis sativa. Biol. Pharm. Bull. 39:1144-1149.

Ko, W. H. (1979) Mating-type distribution of Phytophthora colocasiae on the island of

Hawaii. Mycologia 71:434-437.

116

Koike, S. T. (2016) Soilborne diseases of vegetable crops. Crops and Soils. 49:42-44.

Kroon, L. P. N. M., Bakker, F. T., Van Den Bosch, G. B. M., Bonants, P. J. M., and Flier,

W. G. (2004) Phylogenetic analysis of Phytophthora species based on mitochondrial and nuclear DNA sequences. Fungal Genet Biol 41:766-782.

Kubota, R., and Jenkins, D. M. (2015) Real-time duplex applications of loop-mediated amplification (LAMP) by assimilating probes. Int. J. Mol. Sci. 16:4786-4799.Kusunoki,

M. 2012. Damping off of Lettuce Caused by Pythium spp. (in Japanese). Japan Plant

Protection Association. 66:96.

Kurogi, S. (2017) The occurrences of taro leaf blight caused by Phytophthora colocasiae in Miyazaki prefecture and its control measures (in Japanese). Plant Prot 71:458-462.

Landis, J. R. and Koch, G. G. (1977) The measurement of observer agreement for categorical data. Biometrics 33:159-174.

Li, M., Asano, T., Suga, H., and Kageyama, K. (2011) A multiplex PCR for the detection of Phytophthora nicotianae and P. cactorum, and a survey of their occurrence in strawberry production areas of Japan. Plant Dis. 95:1270-1278.

Li, M., Ishiguro, Y., Kageyama, K., and Zhu, Z. (2015) A simple method for normalization of DNA extraction to improve the quantitative detection of soil-borne plant pathogenic oomycetes by real-time PCR. Lett. Appl. Microbiol. 61:179-185.

Li, M., Ishiguro, Y., Otsubo, K., Suzuki, H., Tsuji, T., Miyake, N., Nagai, H, Suga, H., and Kageyama, K. (2014) Monitoring by real-time PCR of three water-borne zoosporic

Pythium species in potted flower and tomato greenhouses under hydroponic culture

117 systems. Eur J Plant pathol, 140: 229-242.

Lim, C. W., Baek, W., Jung, J., Kim, J. H., and Lee, S. C. (2015) Function of ABA in stomatal defense against biotic and drought stresses. Int. J. Mol. Sci, 16:15251-15270.

Lin, M. J. and Ko, W. H. (2008) Occurrence of isolates of Phytophthora colocasiae in

Taiwan with homothallic behavior and its significance. Mycologia 100:727-734.

Lynch, J. M., Lumsden, R. D., Atkey, P. T., and Ousley, M. A. (1991) Prospects for control of Pythium damping-off of lettuce with Trichoderma, Gliocladium and Enterobacter spp. Biol. Fertil. Soils. 12:95-99.

Lévesque, C. A. and De Cock, A. W. A. M. (2004) Molecular phylogeny and taxonomy of the genus Pythium. Mycol Res 108: 1363-1388.

Mahony, J., Chong, S., Bulir, D., Ruyter, A., Mwawasi, K., and Waltho, D. (2013)

Multiplex loop-mediated isothermal amplification (M-LAMP) assay for the detection of influenza A/H1, A/H3 and influenza B can provide a specimen-to-result diagnosis in 40 min with single genome copy sensitivity. J. Clin. Virol. 58:127-131.

Martin, F. N., and Tooley, P. W. (2003). Phylogenetic relationships among Phytophthora species inferred from sequence analysis of mitochondrially encoded cytochrome oxidase

I and II genes. Mycologia 95:269-284.

Matsumoto, C., Kageyama, K., Suga, H. and Hyakumachi, M. (2000) Intraspecific DNA polymorphisms of Pythium irregulare. Mycol Res 104: 1333-1341.

Matsuura, K., Kanto, T., Tojo, M., Uzuhashi, S., and Kakishima, M. (2010) Pythium wilt

118 of lettuce caused by Pythium uncinulatum in Japan. J. Gen. Plant Pathol. 76:320-323.

Mbong G. A., Fokunang C. N., Lum A., Fontem B. M. and Tembe E. A. (2013) An overview of Phytophthora colocasiae of cocoyams: A potential economic disease of food security in Cameroon. Discourse J Agric Food Sci 1:140-145.

McCauley, A., Jones, C., and Jacobsen, J. (2009) Plant nutrient functions and deficiency and toxicity symptoms. Nutrient management module, 9.

Mellow, K. D., Tyson, J. L., Fullerton, R. A., Tugaga, A., and Maslen-Miller, A. (2018)

Mating types of Phytophthora colocasiae on the island of Upolu, Samoa. N Z Plant Prot

71:289-292.

Miles, T. D., Martin, F. N., and Coffey, M. D. (2015) Development of rapid isothermal amplification assays for detection of Phytophthora spp. in plant tissue. Phytopathology,

105:265-278.

Mittler, R. (2006) Abiotic stress, the field environment and stress combination. Trends

Plant Sci, 11:15-19.

Miyaji, H., Kitashiro, A., Kanno, Y., Kawanobu, S. and Terahara, R. (2016) Some properties Phytophthora colocasiae occurred in taro plant of Miyazaki (abstract in

Japanese). Jpn J Phytopathol 82:78.

Miyake, N., Nagai, H., Kato, S., Matsusaki, M., Fukuta, S., Takahashi, R., Suzuki, R. and

Ishiguro, Y. (2017) Practical method combining loop-mediated isothermal amplification and bait trap to detect Pythium helicoides from hydroponic culture solutions. J Gen Plant

Pathol 83:1-6.

119

Mori, Y., Kitao, M., Tomita, N. and Notomi, T. (2004) Real-time turbidimetry of LAMP reaction for quantifying template DNA. J Biochem Biophys Methods 59:145-157.

Mori, Y., Nagamine, K., Tomita, N. and Notomi, T. (2001) Detection of loop-mediated isothermal amplification reaction by turbidity derived from magnesium pyrophosphate formation. Biochem Biophys Res Commun 289:150-154.

Morita, Y. and Tojo, M. (2007) Modifications of PARP Medium Using Fluazinam,

Miconazole, and Nystatin for Detection of Pythium spp. in Soil. Plant Dis 91:1591-1599.

Narula, K. L., and Mehrotra, R. S. (1980) Occurrence of A1 mating type of Phytophthora colocasiae. Indian Phytopathol 33:603-604.

Nath, V. S., Hegde, V. M., Jeeva, M. L., Misra, R. S., Veena, S. S., Raj, M., Unnikrishnan,

S. K. and Darveekaran, S. S. (2014) Rapid and sensitive detection of Phytophthora colocasiae responsible for the taro leaf blight using conventional and real-time PCR assay.

FEMS Microbiol Lett 352:174-183.

Nelson, S., Brooks, F. and Teves, G. (2011) Taro leaf blight in Hawai‘i. Plant Dis Bulletin

71:1-14.

Nordskog, B., Nærstad, R., Herrero, M. L., Sundheim, L., and Hermansen, A. (2008)

Fungal pathogens in Norwegian lettuce fields. ACTA AGR SCAND B-S P. 58:230-235.

Notomi, T., Okayama, H., Masubuchi, H., Yonekawa, T., Watanabe, K., Amino, N. and

Hase, T. (2000) Loop-mediated isothermal amplification of DNA. Nucleic Acids Res 28: e63.

Paulitz, T. C. and Adams K. (2003) Composition and distribution of Pythium

120 communities in wheat fields in eastern Washington state. Phytopathology 93: 867-873.

Quitugua, R. J. and Trujillo E. E. (1998) Survival of Phytophthora colocasiae in field soil at various temperatures and water matric potentials. Plant Dis 82:203-207.

Rahman, M. Z., Uematsu, S., Coffey, M. D., Uzuhashi, S., Suga, H., and Kageyama, K.

(2014) Re-evaluation of Japanese Phytophthora isolates based on molecular phylogenetic analyses. Mycoscience. 55:314-327.

Rahman, M. Z., Uematsu, S., Kimishima, E., Kanto, T., Kusunoki, M., Motohashi, K.,

Ishiguro, Y., Suga, H., and Kageyama, K. (2015) Two plant pathogenic species of

Phytophthora associated with stem blight of Easter lily and crown rot of lettuce in

Japan. Mycoscience. 56:419-433.

Reinhart, K., Bauer, M., Riedemann, N. C. and Hartog, C. S. (2012) New approaches to sepsis: molecular diagnostics and biomarkers. Clin Microbiol Rev 25:609-634.

Rigano, L. A., Marano, M. R., Castagnaro, A. P., Amaral, A. M. D. and Vojnov, A. A.

(2010) Rapid and sensitive detection of citrus bacterial canker by loop-mediated isothermal amplification combined with simple visual evaluation methods. BMC

Microbiol 10:176.

Ristaino, J. B., Madritch, M., Trout, C. L., and Parra, G. (1998) PCR amplification of ribosomal DNA for species identification in the plant pathogen genus Phytophthora. Appl

Environ Microbiol 64:948-954.

Rojas, J. A., Miles, T. D., Coffey, M. D., Martin, F. N. and Chilvers, M. I. (2017)

121

Development and application of qPCR and RPA genus-and species-specific detection of

Phytophthora sojae and P. sansomeana root rot pathogens of soybean. Plant

Dis 101:1171-1181.

Rossman, A. Y. and Palm, M. E. (2006) Why are Phytophthora and other oomycota not true fungi?. Outlooks Pest Manage 17: 217.

Samson, R., Legendre, J. B., Christen, R., Fischer-Le Saux, M., Achouak, W., and Gardan,

L. (2005) Transfer of Pectobacterium chrysanthemi (Burkholder et al. 1953) Brenner et al. 1973 and Brenneria paradisiaca to the genus Dickeya gen. nov. as Dickeya chrysanthemi comb. nov. and Dickeya paradisiaca comb. nov. and delineation of four novel species, Dickeya dadantii sp. nov., Dickeya dianthicola sp. nov., Dickeya dieffenbachiae sp. nov. and Dickeya zeae sp. nov. Int. J. Syst. Evol Microbiol 55:1415-

1427.

Sawada, K., and CHEN, C. C. (1926) On the putrefaction disease of Antirrhinum majus. J

Nat Hist Soc Taiwan 16.

Schena, L., Hughes, K. J. and Cooke, D. E. (2006). Detection and quantification of

Phytophthora ramorum, P. kernoviae, P. citricola and P. quercina in symptomatic leaves by multiplex real‐time PCR. Mol Plant Pathol 7:365-379.

Schroeder, K. L., Okubara, P. A., Tambong, J. T., Lévesque, C. A., and Paulitz, T. C.

(2006) Identification and quantification of pathogenic Pythium spp. from soils in eastern

Washington using real-time polymerase chain reaction. Phytopathol 96: 637-647.

Schwenkbier, L., Pollok, S., König, S., Urban, M., Werres S., Cialla-May, D., Weber, K.

122 and Popp, J. (2015) Towards on-site testing of Phytophthora species. Anal Methods

7:211-217.

Seifert, K. A., Samson, R. A., Houbraken, J., Lévesque, C. A., Moncalvo, J. M., Louis-

Seize, G., and Hebert, P. D. (2007) Prospects for fungus identification using CO1 DNA barcodes, with Penicillium as a test case. Proc Natl Acad Sci 104:3901-3906.

Shen, D., Li, Q., Yu, J., Zhao, Y., Zhu, Y., Xu, H. and Dou, D. (2017) Development of a loop-mediated isothermal amplification method for the rapid detection of Pythium ultimum. Australas Plant Pathol 46: 571-576.

Sims, L. L., Sutton, W., Reeser, P., and Hansen, E. M. (2015) The Phytophthora species assemblage and diversity in riparian alder ecosystems of western Oregon,

USA. Mycologia 107:889-902.

Singh, D., Jackson, G., Hunter, D., Fullerton, R., Lebot, V., Taylor, M., Losefa, T., Okpul,

T. and Tyson, J. (2012) Taro leaf blight—a threat to food security. Agriculture 2:182-203.

Spies, Christoffel, F. J., Mazzola, M. and McLeod, A. (2011b) Characterisation and detection of Pythium and Phytophthora species associated with grapevines in South

Africa. Eur J Plant Pathol 131:103-119.

Spies, Christoffel, F. J., Mazzola, M., Botha, W. J., Langenhoven, S. D., Mostert. and

Mcleod, A. (2011a) Molecular analyses of Pythium irregulare isolates from grapevines in South Africa suggest a single variable species. Fun bio 115: 1210-1224.

Stanghellini, M. E., and Rasmussen, S. L. (1994) Hydroponics. A solution for zoosporic pathogens. Plant Dis 78: 1129–1138.

123

Sung, C. H. and Lu, J. K. (2009) Reverse transcription loop-mediated isothermal amplification for rapid and sensitive detection of nervous necrosis virus in groupers. J virol Methods 159: 206–210.

Takahashi, R., Fukuta, S., Kuroyanagi, S., Miyake, N., Nagai, H., Kageyama, K. and

Ishiguro, Y. (2014) Development and application of a loop-mediated isothermal amplification assay for rapid detection of Pythium helicoides. FEMS Microbiol Lett 355:

28-35.

Tamai, D. (2014) The practical cultivation and technologist training in tomato low node order pinching and high density planting cultivation (In Japanese). Shisetsu-to-Engei 165:

62–65.

Tauzin, A. S., and Giardina, T. (2014) Sucrose and invertases, a part of the plant defense response to the biotic stresses. Front Plant Sci 5.

Teakle, D. S. (1957) Papaw root rot caused by Phytophthora palmivora. - Qd J agric

Sci 14:81-91.

Tomlinson, J. A, Dickinson, M. J. and Boonham, N. (2010) Detection of Botrytis cinerea by loop-mediated isothermal amplification. Lett Appl Microbiol 51:650-657.

Tyson, J. L., and Fullerton, R. A. (2007) Mating types of Phytophthora colocasiae from the Pacific region, India and South-east Asia. Australas Plant Dis Notes 2:111-112.

Van der Plaats-Niterink, A. J. (1981) Monograph of the genus Pythium. Studies in

Mycology, 21. Centraalbureau voor Schimmelcultures, Baarn, The Netherlands.

124

Vasquez, E. A. (1990) Yield loss in taro due to Phytophthora leaf blight. J Root Crops

16:48-50.

Vollenweider, P., and Günthardt-Goerg, M. S. (2005) Diagnosis of abiotic and biotic stress factors using the visible symptoms in foliage. Environ Pollut. 137:455-465.

Wager, V. A. (1931) Diseases of plants in South Africa due to members of the Pythiaceae.

Bull Dep Agric For Un S Afr 105:1-43.

Waggoner, B. M., and Speer, B. R. (1994). Introduction to the Oomycota. University of

California at Berkeley. http://www. ucmp. berkeley. edu/chromista/oomycota. html, 2004.

Wang, W., Vinocur, B., and Altman, A. (2003) Plant responses to drought, salinity and extreme temperatures: towards genetic engineering for stress tolerance. Planta 218 1:1-

14.

Ward, R. D., Zemlak, T. S., Innes, B. H., Last, P. R., and Hebert, P. D. (2005) DNA barcoding Australia's fish species. Philos Trans R Soc Lond B Biol Sci 360:1847-1857.

Watanabe, H., Kageyama, K., Taguchi, Y., Horinouchi, H., and Hyakumachi, M. (2008)

Bait method to detect Pythium species that grow at high temperatures in hydroponic solutions. J Gen Plant Pathol 74:417.

White, T. J., Bruns, T., Lee, S. and Taylor, J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In: Innis MA, Gelfand DH, Sninsky

JJ, White TJ, editors. PCR Protocols: A Guide to Methods and Applications. San Diego:

Academic Press pp. 315-322.

125

Yu, T. F. (1940) A list of important crop diseases occurring in Kiangsu Province (1934-

1937). Lingnan Sci J 19:67-78.

Zhang, K. M., Zheng F. C., Li Y. D., Ann P. J. and Ko W. H. (1994) Isolates of

Phytophthora colocasiae from Hainan Island in China: evidence suggesting an Asian origin of this species. Mycologia 86:108-112.

Zhang, Y., Kiriiwa, Y., and Nukaya, A. (2015) Influence of nutrient concentration and composition on the growth, uptake patterns of nutrient elements and fruit coloring disorder for tomatoes grown in extremely low-volume substrate. Hort J 84:37-45.

126