ABSTRACT REEVES, ELLA ROBYN. Pythium Spp. Associated with Root

ABSTRACT

REEVES, ELLA ROBYN. Pythium spp. Associated with Root Rot and Stunting of Winter Field and Cover Crops in North Carolina. (Under the direction of Dr. Barbara Shew and Dr. Jim Kerns).

Soft red winter wheat (Triticum aestivum) was valued at over $66 million in North Carolina in 2019, but mild to severe stunting and root rot limit yields in the Coastal Plain region during years with above-average rainfall. Pythium irregulare, P. vanterpoolii, and P. spinosum were previously identified as causal agents of stunting and root rot of winter wheat in this region. Annual double-crop rotation systems that incorporate winter wheat, or other winter crops such as clary sage, rapeseed, or a cover crop are common in the Coastal Plain of North Carolina. Stunting and root rot reduce yields of clary sage, and limit stand establishment and biomass accumulation of other winter crops in wet soils, but the role that Pythium spp. play in root rot of these crops is not understood, To investigate species prevalence, isolates of Pythium were collected from stunted winter wheat, clary sage, rye, rapeseed, and winter pea plants collected in eastern North Carolina during the growing season of 2018-2019, and from all crops except winter wheat again in 2019-2020. A total of 534 isolates were identified from all hosts. P. irregulare (32%), P. vanterpoolii (17%), and P. spinosum (16%) were the species most frequently recovered from wheat. P. irregulare (37% of all isolates) and members of the species complex Pythium sp. cluster B2A (28% of all isolates) comprised the majority of isolates collected from clary sage, rye, rapeseed, and winter pea. In experiments on winter wheat, highly aggressive isolates of P. irregulare, P. vanterpoolii, and P. spinosum at 14°C were identified. In vitro growth of these isolates was measured at 14°C and 20°C, and all isolates grew faster at the higher temperature. Experiments also investigated the influence of environment (3 nitrogen levels x 2 temperatures) and pathogen species (P. irregulare, P. spinosum, or P. irregulare + P. spinosum) on disease severity, plant height, root length, and biomass. All inoculation treatments caused severe root rot under all conditions tested, and disease was more severe at 12/14°C than at 18/20°C, but there was no effect of nitrogen application. In experiments on clary sage, P. irregulare and P. spinosum were aggressive pathogens at 18°C and caused moderate root necrosis at 28°C. Isolates representing Pythium sp. cluster B2A caused slight to moderate root necrosis on rapeseed and clary sage at 18°C, but no symptoms on rye or winter pea. Cultivation of winter wheat, clary sage, or rye may maintain or increase populations of P. irregulare and P. spinosum in crop rotation systems, whereas cultivation of clary sage, rye, rapeseed, or winter pea may maintain or increase populations of P. irregulare and Pythium sp. cluster B2A. P. irregulare and P. spinosum were aggressive pathogens of wheat and clary sage at temperatures ranging from 14°C to 18°C, which may explain their frequent recovery from multiple hosts during the winter.

by Ella Robyn Reeves

A thesis submitted to the Graduate Faculty of North Carolina State University in partial fulfillment of the requirements for the degree of Master of Science

Plant Pathology

Raleigh, North Carolina 2020

APPROVED BY:

______Dr. Barbara Shew Dr. Jim Kerns Committee Chair Committee co-chair

______Dr. Christina Cowger Dr. Lindsey Thiessen

DEDICATION

I am dedicating this work to my father, Jeff Reeves. He taught me to pay attention to the details of the world around me, and without his love and guidance I would not be where I am today.

BIOGRAPHY

Ella Robyn Reeves grew up on her family’s farm in Pulaski County, Virginia. Spending time outdoors with animals and plants sparked her interested in the natural sciences, which led her to study plant science at Virginia Tech. There, she obtained two degrees; one in biological sciences and one in environmental horticulture. While at Virginia Tech, Ella got a job in the Virginia Tech Plant Disease Clinic with Mary Ann Hansen and Elizabeth Bush, who inspired her to pursue a career in plant pathology. She accepted an assistantship at NC State University to pursue a M.S. in Plant Pathology under the guidance of Dr. Barbara Shew, which she began in the summer of 2018.

iii

ACKNOWLEDGEMENTS

I have many people to thank but would like to begin by thanking Dr. Barbara Shew for being a wonderful graduate advisor, role model, and overall person. I have learned much under her guidance and am very grateful for my time working with her. I also thank my committee co- chair, Dr. Jim Kerns, for his guidance and support over the last two years. The knowledge, patience, and advice of my committee members, Dr. Christina Cowger and Dr. Lindsey Thiessen, have been integral to the completion of this work, and I have learned much during my time working with them.

Multiple extension specialists, agents, and growers helped tremendously with this work and have been so kind while doing so. I would especially like to thank Dr. Rachel Vann and Richard Rhodes, and members of the Plant Disease and Insect Clinic for their help with sample collection.

I have thoroughly enjoyed and gained much from my coursework at NC State, and would like to thank the multiple professors who have dedicated time to ensuring that students get a great education. I would especially like to thank Dr. Marc Cubeta for making PP 575 a fun and interesting course, and for being a great mentor.

My fellow graduate students, including Alejandro Llanos Melo, Madison Stahr, and Johnny Balidion, have been great friends and mentors. Ian Mellon, Michael Elliot, and Christine Miller have been great lab mates and co-workers, and helped a lot with the completion of this project. I would especially like to thank Christine Miller for the many laughs shared while planting wheat in ~1,100 cone-tainers.

I would also like to thank Mary Ann Hansen and Elizabeth Bush, who introduced me to the field of plant pathology and encouraged me to pursue graduate studies.

Lastly, I would like to thank my family; Eli Reeves, Emma and Derek Brown, and Ann and Jeff Reeves. Their love and encouragement throughout my graduate career has meant so much.

TABLE OF CONTENTS

LIST OF TABLES ...... vi LIST OF FIGURES ...... vii CHAPTER 1: LITERATURE REVIEW ...... 1 REFERENCES ...... 9

CHAPTER 2: Pythium spp. associated with root rot and stunting of winter wheat in North Carolina ...... 15 ABSTRACT ...... 15 INTRODUCTION ...... 16 MATERIALS AND METHODS ...... 18 RESULTS ...... 24 DISCUSSION ...... 28 ACKNOWLEDGEMENTS ...... 32 REFERENCES ...... 33

CHAPTER 3: Pythium spp. associated with root rot and stunting of winter crops in North Carolina ...... 51 ABSTRACT ...... 51 INTRODUCTION ...... 52 MATERIALS AND METHODS ...... 54 RESULTS ...... 58 DISCUSSION ...... 61 ACKNOWLEDGEMENTS ...... 65 REFERENCES ...... 66

LIST OF TABLES

Table 2.1 Species of Pythium isolated from wheat plants exhibiting symptoms of Pythium root rot in eight counties in North Carolina during the winter of 2018-2019 ...... 38

Table 2.2 Sequences of the ITS or COI barcode submitted to GenBank (National Center for Biotechnology Information) for a single isolate representing each species of Pythium isolated from winter wheat in 2019 ...... 39

Table 2.3 Mean percentage of healthy roots, plant height, root length, and biomass of wheat cv. ‘Jagalene’ inoculated with five isolates each of Pythium irregulare, P. spinosum, and P. vanterpoolii ...... 40

Table 2.4 Linear contrasts for effect of inoculation with Pythium irregulare, P. spinosum, and P. vanterpoolii on plant biomass in wheat plants cv ‘Jagalene’...... 42

Table 2.5 Effect of temperature on mean area under the growth curve (AUGC) for 5 isolates of each Pythium irregulare, P. spinosum, and P. vanterpoolii isolated from wheat and grown on V8 juice agar at 14°C or 20°C...... 43

Table 2.6 Linear contrasts for mean area under the growth curve (AUGC) for wheat isolates of Pythium irregulare, P. spinosum, and P. vanterpoolii grown on V8 juice agar at 14°C or 20°C...... 44

Table 3.1 Monthly precipitation totals at the Upper Coastal Plain Research Station in Edgecombe County, NC in the winters of 2018-2019 and 2019-2020 ...... 70

Table 3.2 Average soil temperature by month at the Upper Coastal Plain Research Station in Edgecombe County, NC in the winters of 2018-2019 and 2019-2020...... 71

Table 3.3 Species of Pythium isolated from clary sage in Bertie County, NC in the winters of 2018-2019 and 2019-2020 ...... 72

Table 3.4 Species of Pythium isolated from rye at five counties in NC in the winters of 2018-2019 and 2019-2020 ...... 73

Table 3.5 Species of Pythium isolated from rapeseed at six counties in NC in the winters of 2018-2019 and 2019-2020 ...... 74

Table 3.6 Species of Pythium isolated from winter pea at three counties in NC in the winters of 2018-2019 and 2019-2020 ...... 75

Table 3.7 Sequences submitted to GenBank (National Center for Biotechnology Information) for a single isolate representing each species of Pythium isolated from each host between 2018-2020 ...... 76

LIST OF FIGURES

Figure 2.1 County map of North Carolina. Stars indicate locations where stunted wheat plants were collected for isolation of Pythium spp. in 2019 ...... 45

Figure 2.2 Visual rating scale based on percentage of healthy root systems of wheat cv. ‘Jagalene’ inoculated with isolates of Pythium spp., left to right:1 = fully- developed, white roots (100%), 2 = slight root necrosis and loss of volume throughout the root system (≥ 75% < 100%), 3 = moderate root necrosis and loss of lateral roots (≥ 50% < 754%), 4 = severe root necrosis with loss of lateral roots (≥ 25% < 50%), and 5 = no healthy roots evident or plant death (0%). Note purple discoloration of the lower stem in the picture representing a rating of 4...... 46

Figure 2.3 Symptoms of Pythium root and crown rot on winter wheat in North Carolina, A, Severely affected plants adjacent to healthy plants in Beaufort County, NC on March 29, 2019. Stunted plants (arrow) had necrotic crown tissue, decaying lower leaf sheaths, and sparse root systems; B, Stunted (arrow) and healthy wheat plants in Johnston County, NC on March 6, 2019. Necrosis of the crowns and roots was not observed in stunted plants, but root systems had less volume and fewer fine roots than in healthy plants ...... 47

Figure 2.4 Seedling pathogenicity assays on winter wheat cv. ‘Jagalene’. A, Three seedlings inoculated with a rice grain colonized by Pythium irregulare, bottom right seedling with uncolonized rice grain (control). Seedlings were maintained on moist, sterile filter paper in a moist chamber; B, Severe necrosis of the root tips was observed when a young root came into direct contact with the pathogen-colonized rice grain. Some roots outgrew these symptoms, while others remained severely stunted ...... 48

Figure 2.5 Plant biomass of wheat cv. ‘Jagalene’ inoculated with five isolates each of Pythium irregulare (PiW1-PiW5), P. spinosum (PsW1-PsW5), and P. vanterpoolii (PvW1-PvW5). Data from two trials were analyzed separately using PROC MIXED in SAS 9.4. Means represent average biomass of nine replicate plants. Error bars represent standard deviation. Fisher’s LSD calculated with alpha = 0.01 ...... 49

Figure 2.6 Disease severity measured as percentage of healthy roots (A) and plant biomass (B) on wheat cv. ‘Jagalene’ inoculated with Pythium irregulare, Pythium spinosum, both P. irregulare and P. spinosum, or noninoculated (control) at 12/14°C and 18/20°C. Data from two trials were combined and analyzed using PROC MIXED in SAS 9.4. Letters indicate grouping of least square means within temperature treatments according to Tukey’s Honestly Significant Difference (alpha = 0.05). Uppercase letters indicate grouping within 12/14°C. Lowercase letters indicate grouping within 18/20°C. Error bars represent standard error ...... 50

vii

Figure 3.1 Disease severity caused by 9 isolates of Pythium on clary sage at 18°C and 28°C. Disease severity measured using ordinal rating scale with 1 = healthy white roots and 5 = plant death. *indicates isolate was obtained from roots of healthy plant. ** indicates significant difference in aggressiveness at 18°C compared to 28°C (P < 0.005). Values are means of two trials containing two replicates per trial ...... 78

Figure 3.2 Visual rating scale for the assessment of root rot severity on clary sage. 1 = healthy white roots with fully-developed system, 2 = slight to moderate root necrosis throughout a fully-developed root system, 3 = moderate root necrosis and loss of fine roots, 4 = severe root necrosis with loss of fine roots, and 5 = complete root necrosis, plant dead or death imminent ...... 79

Figure 3.3 Stunted rapeseed was adjacent to plants of a normal size throughout a field in Robeson County, NC sampled in February 2020 ...... 80

Figure 3.4 Species of Pythium isolated from stunted clary sage, rye, rapeseed, and winter pea over the course of two growing seasons. Sampling was conducted between October 2018 and March 2019 (18’) and between December 2019 and February 2020 (19’). Isolates representing <5% of isolates from each host designated as “Pythium spp.” ...... 81

Figure 3.5 Necrosis and constriction of crown tissue on a rapeseed plant seven days after inoculation with P. irregulare. The pathogen was successfully re-isolated from root tissue...... 82

Figure 3.6 Winter pea (A) and rye (B) collected in Lee County, NC in January 2020. Apparently healthy plants (right) and stunted plants with loss of roots and slight necrosis (left) ...... 83

viii

LITERATURE REVIEW

The pathogen The genus Pythium is in the Kingdom Stramenopila, subphyllum Oomycota, and is in the same order (Peronosporales) as the genus Phytophthora. Organisms in the subphyllum Oomycota have biflagellate zoospores, cell walls containing B-glucans and cellulose, and coenocytic hyphae. Members of the genus Pythium are heterotrophic, filamentous, and grow vegetatively as diploid organisms. They reproduce sexually through gametangia (antheridia and oogonia). It has been proposed that the genus contains up to 300 species, but as of 2004, 106 have been classified (Schroeder et al. 2013). Members occupy terrestrial (agricultural fields, forests, grasslands) and aquatic (freshwater streams and lakes) habitats around the world. While the genus is mostly composed of soil saprophytes and plant pathogens, some members are known pathogens of animals and humans (Gaastra et al. 2010). Most plant-pathogenic species have a broad host range (Schroeder et al. 2013). Although many species of Pythium are classified as necrotrophs, some species exhibit hemibiotrophic lifestyles (Latijnhouwers et al. 2003). The Monograph of the genus Pythium completed by J. Van Der Plaats-Niterink is a very useful compilation of information about the pathogenicity and morphology of eighty-five species of Pythium. It contains keys that traditionally have been used to identify species based on morphology of oogonia, antheridia, sporangia, zoospores, and colony morphology on cornmeal agar. Key distinguishing features are the ornamentation of oogonia and shape of sporangia. The production of sporangia often requires water and can be elicited by adding plugs of colonized media to sterile water containing grass leaves. Cornmeal, potato-carrot, and water agar are common culture media used in the isolation of Pythium, and antibiotics and fungicides are often added to suppress the growth of competing organisms. Some species are heterothallic and require an alternate mating type to produce oospores, which complicates identification based on morphology alone (Van Der Plaats-Niterink, 1981). The development of molecular tools such as polymerase chain reaction and primers that amplify the DNA of oomycetes has allowed for more accurate methods of identification and classification of Pythium species. Almost all described species have had at least one locus sequenced for phylogeny. The internal transcribed spacer (ITS) region of the ribosomal DNA (rDNA) and the cytochrome c oxidase subunit I (COI) gene of the mitochondrial DNA (mtDNA) have both been used extensively to identify species. Both regions were sequenced in a large

study by Robideau et al. (2011) using validated isolates to create a comprehensive collection of sequences for identification. This collection is compiled in the Barcode of Life Data System (www.boldsystems.org). The genus has been divided into eleven major clades, designated A-K, based on the sequence of the ITS 1,2 region, 5.8S gene, and large nuclear ribosomal subunit (LSU) (Levesque and de Cock 2004). Many plant pathogenic species are within Pythium clades B, F, and I (Levesque and de Cock 2004; Rojas et al. 2017a). Sequencing the whole genome of Pythium ultimum var. ultimum, a widespread and aggressive plant pathogen, revealed significant differences between this species of Pythium and other oomycete plant pathogens. Notably, the genome of P. ultimum var. ultimum lacked genes encoding RXLR effectors. These effectors are thought to act as avirulence factors in gene-for-gene interactions between a pathogen and its host, and genes predicted to encode them are abundant in the genomes of other aggressive oomycete pathogens, including Phytophthora infestans and Phytophthora ramorum. Other species of Pythium may also lack RXLR effectors, and this may explain, in part, the necrotrophic lifestyle of many members of the genus (Levesque et al. 2010). Plant diseases caused by Pythium spp. are a problem in agricultural production systems worldwide (Martin and Loper 1999). Many Pythium spp. cause damage by infecting juvenile tissue and are considered primary colonizers of young plant tissue. Crop losses in the form of pre- and postemergence damping off, root rot, and plant stunting are common and can be very costly. Infection of the fine roots of mature plants can lead to compromised plant health and reduced yield (Martin and Loper 1999; Schroeder et al. 2013; Van Der Plaats-Niterink 1981). Pythium spp. initiate infection via hyphae or by zoospores in the presence of water and appropriate ions or stimulatory compounds. Zoospores are produced in vesicles formed outside of sporangia, and once released, they can swim to host tissue where they encyst and initiate infection. Oospores, the sexual spores formed by the union of an oogonia and antheridia, act as survival structures under adverse conditions, and in some species can germinate to produce hyphae and sporangia (Schroeder et al. 2013; Van Der Plaats-Niterink 1981). Several species of Pythium may colonize the roots of a single plant (Broders et al. 2007), but the effect of colonization can vary depending on the host and species present. For example, Radmer et al. (2017) found that both P. inflatum and P. acrogynum increased the root length and above-ground biomass of corn in pathogenicity assays. In contrast, they found that P. ultimum var. ultimum and P. irregulare greatly limited root growth under the same conditions. Some

species, like P. vexans on Fraser fir, may live saprophytically on roots and cause little to no damage (Ivors et al. 2008). Pythium group F, which is a member of the unresolved species complex Pythium sp. cluster B2A, is able to infect the roots of tomato plants without eliciting visible symptoms, even when pathogen hyphae penetrate to the stele tissue (Rey et al. 1998). DNA of pathogenic Pythium clades B and F has been detected in the mesocotyls of corn and the hypocotyls of soybean displaying slight to no symptoms (Acharya et al. 2020). Environmental factors, including temperature and moisture, influence the behavior of Pythium spp. and disease caused by these organisms. Temperature can affect the geographic and seasonal diversity and aggressiveness of Pythium spp. (Matthiesen et al. 2016; Toporek and Keinath 2019). A survey of Pythium spp. causing root and stem rot of cucurbits in South Carolina found seasonal variation in the species recovered (Toporek and Keinath 2019). Pythium myriotylum and P. aphanidermatum were the most frequently recovered species between May and September, while P. spinosum and P. irregulare were the most frequently recovered species in November. P. irregulare is known to be more aggressive towards certain hosts at low temperatures, whereas P. aphanidermatum and P. myriotylum are more aggressive at higher temperatures (Martin and Loper 1999). In another study investigating the effects of temperature on the aggressiveness of Pythium spp. recovered from corn seedlings in Iowa, Matthiesen et al. (2016) found that P. torulosum was more aggressive on corn and soybeans at 13°C than at 18°C or 23°C. This species was also the most frequently recovered species from corn seedlings in the early spring when temperatures were between 10 to 16°C. In contrast, P. sylvaticum was more aggressive at 18°C and 23°C than at 13°C, and was recovered at high frequencies from soybean seedlings later in the season when temperatures exceeded 18°C. Variation in temperature preferences within species of Pythium has also been observed (Hodges and Campbell 1994). High soil moisture is generally associated with disease development caused by Pythium spp., as free water is required for the release of infective zoospores (Martin and Loper 1999). Kirkpatrick et al. (2006) found that, in comparison to soil fungi, frequency of Pythium isolation from soybean roots increased under flooded conditions. However, not all species thrive under high moisture, and may be able to cause disease under a variety of environmental conditions. In one study, the aggressiveness of P. irregulare was more affected by temperature than soil moisture, with disease being most severe at 13°C regardless of moisture regime. In contrast, P.

vexans was aggressive at all temperatures tested, but only under a periodically-saturated soil moisture regime (Biesbrock and Hendrix Jr. 1970).

Pythium spp. in agronomic cropping systems Pythium spp. cause damping-off, root rot, and stunting of major agronomic crops in North America. Disease caused by Pythium spp. in wheat and barley has been well documented in the Pacific Northwestern United States (Chamswarng and Cook 1985; Cook et al. 1980; Schroeder et al. 2006), and has been described in Australia (Pankhurst et al. 1995), and the UK (Waller 1979). In the central and eastern dryland regions of Washington state, Pythium mainly causes root rot of spring wheat, though has historically caused disease in winter wheat (Mavrodi et al. 2012, Paulitz et al. 2002). Chamswarng and Cook (1985) identified 10 species pathogenic on wheat in this region, with P. aristosporum, P. volutum, P. ultimum, P. sylvaticum complex, and P. irregulare being the most damaging. Non-lethal infections are common, and compromised root systems lead to reduced nutrient uptake, plant stunting, and reduced yields. Infected roots may appear asymptomatic, complicating diagnosis (Schroeder et al. 2006). Schroeder et al. (2006) successfully developed species-specific primers for nine of the most frequently isolated species of Pythium in Eastern Washington (Paulitz and Adams, 2003) to use in real-time polymerase chain reactions. This method is a rapid way to detect and quantify the pathogen and is a useful tool for diagnosis in that region. Seedling diseases caused by Fusarium, Rhizoctonia, Pythium, and/or Phomopsis were the second most yield-limiting disease in soybeans from 2010 to 2014 in the United States and Canada (Allen et al. 2017). An increased incidence of soybean seedling disease in the Midwestern United States prompted Rojas et al. (2017a) to conduct a large-scale study on oomycetes causing damping-off and root rot of soybean seedlings. This multistate survey in 2011 and 2012 revealed P. sylvaticum, P. oopapillum, P. irregulare, and P. heterothallicum as the predominant species of Pythium recovered from symptomatic seedlings. In pathogenicity assays, the species most aggressive towards soybean were those within clade F and clade B. In another study, eleven different species of Pythium were isolated from diseased corn and soybean seedlings collected in Ohio, with P. dissotocum, P. sylvaticum, P. irregulare, P. torulosum, P. inflatum, and P. ultimum var. ultimum most frequently recovered. When the aggressiveness of isolates towards corn and soybean seedlings was compared, P. ultimum var. ultimum was highly

aggressive on both crops while P. sylvaticum and P. dissoticum were more aggressive on soybean than on corn. Variation in aggressiveness among isolates of P. irregulare was also observed (Broders et al. 2007). In the Eastern United States P. ultimum has been associated with seedling disease on soybean cv. Essex in Virginia (Griffin 1990). In Georgia, P. arrhenomanes, P.graminicola, and P. irregulare were isolated from corn seedlings under a double-crop corn rotation system with a history of yield decline and plant stunting (Sumner et al. 1990) Managing disease caused by Pythium in field crops typically involves the use of fungicides as seed treatments. The phenylamide mefenoxam/metalaxyl, the thiazole carboxamide ethaboxam, and some of the strobilurins (azoxystrobin, trifloxystrobin, pyraclostrobin) are all used singly or in combination to protect corn and soybean seed across North America (Radmer et al. 2017). Wheat seed is routinely treated with metalaxyl or mefenoxam in the Pacific Northwest to protect seedlings from infection by Pythium spp. (Paulitz et al. 2002), as is seed of other crops grown in rotation with wheat (pea, lentil, chickpea, and canola). Recently, isolates of Pythium with reduced sensitivity to metalaxyl have been recovered in fields under a wheat-pulse rotation system in the Pacific Northwest (Chen and Van Vleet 2016), prompting researchers to encourage the use of ethaboxam as an alternative seed treatment (White et al. 2019). While the development of resistance is thought to be less likely when certain fungicides are used as seed treatments (Brantner and Windels 1998), results from some fungicide resistance assays suggest that the repeated use of the same seed treatment may lead to selection for insensitive isolates in the field (Broders et al. 2007). Cultural practices play a role in Pythium community composition and disease incidence. An increased incidence of damping off caused by Pythium spp. has been observed in minimal or zero tillage systems, which are increasingly common across North America (Cook et al. 1980; Radmer et al. 2017; Rojas et al. 2017b). Cover crops used in minimal or zero tillage systems may influence community composition of soilborne pathogens by acting as a “green bridge” between cropping cycles (Bakker et al. 2016). The presence of crop residue can increase soil moisture and decrease soil temperature, creating an optimal environment for infection by Pythium spp. and certain other soilborne pathogens (Pankhurst et al. 1995). Many species of Pythium have a broad host range, but host preferences may influence population abundance and inoculum carry-over in different crop rotation systems. In Iowa, researchers investigated differences in populations of Pythium infecting corn seedlings planted

after rye, camelina, or no cover crop. They detected a greater abundance of Pythium clade B in the roots of corn seedlings planted after rye than in corn seedlings following camelina. Conversely, the roots of corn seedlings following camelina had a greater abundance of Pythium clade F as compared to corn seedlings planted after rye. Root rot incidence was not significantly different between cover crop treatments but shoot dry weight of corn seedlings planted after camelina or no cover crop was greater than when planted after rye. This work suggests that different winter crops or cover crops have the potential to harbor different species of Pythium, which may influence disease in subsequently planted crops (Acharya et al. 2020). Similarly, in another study corn seedlings showed elevated incidence of infection with P. volutum, a member of Pythium clade B, when planted after a rye cover crop in comparison to seedlings planted after no cover crop (Bakker et al. 2017; Lévesque and De Cock 2004). Knowing which species of Pythium are associated with winter cash or cover crops would help growers to avoid practices that may increase seedling diseases in subsequent crops (Bakker et al. 2017). The repeated cultivation of some crops may lead to selection pressure that affects pathogen populations, and, therefore, disease incidence (Sumner et al. 1990; Zhang and Yang 2000). In the North Central United States, isolates of Pythium spp. pathogenic on both corn and soybean were recovered at high frequencies from fields under long term corn-soybean rotations (Zhang and Yang 2000). Environmental and edaphic factors may also have an effect on Pythium populations and disease incidence (Broders et al. 2009; Paulitz and Adams 2003; Rojas et al. 2017b). Soil pH, cation exchange capacity (CEC), and calcium and magnesium content were positively correlated with Pythium species diversity in Ohio (Broders et al. 2009). Disease incidence was negatively correlated with species diversity, and soil cation exchange capacity (CEC) and calcium content had a significant, negative linear relationship with disease incidence. However, none of the individual soil properties accounted for more than 10% of the variation in disease incidence (Broders et al. 2009). Different species of Pythium appear to respond differently to certain edaphic factors. In one study, the abundance of P. sylvaticum was low in soils with high pH (7 to 8) and CEC (30 to 40 meq/100 g), while abundance of P. heterothallicum was high under these same conditions in the Midwestern United States (Rojas et al. 2017b). Host resistance to Pythium spp. has been investigated in numerous crops, including soybean and wheat (Higginbotham et al. 2004; Kumar et al. 1991; Lerch-Olson et al. 2020). Recently, a set of 40 soybean breeding lines chosen for their broad genetic diversity were

screened for resistance to P. lutarium, P. oopapillum, P. sylvaticum, and P. torulosum. Breeding lines differed in their resistance to each species, and a range of responses were observed. Researchers observed differences in seed rot severity as compared to root rot severity within and between species, and concluded that different loci could be contributing to resistance at different physiological stages to the different species of Pythium (Lerch-Olson et al. 2020). In Washington state, researchers studied wheat germ plasm for resistance to Pythium root rot caused by P. debaryanum and P. ultimum in a controlled environment. Highly tolerant and susceptible cultivars were identified, and there was a variation in the response of the different genotypes to the two species (Higginbotham et al. 2004).

Agronomic cropping systems in North Carolina Annual double-crop rotations are common in North Carolina, and often include a crop of winter wheat (Triticum aestivum) followed by a summer planting of soybean or sorghum. Some producers incorporate alternative winter crops, such as clary sage (Salvia sclarea L.), rapeseed (Brassica napus L.), or cover crops into cropping systems that may also include soybean, corn, cotton, sweetpotato or peanut in the overall rotation plan. North Carolina is the largest producer of winter wheat in the Southeast, with production valued at $66 million in 2019 (NASS USDA). Clary sage is a specialty crop grown for the production of sclareolide, which is a fixative used in the fragrance industry, and is grown in place of winter wheat in the northeastern part of the state. Rapeseed is a winter grain crop grown for the production of oil and meal in North Carolina, and 941 hectares were harvested in 2017 (USDA-NASS). In cases when neither wheat, clary sage, nor rapeseed are planted, an increased awareness of the benefits of conservation practices has led to the increased planting of cover crops throughout the winter. According to the USDA Census of Agriculture, 4,930 farms in North Carolina reported planting 195,174 hectares of cover crops in 2017. This is an increase from the 157,201 planted on 4,405 farms in 2012 (USDA-NASS). Small grains including rye, wheat, oats, barley, and triticale, and legumes such as Austrian winter pea, crimson clover, and hairy vetch are all cover crops well suited to North Carolina. Rapeseed grown in monoculture as a cover crop is not common, but the crop is included in cover crop mixes (R. Vann, personal communication). Cover cropping has numerous potential benefits such as reduced soil erosion, increased soil organic matter, soil moisture retention and cover, and addition or removal of nitrogen (Crozier et al. 2014).

Pythium spp. in agricultural systems in North Carolina In a survey for species of Pythium throughout the southeast, eleven species were isolated from soils collected throughout North and South Carolina, with isolates belonging to the P. irregulare-debaryanum complex recovered at the highest frequency (Hendrix and Campbell 1970). In a 3-year survey conducted in North Carolina from 1994 to 1996, P. irregulare and P. spinosum were the most frequently recovered species implicated in causing pod rot of peanut (Hollowell et al. 1998). P. spinosum has been isolated from stevia and peanut samples submitted to the Plant Disease and Insect Clinic at NC State University, and was pathogenic on rye in North Carolina (Lookabaugh et al. 2017). Lookabaugh et al. (2017) were the first to report P. spinosum, P. vanterpoolii, and P. irregulare as causal agents of root rot of winter wheat in North Carolina in 2016. Heavy rainfall due to an El Niño weather pattern that year led to incidences of soil waterlogging throughout the growing season, and patches of severely stunted wheat were observed in multiple fields, especially in the Coastal Plain and Tidewater regions of the state. Despite this work, little is known about populations of Pythium infecting winter wheat and other winter crops in the Southeast. Likewise, the etiology of disease caused by these organisms on winter wheat in North Carolina is not well understood.

Objectives The objectives of this research are to 1) identify species of Pythium causing root rot and stunting of winter wheat in North Carolina and investigate the role of environmental and cultural factors in the development of this disease, and 2) identify Pythium spp. causing root rot and stunting of clary sage, rapeseed and winter cover crops in North Carolina.

REFERENCES

1. Acharya, J., Moorman, T. B., Kaspar, T. C., Lenssen, A. W., and Robertson, A. E. 2020. Cover crop rotation effects on growth and development, seedling disease and yield of corn and soybean. Plant Dis. 104:677-687.

2. Allen, T. W., Bradley, C. A., Sisson, A. J., Byamukama, E., Chilvers, M. I., Coker, C. M., et al. 2017. Soybean yield loss estimates due to diseases in the United States and Ontario, Canada, from 2010 to 2014. Plant Health Prog. 18:19–27.

3. Bakker, M. G., Acharya, J., Moorman, T. B., Robertson, A. E., and Kaspar, T. C. 2016. The potential for cereal rye cover crops to host corn seedling pathogens. Phytopathology 106:591–601.

4. Bakker, M. G., Moorman, T. B., Kaspar, T. C., and Manter, D. K. 2017. Isolation of cultivation-resistant oomycetes, first detected as amplicon sequences, from roots of herbicide-terminated winter rye. Phytobiomes 1:24–35.

5. Biesbrock, J. A., and Hendrix Jr., F. F. 1970. Influence of soil water and temperature on root necrosis of peach caused by Pythium spp. Phytopathology 60:880–882.

6. Brantner, J. R., and Windels, C. E. 1998. Variability in sensitivity to metalaxyl in vitro, pathogenicity, and control of Pythium spp. on sugar beet. Plant Dis. 82:896–899.

7. Broders, K. D., Lipps, P. E., Paul, P. A., and Dorrance, A. E. 2007. Characterization of Pythium spp. association with corn and soybean seedling disease in Ohio. Plant Dis. 91:727– 735.

8. Broders, K. D., Wallhead, M. W., Austin, G. D., Lipps, P. E., Paul, P. A., Mullen, R. W., et al. 2009. Association of soil chemical and physical properties with Pythium species diversity, community composition, and disease incidence. Phytopathology 99:957–967.

9. Chamswarng, C., and Cook, R. J. 1985. Identification and comparative pathogenicity of Pythium species from wheat roots and wheat field soils in the Pacific Northwest. Phytopathology 75:821–827.

10. Chen, W., and Van Vleet, S. 2016. WSU - Chickpea damping-off due to metalaxyl-resistant Pythium: An emerging disease in the Palouse. Washington State University Extension Publications. FS211E.

11. Cook, R. J., Sitton, J. W., and Waldher, J. T. 1980. Evidence for Pythium as a pathogen of direct-drilled wheat in the Pacific Northwest. Plant Dis. 64:102–103.

12. Crozier, C., Hoyt, G., Wagger, M. 2014. Winter Annual Cover Crops. NC State Extension Publications. AG-439-58.

13. Gaastra, W., Lipman, L. J. A., De Cock, A. W. A. M., Exel, T. K., Pegge, R. B. G., Scheurwater, J., et al. 2010. Pythium insidiosum: An overview. Vet Microbiol. 146:1–16.

14. Griffin, G. J. 1990. Importance of Pythium ultimum in a disease syndrome of cv. Essex soybean. Can. J. Plant Pathol. 12:135–140.

15. Hendrix, F. F., and Campbell, W. A. 1970. Distribution of Phytophthora and Pythium species in soils in the continental United States. Can. J. Bot. 48:377–384.

16. Higginbotham, R. W., Paulitz, T. C., Campbell, K. G., and Kidwell, K. K. 2004. Evaluation of adapted wheat cultivars for tolerance to Pythium root rot. Plant Dis. 88:1027–1032.

17. Hodges, C. F., and Campbell, D. A. 1994. Infection of adventitious roots of Agrostis palustris by Pythium species at different temperature regimes. Can. J. Bot. :378–383.

18. Hollowell, J. E., Shew, B. B., Beute, M. K., and Abad, Z. G. 1998. Occurrence of pod rot pathogens in peanuts grown in North Carolina. Plant Dis. 82:1345–1349.

19. Ivors, K. L., Abad, Z. G., and Benson, D. M. 2008. Evaluating the pathogenicity of Pythium vexans isolates from fraser fir in North Carolina. Plant Health Prog. 9:8.

20. Kirkpatrick, M. T., Rupe, J. C., and Rothrock, C. S. 2006. Soybean response to flooded soil conditions and the association with soilborne plant pathogenic genera. Plant Dis. 90:592– 596.

21. Kumar, J., Kaiser, W. J., Hannan, R. M. 1991. Damping-off resistance in chickpeas. Plant Dis. 75:1244-1245.

22. Latijnhouwers, M., De Wit, P. J. G. M., and Govers, F. 2003. Oomycetes and fungi: Similar weaponry to attack plants. Trends Microbiol. 11:462–469.

23. Lerch-Olson, E. R., Dorrance, A. E., Robertson, A. E. 2020. Resistance of the SoyNAM parents to seed and root rot caused by four Pythium species. Plant Dis. 104:2489-2497.

24. Levesque, C. A., Brouwer, H., Cano, L., Hamilton, J. P., Holt, C., Huitema, E., et al. 2010. Genome sequence of the necrotrophic plant pathogen Pythium ultimum reveals original pathogenicity mechanisms and effector repertoire. Genome Biol. 11: R73.

25. Levesque, C. A., de Cock, A. W. A. M. 2004. Molecular phylogeny and taxonomy of the genus Pythium. Mycol. Res. 108:1363-1383.

26. Lookabaugh, E., Shew, B., and Cowger, C. 2017. Three Pythium species isolated from severely stunted wheat during an outbreak in North Carolina. Plant Health Prog. 18:169–173.

27. Martin, F. N., and Loper, J. E. 1999. Soilborne plant diseases caused by Pythium spp.: Ecology, epidemiology, and prospects for biological control. Crit. Rev. Plant Sci. 18:111- 181.

28. Matthiesen, R. L., Ahmad, A. A., and Robertson, A. E. 2016. Temperature affects

aggressiveness and fungicide sensitivity of four Pythium spp. that cause soybean and corn damping off in Iowa. Plant Dis. 100:583–591.

29. Mavrodi, O. V., Walter, N., Elateek, S. Taylor, C. G., Okubara, P. A. 2012. Suppression of Rhizoctonia and Pythium root rot of wheat by new strains of Pseudomonas. Biol. Control. 62:93-102.

30. Pankhurst, C. E., McDonald, H. J., and Hawke, B. G. 1995. Influence of tillage and crop rotation on the epidemiology of Pythium infections of wheat in a red-brown earth of South Australia. Soil Biol. Biochem. 27:1065–1073.

31. Paulitz, T. C., and Adams, K. 2003. Composition and distribution of Pythium communities in wheat fields in Eastern Washington State. Phytopathology 93:867–873.

32. Paulitz, T. C., Smiley, R. W., and Cook, R. J. 2002. Insights into the prevalence and management of soilborne cereal pathogens under direct seeding in the Pacific Northwest, U.S.A. Can. J. Plant Pathol. 24:416–428.

33. Radmer, L., Anderson, G., Malvick, D. M., Kurle, J. E., Rendahl, A., and Mallik, A. 2017. Pythium, Phytophthora, and Phytopythium spp. associated with soybean in Minnesota, their relative aggressiveness on soybean and corn, and their sensitivity to seed treatment fungicides. Plant Dis. 101:62–72.

34. Rey, P., Benhamou, N., and Tirilly, Y. 1998. Ultrastructural and cytochemical investigation of asymptomatic infection by Pythium spp. Phytopathology 88:234-244.

35. Robideau, G. P., De Cock, A. W. A. M., Coffey, M. D., Voglmayr, H., Brouwer, H., Bala, K., et al. 2011. DNA barcoding of oomycetes with cytochrome c oxidase subunit I and internal transcribed spacer. Mol. Ecol. Resour. 11:1002–1011.

36. Rojas, J. A., Jacobs, J. L., Napieralski, S., Karaj, B., Bradley, C. A., Chase, T., et al. 2017a.

Oomycete species associated with soybean seedlings in North America—Part I: Identification and pathogenicity characterization. Phytopathology 107:280–292.

37. Rojas, J. A., Jacobs, J. L., Napieralski, S., Karaj, B., Bradley, C. A., Chase, T., et al. 2017b. Oomycete species associated with soybean seedlings in North America—Part II: Identification and pathogenicity characterization. Phytopathology 107:280–292.

38. Schroeder, K. L., Martin, F. N., de Cock, A. W. A. M., Lévesque, C. A., Spies, C. F. J., Okubara, P. A., et al. 2013. Molecular detection and quantification of Pythium species: Evolving taxonomy, new tools, and challenges. Plant Dis. 97:4–20.

39. Schroeder, K. L., Okubara, P. A., Tambong, J. T., Lévesque, C. A., and Paulitz, T. C. 2006. Identification and quantification of pathogenic Pythium spp. from soils in Eastern Washington using real-time polymerase chain reaction. Phytopathology 96:637–647.

40. Sumner, D., Gascho, G. J., Johnson, A. W., Hook, J. E., and Threadgill, D. E. 1990. Root disease, populations of soil fungi, and yield decline in continuous double-crop corn. Plant Dis. 74:704–710.

41. Toporek, S. and Keinath, A. P. 2019. Time-point field sampling of Pythium spp. pathogenic on cucurbits reveals a seasonal change in species recovery. (Abstr). Phytopathology 109: S2.1.

42. Van Der Plaats-Niterink 1981. Monograph of the genus Pythium. Studies in Mycology No. 21. Centraalbureau Voor Schimmelcultures, Baarn, The Netherlands.

43. Waller, J. M. 1979. Observations on Pythium root rot of wheat and barley. Plant Pathol. 28:17–24.

44. White, D. J., Chen, W., and Schroeder, K. L. 2019. Assessing the contribution of ethaboxam in seed treatment cocktails for the management of metalaxyl-resistant Pythium ultimum var.

ultimum in Pacific Northwest spring wheat production. Crop Prot. 115:7–12.

45. Zhang, B. Q., and Yang, X. B. 2000. Pathogenicity of Pythium populations from corn- soybean rotation fields. Plant Dis. 84:94–99.

CHAPTER 2. Pythium spp. associated with root rot and stunting of winter wheat in North Carolina

ABSTRACT

Soft red winter wheat (Triticum aestivum) was valued at over $66 million in North Carolina in 2019. Mild to severe stunting and root rot limit yields during years with abundant rainfall, especially in eastern NC. Pythium irregulare, P. vanterpoolii, and P. spinosum were previously identified as causal agents of Pythium root rot of wheat in this region. To investigate species prevalence, 114 isolates of Pythium were collected from symptomatic plants collected in 8 counties. Twelve species were recovered, and P. irregulare (32%), P. vanterpoolii (17%), and P. spinosum (16%) were the most common. Pathogenicity screens were performed with select isolates, and slight to severe necrosis of young roots was observed. The aggressiveness of five isolates each of P. irregulare, P. vanterpoolii, and P. spinosum was compared on a single cultivar of wheat at 14°C, and highly aggressive isolates were found within all species. In vitro growth of these isolates was measured at 14°C and 20°C, and all isolates grew faster at the higher temperature. However, the fastest growing isolates at 14°C were among the most aggressive. Experiments investigated the influence of environment (3 nitrogen levels x 2 temperatures) and pathogen species (P. irregulare, P. spinosum, or P. irregulare + P. spinosum) on disease severity, plant height, root length, and biomass. All inoculation treatments caused severe root rot under all conditions tested, and disease was more severe at 12/14°C than at 18/20°C, but there was no effect of nitrogen application.

INTRODUCTION

Winter wheat (Triticum aestivum) is a commodity crop in North Carolina with production valued at $66 million in 2019 (NASS USDA). Lookabaugh et al. (2017) were the first to report Pythium spinosum, P. vanterpoolii, and P. irregulare as causal agents of an outbreak of root rot of wheat in North Carolina in 2016. Heavy rainfall due to an El Nino weather pattern led to prolonged soil saturation throughout the 2015-2016 growing season, and patches of severely stunted wheat were observed in multiple fields in the Coastal Plain and Tidewater counties of the state. Symptoms were often observed in low-lying areas and appeared in the late winter and early spring. Plants suffering from Pythium root rot remained small and stunted, while healthy plants elongated normally. Sparse root systems lacking fine roots are characteristic of the disease, and necrosis of crown tissue and lower leaf sheaths was observed in severe cases. The 2016 outbreak brought attention to a problem that was previously unappreciated, and less widespread cases of Pythium root rot have been observed in North Carolina wheat since then (C. Cowger, unpublished data). The causes and factors contributing to Pythium root rot of winter wheat in North Carolina are not well understood. Disease caused by Pythium spp. in wheat and barley has been well documented in the Pacific Northwest region of the United States, specifically in the eastern dryland region of Washington (Chamswarng and Cook 1985; Cook et al. 1980; Paultiz and Adams 2003; Schroeder et al. 2006). In this region, lack of seedling emergence, root rot, and plant stunting are problems in spring wheat, and their control is particularly important under direct-seeded (no-till) conditions (Mavrodi et al. 2012). Chamswarng and Cook (1985) identified P. aristosporum, P. volutum, P. ultimum, P. sylvaticum complex, and P. irregulare as the most damaging species to wheat in Washington. Paulitz and Adams (2003) found that P. abappressorium sp. nov., P. rostratum, and P. debaryanum were the most abundant species baited from the soil of wheat fields in eastern Washington. Pythium root rot of wheat and barley has also been described in Australia (Pankhurst et al. 1995) and the UK (Waller 1979). Environmental and cultural factors play a role in disease caused by Pythium spp. through their influences on pathogen behavior and host response. Temperature can affect the geographic and seasonal diversity and aggressiveness of Pythium spp. (Matthiesen et al. 2016; Toporek and Keinath 2019). A survey of Pythium spp. causing root and stem rot of cucurbits in South Carolina found seasonal variation in the species recovered (Toporek and Keinath 2019). Pythium

myriotylum and P. aphanidermatum were the most frequently recovered species between May and September, while P. spinosum and P. irregulare were the most frequently recovered species in November. In another study investigating the effects of temperature on the aggressiveness of Pythium spp. recovered from corn seedlings in Iowa, Matthiesen et al. (2016) found that P. torulosum was more aggressive on corn and soybeans at 13°C than at 18°C or 23°C. This species was also the most frequently recovered species from corn seedlings in the early spring when temperatures were between 10 to 16°C. In contrast, P. sylvaticum was more aggressive at 18°C and 23°C than at 13°C, and was recovered at high frequencies from soybean seedlings later in the season when temperatures exceeded 18°C. There is no published literature on the interactions of wheat-infecting Pythium species and temperature in North Carolina. For many species of Pythium, soil moisture is an important factor in disease development as it is critical for the release of infective zoospores, and can influence the production of sporangia and oospores (Martin and Loper 1999; Van Der Plaats-Niterink 1981). Severe cases of Pythium root rot of wheat in North Carolina are often associated with situations of prolonged soil saturation (Lookabaugh et al., 2017; authors’ personal observations). It is unclear whether saturation favors disease directly, by increasing pathogen dispersal and reproduction, or indirectly, through detrimental effects on the plant (Araki et al., 2012). In addition to temperature and soil moisture, tillage practices (Cook et al. 1980; Pankhurst et al. 1995), soil type and fertility, fertilizer source and application method, and soil microbial communities are some of the factors that may influence development of Pythium root rot in the field (Martin and Loper 1999). Symptoms of severe Pythium root rot in North Carolina often are evident around the time of spring nitrogen application (approximately Zadoks growth stage 30), when some plants remain stunted while others take up the nitrogen and undergo stem elongation (C. Cowger, unpublished data). In the Pacific Northwest, fertilizer application and the form of nitrogen influence Pythium root rot in wheat (Smiley et al. 1996). In a long-term study of diseases caused by soilborne pathogens of wheat in Oregon, Pythium root rot was more prevalent in fields where high levels of inorganic nitrogen were applied as compared to fields treated with no nitrogen or organic sources in the form of decaying pea vines or manure. Information on Pythium root rot of wheat in the U.S. Pacific Northwest may not be applicable to the disease in the Mid-Atlantic states due to major differences in production systems. In the Northwest, production is largely concentrated in the relatively dry regions of

eastern Oregon, eastern Washington state, and Idaho. These areas have deep loess soils of varying texture and can receive anywhere from 10 to 60 centimeters (cm) of rain per year, depending on latitude and longitude (PRISM Climate Group, Oregon State University, http://prism.oregonstate.edu, created 2015). Common annual rotation schemes in this region are winter wheat – summer fallow, winter wheat – spring pulse (Paulitz and Adams 2003; Smiley et al. 2016) or, in more northerly areas, winter wheat – pulse or canola – spring wheat (White et al. 2019). In contrast, winter wheat in North Carolina is predominately grown in the Coastal Plain, where soils are generally sandy loams, or the coastal Tidewater zone, which has rich organic soils. Pythium root rot of wheat has only been reported in North Carolina’s eastern region, and not in the Piedmont, where clay loam soils predominate. Annual precipitation in eastern North Carolina averages around 127 cm but can range from 102 to 152 cm per year (PRISM Climate Group, Oregon State University, http://prism.oregonstate.edu, created 2015). Winter wheat in the Coastal Plain or Tidewater region is commonly produced in an annual double crop rotation with a summer crop of soybeans, but not in consecutive years. Multi-year rotation schemes include other winter crops such as clary sage, cover crops such as rye, triticale, or mixed stands, and summer crops such as corn, cotton, peanuts, tobacco, or sweetpotato. Pythium root rot of winter wheat and the environmental and cultural conditions conducive to disease development are understudied in North Carolina. The objectives of this study were to 1) expand on previous sampling and confirm the distribution of species of Pythium infecting winter wheat in North Carolina; 2) compare the aggressiveness and in vitro growth of a subset of isolates representing the most frequently recovered species; and 3) investigate the influence of temperature, pathogen species, and application of nitrogen on disease development.

MATERIALS AND METHODS

Sample collection. Samples were collected from commercial fields and experimental plots in eight North Carolina counties between February and April of 2019 (Fig. 2.1). Counties were in the Coastal Plain (Edgecombe, Duplin, and Johnston), Tidewater (Beaufort, Camden, and Perquimans), and Piedmont (Yadkin and Rowan) regions of the state. The selected sites had stunted wheat plants in widespread patches, which is characteristic of Pythium root rot. Ten to fifteen symptomatic and two asymptomatic wheat plants were collected from scattered locations

at each site. Isolates were also retrieved from samples submitted to the NC State Plant Disease and Insect Clinic. Isolate derivation. Plant roots were washed under running tap water until clear of debris, then rinsed in distilled water and dried with paper towels. Root pieces ranging from 1 to 3 cm in length were cut from each root system, and pieces were rinsed in a beaker of sterile distilled water. Two clumps of 2 to 3 root pieces each were plated onto cornmeal agar (CMA- PARPB) amended with PCNB (100 mg/L), ampicillin (250 mg/L), rifampicin (5 mg/L), Delvocid (50% pimaricin, 10 mg/L), and benomyl (10 mg/L) (Jeffers and Martin 1986) and incubated at 25°C. Root pieces were also plated onto 2% water agar and incubated at 18°C. All plates were incubated for 3 days and checked every 24 hours for growth. Plugs from colonies resembling Pythium spp. were transferred to plates of fresh 2% water agar and immersed in the media to suppress bacterial contamination. Pure cultures were obtained from transfer plates by hyphal tipping onto 60-mm plates of 2% water agar (Van Der Plaats- Niterink 1981). Up to three isolates resembling Pythium spp. were transferred from each plant. For long-term storage at room temperature, four 4-mm plugs from pure cultures were stored in 2 ml microcentrifuge tubes containing two twice-autoclaved hemp seeds and 1 mL of sterile distilled water (Raabe et al., 1973). Identification of Isolates. Isolates were identified by bidirectional sequencing of the ITS 1, 2 and 5.8S region of the ribosomal DNA, or for isolates that did not yield a high quality PCR amplicon of the ITS region, the Cytochrome c oxidase subunit I (COI) of the mitochondrial DNA (Robideau et al. 2011). Genomic DNA was amplified via direct PCR from mycelial tissue using the Thermo Scientific Phire Plant Direct PCR Kit (Thermo Fisher Scientific #F-160S). Pure cultures were grown on potato dextrose agar (Becton, Dickinson, and Company) in 60-mm petri dishes for 5 to 7 days until mycelium was stripped and transferred into a 1.5-µl Eppendorf tube. Mycelium was stored at -20°C until used for template dilution. A sterile toothpick was used to transfer a pinhead-sized volume, approximately 20 mg, of mycelium into 50 µl of nuclease-free water. This template dilution was incubated for 30 minutes and 1 µl was used in a PCR reaction consisting of 25 µl of 2X Phire Plant Direct PCR Master Mix, 22 µl nuclease-free water, and 1 µl each of primer ITS4 (5’ TCCTCCGCTTATTGATATGC) and ITS5 (5’ GGAAGTAAAAGTCGTAACAAGG) (White et al. 1990) or primer OomCoxI- Levup (5’ TCAWCWMGATGGCTTTTTTCAAC) and

OomCoxI-Levlo (5’ CYTCHGGRTGWCCRAAAAACCAAA). Primers were chosen based on their success in previous studies (Del Castillo Munera and Hausbeck 2016; Lookabaugh et al. 2017; Robideau et al. 2011). Thermocycler conditions consisted of an initial denaturation period of 5 minutes at 98°C, 35 cycles of 5 s at 98°C, 5 s at 53°C for the ITS region, or 5 s at 53.8°C for the COI region, 20 s at 72°C, and a final extension of 1 minute at 72°C. Products were loaded onto a 1% agarose gel containing 10 µl SYBR Safe DNA Gel Stain (Invitrogen), and run at 100V for 60 minutes. Products were purified using ExoSAP-IT (Affymetrix) and submitted to Eton Bioscience Inc. for Sanger sequencing. DNA was extracted from stored mycelium of isolates that did not yield a PCR product using the direct method. Extraction was performed using the PUREGENE DNA Isolation Kit for 10 to 20 mg of tissue (Qiagen, Valencia, CA) with a protocol optimized for Phytophthora species (Ivors 2015). A template dilution was prepared by diluting 1 µl DNA in 99 µl dilution buffer (Thermo Fisher Scientific #F-160S), and 1 µl of this dilution was used in a PCR reaction as described above. Sequences were trimmed and aligned using CLC Genomics Workbench; then, the BLAST algorithm was used in the BOLD identification system (The Barcode of Life Data System) to identify isolates to species (Robideau et al. 2011). Identities were determined by matching query sequences to accessions used in the barcoding study by Robideau et al. (2011) that had similarity scores greater than 98%. The identity of select isolates used in pathogenicity assays was confirmed based on morphology of oogonia, antheridia, oospores, and sporangia obtained in a grass-leaf water-blank culture (Abad et al. 1994) and colony morphology on CMA according to the keys of J. Van Der Plaats-Niterink (1981). Pathogenicity assays on wheat. Fifteen isolates, 5 each of P. irregulare, P. spinosum, and P. vanterpoolii, were used for pathogenicity screens on wheat seedlings. These species were selected based on frequency of isolation among the samples collected. Rice-grain inoculum was prepared by combining 25 g long-grain white rice with 18 ml distilled water in a 250 ml flask, autoclaving twice for 45 minutes each, and transferring four 4-mm plugs from the edge of an actively growing Pythium culture on V8 juice agar. Flasks were incubated in the dark at 25°C for five days and shaken daily to promote uniform colonization. Seeds of wheat cultivar ‘Jagalene’ were germinated on moistened, sterile 9-cm filter paper (Fisher Scientific) in a moist chamber and incubated at 18°C. After 48 hours, a colonized rice grain was placed in direct contact with a

young wheat root and the filter paper was moistened with sterile distilled water to maintain a film of free water around the inoculation site. Control seedlings were mock-inoculated with an uncolonized rice grain as positive controls. After 48 hours at 18°C, symptoms ranged from slight to severe root necrosis and stunting. Aggressiveness of isolates on winter wheat. After screening for pathogenicity as described above, the same fifteen isolates were selected for experiments comparing their aggressiveness on wheat. Experiments were conducted in 4 x 20 cm cone-tainers containing a 1:2 v:v mixture of sterile soil/sand. This mix mimicked a loamy sand soil, which is common in fields throughout the Coastal Plain of North Carolina. Inoculum was pathogen-colonized rice grains prepared as previously described. Cone-tainers were prepared by layering a single cotton ball, 140 g of soil mix, 10 pathogen-colonized rice grains, and 20 g soil mix, followed by watering overhead with 20 ml of tap water. Cone-tainers were placed individually into 4 x 2 x 12-inch polyethylene bags containing 80 ml tap water and secured with rubber bands to maintain soil moisture and prevent cross-contamination. All tap water used for watering was pre-chilled to 14°C before application. An additional 20 g of soil mix was added to the top of the cones, and a single, pre-germinated wheat seed was placed in this loose soil. Tap water was lightly sprayed over the soil surface to maintain moisture for plant emergence. Three individual cone-tainers (observations) were grouped together for each of the 16 inoculation treatments (the 15 Pythium isolates plus a noninoculated control) to make an experimental unit, and units were randomized within replicate. Each trial consisted of three replicates that were distributed among two growth chambers and tested simultaneously, and there were two trials in time. The growth chambers were set to 12°C /14°C on a 12-hour night/day cycle. Disease was assessed after 20 days for each observation. Severity was rated using a visual scale based on the presence of necrosis and percentage of healthy root system (0 to 100%). The rating scale was: 1 = fully-developed system of white roots (100%), 2 = slight root necrosis and loss of volume throughout the root system (≥ 75% < 100%), 3 = moderate root necrosis and loss of lateral roots (≥ 50% < 75%), 4 = severe root necrosis with loss of lateral roots (≥ 25% < 50%), and 5 = no healthy roots evident or plant death (0%) (Fig. 2.2). For statistical analyses, the midpoint of the assigned interval of percentage of healthy root system was used in place of the disease severity rating. In addition to disease severity, maximum plant height (length of the

longest leaf), maximum root length (length of the longest root), and biomass (whole-plant fresh weight) were measured for each plant at the end of the experiment. Data were analyzed in SAS 9.4 with PROC MIXED. Replicate was treated as a random effect and isolate was treated as a fixed effect. To test for differences between trials, trial was treated as a fixed effect. There was a significant interaction (P < 0.05) between inoculum x trial on all parameters measured, so data were analyzed separately for each trial. The plots=residualpanel option in PROC MIXED confirmed the normal distribution of residuals. The noninoculated control was omitted from analysis of disease severity data. Ten plants that had poor emergence and remained small (biomass < 0.01 g) throughout the experiment were omitted from the final analysis. Means were compared using Fisher’s Least Significant Difference (LSD) (P < 0.01), and linear contrasts were performed between species to identify differences in biomass. In vitro growth of isolates at two temperatures. The growth of the same 15 isolates used in the aggressiveness experiment was compared in vitro at 14°C and 20°C. A single 4-mm plug was transferred from the edge of an actively growing colony on 2% water agar onto a 100- mm plate of V8 juice agar, 1 cm from the edge of the plate. Plates were sealed with Parafilm, inverted, and incubated in the dark in two growth chambers set to 14°C ± 1°C and 20°C ± 1°C. The experiment had a split-plot design with temperatures as whole plots and isolates as subplots. Three plates of each isolate (observations) were incubated together and isolates were randomized within chamber. Three replicates were conducted over time and the whole experiment was completed twice. Maximum colony growth from the edge of the plug (radius) was measured in millimeters after 24, 48, and 72 hours for each plate. Area under the growth curve (AUGC) was calculated for each isolate x temperature x trial x rep combination and used for analysis in SAS 9.4 with PROC MIXED. Replicate was treated as a random effect and isolate, temperature, and their interactions were treated as fixed effects. To test for differences between trials, trial was treated as a fixed effect. There was no effect (P > 0.05) involving trial, so data from both trials were combined. The plots=residualpanel option in PROC MIXED confirmed the normal distribution of residuals. Least square means were compared using Fisher’s LSD (P < 0.01). Data from experiments comparing the aggressiveness of isolates on winter wheat and in vitro growth were used to calculate Spearman’s correlation coefficients (PROC CORR) in SAS 9.4. Mean

percentage of healthy roots, plant height, root length, biomass, and AUGC at 14°C and 20°C for each of the fifteen isolates were used in the analysis. Effect of temperature, pathogen species, and level of nitrogen on disease. A single isolate each of P. irregulare (P. irregulare-1) and P. spinosum (P. spinosum-2) was used for experiments assessing the influence of temperature, pathogen species, and level of nitrogen on disease severity. Experiments were conducted in 4 x 20 cm cone-tainers containing pasteurized field soil collected in Edgecombe County, NC. The soil was a Norfolk loamy sand with pH ranging between 5.5 to 6.0 and a cation exchange capacity (CEC) of ~4.0 and was steam- pasteurized for a minimum of 200 minutes at a temperature > 82°C. Inoculum was pathogen- colonized rice grains prepared as previously described. Cone-tainers were prepared by layering a single cotton ball, 140 to 150 g of soil, 10 pathogen-colonized rice grains, and 12 to15 g soil. Cone-tainers were then watered with 20 to 40 ml of tap water and placed separately into 4 x 2 x 12-inch polyethylene bags containing 60 to 80 ml tap water to maintain soil moisture and prevent cross-contamination. After an additional 12 to 15 g of soil was added to the top of the cones, a single pre-germinated wheat seed was placed into this loose soil and tap water was lightly sprayed over the soil surface. Nitrogen treatments (0, 1x or 2x) were established by addition of granular fertilizer containing 34-0-0 nitrogen (25% urea, 9% ammonium) with 11% sulfur (Camp fertilizer) dissolved in distilled water. The solution was pipetted immediately after mixing into individual cone-tainers. For a solution with application rate equivalent to 16.8 kg/hectare nitrogen (1x rate), 1 g of fertilizer was dissolved in 161 ml distilled water, and 1 ml of this solution was added to each cone-tainer. The amount of dissolved fertilizer was doubled for a solution with application rate equivalent to 33.6 kg/hectare (2x rate). To test for the influence of nitrogen application on soil pH, a single cone-tainer representing each nitrogen x temperature treatment was included as a “destructive sample” in the first run of the experiment. The top 2 inches of soil were collected from each destructive sample 10 days after treatment, and the pH was measured in a 1:2 soil:distilled water solution using a hand-held probe (Oakton pHTestr 30). In the first run of the experiment, the pH of soil for each nitrogen x temperature treatment was also measured after 20 days when disease severity was assessed. The experimental design was a split-plot with two individual diurnal growth chambers set to 12/14°C and 18/20°C 12-hour night/day as whole plots. The humidity in the chambers was

maintained at 60%. Randomized subplots contained five individual cone-tainers (observations) for each combination of 4 inoculum treatments (P. irregulare, P. spinosum, P. irregulare + P. spinosum, and noninoculated control) and 3 rates of nitrogen. Three replicate trials were conducted in time with a 2- to 4-week lag between each, and the whole experiment was conducted twice. Disease was assessed after 20 days for each observation and replicate. Disease severity, maximum plant height, maximum root length, and biomass were measured as previously described. Data were analyzed in SAS 9.4 with PROC MIXED. Temperature, rate of nitrogen, inoculum, and their interactions were treated as fixed effects, and replicate was treated as a random effect. To test for trial effects, trial was treated as a fixed effect. There was no effect (P > 0.05) involving trial on any parameters measured, so data from both trials were combined and trial and interactions involving trial were treated as random effects. The plots=residualpanel option in PROC MIXED confirmed the normal distribution of residuals. Least square means were compared using Tukey’s Honestly Significant Difference (P < 0.05) where appropriate. Spearman’s correlation coefficients were calculated using PROC CORR.

RESULTS

Isolate collection. Severity of root rot varied by location. Severely stunted plants exhibiting root rot, major loss of fine roots, and crown necrosis were recovered from a site in Beaufort County, NC (Figure 2.3). This site had a history of severe Pythium root rot in years with abundant rainfall. Samples submitted to the Plant Disease and Insect Clinic from a single site each in Duplin and Perquimans counties were severely stunted and had severe root and crown rot similar to plants recovered in Beaufort County. Pythium was frequently isolated from the roots and crowns of severely symptomatic plants, and oospores were observed in the lower leaf sheaths and fine roots of many of these plants. Stunting in the field was often in low-lying or poorly drained areas. Moderate symptoms were observed at sites in Johnston and Edgecombe counties, with symptomatic plants displaying slight root necrosis and loss of fine roots. Few sites, such as one in Yadkin County in the Piedmont region, had slightly stunted plants that did not exhibit notable loss of fine roots or necrosis, and few plants collected at that site yielded Pythium.

In total, 114 isolates of Pythium were identified from the roots and crowns of wheat (Table 2.1). At least one isolate identified as Pythium was recovered from 68% of wheat plants collected during sampling. The most frequently recovered species were P. irregulare (32% of isolates), P. vanterpoolii (17% of isolates), and P. spinosum (16% of isolates). Pythium mamillatum (11% of isolates) and members of the species complex Pythium sp. cluster B2A (8% of isolates) were the next most abundantly recovered species. Six isolates of P. attrantheridium were recovered from plants collected at a single site in Rowan County. Four or fewer isolates of six additional species were recovered. In some cases, two isolates of different species co-infected a root system, but no patterns in coinfection by the same pairs of species were found. Two isolates of P. mamillatum and a single isolate each of P. irregulare, and P. vanterpoolii were identified from the root systems of apparently healthy plants that were not necrotic. In addition to the 114 isolates identified as Pythium, eight isolates were suspected to be members of the genus based on morphological characteristics, but did not yield a quality PCR product for sequencing of the ITS or COI region and were not identified. In addition to Pythium spp., isolates of Mortierella spp. were frequently recovered on CMA-PARPB and on WA, and 10 to 12 isolates of Rhizoctonia spp. were recovered on WA. A single isolate of Aphanomyces cladogamus was isolated from the roots of a stunted plant obtained from Johnston County. Sequences of the ITS or COI region for single isolates of Pythium spp. representing each species recovered were deposited into GenBank under accessions MT968520 to MT968531 (Table 2.2). Pathogenicity assays on wheat. Symptoms on inoculated seedlings ranged from slight to severe root necrosis and stunting. Severe root tip necrosis was observed where young roots came into direct contact with the colonized rice grain. Little to no necrosis was observed on mature root tissue, and in some cases the young root would continue to grow and recover from initial necrosis of the root tip (Fig. 2.4). All 15 isolates used in the subsequent experiments caused slight to severe necrosis. Aggressiveness of isolates on winter wheat. Symptoms on inoculated wheat plants ranged from slight root necrosis and loss of fine roots to severely necrotic and compromised root systems. Severely necrotic root tissue was often thickened and lignified compared to healthy tissue. In plants with a root rot rating of 3 or greater, a color change in the lower stem tissue was often observed (Fig. 2.2). Along with chlorosis, this purple discoloration was also observed on the leaf tips of severely stunted plants. Severely affected plants often had a spindly appearance,

and in some cases, the first true leaf was twisted. Despite being grown in wet soil, noninoculated wheat plants had healthy white root systems that grew to the full capacity of the cone-tainers. Disease was more severe in trial 2 as compared to trial 1 (Table 2.3). Averaged across all inoculation treatments, mean percentage of healthy roots was 59.9% in trial 1 compared to 57.4% in trial 2, and mean biomass was 0.38 g in trial 1 compared to 0.31 g in trial 2. The isolate x trial effect was significant for percentage of healthy roots (P = 0.0148), plant height (P < 0.0001), root length (P < 0.0001), and biomass (P < 0.0001). Some isolates, such as P. vanterpoolii-5, differed in aggressiveness by trial, making it difficult to draw conclusions about the most aggressive isolates (Figure 2.5). However, isolates P. irregulare-3, P. spinosum-4, and P. vanterpoolii-4 were consistently among those that caused the greatest reduction in plant biomass, percentage of healthy roots, plant height, and root length in each trial (Table 2.3, Fig. 2.5). Variation in isolate aggressiveness between and within species was observed. When isolate data were averaged by species, isolates of P. spinosum and P. irregulare caused a greater reduction in plant biomass than isolates of P. vanterpoolii in trial 1 (Table 2.4). Isolate P. vanterpooli-4 was significantly more aggressive in reducing plant biomass and plant height than other members of the same species in trial 1 (Table 2.3). In trial 2, the biomass of all inoculated plants was reduced compared to the noninoculated control, and when data were averaged by species, isolates of P. spinosum were more aggressive than those of P irregulare and P. vanterpoolii (Table 2.3, Table 2.4). When data from both trials were combined (n = 96) all plant variables were highly and positively correlated (P < 0.0001). The rating of percentage of healthy roots was correlated with plant height (r = 0.570), root length (r = 0.728), and biomass (r = 0.718). Root length was also correlated with plant height (r = 0.613) and biomass (r = 0.757); plant height and biomass also were correlated (r = 0.869). In vitro growth of isolates at two temperatures. Area under the growth curve was consistent between replicates and trials. The effects of isolate, temperature, and their interaction were significant (P < 0.0001), but all isolates grew faster at 20°C than at 14°C. When averaged for each isolate, AUGC at 14°C and 20°C was highly correlated (r = 0.997, P < 0.0001, n = 15). AUGC for isolates belonging to the same species was not different according to Fisher’s LSD (alpha = 0.01), with the exception of isolate P. vanterpoolii-4. This isolate grew more rapidly than other isolates of P. vanterpoolii (Table 2.5). When AUGC was averaged within species, P.

spinosum had the fastest growth rate at both temperatures (Table 2.6). In few instances, isolates of P. spinosum reached maximum growth (to the edge of the plate) after 72 hours at 20°C. When all data from the aggressiveness trials and the in vitro trials were combined, there was moderate negative correlation between AUGC at 14°C and percentage of healthy roots (r = - 0.380, P = 0.038). Isolates that had the greatest AUGC at 14°C (P. irregulare-3, P. spinosum-4, and P. vanterpoolii-4) were also the most aggressive isolates in the inoculation trials at that temperature (Table 2.3, Table 2.5). Effect of temperature, pathogen species, and level of nitrogen on disease. Inoculated plants displayed symptoms similar to those described above. The pathogen was successfully re- isolated from inoculated plants, but not from the noninoculated controls. Inoculated plants had sparse root systems, with severe necrosis of the root tips and lack of fine root development. All inoculated plants had a decrease in the percentage of healthy roots (P = 0.0027), root length (P = 0.0271), and plant height (P = 0.0091). The greatest disease severity (48.5% of healthy root system) was recorded for plants inoculated with P. irregulare at 12/14°C (Fig. 2.6A). The interaction between inoculum x temperature was significant for biomass (P = 0.0256), and biomass was reduced at 12/14°C compared to 18/20°C within the inoculation treatments P. irregulare + P. spinosum (P = 0.032), P. spinosum (P = 0.030), and noninoculated (P = 0.0042). The negative effects of low temperature on biomass were less marked in the treatment with P. irregulare (P = 0.0537; Fig. 2.6B). Severe stunting and chlorosis were less prevalent in the plants that received nitrogen than in those that did not, but there was no effect of nitrogen application on any parameters measured. In general, plants were darker green and had less chlorosis of the leaf tips with application of the 1x and 2x rate of nitrogen than in the no-nitrogen treatment, but for inoculated plants these above-ground differences were not associated with a corresponding increase in the percentage of healthy roots, plant height, root length, or biomass (P > 0.05). Nitrogen application led to a slight (0.2-0.5 pH units) increase in soil pH, but on average pH remained between 5.5 and 6.5. When data from both trials were combined (n = 144), there was a significant positive correlation (P < 0.0001) between percentage of healthy roots and biomass (r = 0.758), root length (r = 0.752) and plant height (r = 0.646). There was also a significant positive correlation (P < 0.0001) between root length and plant height (r = 0.693) and biomass (r = 0.837). Plant height and biomass (r = 0.914) were also highly correlated (P < 0.0001).

DISCUSSION

Pythium root rot can be a common problem in winter wheat in eastern North Carolina, especially in years with above-average rainfall. The results of this study expand on and support earlier findings that P. irregulare, P. spinosum, and P. vanterpoolii are the main causal agents of Pythium root rot of winter wheat in North Carolina (Lookabaugh et al. 2017). P. irregulare was found in all counties sampled, whereas P. spinosum and P. vanterpoolii were not as widespread. P. irregulare is common in agricultural production systems worldwide. It causes disease on a wide range of hosts, including wheat (Hendrix and Campbell 1970; Van Der Plaats-Niterink 1981; Pankhurst et al. 1995; Paulitz et al. 2002; You et al. 2017). P. spinosum has not been associated with root rot of wheat elsewhere in the United States but was as aggressive as P. irregulare in this study. It is frequently recovered from soybean seedlings across the Midwest (Rojas et al. 2017a), and along with P. irregulare, was the most frequently recovered Pythium species causing pod rot of peanut in North Carolina (Hollowell et al. 1998). P. vanterpoolii has not been reported as a pathogen of wheat in the Pacific Northwest, but has been isolated from soybean seedlings in the Midwest (Rojas et al. 2017a). Coinfections of wheat roots by different species of Pythium were observed in this study, as previously reported from corn and soybean (Broders et al. 2007). Overall, twelve species of Pythium were recovered from wheat roots in this survey. After the three most abundant species, P. mamillatum and members of the species complex Pythium sp. cluster B2A were the next most frequently recovered. P. mamillatum has been reported as a pathogen of wheat in Australia, but not in the United States. The species complex Pythium sp. cluster B2A includes P. coloratum, P. diclinum, P. cf. dictyosporum, P. dissotocum, P. lutarium, P. sp. ‘Group F’ and P. sp. ‘tumidum’ (Robideau et al. 2011), and was isolated at a high frequency from the roots of other winter crops in North Carolina in the winters of 2018-2019 and 2019-2020 (E. Reeves, unpublished data). The pathogenicity of these species on winter wheat should be investigated further. Six or fewer isolates of seven additional species were recovered. Although the species composition found differed from reports from other regions and crops, the diversity of species observed agreed with previous reports (Broders et al. 2007; Chamswarng and Cook 1985; Rojas et al. 2017a). Mortierella spp. and Rhizoctonia spp. also were recovered from wheat roots, with Mortierella spp. being the most frequently recovered. There is evidence for both synergistic and antagonistic relationships between Pythium and

Rhizoctonia in numerous hosts (Foster et al. 2017; Garcia and Mitchell 1975; Hollowell et al. 1998; Pieczarka and Abawi 1978), but we did not explore these relationships further in this work. Isolation methods did not favor recovery of other fungal root pathogens, such as Fusarium, that may have been present. Colonization of roots by Pythium spp. in the absence of necrosis as observed in this study has been described previously (Rey et al. 1998; Schroeder et al. 2006). Pythium was recovered from several apparently healthy plants collected in the field, and asymptomatic colonization of mature root tissue was observed during the pathogenicity screens. We suspect that some species of Pythium colonize the roots of wheat plants without causing extensive damage, and that stress from wet soils and low temperatures is critical to disease development. In our experiments the roots of noninoculated wheat plants were healthy despite being grown at low temperatures in wet soils, which suggests that these stressors alone do not cause visible damage to wheat. However, wheat root growth, shoot growth, and respiration are severely compromised in waterlogged soils, and the effects of waterlogging can have negative impacts on plant health even when aerobic soil conditions are restored. Growth stage influences the ability of a wheat plant to recover from the stress induced by soil saturation, and evidence suggests that recovery is not as successful once a plant has entered the reproductive growth stage (Araki et al. 2012; Malik et al. 2002). Saturated soil and low temperatures may not necessarily be advantageous for the pathogen, though both soil moisture and temperature influence the production of sporangia, zoospores, and oospores for many Pythium spp. (Martin and Loper 1999; Van Der Plaats-Niterink 1981). Results from this work suggest that the combination of wet soils, low temperatures, and colonization of root tissue by Pythium leads to the development of Pythium root rot. In the experiment investigating the influence of pathogen species, temperature, and level of nitrogen in a controlled environment, there were slight differences in symptom severity for wheat plants inoculated with P. irregulare, P. spinosum, or both species. In the experiment comparing the aggressiveness of isolates of P. spinosum, P. irregulare, and P. vanterpoolii, symptom severity on wheat did not differ consistently between and within species, but these results varied by the parameter measured and by trial. This inconsistency made it difficult to distinguish the most aggressive isolates. We propose that plant biomass was the best indicator of disease measured in this study and could be used to further explore differences in aggressiveness within and amongst species. In both experiments, plant biomass and plant height were highly

correlated, suggesting that the measurement of both parameters may not be necessary. Maximum root length was also correlated to plant biomass, though it is important to note the large standard deviation for this parameter within some treatments. We suggest that a visual rating scale for root rot severity and measurement of plant biomass be used in future work to assess disease severity. Variation in aggressiveness within species of Pythium spp. has been demonstrated several times (Broders et al. 2007; Higginbotham et al. 2004). This work further emphasizes the importance of screening a range of isolates before selecting those for use in breeding trials. Little work has been done investigating resistance to Pythium root rot in wheat, but resistant cultivars would be a valuable management tool for growers in the Southeastern United States (P. Murphy, personal communication). In our experiments, disease was more severe at 12/14°C than at 18/20°C, but the in-vitro growth rate of all isolates of P. irregulare, P. spinosum, and P. vanterpoolii was faster at 20°C than at 14°C. There was, however, a positive correlation between pathogen aggressiveness and in-vitro growth rate at 14°C, and the most aggressive isolates at 14°C had the fastest growth rate of their species at this temperature. Slower seedling growth and favorable temperatures for pathogen growth may play a role in the increased severity at the lower temperature. Disease caused by P. irregulare on multiple crops has been reported to be more severe at low temperatures. Ingram and Cook (1990) inoculated winter wheat with P. irregulare and evaluated stunting at five temperatures ranging from 5°C to 25°C. Stunting (measured as length of the first true leaf) was more severe at 5/10°C and less severe at 20°C. In one study, the aggressiveness of P. irregulare on the roots of peach trees was affected more by temperature than soil moisture, with disease being most severe at 13°C regardless of moisture regime. In contrast, P. vexans was aggressive at all temperatures tested, but only under a periodically-saturated soil moisture regime (Biesbrock and Hendrix Jr. 1970). Rojas et al. (2017a) found that both P. spinosum and P. vanterpoolii caused greater seed rot of soybean at 13°C than at 20°C, and only P. vanterpoolii caused disease of soybean seedlings at 20°C. The lack of effect from nitrogen application in this study was unexpected based on field observations. The rate, timing, and form of nitrogen used could have affected results. A commercial granular fertilizer in the form of urea and ammonium was used in our work to mimic common practice in North Carolina. The rates were based on preplant recommendations and were lower than rates applied in the late winter and early spring, when disease usually becomes

apparent. It is important to note that other sources of nitrogen, such as liquid urea-ammonium nitrate and poultry litter, are also used in wheat production systems throughout the state. In order to eliminate natural Pythium inoculum as well as potential competitors, we used a pasteurized field soil in this study. It is possible that microbial activity in natural soil would modify the effects of wet soils, cold temperature, and application of nitrogen on the host or pathogen. Soil microbial composition is known to have an influence on populations of Pythium and disease development, and microbial communities play an important role in nitrogen utilization in the soil (Martin and Loper 1999; Ros et al. 2019, Chun and Lockwood 1985). At higher temperatures, microbial degradation of urea may inhibit pathogen growth and germination through the production of ammonia. Chun and Lockwood (1985) found that populations of P. ultimum decreased with application of urea during the summer months, but not as rapidly or drastically in the fall when temperatures dropped. Recent work has provided insight into how nitrogen source affects the composition of soil microbial communities, and this could be an avenue of further research for management of Pythium root rot of wheat (Caradonia et al. 2019; Gu et al. 2020). Infection of winter wheat by Pythium spp. does not generally affect stand establishment in North Carolina. In our experiments, we planted healthy pregerminated seedlings to avoid loss due to poor seed quality or pre- and post-emergence damping off, but plants were still in the early stages of development. Although severe symptoms of Pythium root and crown rot in North Carolina are seen five to six months after planting, our results provide insights that are applicable to the field setting. Early season infections may compromise plant health and result in increased susceptibility and additional damage by Pythium spp. throughout the growing season. Hering et al. (1987) proposed that Pythium infects wheat embryos within 2 days of planting under optimal conditions in the Pacific Northwest, which can lead to a significant decrease in seedling vigor. If seedlings do not establish a healthy root system when young, ongoing destruction of the fine roots throughout the growing season can result in significant reductions in plant growth and yield (Hering et al. 1987). In North Carolina, the root systems of severely affected plants often were drastically under-developed, suggesting long-term damage starting from seedling infections. In some cases, however, symptoms reflected apparently recent infections of a well-developed root system. Future work should investigate which Pythium spp. infect wheat at different stages of

crop development throughout the growing season and the effects of early infection on subsequent disease severity. Results from this work have increased our knowledge of the etiology of Pythium root rot of wheat in North Carolina and can be used to develop improved management strategies. Aggressive isolates of P. irregulare, P. spinosum, and P. vanterpoolii were identified and could be used to screen wheat cultivars and breeding lines for resistance to Pythium root rot. Where possible, growers may be advised to plant wheat earlier in the fall to allow seedlings to develop a healthy root system before soil temperatures drop and conditions become more conducive to damage by Pythium spp.. Likewise, facilitating soil drainage to prevent the harmful effects of waterlogging and conditions conducive to disease development would be beneficial. A better understanding of which species of Pythium infect other winter crops and rotation crops such as corn and soybean may provide additional insight into the utility of crop rotation as a management strategy.

ACKNOWLEDGEMENTS

The authors thank Dr. Rachel Vann, Rod Gurganus, Tim Hambrick, Tim Britton, Shawn Butler and Mike Munster for assistance with sample collection, Dr. Emma Lookabaugh and Dr. Angela Post for advice on Pythium and wheat production, Dr. Emily Griffith for help with statistical analyses, and Christine Miller, Ian Mellon, Rebecca Whetten, Michael Elliot, and Hailey Shoptaugh for technical assistance. This work was supported by USDA-NIFA project number 1017274-NC02720 and USDA-APHIS award number 2016-0244/15-8130-0596-CA.

REFERENCES

1. Abad Z. G., Shew H. D., Lucas L. T. 1994. Characterization and pathogenicity of Pythium species isolated from turfgrass with symptoms of root and crown rot in North Carolina. Phytopathology 84:913–921.

2. Araki, H., Hossain, M.A., Takahashi, T. 2012. Waterlogging and hypoxia have permanent effects on wheat root growth and respiration. J. Agron. Crop Sci. 198:264–275.

3. Biesbrock, J. A., and Hendrix Jr., F. F. 1970. Influence of soil water and temperature on root necrosis of peach caused by Pythium spp. Phytopathology 60:880–882.

4. Broders, K. D., Lipps, P. E., Paul, P. A., and Dorrance, A. E. 2007. Characterization of Pythium spp. associated with corn and soybean seedling disease in Ohio. Plant Dis. 91:727– 735.

5. Caradonia, F., Ronga, D., Catellani, M., Giaretta Azevedo, C. V., Terrazas, R. A., Robertson- Albertyn, S., et al. 2019. Nitrogen fertilizers shape the composition and predicted functions of the microbiota of field-grown tomato plants. Phytobiomes J. 3:315–325.

6. Chamswarng, C., and Cook, R. J. 1985. Identification and comparative pathogenicity of Pythium species from wheat roots and wheat-field soils in the Pacific Northwest. Phytopathology 75:821–827.

7. Chun, D., and Lockwood, J. L. 1985. Reductions of Pythium ultimum, Thielaviopsis basicola, and Macrophomina phaseolina populations in soil associated with ammonia generated from urea. Plant Dis. 69:154–158.

8. Cook, R. J., Sitton, J. W., and Waldher, J. T. 1980. Evidence for Pythium as a pathogen of direct-drilled wheat in the Pacific Northwest. Plant Dis. 64:102–103.

9. Del Castillo M´unera. J., and Hausbeck, M. k. 2016. Characterization ofPythium species assoiation with greenhouse floriculture crops in michigan. Plant Dis. 100:569-576.

10. Foster, K., You, M. P., Nietschke, B., Edwards, N., and Barbetti, M. J. 2017. Soilborne root disease pathogen complexes drive widespread decline of subterranean clover pastures across diverse climatic zones. Crop Pasture Sci. 68:33–44.

11. Garcia, R., and Mitchell, D. J. 1975. Interactions of Pythium myriotylum with several fungi in Peanut Pod Rot. Phytopathology 65:1375–1381.

12. Gu, Z., Wang, M., Wang, Y., Zhu, L., Mur, L. A. J., Hu, J., et al. 2020. Nitrate stabilizes the rhizospheric fungal community to suppress Fusarium Wilt disease in cucumber. Mol. Plant. Microbe. Interact. 33:590–599.

13. Hendrix, F. F., and Campbell, W. A. 1970. Distribution of Phytophthora and Pythium species in soils in the continental United States. Can. J. Bot. 48:377–384.

14. Hering, T. F., Cook, R. J., and Tang, W. H. 1987. Infection of wheat embryos by Pythium species during seed germination and the influence of seed age and soil matric potential. Phytopathology 77:1104–1108.

15. Higginbotham, R. W., Paulitz, T. C., and Kidwell, K. K. 2004. Virulence of Pythium species isolated from wheat fields in Eastern Washington. Plant Dis. 88:1021–1026.

16. Hollowell, J. E., Shew, B. B., Beute, M. K., and Abad, Z. G. 1998. Occurrence of pod rot pathogens in peanuts grown in North Carolina. Plant Dis. 82:1345–1349.

17. Ingram, D. M., and Cook, R. J. 1990. Pathogenicity of four Pythium species to wheat, barley, peas and lentils. Plant Pathol. 39:110–117.

18. Ivors, K. L. 2015. Laboratory protocols for Phytophthora species. American

Phytopathological Society, St. Paul, MN.

19. Jeffers, S. N., and Martin, S. B. 1986. Comparison of two media selective for Phytophthora and Pythium species. Plant Dis. 70:1038–1043.

20. Lookabaugh, E., Shew, B., and Cowger, C. 2017. Three Pythium species isolated from severely stunted wheat during an outbreak in North Carolina. Plant Heal. Prog. 18:169–173.

21. Malik, A. I., Colmer, T. D., Lambers, H., Setter, T. L., Schortemeyer, M. 2002. Short-term waterlogging has long-term effects on the growth and physiology of wheat. New Phytol. 153: 225-236.

22. Martin, F. N., and Loper, J. E. 1999. Soilborne plant diseases caused by Pythium spp.: Ecology, epidemiology, and prospects for biological control. Crit. Rev. Plant Sci. 18:111- 181.

23. Matthiesen, R. L., Ahmad, A. A., and Robertson, A. E. 2016. Temperature affects aggressiveness and fungicide sensitivity of four Pythium spp. that cause soybean and corn damping off in Iowa. Plant Dis. 100:583–591.

24. Mavrodi, O. V., Walter, N., Elateek, S., Taylor, C. G., and Okubara, P. A. 2012. Suppression of Rhizoctonia and Pythium root rot of wheat by new strains of Pseudomonas. Biol. Control 62:93-102.

25. Pankhurst, C. E., McDonald, H. J., and Hawke, B. G. 1995. Influence of tillage and crop rotation on the epidemiology of Pythium infections of wheat in a red-brown earth of South Australia. Soil Biol. Biochem. 27:1065–1073.

26. Paulitz, T. C., and Adams, K. 2003. Composition and distribution of Pythium communities in wheat fields in Eastern Washington State. Phytopathology 93:867–873.

27. Paulitz, T. C., Smiley, R. W., and Cook, R. J. 2002. Insights into the prevalence and management of soilborne cereal pathogens under direct seeding in the Pacific Northwest, U.S.A. Can. J. Plant Pathol. 24:416–428.

28. Pieczarka, D. J., and Abawi, G. S. 1978. Effect of interaction between Fusarium, Pythium, and Rhizoctonia on severity of bean root rot. Phytopathology 68:403–408.

29. Raabe, R. D., Hurliman, J. H., and Emerson, R. 1973. A storage method for pythiaceous fungi. 2 Int. Congress of Plant Pathology, Minneapolis. Abst. No. 0362.

30. Rey, P., Benhamou, N., and Tirilly, Y. 1998. Ultrastructural and cytochemical investigation of asymptomatic infection by Pythium spp. Phytopathology 88:234–244.

31. Robideau, G. P., De Cock, A. W. A. M., Coffey, M. D., Voglmayr, H., Brouwer, H., Bala, K., et al. 2011. DNA barcoding of oomycetes with cytochrome c oxidase subunit I and internal transcribed spacer. Mol. Ecol. Resour. 11:1002–1011.

32. Rojas, J. A., Jacobs, J. L., Napieralski, S., Karaj, B., Bradley, C. A., Chase, T., et al. 2017a. Oomycete species associated with soybean seedlings in North America—Part I: Identification and pathogenicity characterization. Phytopathology 107:280–292.

33. Ros, M., Almagro, M., Fernandez, J. A., Egea-Gilabert, C., Faz, A., Pascual, J. A. 2019. Approaches for the discrimination of suppressive soils for Pythium irregulare disease. App. Soil Ecol. 147:1-7.

34. Schroeder, K. L., Okubara, P. A., Tambong, J. T., Lévesque, C. A., and Paulitz, T. C. 2006. Identification and quantification of pathogenic Pythium spp. from soils in Eastern Washington using real-time polymerase chain reaction. Phytopathology 96:637–647.

35. Smiley, R. W., Collins, H. P., and Rasmussen, P. E. 1996. Diseases of wheat in long-term agronomic experiments at Pendleton, Oregon. Plant Dis. 80:813–820.

36. Smiley, R. W., Machado, S., Rhinhart, K. E. L., Reardon, C. L., and Wuest, S. B., 2016. Rapid quantification of soilborne pathogen communities in wheat-based long-term field experiments. Plant Dis. 100: 1692-1708.

37. Toporek, S. and Keinath, A. P. 2019. Time-point field sampling of Pythium spp. pathogenic on cucurbits reveals a seasonal change in species recovery. (Abstr). Phytopathology 109:S2.1.

38. Van der Plaats-Niterink, A. J. 1981. Monograph of the genus Pythium. Studies in Mycology No. 21. Centraalbureau Voor Schimmelcultures, Baarn, The Netherlands.

39. Waller, J. M. 1979. Observations on Pythium root rot of wheat and barley. Plant Pathol. 28:17–24.

40. White, T. J., Bruns, T., Lee, S., and Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pages 315-322 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis, D. H. Gelfand, J. J. Sninsky and T. J. White, eds: Academic Press, San Diego, CA.

41. White, D. J., Chen, W., and Schroeder, K. L. 2019. Assessing the contribution of ethaboxam in seed treatment cocktails for the management of metalaxyl-resistant Pythium ultimum var. ultimum in Pacific Northwest spring wheat production. Crop Prot. 115:7-12.

42. You, M. P., Rensing, K., Renton, M., and Barbetti, M. J. 2017. Modeling effects of temperature, soil, moisture, nutrition and variety as determinants of severity of Pythium damping-off and root disease in subterranean clover. Front. Microbiol. 8:1–15.

Table 2.1. Species of Pythium isolated from wheat plants exhibiting symptoms of Pythium root rot in eight counties in North Carolina during the winter of 2018-2019.

Sample Location and Datea Yad Row Edg Joh Bea Dup Cam Per Isolates/ Species of Pythium (3/20) (3/20) (3/06) (3/07) (3/29) (4/19) (4/19) (4/19) spp. P. irregulare 7 4 2 6 9 6 1 1 36 P. vanterpoolii 1 - 2 - 15 - - 1 19

P. spinosum - - 6 1 3 3 1 4 18

P. mamillatum - - - - 12 - - - 12 Pythium sp. cluster B2Ab 1 - 1 1 4 2 - - 9 P. attrantheridium - 6 ------6

P. cryptoirregulare - 2 1 - - 1 - 4 P. sylvaticum 1 - 1 - - - - 2 4 P. inflatum - - - 1 - 1 - - 2 P. rostratifingins 2 ------2

P. minus - 1 ------1

P. ultimum var. ultimum - - 1 - - - - - 1 Isolates by location 12 13 14 9 43 13 2 8 114

aCounties are as follows: Yadkin (Yad), Rowan (Row), Edgecombe (Edg), Johnston (Joh), Beaufort (Bea), Duplin (Dup), Camden (Cam), and Perquimans (Per). Sampling date is month/day. All samples were collected in 2019. bPythium sp. cluster B2A is an unresolved species complex including P. coloratum, P. diclinum, P. cf. dictyosporum, P. dissotocum, P. lutarium, P. sp. ‘Group F’ and P. sp. ‘tumidum’.

Table 2.2. Sequences of the ITS or COI barcode submitted to GenBank (National Center for Biotechnology Information) for a single isolate representing each species of Pythium isolated from winter wheat in 2019.

Sequence Reference Species of Pythium length Accession % Similarity Accession P. irregulare 779 bp HQ643649 100.0% MT968520 P. vanterpoolii 808 bp HQ643951 100.0% MT968521 P. spinosum 841 bp HQ643794 99.8% MT968522 P. mamillatuma 635 bp HQ708732 100.0% MT968523 P. sp. cluster B2A 793 bp HQ643789 99.8% MT968524 P. attrantheridium 758 bp HQ643476 100.0% MT968525 P. cryptoirregularea 637 bp HQ708561 100.0% MT968526 P. sylvaticum 915 bp HQ643850 99.3% MT968527 P. inflatum 764 bp HQ643566 99.7% MT968528 P. rostratifingens 706 bp HQ643764 99.6% MT968529 P. minus 650 bp HQ643696 100.0% MT968530 P. ultimum var. ultimum 830 bp HQ643942 99.9% MT968531 aCOI region sequenced. All other sequences are of the ITS barcode.

Table 2.3. Mean percentage of healthy roots, plant height, root length, and biomass of wheat cv. ‘Jagalene’ inoculated with five isolates each of Pythium irregulare, P. spinosum, and P. vanterpoolii.

Percentage of Isolate healthy roots (%)a Plant height (cm)a Root length (cm)a Biomass (g)a Trial 1 P. irregulare PiW1 51.4 d 10.2 cd 10.8 g 0.20 e PiW2 62.5 abcd 11.4 bcd 22.8 abc 0.38 cd PiW3 56.9 cd 10.1 cd 16.2 def 0.25 de PiW4 59.7 bcd 10.4 cd 18.7 bcde 0.28 de PiW5 59.7 bcd 10.8 bcd 19.8 abcd 0.31 de P. spinosum PsW1 57.0 cd 10.5 cd 11.8 fg 0.27 de PsW2 51.4 d 10.1 cd 15.2 defg 0.28 de PsW3 57.0 cd 11.2 bcd 13.4 efg 0.31 cde PsW4 54.2 d 10.3 cd 17.6 cde 0.28 de PsW5 57.0 cd 11.0 bcd 15.7 defg 0.33 cde P. vanterpoolii PvW1 73.6 a 14.3 a 24.3 a 0.64 b PvW2 70.8 ab 12.4 abc 24.3 a 0.58 b PvW3 62.5 abcd 13.1 ab 19.9 abcd 0.48 bc PvW4 57.0 cd 9.5 d 16.3 def 0.26 de PvW5 68.1 abc 14.5 a 22.3 abc 0.89 a Noninoculated control 100.0 13.9 a 23.8 ab 0.91 a Inoculum effect P = 0.0009 P < 0.0001 P < 0.0001 P < 0.0001

Trial 2 P. irregulare PiW1 57.0 9.7 bcd 18.7 abcd 0.30 bcdef PiW2 56.9 9.2 d 15.9 abcd 0.26 def 40

Table 2.3. (continued) PiW3 51.4 9.2 d 11.6 cd 0.21 ef PiW4 54.2 10.3 abcd 14.3 abcd 0.26 def PiW5 50.0 8.6 d 13.3 bcd 0.21 f P. spinosum PsW1 65.3 11.9 abc 22.0 ab 0.39 bcd PsW2 70.8 12.1 ab 22.8 a 0.43 bc PsW3 55.6 10.2 abcd 14.3 abcd 0.37 bcde PsW4 43.1 8.4 d 10.1 d 0.22 ef PsW5 62.5 12.5 a 20.2 abc 0.46 ab P. vanterpoolii PvW1 54.2 9.6 cd 12.8 bcd 0.26 def PvW2 59.7 9.6 cd 18.3 abcd 0.30 cdef PvW3 70.8 10.7 abcd 18.3 abcd 0.37 bcde PvW4 52.8 10.1 abcd 12.1 cd 0.28 cdef PvW5 57.0 10.4 abcd 15.5 abcd 0.29 cdef Noninoculated control 98.6 11.7 abc 18.9 abcd 0.61 a Inoculum effect P = 0.1207 P = 0.0008 P = 0.0169 P < 0.0001 aValues are means of nine replicate plants. Within each parameter and trial, values followed by the same letter are not significantly different (Fisher’s LSD, alpha = 0.01).

Table 2.4. Linear contrasts for effect of inoculation with Pythium irregulare, P. spinosum, and P. vanterpoolii on plant biomass in wheat plants cv ‘Jagalene’.

Contrasts between species Mean biomass (g)a Difference ± s.e. P > |t| Trial 1 P. irregulare vs. P. spinosum 0.283 – 0.295 -0.012 ± 0.03 0.6665 P. spinosum vs. P. vanterpoolii 0.295 – 0.568 -0.273 ± 0.03 <0.0001 P. vanterpoolii vs. P. irregulare 0.568 – 0.283 0.285 ± 0.03 <0.0001

Trial 2 P. irregulare vs. P. spinosum 0.248 – 0.352 -0.123 ± 0.03 <0.0001 P. spinosum vs. P. vanterpoolii 0.352 – 0.287 0.075 ± 0.03 0.0050 P. vanterpoolii vs. P. irregulare 0.287 – 0.248 0.048 ± 0.03 0.0624 aMean biomass listed in the same order as the contrast.

Table 2.5. Effect of temperature on mean area under the growth curve (AUGC) for 5 isolates of each Pythium irregulare, P. spinosum, and P. vanterpoolii isolated from wheat and grown on V8 juice agar at 14°C or 20°C. AUGC AUGC Isolate 14°Ca 20°Ca P. irregulare PiW1 41.5 b 74.5 b PiW2 41.2 b 74.4 b PiW3 42.0 b 74.8 b PiW4 41.4 b 76.6 b PiW5 38.3 b 72.4 b P. spinosum PsW1 51.3 a 90.0 a PsW2 51.7 a 91.2 a PsW3 51.9 a 91.4 a PsW4 54.6 a 93.5 a PsW5 53.1 a 91.3 a P. vanterpoolii PvW1 19.3 c 42.2 c PvW2 18.3 c 39.7 c PvW3 19.0 c 39.6 c PvW4 40.3 b 77.4 b PvW5 19.3 c 43.5 c

Mean 38.9 71.5 aColony radius measured in (mm) every 24 hours for three days. Letters indicate separation of means within temperature according to Fisher’s LSD (alpha = 0.01).

Table 2.6. Linear contrasts for mean area under the growth curve (AUGC) for wheat isolates of Pythium irregulare, P. spinosum, and P. vanterpoolii grown on V8 juice agar at 14°C or 20°C.

Contrasts between speciesa Mean AUGC (mm)b Difference ± s.e. P > |t| 14°C P. irregulare vs. P. spinosum 40.895 – 52.493 -11.60 ± 0.63 <0.0001 P. spinosum vs. P. vanterpoolii 52.493 – 23.227 29.27 ± 0.63 <0.0001 P. vanterpoolii vs. P. irregulare 23.227 – 40.895 -17.67 ± 0.63 <0.0001 20°C P. irregulare vs. P. spinosum 74.538 – 91.481 -16.94 ± 0.82 <0.0001 P. spinosum vs. P vanterpoolii 91.481 – 48.494 42.99 ± 0.82 <0.0001 P. vanterpoolii vs. P. irregulare 48.494 – 74.538 -26.04 ± 0.82 <0.0001 aColony radius measured in (mm) every 24 hours for three days. Linear contrasts completed in PROC MIXED. Data from both trials combined. bMean AUGC listed in the same order as the contrast.

Figure 2.1. County map of North Carolina. Stars indicate locations where stunted wheat plants were collected for isolation of Pythium spp. in the winter of 2019.

Figure 2.2. Visual rating scale based on percentage of healthy root systems of wheat cv. ‘Jagalene’ inoculated with isolates of Pythium spp., left to right:1 = fully-developed, white roots (100%), 2 = slight root necrosis and loss of volume throughout the root system (≥ 75% < 100%), 3 = moderate root necrosis and loss of lateral roots (≥ 50% < 75%), 4 = severe root necrosis with loss of lateral roots (≥ 25% < 50%), and 5 = no healthy roots evident or plant death (0%). Note purple discoloration of the lower stem in the picture representing a rating of 4.

A B

Figure 2.3. Symptoms of Pythium root and crown rot on winter wheat in North Carolina, A, Severely affected plants adjacent to healthy plants in Beaufort County, NC on March 29, 2019. Stunted plants (arrow) had necrotic crown tissue, decaying lower leaf sheaths, and sparse root systems; B, Stunted (arrow) and healthy wheat plants in Johnston County, NC on March 6, 2019. Necrosis of the crowns and roots was not observed in stunted plants, but root systems had less volume and fewer fine roots than in healthy plants.

A B

Figure 2.4. Seedling pathogenicity assays on winter wheat cv. ‘Jagalene’. A, Three seedlings inoculated with a rice grain colonized by Pythium irregulare, bottom right seedling with uncolonized rice grain (control). Seedlings were maintained on moist, sterile filter paper in a moist chamber; B, Severe necrosis of the root tips was observed when a young root came into direct contact with the pathogen-colonized rice grain. Some roots outgrew these symptoms, while others remained severely stunted.

P. irregulare

P. spinosum

P. vanterpoolii

Figure 2.5. Plant biomass of wheat cv. ‘Jagalene’ inoculated with five isolates each of Pythium irregulare (PiW1-PiW5), P. spinosum (PsW1-PsW5), and P. vanterpoolii (PvW1-PvW5). Data from two trials were analyzed separately using PROC MIXED in SAS 9.4. Means represent average biomass of nine replicate plants. Error bars represent standard deviation. Fisher’s LSD calculated with alpha = 0.01.

Figure 2.6. Disease severity measured as percentage of healthy roots (A) and plant biomass (B) on wheat cv. ‘Jagalene’ inoculated with Pythium irregulare, Pythium spinosum, both P. irregulare and P. spinosum, or noninoculated (control) at 12/14°C and 18/20°C. Data from two trials were combined and analyzed using PROC MIXED in SAS 9.4. Letters indicate grouping of least square means within temperature treatments according to Tukey’s Honestly Significant Difference (alpha = 0.05). Uppercase letters indicate grouping within 12/14°C. Lowercase letters indicate grouping within 18/20°C. Error bars represent standard error.

CHAPTER 3. Pythium spp. associated with root rot and stunting of winter crops in North Carolina

ABSTRACT

Annual double-crop rotation systems that incorporate winter wheat, clary sage, or a cover crop are common in eastern North Carolina. Stunting and root rot of clary sage (Salvia sclarea L.) reduce yields of this crop, especially in wet soils. Stunting and reduced stand establishment also afflict cover crops, including rye, rapeseed, and winter pea. Pythium spp. are causal agents of root rot of winter wheat in this region, but their role in root rot and stunting of other winter crops is not understood. During the growing seasons of 2018-2019 and 2019-2020 samples of clary sage, rye, rapeseed, and winter pea displaying symptoms of stunting were collected across eastern NC, resulting in the recovery of 420 isolates of Pythium from the roots of all hosts. P. irregulare, P. spinosum, and the complex Pythium sp. cluster B2A were the most frequently isolated species from clary sage. P. irregulare and P. spinosum were aggressive pathogens of clary sage at 18°C, and caused moderate root rot at 28°C. Koch’s postulates confirmed that Pythium sp. cluster B2A, P. sylvaticum, P. pachycaule, P aphanidermatum, P. myriotylum, and P. oopapillum are pathogens of clary sage. P. irregulare (37% of all isolates) and members of the species complex Pythium sp. cluster B2A (28% of all isolates) comprised the majority of isolates collected from all hosts and were the most frequently isolated species from rye, rapeseed, and winter pea. In pathogenicity assays, isolates representing P. irregulare and P. spinosum caused slight to moderate root necrosis on rye, rapeseed, and winter pea. Isolates representing Pythium sp. cluster B2A caused slight to moderate root necrosis on rapeseed and clary sage, but no symptoms on rye or winter pea.

INTRODUCTION

Agriculture in North Carolina is highly diversified, with a variety of agronomic and specialty crops grown throughout the state. In eastern North Carolina, annual double-crop rotations are common and often include a crop of winter wheat followed by a summer planting of soybean. Some producers incorporate alternative winter crops, such as clary sage (Salvia sclarea L.) or cover crops into cropping systems that may also include soybean, corn, cotton, sweetpotato, tobacco, or peanut in the overall rotation plan. Clary sage is a valuable specialty crop grown for the production of sclareolide, which is a fixative used in the fragrance industry, and is frequently grown in place of winter wheat in the northeastern part of the state. Clary sage is sown in August, whereas winter wheat is planted in late October, but both crops are harvested in June. Pre- and post-emergence damping-off, root rot, and stunting of clary sage often limit yields of this crop in North Carolina, especially in years with abundant rainfall leading to wet soils. Growers have reported an increase in symptoms of stunting and root rot when clary sage is grown in consecutive years. The seed of clary sage is treated with a formulation to protect against soilborne pathogens, yet seedling disease remains a limiting factor in the production of this crop (William Barrow, personal communication). While many soilborne plant pathogens may be involved, Pythium spp. are ubiquitous and cause disease in winter wheat in eastern North Carolina (Lookabaugh et al. 2017; Reeves 2020). In cases when neither wheat nor clary sage are planted, a growing interest in soil conservation practices has led to an increased planting of cover crops on ground that otherwise would remain fallow throughout the winter. According to the USDA Census of Agriculture, 4,930 farms in North Carolina reported planting 195,174 hectares of cover crops in 2017. This is an increase from the 157,201 planted on 4,405 farms in 2012 (USDA-NASS). Small grains including rye, oats, barley, and triticale, and legumes such as Austrian winter pea, hairy vetch, and crimson clover are all cover crops well suited to North Carolina. Winter rye (Secale cereale L.) is a cover crop popular with growers throughout the state because it provides reliable cover and seed is readily available. Winter pea (Pisum sativum L.) is not widely planted but is under evaluation by researchers as a possible cover crop option in North Carolina, especially for use in organic production systems. Rapeseed (Brassica napus L.) is a winter grain crop grown for the production of oil and meal in North Carolina, and 941 hectares were harvested in 2017 (USDA- NASS). Rapeseed grown in monoculture as a cover crop is not common, but the crop is included

in cover crop mixes (R. Vann, personal communication). Cover cropping has numerous potential benefits including reduced soil erosion, increased soil organic matter, soil moisture retention and cover, and addition or removal of nitrogen (Crozier et al. 2014). Cover cropping also has the potential to be a valuable tool in the management of diseases caused by soilborne plant pathogens (Acharya et al. 2020; Bakker et al. 2016; Henry et al. 2019; Leandro et al. 2018; Njoroge et al. 2008, 2009). Conversely, cover crops may be vulnerable to disease caused by soilborne plant pathogens, which may increase disease pressure on other crops included in the rotation. Root rot and stunting sometimes limit stand establishment and biomass accumulation of winter cover crops in North Carolina, suggesting that Pythium spp. may be involved. Many species of Pythium have a broad host range, but host preferences may influence population abundance and inoculum carry-over in different crop rotation systems. In Iowa, researchers investigated differences in populations of Pythium infecting corn seedlings planted after rye (Secale cereal L.), camelina (Camelina sativa [L.] Crantz), or no cover crop (Acharya et al. 2020). They detected a greater abundance of Pythium clade B in the roots of corn seedlings planted after rye than in corn seedlings following camelina. Conversely, the roots of corn seedlings following camelina had a greater abundance of Pythium clade F as compared to corn seedlings planted after rye. Root rot incidence was not significantly different between cover crop treatments but shoot dry weight of corn seedlings planted after camelina or no cover crop was greater than when planted after rye. This work suggests that different winter crops or cover crops have the potential to harbor different species of Pythium, which may influence infection of subsequently planted crops (Acharya et al. 2020). Similarly, corn seedlings showed elevated incidence of infection with P. volutum, a member of Pythium clade B, when planted after a rye cover crop in comparison to seedlings planted after no cover crop (Bakker et al. 2017; Lévesque and De Cock 2004). Knowing which species of Pythium are associated with winter cash or cover crops would help growers to avoid practices that may increase seedling diseases in subsequent crops (Bakker et al. 2017). To the best of our knowledge, no work has investigated species of Pythium associated with root rot and stunting of clary sage, rapeseed, or winter cover crops in North Carolina. The objectives of this study were to 1) identify species of Pythium associated with root rot and stunting of clary sage, winter rye, rapeseed, and winter pea in eastern North Carolina, and 2) evaluate the pathogenicity of recovered isolates on these winter crops. A better understanding of

Pythium spp. infecting crops in winter will provide information needed to manage root diseases in winter cash crops such as clary sage and to guide selection of cover crops that have neutral or suppressive effects on Pythium root rot in subsequent plantings.

MATERIALS AND METHODS

Isolate collection. Samples were collected from clary sage, rye, rapeseed, and winter peas growing in commercial fields and experimental plots across eastern North Carolina in the October of 2018 through spring of 2019 and in the December of 2019 through February 2020. Ten to fifteen symptomatic and two asymptomatic plants were randomly collected from locations throughout each sampling site, and plants were transported to the laboratory and stored at 4°C until processed. Plant roots were washed under running tap water until clear of soil and debris, then rinsed in sterile distilled water and dried with paper towels. Root pieces ranging from 1 to 3 cm in length were cut from the root system, and pieces were rinsed in a beaker of sterile distilled water. Two clumps of 2 to 3 root pieces were plated onto cornmeal agar (CMA-PARPB) amended with PCNB (100 mg/L), ampicillin (250 mg/L), rifampicin (5 mg/L), Delvocid (50% pimaricin, 10 mg/L), and benomyl (10 mg/L) (Jeffers and Martin 1986) and were incubated at 25°C. Root pieces were also plated onto 2% water agar and incubated at 18°C, and all plates were monitored for 72 hours. Colonies resembling Pythium spp. were transferred to fresh 2% water agar by submerging plugs in the media to suppress bacterial contamination, and pure cultures were then obtained by hyphal tipping onto 2% water agar in 60-mm Petri dishes (Van Der Plaats-Niterink 1981). Up to three isolates resembling Pythium spp. were transferred from each plant. For long term storage, four, 4-mm plugs each from pure cultures were stored in 2 ml microcentrifuge tubes each containing two twice-autoclaved hemp seeds and 1 mL of sterile distilled water (Raabe et al., 1973). Identification of isolates. Isolates were identified by bidirectional sequencing of the ITS 1, 2 and 5.8S region of the ribosomal DNA or the Cytochrome c oxidase subunit I (COI) region of the mitochondrial DNA (Robideau et al. 2011). Genomic DNA was amplified via direct polymerase chain reaction (PCR) from mycelial tissue using the Thermo Scientific Phire Plant Direct PCR Kit (Thermo Fisher Scientific #F-160S). Pure cultures were grown on potato dextrose agar (Becton, Dickinson, and Company) in 60-mm Petri dishes for 5 to 7 days until

mycelium was stripped and transferred into a 1.5 µl Eppendorf tube. Mycelium was stored at - 20°C until used for template dilution. A sterile toothpick was used to transfer a pinhead-sized volume, approximately 0.02 g of mycelium, into 50 µl of dilution buffer or nuclease-free water. This template dilution was incubated for 30 minutes and 1 µl was used in a PCR reaction consisting of 25 µl of 2X Phire Plant Direct PCR Master Mix, 22 µl nuclease-free water, and 1 µl of each primer ITS4 (5’ TCCTCCGCTTATTGATATGC) and ITS5 (5’ GGAAGTAAAAGTCGTAACAAGG) (White et al. 1990) or OomCoxI- Levup (5’ TCAWCWMGATGGCTTTTTTCAAC) and OomCoxI-Levlo (5’ CYTCHGGRTGWCCRAAAAACCAAA). Primers were chosen based on their success in previous studies (Del Castillo Munera and Hausbeck 2016; Lookabaugh et al. 2017; Robideau et al. 2011). Thermocycler conditions consisted of an initial denaturation period of 5 minutes at 98°C, 35 cycles of 5 s at 98°C, 5 s at 53°C for the ITS region, or 5 s at 53.8°C for the COI region, 20 s at 72°C, and a final extension of 1 minute at 72°C. Products were loaded onto a 1% agarose gel containing 10 µl SYBR Safe DNA Gel Stain (Invitrogen), and run at 100V for 60 minutes. Products were purified using ExoSAP-IT (Affymetrix) and submitted to Eton Bioscience Inc. for Sanger sequencing. Sequences were trimmed and aligned using CLC Genomics Workbench, then the BLAST algorithm was used in GenBank, available through the National Center for Biotechnology Information, or the BOLD identification system (The Barcode of Life Data System) to identify isolates to species. Query sequences were matched to accessions used in the barcoding study by Robideau et al. (2011) that had similarity scores greater than 98%. No more than two isolates collected from each plant were selected for identification to species. The identity of all isolates used in pathogenicity assays was confirmed based on morphology of oogonia, antheridia, oospores, and sporangia obtained in a grass-leaf water-blank culture (Abad et al. 1994) and colony morphology on CMA according to the keys of J. Van Der Plaats-Niterink (1981). Pathogenicity and aggressiveness of Pythium on clary sage. A single isolate representing each of eight species isolated from clary sage was used to fulfill Koch’s postulates. An additional isolate representing P. irregulare recovered from an apparently healthy plant was also included, for a total of nine isolates (Figure 3.1). Rice-grain inoculum was prepared by combining 12.5 g long-grain white rice with 9 ml distilled water in a 125 ml flask, autoclaving twice for 45 minutes each, and transferring to the flask four, 2-mm plugs from the edge of a

Pythium culture growing actively on V8 juice agar. Flasks were incubated in the dark at 25°C for five days and shaken daily to promote uniform colonization. Seeds of clary sage cultivars ‘English’ and ‘Early Selection’ were pre-germinated and transplanted into 6-well plastic trays containing Jolly Gardener Pro-Line C/P potting mix (Oldcastle Lawn & Garden). Trays were placed in moist chambers and seedlings were grown at 18°C in a diurnal growth chamber on a 12-hour day/night cycle. Three weeks after planting, seedlings were inoculated by placing three pathogen-colonized rice grains 1 cm from the base of each plant and 1 cm deep. A single plant of each cultivar was inoculated with each isolate, and each tray contained a control plant mock- inoculated with uncolonized rice grains. Plants were watered daily with 2 ml water and incubated as above. After seven days, root systems were washed free of potting mix and plated onto CMA- PARPB for re-isolation of the pathogen. Control plants were also washed and plated to check for colonization. The identity of the recovered isolates was confirmed based on morphology as previously described. The isolates used to fulfill Koch’s postulates were selected for an experiment investigating the influence of temperature on disease severity (Figure 3.1). Seeds of clary sage cultivar ‘Early Selection’ were sown and seedlings were inoculated as described above. The experimental design was a split-plot involving four diurnal growth chambers. Two chambers were each set to 18°C and 28°C on a 12-hour day/night cycle, serving as whole plots. Subplots were 6-well trays, and the subplot treatment was inoculation with a single isolate. Three plants each inoculated with a single isolate (observations) were grouped together on one end of each tray with two isolate combinations per tray. Three control plants were mock-inoculated with uncolonized rice grains, and all plants were watered with 2 ml water each daily. Two replicates were conducted simultaneously, and the whole experiment (trial) was conducted twice in succession. Disease severity was assessed with a visual rating scale based on extent of necrosis and root system development. The rating scale was: 1 = white roots with fully-developed system, 2 = slight root necrosis throughout a fully-developed root system, 3 = moderate root necrosis and loss of fine roots, 4 = severe root necrosis with loss of fine roots, and 5 = complete root necrosis and plant death (Figure 3.2). Data were analyzed in SAS 9.4 with PROC MIXED. Isolate, temperature, trial, and their interactions were treated as fixed effects, and replicate was treated as a random effect. The interaction between isolate, temperature, and trial was barely significant (P

= 0.0498) so data from both trials were combined. The interaction was due to slight differences in disease severity caused by weakly pathogenic isolates at the two temperatures. In further analyses trial and its interactions were treated as random effects. The plots=residualpanel option in PROC MIXED confirmed the normal distribution of residuals, and the original rating scale values were used in the analysis. Least-squares means were calculated for each isolate at both temperatures to further characterize isolate-temperature interactions. Pathogenicity of select species on winter crops. A single isolate of P. irregulare, P. spinosum, and Pythium sp. cluster B2A from each of three hosts, rye, rapeseed, or winter pea, was used to inoculate its respective host, for a total of nine isolates. These species were selected based on frequency of isolation among the samples of all crops collected. All isolates were pulled from storage tubes and grown on 2% water agar before transferring to V8 juice agar. Rice-grain inoculum was prepared as previously described. Seeds of rye, rapeseed, and winter pea were each germinated on moist filter paper at room temperature. After 48 hours of incubation, germinated seeds were planted into 4 x 20 cm cone-tainers containing Jolly Gardener Pro-Line C/P potting mix (Oldcastle Lawn & Garden). Cone-tainers were placed individually into 4 x 2 x 12-inch polyethylene bags containing 80 ml tap water to maintain moisture in the potting mix while preventing cross-contamination. Plants were watered with 20 ml of tap water after seedlings were planted. Surface moisture was maintained afterwards by addition of 10-15 ml of tap water when the surface of the potting mix appeared dry. One week after planting, seedlings were inoculated by placing three pathogen-colonized rice grains 1 cm from the base of each plant and 1 cm deep. Three plants of each host were inoculated with each species (P. irregulare, P. spinosum, Pythium sp. cluster B2A). Three control plants were mock-inoculated with uncolonized rice grains, with the exception of rye. One out of three of the control rye plants emerged, so this was the only mock-inoculated plant. Fifteen ml of tap water was applied to the soil surface of each cone-tainer immediately after inoculation. After seven days, root systems were washed free of soil and observed for symptoms. Root pieces measuring 3 to 4 cm in length were plated onto CMA-PARPB for recovery of the pathogen. The identity of recovered isolates was confirmed based on morphology as previously described.

RESULTS

Isolate collection. Symptoms varied by location and crop during both years of sampling. Stunting was often observed in wet, low-lying areas of the field, but nevertheless was patchy. In the winter of 2018-2019, average monthly precipitation in Edgecombe County, NC was greater than the 30-year average in November, December, and February. In the winter of 2019-2020, the average monthly precipitation was almost twice the 30-year average in February, but was around or below average in the other months from October to March (Table 3.1). Soil temperatures in the winter of 2018 to 2019 were slightly lower than those in the winter of 2019 to 2020, and, on average, remained between 7°C and 12°C between November and March. Average soil temperatures in the winter of 2019 to 2020 remained, on average, between 9°C and 14°C from November to March (Table 3.2). Clary sage. In clary sage, severe root necrosis and stunting were observed in five fields in Bertie County sampled in October 2018 and February 2019. In some cases, severely affected plants were adjacent to apparently healthy plants. Compared to stunted plants, some plants had no above-ground symptoms and larger root systems, but slight root tip necrosis and loss of fine roots was evident. Pythium was isolated from the roots of plants displaying severe root rot and from four plants that had slight tip necrosis but no above-ground symptoms. A total of 106 isolates were collected from clary sage over the course of two years (Table 3.3). P. irregulare was the most frequently recovered species (32% of isolates), followed by P. spinosum (20% of isolates), and members of the species complex Pythium sp. cluster B2A (19% of isolates). A single isolate of Phytopythium helicoides was recovered from a plant collected in October 2018. An additional six isolates were identified as putative Pythium sp. but could not be identified to species by sequencing or morphological characteristics. Four isolates of P. irregulare and a single isolate of each P. spinosum and P. pachycaule were each isolated from individual apparently healthy plants. Rye. Rye displayed stunting and loss of fine roots, but little to no root necrosis was observed, even in samples where oospores of Pythium were observed in root tissue (Figure 3.6). Severity of stunting varied by location and was generally more severe in wet, low-lying areas. Pythium was isolated from plants displaying loss of fine roots and stunting and from 11 apparently healthy plants. A total of 166 isolates were collected from rye over two years of sampling (Table 3.4). The most frequently recovered species was P. irregulare (36% of isolates),

followed by members of the species complex Pythium sp. cluster B2A (24% of isolates), and P. spinosum (13% of isolates). Three isolates identified as putative Pythium spp. could not be identified to species by sequencing or morphological characteristics . P. irregulare (seven isolates), members of the species complex Pythium sp. cluster B2A (four isolates), P. sylvaticum (two isolates), P. oopapillum (two isolates), and a single isolate of each P. acanthicum and P. cryptoirregulare were each isolated from individual apparently healthy plants. Rapeseed. Stunted rapeseed had shorter tap roots and loss of fine roots compared to plants with no symptoms of stunting. Little to no root necrosis was observed, but necrotic lesions on the lower crown tissue of stunted plants were evident in both years. In some cases, severely affected plants displayed purple discoloration of the crown. In the second year of sampling, fields in Robeson County had patches of severely stunted plants with crown necrosis and discoloration. Patches of symptomatic plants were in wet areas of the field (Figure 3.3). No oospores were observed in the root or crown tissue of stunted or apparently healthy plants. Pythium was isolated from symptomatic and apparently healthy plants, and the majority of isolates grew out of crown tissue rather than lower root tissue. When sampling results from both years were combined, a total of 109 isolates were obtained from rapeseed, with members of the species complex Pythium sp. cluster B2A the most frequently recovered (45% of isolates) (Table 3.5). Pythium sp. cluster B2A (four isolates), P. irregulare (three isolates), and P. rostratifingens (two isolates) were isolated from the roots of seven individual apparently healthy plants. Winter pea. Roots of stunted winter pea displayed symptoms of necrosis, loss of fine roots, and reduced nodulation compared to the roots of apparently healthy plants (Figure 3.6). Pythium was isolated from symptomatic plants and from one apparently healthy plant. When sampling results from both years were combined, 39 isolates were collected (Table 3.6). The most frequently recovered species was P. irregulare (41% of isolates) followed by members of the species complex Pythium sp. cluster B2A (28% of isolates). One isolate of P. spinosum was isolated from the roots of an apparently healthy plant. P. irregulare was the most frequently isolated species (37% of isolates) from all hosts sampled over the course of two growing seasons. Members of the species complex Pythium sp. cluster B2A (28% of isolates) and P. spinosum (13% of isolates) were the next most frequently isolated species (Figure 3.4). In the first year of sampling, at least one isolate identified as a species of Pythium was isolated from 81% of clary sage, 80% of rye, 85% of rapeseed, and 58%

of winter pea plants. In the second year of sampling, species of Pythium were isolated from 85% of clary sage, 92% of rye, 83% of rapeseed, and 53% of winter pea plants. These numbers do not take into account the isolates that were suspected to be members of the genus but could not be identified to species. In many cases, two isolates of different species were recovered from a single root system, but no patterns in coinfection by the same pairs of species were found for any hosts. In both years of sampling, isolates of Mortierella spp. were frequently recovered on CMA- PARPB and on WA from the roots of all hosts sampled, but only several isolates of Rhizoctonia spp. were recovered on WA from any host. Sequences of the ITS or COI region for single isolates of Pythium spp. representing each host-species combination were deposited into GenBank under accessions MW025199-MW025230 or MW073111-MW073113 (Table 3.7). Pathogenicity and aggressiveness of Pythium on clary sage. Koch’s postulates were fulfilled for eight species and symptoms ranged from slight root necrosis to plant death (Figure 3.2). Pythium aphanidermatum, P. oopapillum, P. pachycaule, and an isolate belonging to the species complex cluster B2A elicited slight root necrosis and were considered weakly pathogenic. Pythium myriotylum, P. spinosum, P. irregulare, and P. sylvaticum caused moderate to severe root necrosis, plant wilting, and in some cases plant death (Figure 3.2). In the experiment comparing disease severity at two temperatures, the interaction between isolate and temperature was significant (P = 0.0023), and disease caused by P. sylvaticum, P. spinosum, and the isolate of P. irregulare from a stunted plant was more severe at 18°C than at 28°C (Fig. 3.1, P < 0.005). Disease caused by P. aphanidermatum was more severe at 28°C than at 18°C (P = 0.023). Anotherisolate of P. irregulare isolated from the roots of an apparently healthy clary sage plant was less aggressive than the isolate of P. irregulare recovered from the roots of a stunted plant. Disease severity did not differ at the two temperatures when plants were inoculated with P. myriotylum, P. pachycaule, P. oopapillum, or Pythium sp. cluster B2A. Pathogenicity of select species on winter crops. Symptoms on rye, rapeseed, and winter pea ranged in severity. All inoculated rye was slightly stunted compared to the noninoculated control. Rye inoculated with P. irregulare and P. spinosum had slight discoloration of the root tissue in the zone of inoculation, (1 cm below the soil line). Otherwise, root systems were healthy. No discoloration of roots was observed on rye inoculated with Pythium sp. cluster B2A. There were no differences in the above-ground growth of inoculated and non-inoculated

rapeseed, with the exception of a single plant inoculated with P. irregulare. This plant had necrosis and constriction of crown tissue at the soil line (Figure 3.5). Rapeseed inoculated with P. irregulare and Pythium sp. cluster B2A had slight necrosis in the zone of inoculation and constriction of the crown tissue. Inoculation with P. spinosum caused slight discoloration of the root tissue in the zone of inoculation, but root systems were otherwise healthy. There were no differences in the aboveground growth of inoculated and noninoculated winter pea. Inoculation with P. irregulare or P. spinosum caused moderate necrosis and loss of fine roots in the zone of inoculation. Winter pea inoculated with Pythium sp. cluster B2A had no discoloration of root tissue or loss of fine roots. Each isolate of Pythium was successfully re- isolated from all inoculated host plants within 48 hours. No organisms were recovered from the roots of noninoculated control plants within 72 hours.

DISCUSSION

Damping-off, root rot, and stunting of clary sage are frequent problems limiting yield of this crop in northeastern NC. This study shows that several species of Pythium, including P. irregulare, P. spinosum, and members of the species complex Pythium sp. cluster B2A are widespread and aggressive pathogens causing root rot and stunting of clary sage in NC. Koch’s postulates were fulfilled with isolates representing these three species, as well as for five additional species recovered in our sampling. According to the USDA ARS National Fungus Collections database, only P. debaryanum and an unidentified Pythium spp. have been reported as pathogens of Salvia in the United States. Thus, this work represents the first report of P. irregulare, P. spinosum, Pythium sp. cluster B2A, P. aphanidermatum, P. pachycaule, P. myriotylum, P. sylvaticum, and P. oopapillum as pathogens of clary sage. In the experiment comparing disease severity on clary sage at two temperatures, isolates of P. irregulare, P. spinosum, and P. sylvaticum were the most aggressive, and disease was more severe at 18°C than at 28°C. It is likely that increased disease severity at lower temperatures does not rely solely on an increased ability of the pathogen to cause disease, but rather results from a combination of increased host susceptibility and favorable conditions for the pathogen (Martin and Loper 1999). The noninoculated plants in this experiment grew more slowly at 18°C than those at 28°C, and therefore, had proportionally more young roots that were susceptible to

infection for a longer period of time. Management of disease caused by Pythium in clary sage may include planting earlier to allow plants to establish a healthy root system before soil temperatures drop. Avoiding planting into wet soils, and the use of a seed treatment with efficacy against oomycetes, such as those containing metalaxyl or mefenoxam, may also mitigate disease by allowing seedlings to develop a healthy root system early in the growing season. The combination of favorable temperatures for pathogen growth and increased host susceptibility at low temperatures may provide some explanation for the high recovery rate of P. irregulare and P. spinosum from clary sage in this study. These species were also recovered in high abundance from the roots of stunted winter wheat collected in North Carolina in 2019. In experiments using recovered isolates, stunting and root rot were more severe at 14°C than at 20°C when wheat was inoculated with P. irregulare or P. spinosum in a controlled environment (Reeves 2020). Seasonal variation in populations of Pythium spp. has been observed in several studies (Hancock 1977; Kerns and Tredway 2008; Matthiesen et al. 2016; Toporek and Keinath 2019). In South Carolina, P. spinosum and P. irregulare were the most frequently recovered species of Pythium causing root and stem rot of cucurbits in November, while P. myriotylum and P. aphanidermatum were the most frequently recovered species causing this disease between May and September (Toporek and Keinath 2019). Pythium volutum and P. torulosum, the causal agents of Pythium root dysfunction of creeping bentgrass in North Carolina, were isolated from this host in the fall and early spring but not during the summer months when symptoms of this disease develop (Kerns and Tredway 2008). P. irregulare is known to be more aggressive towards certain hosts at low temperatures, whereas P. aphanidermatum and P. myriotylum are more aggressive at higher temperatures (Martin and Loper 1999). Interestingly, the isolate identified as Pythium sp. cluster B2A (discussed in further detail below) used in the experiment on clary sage was not highly aggressive at either temperature but caused moderate symptoms at both temperatures. In pathogenicity screens on other hosts, no necrosis on the roots of rye or winter pea was observed when inoculated with isolates belonging to cluster B2A, and very slight necrosis of rapeseed roots was observed. The criteria for the fulfillment of Koch’s postulates include the replication of initial symptoms of the observed disease, therefore, Koch’s postulates were not fulfilled for this species complex on rye, rapeseed, or winter pea in this study (Figure 3.6). It is important to consider how members of this species complex may differ in their pathogenicity, making it difficult to draw conclusions about the

complex as a whole based on the behavior of single isolates. However, the work presented here suggests that isolates belonging to Pythium sp. cluster B2A have the ability to colonize the root tissue of healthy rye, rapeseed, and winter pea without an observable negative impact on plant health. Pythium sp. ‘Group F’, which is a member of cluster B2A, is able to infect the roots of healthy tomato plants without causing symptoms (Rey et al. 1998) . Stressors encountered in the field, including wet soil, low temperatures, and disease caused by other organisms may predispose plants to stunting and loss of fine roots caused by Pythium sp. cluster B2A. Members of this complex were recovered in high abundance from all hosts sampled in the current study, but they were seldom recovered from wheat in NC (Lookabaugh et al. 2017; Reeves 2020). The diversity of Pythium spp. recovered in this study is not surprising due to the widespread distribution of many of these organisms and is consistent with results from other studies (Broders et al. 2007; Rojas et al. 2017; Reeves 2020). Nevertheless, what stands out is that P. irregulare (37% of all isolates), members of the species complex Pythium sp. cluster B2A (28% of all isolates), and P. spinosum (13% of isolates) were recovered in high abundance in both years of sampling. P. irregulare and P. spinosum are classified as members of Pythium clade F, while the species complex Pythium sp. cluster B2A is within Pythium clade B (Lévesque and De Cock 2004). Pythium sp. cluster B2A includes P. coloratum, P. diclinum, P. cf. dictyosporum, P. dissotocum, P. lutarium, P. sp. ‘Group F’ and P. sp. ‘tumidum’. All isolates that had matching identities to species within this complex were identified as ‘Pythium sp. cluster B2A’ due to the inability to distinguish these species based on the ITS or COI barcodes alone (Robideau et al. 2011). Pythium irregulare is a widespread soilborne pathogen and has been frequently isolated from soybeans across the United States (Coffua et al. 2016; Martin and Loper 1999; Rojas et al. 2017a). In a survey of Pythium spp. baited from soils in a field under soybean-corn rotation in Southeastern Pennsylvania, P. irregulare was one of the most frequently isolated species, along with P. sylvaticum, P. nodosum, and P. heterothallicum (Coffua et al. 2016). In a survey of oomycetes causing seedling disease in eleven states across the Midwestern United States, P. sylvaticum, P. oopapillum, and P. irregulare were the most frequently isolated species (Rojas et al. 2017a). Of the members of the species complex Pythium sp. cluster B2A, P. dissotocum is the most frequently recovered plant pathogenic species, and has been isolated in high abundance from corn and soybean in the Midwestern United States (Broders et al. 2007, Rojas et al. 2017a).

Due to the novelty of this work, it is difficult to compare results to those from other hosts in other regions. Little literature exists on Pythium spp. associated with winter field and cover crops in the United States to date, and most research that has been published is on populations of Pythium associated with winter rye (Acharya et al. 2020; Bakker et al. 2016, 2017; Schenck et al. 2017). This is fitting, as rye is reported as the most frequently planted cover crop nationwide over the past four years (National Cover Crop Survey, 2020). Many species of Pythium have a broad host range, but recent work has identified associations between certain hosts and taxonomic groups, specifically an association between winter rye and Pythium clade B. Clade B has been detected in greater abundance, relative to other clades of Pythium in the roots of rye shortly after herbicide termination (Bakker et al. 2017). Researchers have linked increased abundance of Pythium clade B in rye roots to an increase in seedling disease caused by this organism in subsequent corn plantings (Acharya et al. 2020; Bakker et al. 2017; Schenck et al. 2017). Our results relied solely on a culture-based approach to identify Pythium from the roots of cover crops, and we did not attempt to quantify the pathogen in root systems. Molecular tools can be used to quantify the DNA of target organisms in root tissue, and may identify organisms that otherwise would go undetected in culture (Bakker et al. 2017). Future work may use amplicon sequencing or quantitative polymerase chain reaction (qPCR) to further identify Pythium spp. inhabiting the roots of winter cover crops in North Carolina. According to the USDA ARS National Fungus Collections database, five species of Pythium are reported as pathogens of rye in the United States, including P. aphanidermatum, P. arrhenomanes, P. debaryanum, P. graminicola, and P. ultimum. P. irregulare has been reported as a pathogen in South Africa, but not in the United States. We isolated P. irregulare and P. spinosum at high frequencies from the roots of stunted rye in this study. In pathogenicity assays, isolates representing these species caused slight plant stunting and slight necrosis of root tissue, but stunting was not as severe as that observed on plants collected in the field. Thus, the pathogenicity of P. spinosum on rye should be investigated further. The only species of Pythium reported as a pathogen of rapeseed in the United States is P. ultimum. We isolated P. irregulare at high frequencies from the roots of stunted rapeseed in this study, and in pathogenicity assays an isolate representing this species caused slight necrosis of

root and crown tissue, but no stunting was observed. The pathogenicity of P. irregulare on rapeseed should be investigated further. Nine species of Pythium have been reported as pathogens of pea in the United States, including P. irregulare and P. dissotocum, which is within the species complex Pythium sp. cluster B2A. We isolated P. irregulare at high frequencies from the roots of stunted winter pea in this study, and several isolates of P. spinosum. In pathogenicity assays, isolates representing these species caused moderate necrosis of root tissue, but no stunting was observed. The pathogenicity of P. spinosum on winter pea should be investigated further. P. irregulare, P. spinosum, and members of the species complex Pythium sp. cluster B2A were the predominant species of Pythium recovered from the roots of clary sage, rye, rapeseed, and winter pea in this study. P. irregulare and P. spinosum were also frequently recovered from winter wheat in North Carolina in 2019 (Reeves 2020). Therefore, cultivation of clary sage, rye, or winter wheat in a double crop rotation system may maintain or increase populations of P. irregulare and P. spinosum in the field. Likewise, cultivation of clary sage, rye, rapeseed, or winter pea may maintain or increase populations of P. irregulare and Pythium sp. cluster B2A. Future work should identify species of Pythium causing seedling disease of summer crops in North Carolina, such as soybean and corn, to provide additional information on the utility of crop rotation, double cropping, and cover cropping as disease management strategies. We found that P. irregulare and P. spinosum are aggressive pathogens of clary sage at low temperatures, and this may explain, in part, the frequent recovery of these species during the winter. However, the influence of soil temperature on the distribution of Pythium spp. and disease caused by these organisms in North Carolina also warrants further investigation.

ACKNOWLEDGEMENTS

The authors thank Dr. Rachel Vann, Makayla Gross, Dr. Chris Reberg-Horton, Mac Malloy, Tim Britton, Tim Smith, Richard Rhodes, Shawn Butler and Mike Munster for assistance with sample collection, Dr. Emma Lookabaugh for advice on Pythium, Dr. Emily Griffith for help with statistical analyses, and Christine Miller, Ian Mellon, and Hailey Shoptaugh for technical assistance. This work was supported by USDA-NIFA project number 1017274-NC02720 and USDA-APHIS award number 2016-0244/15-8130-0596-CA.

REFERENCES

2. Acharya, J., Moorman, T. B., Kaspar, T. C., Lenssen, A. W., and Robertson, A. E. 2020. Cover crop rotation effects on growth and development, seedling disease, and yield of corn and soybean. Plant Dis. 104:677–687.

3. Bakker, M. G., Acharya, J., Moorman, T. B., Robertson, A. E., and Kaspar, T. C. 2016. The potential for cereal rye cover crops to host corn seedling pathogens. Phytopathology 106:591–601.

4. Bakker, M. G., Moorman, T. B., Kaspar, T. C., and Manter, D. K. 2017. Isolation of cultivation-resistant Oomycetes, first detected as amplicon sequences, from roots of herbicide-terminated winter rye. Phytobiomes 1:24–35.

5. Broders, K. D., Lipps, P. E., Paul, P. A., and Dorrance, A. E. 2007. Characterization of Pythium spp. associated with corn and soybean seedling disease in Ohio. Plant Dis. 91:727– 735.

6. Coffua, L. S., Veterano, S. T., Clipman, S. J., Mena-Ali, J. I., and Blair, J. E. 2016. Characterization of Pythium spp. associated with asymptomatic soybean in southeastern Pennsylvania. Plant Dis. 100:1870-1879.

7. Crozier, C., Hoyt, G., and Wagger, M. 2014. Winter Annual Cover Crops. NC State Ext. Publ. AG-439-58.

8. Hancock, J. G. 1977. Factors affecting soil populations of Pythium ultimum in the San Joaquin Valley of California. Hilgardia 45:107-122.

9. Henry, P. M., Pastrana, A. M., Leveau, J. H. J., and Gordon, T. R. 2019. Persistence of Fusarium oxysporum f. sp. fragariae in soil through asymptomatic colonization of rotation crops. Phytopathology 109:770–779.

10. Jeffers, S. N., and Martin, S. B. 1986. Comparison of two media selective for Phytophthora and Pythium species. Plant Dis. 70:1038–1043.

11. Kerns, J. P., and Tredway, L. P. 2008. Pathogenicity of Pythium species associated with Pythium root dysfunction of creeping bentgrass and their impact on root growth and survival. Plant Dis. 92:862-869.

12. Leandro, L. F. S., Eggenberger, S., Chen, C., Williams, J., Beattie, G. A., Liebman, M. 2018. Cropping system diversification reduces severity and incidence of soybean sudden death syndrome caused by Fusarium virguliforme. Plant Dis. 102:1748–1758.

13. Lévesque, C. A., and De Cock, A. W. A. M. 2004. Molecular phylogeny and taxonomy of the genus Pythium. Mycol. Res. 108:1363–1383.

14. Lookabaugh, E., Shew, B., and Cowger, C. 2017. Three Pythium species isolated from severely stunted wheat during an outbreak in North Carolina. Plant Heal. Prog. 18:169–173.

15. Martin, F. N., and Loper, J. E. 1999. Soilborne plant diseases caused by Pythium spp.: Ecology, epidemiology, and prospects for biological control. Crit. Rev. Plant Sci. 18:111- 181.

16. Matthiesen, R. L., Ahmad, A. A., and Robertson, A. E. 2016. Temperature affects aggressiveness and fungicide sensitivity of four Pythium spp. that cause soybean and corn damping off in Iowa. Plant Dis. 100:583–591.

17. Njoroge, S. M. C., Kabir, Z., Martin, F. N., Koike, S. T., and Subbarao, K. V. 2009. Comparison of crop rotation for Verticillium wilt management and effect on Pythium species

in conventional and organic strawberry production. Plant Dis. 93:519–527.

18. Njoroge, S. M. C., Riley, M. B., and Keinath, A. P. 2008. Effect of incorporation of Brassica spp. residues on population densities of soilborne microorganisms and on damping-off and fusarium wilt of watermelon. Plant Dis. 92:287–294.

19. Raabe, R.D., Hurliman, J.H., and Emerson, R. 1973. A storage method for pythiaceous fungi. 2 Int. Congress of Plant Pathology, Minneapolis. Abst. No. 0362.

20. Reeves, E. R. 2020. Pythium spp. associated with root rot and stunting of winter field and cover crops in North Carolina. (Master’s Thesis). NC State University.

21. Rey, P., Benhamou, N., and Tirilly, Y. 1998. Ultrastructural and cytochemical investigation of asymptomatic infection by Pythium spp. Phytopathology 88:234–244.

22. Robideau, G. P., De Cock, A. W. A. M., Coffey, M. D., Voglmayr, H., Brouwer, H., Bala, K., et al. 2011. DNA barcoding of oomycetes with cytochrome c oxidase subunit I and internal transcribed spacer. Mol. Ecol. Resour. 11:1002–1011.

23. Rojas, J. A., Jacobs, J. L., Napieralski, S., Karaj, B., Bradley, C. A., Chase, T., et al. 2017a. Oomycete species associated with soybean seedlings in North America—Part I: Identification and pathogenicity characterization. Phytopathology 107:280–292.

24. Schenck, L. A., Bakker, M. G., Moorman, T. B., and Kaspar, T. C. 2017. Effects of cover crop presence, cover crop species selection and fungicide seed treatment on corn seedling growth. Renew. Agric. Food Syst. 34:93–102.

25. Stanghellini, M. E., and Kronland, W. C. 1986. Yield loss in hydroponically grown lettuce attributed to subclinical infection of feeder rootlets by Pythium dissotocum. Plant Dis. 70:1053–1056.

26. Toporek, S. and Keinath, A. P. 2019. Time-point field sampling of Pythium spp. pathogenic on cucurbits reveals a seasonal change in species recovery. (Abstr). Phytopathology 109:S2.1.

27. White, T. J., Bruns, T., Lee, S., and Taylor, J. 1990. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. Pages 315-322 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis, D. H. Gelfand, J. J. Sninsky and T. J. White, eds: Academic Press, San Diego, CA.

28. Van der Plaats-Niterink, A. J. 1981. Monograph of the genus Pythium. Studies in Mycology No. 21. Centraalbureau Voor Schimmelcultures, Baarn, The Netherlands.

Table 3.1. Monthly precipitation totals at the Upper Coastal Plain Research Station in Edgecombe County, NC in the winters of 2018-2019 and 2019-2020.

Total monthly precipitation (cm)a,b Month 30-year averagec 2018-2019 2019-2020 October 7.83 5.50 9.45 November 7.36 9.80 8.52 December 8.02 13.24 6.40 January 9.40 7.73 8.79 February 8.12 12.46 14.37 March 10.12 5.99 7.16 aData obtained from PRISM Climate Group, Oregon State University, http://prism.oregonstate.edu, created 25 July 2020.

bPrecipitation data collected from 4km area surrounding coordinates (35.9228, -77.5246).

c30-year average calculated based on data collected between 1981-2010.

Table 3.2. Average soil temperature by month at the Upper Coastal Plain Research Station in Edgecombe County, NC in the winters of 2018-2019 and 2019-2020.

a,b Monthly average of soil temperature daily mean (°C) Month 2018-2019 2019-2020 October 19.9 21.1

November 12.2 12.1 December 8.9 9.7

January 7.4 9.8 February 9.0 10.2

March 10.8 13.5 aData obtained from North Carolina Climate Office Weather and Climate Database, https://climate.ncsu.edu/cronos/?station=ROCK, created 3 September 2020. bMonthly average calculated from daily average, collected at (35.89295°, -77.67996).

Table 3.3. Species of Pythium isolated from clary sage in Bertie County, NC in the winters of 2018-2019 and 2019-2020.

Sampling location and yeara Isolates/ Species of Pythium B1-18b B3-18 B4-18 B4-19c B5-19 B6-19 spp. P. irregulare 11 4 1 9 5 4 34 P. spinosum 6 2 3 6 4 - 21 P. sp. cluster B2A 3 3 6 7 1 - 20 P. sylvaticum 3 1 3 2 - - 9 P. rostratifingens 4 - - 1 1 1 7 P. pachycaule 3 - - 1 - 2 6 P. aphanidermatum 1 - - - - - 1 P. myriotylum 1 - - - - - 1 P. oopapillum - - 1 - - - 1 Pythium sp. 1 - 1 - 1 3 6

Isolates by location 33 10 15 26 12 10 106 aLetter indicates county (B = Bertie County, NC), following number indicates site within county, and “-18” represents 2018-2019 season, “-19” represents 2019-2020 season.

bSampling at site B1 was performed in October 2018 and in February 2019.

cSamples were collected from two fields within site B4 in 2019-2020.

Table 3.4. Species of Pythium isolated from rye at five counties in NC in the winters of 2018-2019 and 2019-2020.

Sampling location and yeara Species of Pythium L1-18 L2-18 E1-18 E2-18 J1-18 J2-18 E1-19 E2-19 L3-19 L4-19 Le1-19 Isolates/ spp. P. irregulare 7 1 1 5 5 11 1 6 6 6 10 59 P. sp. cluster B2A 1 11 4 4 - 3 8 2 - 3 3 39 P. spinosum 4 1 6 1 - - 2 3 2 2 1 22 P. sylvaticum 2 2 5 3 - - 3 1 - - - 16 P. oopapillum - - 1 1 - - 4 4 1 - 1 12 P. vanterpoolii ------2 1 2 5 P. rostratifingens - - - - 1 1 - - 1 - - 3 P. ultimumb - - 2 ------2 P. acanthicum - - - 1 ------1 P. volutum ------1 - - - 1 P. pachycaule ------1 1 P. inflatum ------1 - - - 1 P. cryptoirregulare ------1 - - 1 Pythium sp. 1 1 - - 1 ------3

Isolates by location 15 16 19 15 7 15 18 18 13 12 18 166 aLetter indicates county (L = Lenoir, E = Edgecombe, J = Johnston, Le = Lee), following number indicates site within county, and “- 18” represents 2018-2019 season, “-19” represents 2019-2020 season. bIsolates identified as P. ultimum var ultimum.

Table 3.5. Species of Pythium isolated from rapeseed at six counties in NC in the winters of 2018-2019 and 2019-2020.

Sampling location and yeara Species of Pythium E2-18 J2-18 E2-19 W1-19 Le1-19 B1-19 R1-19 R2-19 R3-19 Isolates/ spp. P. sp. cluster B2A 4 4 7 - 1 3 13 6 11 49 P. irregulare 2 8 4 4 6 7 4 11 1 47 P. rostratifingens - - 1 1 3 1 - - - 6 P. spinosum 3 - - 1 - - - - - 4 P. sylvaticum 1 ------1 P. pachycaule - 1 ------1 P. oopapillum ------1 - - 1

Isolates by location 10 13 12 6 10 11 18 17 12 109 aLetter indicates county (E = Edgecombe, J = Johnston, W = Wayne, Le = Lee, B = Bladen, R = Robeson), following number indicates site within county, and “-18” represents 2018-2019 season, “-19” represents 2019-2020 season.

Table 3.6. Species of Pythium isolated from winter pea at three counties in NC in the winters of 2018-2019 and 2019-2020.

Sampling location and yeara Species of Pythium L5-18 E2-18 L6-19 L7-19 W1-19 Isolates/ spp. P. irregulare 6 - 1 4 5 16 P. sp. cluster B2A 4 - 5 1 1 11 P. spinosum 5 - 1 - - 6 P. sylvaticum - 1 - 1 - 2 P. inflatum 1 - 1 - - 2 P. oopapillum - 1 - - - 1 P. rostratifingens 1 - - - - 1

Isolates by location 17 2 8 6 6 39 aLetter indicates county (L = Lenoir, E = Edgecombe W = Wayne), following number indicates site within county, and “-18” represents 2018-2019 season, “-19” represents 2019-2020 season.

Table 3.7. Sequences submitted to GenBank (National Center for Biotechnology Information) for a single isolate representing each species of Pythium isolated from each host between 2018-2020.

Sequence Reference Host Species of Pythium length Accession % Similarity Accession Clary Sage P. irregulare 833 bp HQ643622 99.9% MW025199 P. spinosum 909 bp HQ643794 99.6% MW025200 Pythium sp. cluster B2A 796 bp HQ643789 100.0% MW025201 P. sylvaticum 756 bp HQ643852 99.9% MW025202 P. rostratifingens 916 bp HQ643764 99.2% MW025203 P. pachycaule 768 bp HQ643727 98.7% MW025204 P. aphanidermatum 775 bp HQ643442 100.0% MW025205 P. myriotylum 762 bp HQ643703 100.0% MW025206 P. oopapillum 798 bp FJ655175 100.0% MW025207

Rye P. irregulare 922 bp HQ643595 99.9% MW025208 Pythium sp. cluster B2A 798 bp HQ643495 99.9% MW025209 P. spinosum 927 bp HQ643792 99.9% MW025210 P. sylvaticum 910 bp HQ643849 100.0% MW025211 P. oopapillum 797 bp HQ643717 99.6% MW025212 P. vanterpoolii 833 bp HQ643953 98.9% MW025213 P. rostratifingens 960 bp HQ643764 99.3% MW025214 P. ultimum var. ultimum 823 bp HQ643942 100.0% MW025215 b P. acanthicum 635 bp HQ708457 99.5% MW073111 P. volutum 289 bp HQ643971 100.0% MW019914 P. pachycaule 791 bp HQ643727 98.7% MW025216 P. inflatum 796 bp HQ643566 99.8% MW025217 b P. cryptoirregulare 634 bp HQ708561 100.0% MW073112

Table 3.7. (continued) Rapeseed Pythium sp. cluster B2A 794 bp HQ643506 100.0% MW025218 P. irregulare 940 bp HQ643596 99.9% MW025219 P. rostratifingens 932 bp HQ643761 98.8% MW025220 P. spinosum 936 bp HQ643793 99.7% MW025221 P. sylvaticum 762 bp HQ643850 99.7% MW025222 P. pachycaule 786 bp HQ643727 99.8% MW025223 P. oopapillum 797 bp HQ643717 99.8% MW025224

Pea P. irregulare 958 bp HQ643612 99.9% MW025225 Pythium sp. cluster B2A 794 bp HQ643506 100.0% MW025226 P. spinosum 925 bp HQ643794 99.7% MW025227 P. sylvaticum 926 bp HQ643849 100.0% MW025228 P. inflatum 789 bp HQ643566 99.6% MW025229 P. oopapillum 656 bp FJ655179 100.0% MW025230 b P. rostratifingens 641 bp HQ708804 98.3% MW073113 bCOI region sequence

5 s.e. = 0.301 ** ** 4 ** ** 3

2 Disease Disease Severity

Inoculum

Figure 3.1. Disease severity caused by 9 isolates of Pythium on clary sage at 18°C and 28°C. Disease severity measured using ordinal rating scale with 1 = healthy white roots and 5 = plant death. *indicates isolate was obtained from roots of healthy plant. ** indicates significant difference in aggressiveness at 18°C compared to 28°C (P < 0.005). Values are means of two trials containing two replicates per trial.

Figure 3.2. Visual rating scale for the assessment of root rot severity on clary sage. 1 = healthy white roots with fully-developed system, 2 = slight to moderate root necrosis throughout a fully- developed root system, 3 = moderate root necrosis and loss of fine roots, 4 = severe root necrosis with loss of fine roots, and 5 = complete root necrosis, plant dead or death imminent.

Figure 3.3. Stunted rapeseed was adjacent to plants of a normal size throughout a field in Robeson County, NC sampled in February 2020.

n=80 n=26 n=87 n=79 n=23 n=86 n=19 n=20

Figure 3.4. Species of Pythium isolated from stunted clary sage, rye, rapeseed, and winter pea over the course of two growing seasons. Sampling was conducted between October 2018 and March 2019 (18’) and between December 2019 and February 2020 (19’). Individual species representing <5% of isolates from each host designated as “Pythium spp.”

Figure 3.5. Necrosis and constriction of crown tissue on a rapeseed plant seven days after inoculation with P. irregulare. The pathogen was successfully re-isolated from root tissue.

A B

Figure 3.6. Winter pea (A) and rye (B) collected in Lee County, NC in January 2020. Apparently healthy plants (right) and stunted plants with loss of roots and slight necrosis (left).