Ecology and Management of Pythium Species in Float Greenhouse Tobacco Transplant Production

Ecology and Management of Pythium species in Float Greenhouse Tobacco Transplant Production

Xuemei Zhang

Dissertation submitted to the faculty of the Virginia Polytechnic Institute and State University in partial fulfillment of the requirements for the degree of

Doctor of Philosophy in Plant Pathology, Physiology and Weed Science

Charles S. Johnson, Chair Anton Baudoin Chuanxue Hong T. David Reed

December 17, 2020 Blacksburg, Virginia

Keywords: Pythium, diversity, distribution, interactions, virulence, growth stages, disease management, tobacco seedlings, hydroponic, float-bed greenhouses

Ecology and Management of Pythium species in Float Greenhouse Tobacco Transplant Production

Xuemei Zhang

ABSTRACT

Pythium diseases are common in the greenhouse production of tobacco transplants and can cause up to 70% seedling loss in hydroponic (float-bed) greenhouses. However, the symptoms and consequences of Pythium diseases are often variable among these greenhouses. A tobacco transplant greenhouse survey was conducted in 2017 in order to investigate the sources of this variability, especially the composition and distribution of Pythium communities within greenhouses. The survey revealed twelve Pythium species. Approximately 80% of the surveyed greenhouses harbored Pythium in at least one of four sites within the greenhouse, including the center walkway, weeds, but especially bay water and tobacco seedlings. Pythium dissotocum, followed by P. myriotylum, were the most common species. Pythium myriotylum, P. coloratum, and P. dissotocum were aggressive pathogens that suppressed seed germination and caused root rot, stunting, foliar chlorosis, and death of tobacco seedlings. Pythium aristosporum, P. porphyrae, P. torulosum, P. inflatum, P. irregulare, P. catenulatum, and a different isolate of P. dissotocum, were weak pathogens, causing root symptoms without affecting the upper part of tobacco seedlings. Pythium adhaerens, P. attrantheridium, and P. pectinolyticum did not affect tobacco seeds or seedlings. The consequences of Pythium infection were more likely to be severe when they occurred during seed germination than at seedling emergence, or after plant stem elongation when seedling roots had started to grow into underlying nutrient solutions, depending on the species of Pythium. High and low variation was observed among isolates of P. dissotocum and P. myriotylum, respectively. Pythium myriotylum co-existed with multiple other Pythium or oomycete species in the same environments within tobacco greenhouses, and significant in vitro

and/or in vivo interactions between P. myriotylum and some naturally co-existing species were revealed. Pythium porphyrae may have the potential to protect tobacco seeds and seedlings from

P. myriotylum infection. Greenhouse Pythium control trials identified ethaboxam, mefenoxam, and copper ionization as potentially promising alternatives to etridiazole for Pythium disease management in tobacco transplant production. The outcomes of this project provide useful new information to better understand the composition, distribution, and diversity of Pythium communities in tobacco transplant greenhouses and to improve Pythium disease management for tobacco transplant production.

Ecology and Management of Pythium species in Float Greenhouse Tobacco Transplant Production

Xuemei Zhang

GENERAL AUDIENCE ABSTRACT

Pythium diseases are common in tobacco transplant production and can cause up to 70% seedling losses in hydroponic (float-bed) tobacco transplant greenhouses. However, little is known about the composition and distribution of Pythium communities in tobacco transplant greenhouses. This project began with a tobacco transplant greenhouse survey, in which 12

Pythium species were recovered from center walkways, weeds, greenhouse bay water, and tobacco seedlings. Pythium dissotocum and P. myriotylum were the two types (species) of

Pythium most commonly found in the survey. Pythium myriotylum, P. coloratum, and P. dissotocum were aggressive pathogens that suppressed seed germination and caused root rot, stunting, foliar chlorosis, and death of tobacco seedlings. Pythium aristosporum, P. porphyrae,

P. torulosum, P. inflatum, P. irregulare, P. catenulatum, and an isolate of P. dissotocum, were weak pathogens causing root symptoms without affecting the upper part of tobacco seedlings.

Pythium adhaerens, P. attrantheridium, and P. pectinolyticum did not affect tobacco seeds or seedlings. The symptoms caused by infection by Pythium species differed among host (tobacco) growth stages, except for the most aggressive species, P. myriotylum. High levels of variation were observed among isolates of P. dissotocum, in terms of vegetative growth rate (on V8 agar media) and aggressiveness on tobacco seed and seedlings. Pythium myriotylum was found to coexist with multiple other Pythium or oomycete species (neighbor isolates) in the same environments within tobacco greenhouses. Significant interactions between P. myriotylum and some neighbor isolates were revealed, and these interactions significantly affect the consequences of P. myriotylum infection of tobacco seeds. Greenhouse Pythium control trials

identified two chemical water treatments (ethaboxam and mefenoxam), and a non-chemical water treatment (copper ionization) as potentially promising alternatives to the current standard

Pythium control (etridiazole) for Pythium disease management in tobacco transplant production.

The outcomes of this project provide useful new information to both better understand the composition, distribution, and diversity of Pythium communities in tobacco transplant greenhouses and to improve Pythium disease management for tobacco transplant production.

Dedications

I am dedicating this work to my parents (Gui and Ying) and my brother (Song), who are always kind and supportive. Without their love and support, I would not be able to pursue my dream. This dissertation is also dedicated to the love of my life, Howard, and our lovely son

Nick, who are the sunshine of my life. I am grateful for the joy they bring to me.

Acknowledgements

I would like to gratefully acknowledge many people who have been guiding and supporting me during my PhD study, without their help I would not have made it this far. I am extremely thankful for my advisor Dr. Charles Johnson, who has been a wonderful mentor to me.

All the research and life experience that he has shared with me have guided me through many, many difficult times. I could not imagine where I would be if he were not there guiding and supporting me. I deeply appreciate this opportunity of working with him and learning from him.

I would also like to express my gratitude to my advisory committee members: Dr. David Reed,

Dr. Anton Baudoin, and Dr. Chuanxue Hong, who have been incredibly generous and supportive, providing advice, space, and experimental materials for me whenever I needed them.

My heartfelt gratitude extends also to Mary Ann Hansen and Elizabeth Bush at the plant disease clinic on campus, who generously provided tremendous support in my research and personal life.

I also would like to thank Stephen Barts, Taylor Clarke, and other colleagues who helped me collect survey samples. My sincere gratitude also goes to Spencer, Noah, Tyler, Laura, Molly, and my other laboratory mates, without whose help I would not be able to conduct so many trials at the Southern Piedmont Agricultural Research and Extension Center (SPAREC). I also would like to thank Dr. Carol Wilkinson, Brad, Melody, Margaret, Grace, and other folks in the

SPAREC family; they have been so kind and supportive to me in every aspect.

Last but not least, my special “thanks” goes to my dear Pythium friends. I am so thankful that they have been so patient with me and showed me a wonderful world that not everybody would get a chance to see.

vii

Contents

Dedications ...... vi

Acknowledgements ...... vii

Contents ...... viii

List of Figures ...... xi

List of Tables ...... xv

Chapter 1 ...... 1

Introduction ...... 1

1.1 Background ...... 2

1.2 Objectives ...... 3

1.3 Broader Impact ...... 4

Chapter 2 ...... 5

Review of Literature ...... 5

2.1 Tobacco ...... 5

2.2 Tobacco Transplant Production in Float-bed Greenhouses ...... 17

2.3 General Information of Pythium Genus...... 24

2.4 Pythium Pathogens ...... 32

2.5 Pythium in Tobacco Transplant Production Greenhouses ...... 46

2.6 Perspective ...... 60

Chapter 3 ...... 62

Diversity of Pythium Species Recovered from Seven Sites within Tobacco Transplant

Greenhouses...... 62

viii

Abstract ...... 62

3.1 Introduction ...... 63

3.2 Materials and Methods ...... 65

3.3 Results ...... 74

3.4 Discussion ...... 94

3.5 Conclusions ...... 109

Chapter 4 ...... 112

Pathogenicity and Virulence of Pythium Species Recovered from Tobacco Transplant

Greenhouses...... 112

Abstract ...... 112

4.1 Introduction ...... 113

4.2 Materials and Methods ...... 115

4.3 Results ...... 124

4.4 Discussion ...... 161

4.5 Conclusions ...... 174

Chapter 5 ...... 176

Pythium Community Ecology: Interspecific Interaction ...... 176

Abstract ...... 176

5.1 Introduction ...... 177

5.2 Materials and Methods ...... 180

5.3 Results ...... 186

5.4 Discussion ...... 194

5.5 Conclusions ...... 198

Chapter 6 ...... 199

Assessment of Alternative Disease Control Methods for Pythium myriotylum in Tobacco

Transplant Production Greenhouses ...... 199

Abstract ...... 199

6.1 Introduction ...... 200

6.2 Materials and Methods ...... 202

6.3 Results ...... 209

6.4 Discussion ...... 236

6.5 Conclusions ...... 245

Chapter 7 ...... 247

Summaries and Future Directions ...... 247

References ...... 251

Appendix A ...... 275

Chapter 3 Supplementary Materials...... 275

Appendix B ...... 277

Chapter 4 Supplementary Materials...... 277

Appendix C ...... 278

Chapter 6 Supplementary Materials...... 278

List of Figures

Figure 2.1.1. A scale of the growth stages in tobacco...... 7

Figure 2.1.2. The secondary growth stages in tobacco seed germination and leaf development....8

Figure 2.1.3. The seed structure of Nicotiana tabacum ...... 9

Figure 2.1.4. The seed germination process of tobacco seeds ...... 11

Figure 2.1.5. The anatomy of a 10-day-old tobacco seedling ...... 13

Figure 2.1.6. The anatomy of a 6-week-old tobacco seedling ...... 14

Figure 2.2.1. Several 12 x 24-cell (13.5 in x 24.5 in) expanded polystyrene (EPS) trays containing young tobacco seedlings, floating on nutrient solution (bay water) in a bed (bay). ... 18

Figure 2.2.2. The inside image of a float-bed tobacco greenhouse...... 20

Figure 2.3.1. The similarities and differences between true fungi and oomycetes...... 25

Figure 2.4.1. The life cycle of Pythium pathogens that cause diseases in hydroponic greenhouses.

...... 42

Figure 2.5.1. The symptoms of Pythium root rot in float-bed tobacco production greenhouses. . 49

Figure 3.2.1. Sample sites or types in the 2017 tobacco greenhouse survey...... 66

Figure 3.3.1. The composition of isolate collection in the 2017 tobacco greenhouse survey...... 75

Figure 3.3.2. Number of Pythium isolates recovered from different sampling sites, types, or substrates within tobacco greenhouses in the 2017 tobacco greenhouse survey...... 76

Figure 3.3.3. The phylogenetic tree of the oomycete isolates collected in the 2017 greenhouse survey………………………………………………………………………………………….…87

Figure 3.3.4. Phylogenetic tree of Pythium coloratum and P. catenulatum isolates collected in the

2017 greenhouse survey………………………………………………………………….………91

Figure 3.3.5. Phylogenetic tree of Pythium myriotylum isolates collected in the 2017 greenhouse survey…………………………………………………………………………………….………92

Figure 3.3.6. Phylogenetic tree of Pythium dissotocum isolates collected in the 2017 greenhouse survey……………………………………………………………………………………..….…..93

Figure 4.2.1. Demonstration of the tobacco seed or seedling layout used in laboratory pathogenicity tests...... 117

Figure 4.2.2. Demonstration of a mini-bay float water system: A 25-cell mini tray floating in a mini-bay filled with 1 gallon of water...... 120

Figure 4.3.1. The results of tobacco seed inoculation with other Pythium species in Petri dishes.

...... 134

Figure 4.3.2. The results of tobacco seed inoculation with Pythium myriotylum in Petri dishes.

...... 135

Figure 4.3.3. The results of tobacco seedling inoculation with Pythium species in Petri dishes.138

Figure 4.3.4. Disease progress and seedling growth changes over time, when inoculating at seeding in Trial 1 (Top) and Trial 2 (Bottom)...... 152

Figure 4.3.5. Disease progress and seedling growth changes over time, when inoculating at 10 days after seeding in Trial 3 (Top) and Trial 4 (Bottom)...... 155

Figure 4.3.6. Disease progress and seedling growth changes over time, when inoculating at 4 weeks after seeding in Trial 5 (Top) and Trial 6 (Bottom)...... 157

Figure 5.2.1. The design of the co-inoculation experiments...... 183

Figure 5.3.1. Mycelial growth patterns of Pythium myriotylum and other species on dual cultures.

...... 189

Figure 5.3.2 Approaching the clear zone around Pythium porphyrae on a dual culture from 3 cm

xii

away with a microscope (100 X)...... 190

Figure 6.2.1. Five 288-cell Styrofoam trays floating in a small bay...... 205

Figure 6.2.2. The entire root system (yellow) of tobacco seedlings consists of water roots (red, from the root tip to the bottom of the tray) and the part of roots contained in the tray...... 206

Figure 6.3.1. Comparison of seedling vigor (top) and spore reproduction in root tissues (bottom) at the end of a mini-bay chemical trial...... 211

Figure 6.3.2. AUDPC of Pythium diseases under the influence of chemical water treatments in float-bed tobacco production systems in 2017 and 2019 mini-bay greenhouse trials...... 214

Figure 6.3.3. Disease progress analysis (treatment effect changes over time) of the treatment effects of chemical water treatments on water roots root rot incidence (%) in 2017, 2018 and

2019 mini-bay chemical trials...... 216

Figure 6.3.4. Disease progress analysis (treatment effect changes over time) of the treatment effects of chemical water treatments on water roots root severity (%) in 2017, 2018 and 2019 mini-bay chemical trials...... 217

Figure 6.3.5. Disease progress analysis (treatment effect changes over time) of the treatment effects of chemical water treatments on root length (cm) in 2017, 2018 and 2019 mini-bay chemical trials...... 219

Figure 6.3.6. Disease progress analysis (treatment effect changes over time) of the treatment effects of chemical water treatments on plant height in 2017, 2018 and 2019 mini-bay chemical trials...... 220

Figure 6.3.7. Disease progress analysis (treatment effect changes over time) of the treatment effects of chemical water treatments on stunting incidence (%) in 2017, 2018 and 2019 mini-bay chemical trials...... 222

xiii

Figure 6.3.8. Disease progress analysis (treatment effect changes over time) of the treatment effects of chemical water treatments on leaf chlorosis incidence (%) in 2017, 2018 and 2019 mini-bay chemical trials………………………………………………………………………..224

Figure 6.3.9. Disease progress analysis (treatment effect changes over time) of the treatment effects of chemical water treatments on mortality incidence (%) in 2017, 2018 and 2019 mini- bay chemical trials…………………………………………………………………………...…225

Figure 6.3.10. Comparison of tobacco seedling roots (top) and spore reproduction in root tissues

(bottom) at the end of small-bay trial…………………………………………………………..227

Figure 6.3.11. AUDPC of Pythium diseases under the influence of chemical water treatments in float-bed tobacco production systems in 2017 and 2019 small-bay greenhouse trials...... 229

Figure 6.3.12. Disease progress analysis (treatment effect changes over time) of the treatment effects of non-chemical water treatments on water roots root rot incidence (top, %) and severity

(bottom, %) in small-bay non-chemical trials...... 231

Figure 6.3.13. Disease progress analysis (treatment effect changes over time) of the treatment effects of non-chemical water treatments on water leaf chlorosis incidence (top, %) and stunting incidence (bottom, %) in small-bay non-chemical trials...... 234

Figure 6.3.14. Disease progress analysis (treatment effect changes over time) of the treatment effects of non-chemical water treatments on non-germination rate (%) and mortality incidence

(%) in small-bay non-chemical trials...... 234

xiv

List of Tables

Table 2.2.1. Common problems occurring in float greenhouse tobacco transplant production ... 23

Table 2.3.1. The taxonomical changes of Pythium genus...... 26

Table 2.3.2. Morphological characteristics used to identify Pythium species (Van der Plaats-

Niterink, 1981))...... 31

Table 2.4.1. The symptoms caused by Pythium species on tomato (Blancard et al., 2012)...... 35

Table 2.4.2 Common Pythium pathogens occurring in hydroponic crop production greenhouses.

...... 39

Table 2.5.1 The management methods for Pythium control in float-bed tobacco greenhouses. .. 55

Table 3.2.1. The sampling structure of the 2017 tobacco transplant greenhouse survey ……….68

Table 3.3.1. The summary of sample isolation efficiency in the 2017 tobacco transplant greenhouse survey...... 77

Table 3.3.2. Presence of Pythium spp. at different sites within tobacco greenhouses...... 78

Table 3.3.3. Presence of Pythium spp. on directly plated cultures and different types of baits in water samples...... 79

Table 3.3.4. Presence of Pythium spp. in tobacco seedling samples according to disease symptoms exhibited...... 80

Table 3.3.5. Isolation frequencies (presented by sampling site) of Pythium spp. within greenhouses visited only once in the 2017 tobacco transplant greenhouse survey...... 82

Table 3.3.6. Isolation frequencies (presented by sampling site) of Pythium spp. within greenhouses visited multiple times in the 2017 tobacco transplant greenhouse survey...... 85

Table 3.4.1. Distribution and host ranges of Pythium species identified in the 2017 tobacco

greenhouse survey...... 97

Table 4.2.1. The cardinal temperatures of the Pythium species evaluated in the laboratory pathogenicity tests (Van der Plaats-Niterink, 1981, Sparrow, 1931, Paul, 2001) ...... 118

Table 4.2.2. Pythium inoculation treatments in mini-bay greenhouse pathogenicity tests……..121

Table 4.3.1. Mycelial growth measurements of Pythium myriotylum isolates on 10% V8 medium.

...... 124

Table 4.3.2. Mycelial growth measurements of Pythium dissotocum isolates on 10% V8 medium.

...... 125

Table 4.3.3. Germination of tobacco TN 90LC seeds inoculated with Pythium myriotylum isolates in Petri dishes, 10 days after inoculation...... 127

Table 4.3.4. Root rot incidence and severity index of 10-day-old tobacco TN 90LC seedlings inoculated with Pythium myriotylum isolates in Petri dishes, 7 days after inoculation...... 128

Table 4.3.5. Germination of tobacco TN 90LC seeds inoculated with Pythium dissotocum isolates in Petri dishes, 10 days after inoculation...... 129

Table 4.3.6. Root rot incidence and severity index of 10-day-old tobacco TN 90LC seedlings inoculated with Pythium dissotocum isolates in Petri dishes, 7 days after inoculation...... 131

Table 4.3.7. Seedling stand (%) of Tobacco TN 90LC inoculated with Pythium species at seeding in Petri dishes. Results are from two laboratory experiments...... 133

Table 4.3.9. Disease severity at 7 and 10 days after inoculating of 10-day-old tobacco TN 90LC seedlings with individual Pythium species in Petri dishes...... 137

xvi

Table 4.3.10. Germination of TN 90LC tobacco seeds in two greenhouse trials following bay water inoculation with individual Pythium species at seeding...... 140

Table 4.3.12. Effects of float water inoculation with induvial Pythium species at seeding on root vigor, length, and weight of TN 90LC tobacco seedlings...... 143

Table 4.3.13. Effects of float water inoculation with individual Pythium species at seeding on seedling vigor, foliar chlorosis and mortality of TN 90LC tobacco seedlings...... 144

Table 4.3.17. Effects of float water inoculation with individual Pythium species at water-root emergence on root rot incidence and severity and numbers of oospores in the root tissues of TN

90LC tobacco seedlings...... 148

Table 4.3.18. Effects inoculating float water with individual Pythium species at water-root emergence on the vigor, length and weight of roots produced by TN 90LC tobacco seedlings. 149

xvii

Table 4.3.21. Pearson correlation coefficients between tobacco seedling and root vigor and root rot incidence and severity after Pythium inoculations at seeding...... 159

Table 4.3.22. Pearson correlation coefficients between the tobacco seedling and root vigor, and root rot incidence and severity after Pythium inoculations at seedling emergence...... 159

Table 4.3.24. The ANOVA results of disease intensity over time (the area under the disease progress curve, AUDPC), for comparisons across greenhouse trials...... 161

Table 5.2.1. Treatments in the dual culture assays...... 182

Table 5.2.2. Species combination treatments in the co-inoculation experiments...... 184

Table 5.2.3. Inoculum application time in the co-inoculation experiments...... 184

Table 5.3.1. Mycelial growth measurements of Pythium species, Achlya flagellata and

Mortierella hyalina Isolates on 10% V8 agar medium at 27 ºC...... 187

Table 5.3.2. Mycelial growth measurements of Pythium myriotylum in dual culture assays. .... 188

Table 5.3.3. Effects of inoculation treatment, inoculation timing and their interactions on the germination of tobacco TN 90LC seeds and the disease severity index on the seedlings

xviii

germinated from the inoculated seeds in the co-inoculation experiments...... 191

Table 6.2.1. The treatment list in mini-bay chemical trials...... 203

Table 6.2.2. Treatments in small-bay non-chemical trials...... 205

Table 6.3.1. The final effects of chemical treatments on TN 90 LC tobacco seedling roots and root rot diseases in mini-bay chemical trials...... 210

Table 6.3.2. The treatment and time effects on TN 90LC tobacco seedlings and root rot diseases in mini-bay chemical trials...... 213

Table 6.3.3. The treatment effect changes over time: the effects of chemical water treatments on water roots root rot incidence (%) of tobacco seedlings in mini-bay greenhouse trials...... 215

Table 6.3.4. The treatment effect changes over time: the effects of chemical water treatments on water roots root rot severity (%) of tobacco seedlings in mini-bay greenhouse trials...... 217

Table 6.3.5. The treatment effect changes over time: the effects of chemical water treatments on root length (cm) of tobacco seedlings in mini-bay greenhouse trials...... 219

Table 6.3.6. The treatment effect changes over time: the effects of chemical water treatments on plant height (cm) of tobacco seedlings in mini-bay greenhouse trials...... 220

Table 6.3.7. The treatment effect changes over time: the effects of chemical water treatments on stunting incidence (%) of tobacco seedlings in mini-bay greenhouse trials...... 222

xix

Table 6.3.8 The treatment effect changes over time: the effects of chemical water treatments on leaf chlorosis incidence (%) of tobacco seedlings in mini-bay greenhouse trials...... 224

Table 6.3.9. The treatment effect changes over time: the effects of chemical water treatments on mortality incidence (%) of tobacco seedlings in mini-bay greenhouse trials...... 225

Table 6.3.10. The final effects of water treatments on TN 90LC tobacco seedling roots and root rot diseases in small-bay non-chemical trials...... 226

Table 6.3.11. The treatment and time effects on TN 90LC tobacco seedlings and root rot diseases in small-bay trials...... 229

Table S3.1. The sampling structure within the greenhouses with single visits in the 2017 tobacco transplant greenhouse survey………………………………………………………………...…275

Table S3.2. The sampling structure within the greenhouses with multiple visits in the 2017 tobacco transplant greenhouse survey………………………………………………………….276

Table S 4.1. Presence of Pathogenic Pythium spp. at different locations within tobacco greenhouses in 2017 survey...... 277

xxi

Xuemei Zhang Chapter 1 1

Chapter 1

Introduction

Pythium diseases are common and often lingering (persistent) in hydroponic greenhouse production of various vegetables and nursery plants including tobacco transplants, hemp transplants, basil, cilantro, cucumber, lettuce, tomato, spinach, etc., posing a risk to hydroponic crop production worldwide (Goldberg, 1990, Liu et al., 2007, Rafin & Tirilly, 1995, Kumar et al., 2008, Khan et al., 2003, Romero et al., 2012, Huo et al., 2020, Anderson et al., 1997, Punja

& Rodriguez, 2018, Liptay & Tu, 2003, Lin & Huang, 1993, Hong et al., 2004, Larsson, 1994,

Utkhede et al., 2000, Gull et al., 2004, Labuschagne et al., 2002, Labuchagne et al., 2002,

Rodriguez & Punja, 2007, Labuschagne et al., 2003, Kusakari & Tanaka, 1987, Bates &

Stanghellini, 1984, Kageyama et al., 2002, Gull, 2006, Miyake et al., 2014, Stanghellini &

Kronland, 1986, Larsen, 1982). Symptoms of Pythium infection can vary widely among greenhouses, even on the same crop species; infected plants may be symptomless

(asymptomatic), exhibit root discoloration and decay, wilting, stunting, leaf chlorosis (yellowing or bleaching), plant death or the combination of these symptoms (Rafin & Tirilly, 1995,

Gutiérrez et al., 2012, Rey et al., 1998, Stanghellini & Russell, 1971, Anderson et al., 1997, Lin

& Huang, 1993, Herrero et al., 2003, Labuschagne et al., 2003). Pythium has become a more pronounced problem over the 30 years since indoor greenhouses overtook outdoor seedbeds as the sites for tobacco transplant production (Thiessen et al., 2020, Reed et al., 2019, Sigobodhla et al., 2010, Mufunda et al., 2017, Gutiérrez et al., 2012, Cartwright et al., 1995, Seebold et al.,

2013, Anderson et al., 1997, Reed, 2009). Due to the insufficient disease phenotyping

(characterization) of specific Pythium species and a lack of effective control options, Pythium

Xuemei Zhang Chapter 1 2 disease remains a thorn in the side of many tobacco growers.

1.1 Background

Pythium is a genus of oomycete pathogens that damages roots and lower plant parts of various plants in soil or hydroponic environments (Hendrix & Campbell, 1970, Ho, 2018,

Schroeder et al., 2013, Mahendra Rai et al., 2020). Oomycetes are microorganisms that resemble fungi morphologically, but are genetically more closely related to algae, and are abundant in terrestrial environments throughout the world. Known as “water molds”, oomycetes thrive in aquatic environments because water favors their growth, dissemination, and reproduction

(Thines, 2014, Beakes et al., 2012). Consequently, Pythium is a frequent threat to the hydroponic production of economically important plants (Sutton et al., 2006), including tobacco transplant production. Although Pythium species have significantly impacted tobacco transplant production for several decades, our knowledge has remained limited regarding the ecology of these pathogens, mainly due to difficulties in accurately identifying and characterizing Pythium species

(Mostowfizadeh-Ghalamfarsa & Salmaninezhad, 2020, Ho, 2018).

Symptoms of Pythium infection vary widely among tobacco greenhouses and the factors contributing to this symptom variation remain unclear. Previous research suggested that Pythium diseases in tobacco greenhouses are often associated with multiple species of Pythium, and the virulence of these species can be significantly different (Mufunda et al., 2017, Gutiérrez et al.,

2012). However, the distribution of individual Pythium species within tobacco greenhouses remains unclear, as is the structure of the communities of Pythium species that may coexist within tobacco greenhouses. Potential differences in Pythium community structures among tobacco greenhouses remain unknown, hindering our ability to ascertain the causes of the

Xuemei Zhang Chapter 1 3 variation of Pythium disease symptomatology and epidemiology among tobacco greenhouses.

Interactions among Pythium species can affect the root rot severity of plant hosts (Lee &

Hoy, 1992). If coexistence of multiple Pythium species in the same environment is common in tobacco greenhouses, is it possible that root rot diseases in hydroponic systems are also influenced by interactions among these species? Although Mufunda et al. (2017) and Gutierrez et al. (2012) identified the major Pythium species associated with Pythium root rot, and tested the virulence of each species separately, interactions among Pythium species in tobacco greenhouses have not been investigated, nor has the influence that such interactions might have on tobacco transplants, or other crops, in hydroponic systems.

Management of Pythium diseases in tobacco greenhouses currently relies mainly on sanitation and oomyceticide application. The number of commercial products available to tobacco growers for Pythium control in tobacco greenhouses is very limited. In recent years, the use of ultraviolet light and copper ionization has become popular in other hydroponic crop production systems, and these new technologies provide hope for organic growers, However, their efficacies in the management of Pythium diseases in tobacco greenhouses have not been rigorously investigated. Tobacco transplant producers are eager to use more diverse and effective management tools, but the effectiveness of these potential new tools needs to be confirmed.

1.2 Objectives

The objectives of this study were to:

1) identify the species and distribution of Pythium within and among tobacco hydroponic

greenhouses.

2) test the impact of individual Pythium species on tobacco seeds and seedlings at critical

Xuemei Zhang Chapter 1 4

growth stages.

3) study the interactions between aggressive Pythium species and other Pythium species or

major microbial groups that coexist in the same environments in tobacco greenhouses, as

well as the influence of such interactions on tobacco seedlings.

4) compare alternative management tools to a current standard product for Pythium control in

tobacco greenhouses.

1.3 Broader Impact

Currently, there is a lack of knowledge regarding the ecology of Pythium communities in tobacco hydroponic greenhouses. Little is known about the identities of the Pythium species that may occur in different environments within tobacco greenhouses, or the possible interactions between these different Pythium species and host phenology, or the potential interactions among concomitant species Pythium species, or the possibility of interactions between Pythium species and other microbes. The outcome of this project would reveal the roles that different Pythium species may play in tobacco hydroponic greenhouses. The ultimate goal of this work is to improve disease management strategies by exploring Pythium-related microbial relationships in tobacco hydroponic greenhouses, as well as seek potential alternative Pythium control methods.

The outcome of this project will not only benefit the management of Pythium diseases in tobacco transplant production but could also provide implications for understanding and managing

Pythium pathogens in similar hydroponic crop production systems, which may eventually benefit the growing hydroponic crop production industry estimated to worth $5.68 billion (Grand View

Research, 2020).

Xuemei Zhang Chapter 2 5

Chapter 2

Review of Literature

2.1 Tobacco

Tobacco (Nicotiana tabacum) was said to be the most widely cultivated crops in the world, other than common grains and pulses (Lock, 1886). Tobacco currently has a negative public image because of its traditional use in cigarette production, and global tobacco use has been discouraged and declining in recent years (WHO-RITC, 2008, Maciosek et al., 2020,

Hirschfelder, 2010), but the tobacco industry remains an important agriculture sector. It is one of the most valuable and lucrative cash crops in the global agriculture industry (FAO, 2003, Wood,

1998). According to the USDA-ERS (United States Department of Agriculture Economic

Research Service), the US tobacco industry was worth $1.2 billion in 2018, and tobacco remained among the top five cash crops in the states of North Carolina, Kentucky, Tennessee, and Virginia (USDA-ERS, 2018). Tobacco is also being developed as a highly efficient protein and vaccine manufacturing factory (Tremblay et al., 2010, Cornell University, 2019, Erickson et al., 2013, Komarnytsky et al., 2000, Benjamin, 2019, Molina et al., 2004, Cavale, 2020, Daley,

2020, Griffin, 2020). In addition, the history of tobacco production and tobacco product manufacturing ties closely with human history (Breen, 2001, Pego et al., 1995, Billings, 1875,

Jones, 2020, Ferrell, 2013) and tobacco is an important model plant in fundamental biological research (Sierro et al., 2014).

Xuemei Zhang Chapter 2 6

2.1.1 Taxonomy

Tobacco belongs to the genus Nicotiana in the family Solanaceae, the same family where potato, tomato, eggplant, and pepper belong (D'Arcy, 1986). The genus Nicotiana includes N. tabacum, the most well-known species that is widely grown throughout the world for leaf production, but also many other species used for smoking and chewing and multiple ornamental tobacco species valued for flowers (Kishore, 2014, Avery Jr, 1933, Lock, 1886, Johnson & Reed,

1994). There are 76 species in the genus Nicotiana with various chromosome numbers, including a variety of herbaceous annuals, perennials, and shrubby or subarborescent or arborescent (tree- like) plants (Knapp et al., 2004, Avery Jr, 1933). For classification purposes, the species in the genus Nicotiana are divided into 13 sections, and Nicotiana tabacum is the only species belonging to section Nicotiana (Knapp et al., 2004). According to Knapp et al.’s description, the species N. tabacum comprises a group of stout, thick-stemmed herbaceous plants or single- stemmed shrubs, with 24 chromosomes, characterized by large, sessile (petiole-absent) or broadly wing-petioled, viscid tomentose (covered by soft white hairs) leaves, and the corolla is nearly regular, usually pinkish but can vary from white to red, with the tube broadly inflated and the lobes acute, flowers open at daytime (diurnal) (Knapp et al., 2004).

2.1.2 Biology and Physiology of Tobacco Seeds and Seedlings

Tobacco (Nicotiana tabacum) is a dicotyledonous angiosperm; the seeds are produced in flowers and there are two seed leaves in the seed embryo. It is a perennial crop that is cultivated as an annual crop for leaf production. It has 24 chromosomes, and the genome is extensively studied and well-characterized. Tobacco has large, sessile, or broadly wing-petioled, viscid- tomentose leaves, which are harvested as the main products of this crop. The corolla (flower

Xuemei Zhang Chapter 2 7 petal) is nearly regular, salverform, can be white, or pinkish to red, with the tube broadly inflated and the lobes acute, and it opens at daytime (Knapp et al., 2004, Peitsch, 2020).

Growth Stages

An international tobacco industry research association, CORESTA (Cooperation Centre for Scientific Research Relative to Tobacco), has published an identification key to summarize and characterize the phenology of cultivated tobacco plants (Papenfus & Billenkamp, 2019). The key includes nine principle stages, covering the entire tobacco life, from seed germination to the harvesting of the crop (Figure 2.1.1).

Figure 2.1.1. A scale of the growth stages in tobacco (Papenfus & Billenkamp, 2019).

Xuemei Zhang Chapter 2 8

Figure 2.1.2. The secondary growth stages in tobacco seed germination and leaf development (Papenfus & Billenkamp, 2019).

Meso-stages are used to characterize or more accurately identify progression within each principle stage (Figure 2.1.2). Stage 00-09 and Stage 1000-10nn are separated from other stages, which are considered as the transplant (tobacco seedling) production phase. The seeds are usually sown in greenhouses or outdoor plant beds, and the seedlings develop there until they reach proper transplant size. From that point on, the seedlings are grown in the field. The major stages in tobacco crop production are often described as “weeks after seeding”, “weeks after transplanting”, “weeks after topping”, etc. Although this description is not as precise as the

CORESTA scale, it helps growers keep track of the most important stages in tobacco plant development. For example, it takes approximately 10 days for the seed to germinate (reaching

Stage 05-09) and 4-5 weeks for the roots of seedlings to extend into the nutrient solution (“float water” or “bay water”) below greenhouse trays, which is between Stage 1002-1003. Such

Xuemei Zhang Chapter 2 9 descriptions might be vague, but it is enough to help the growers to determine if their plants are growing well. From a scientist’s perspective, knowing the appearance of the tobacco plant at different stages is not enough; the question is what is happening? That is why the researchers conduct experiments to study the anatomy, physiology, and biochemistry of tobacco plants at various growth stages and strive to connect the structures with functions and to deduce the mechanisms involved in the process. In plant pathology, the researchers will associate all this information with the biology of pathogens to understand the disease cycle and to find the appropriate plant growth stages to protect the crops from pathogen attack.

Tobacco Seeds and Seed Germination

Tobacco produces tiny, egg-shaped and flattened seeds with a prominent raphe along one side and ending in the projecting hilum at the smaller end (Figure 2.1.3 & Figure 2.1.4-A).

Figure 2.1.3. The seed structure of Nicotiana tabacum (Finch‐Savage & Leubner‐Metzger, 2006)

The seed coat (testa) is a dark brown reticulated surface. The average size of tobacco seeds is

0.75 mm long, 0.53 mm broad, and 0.47 mm thick. The average a-thousand tobacco seed weight is 0.08 grams (Avery Jr, 1933).The seed structures of Nicotiana species are similar (Figure

Xuemei Zhang Chapter 2 10

2.1.3). The testa serves as protection, consisting of a cutinized two-layered inner wall with a lignified inner layer, with a lightly cutinized thin outer wall. The endosperm serves as nutrient storage. Two seed leaves (cotyledons) and the seed root (radicle) are enclosed within the endosperm layer. Testa rupture and endosperm rupture are separate processes occurring during seed germination, known as the two-step germination process (Finch‐Savage & Leubner‐

Metzger, 2006, Avery Jr, 1933).

During germination (Figure 2.1.4), the radicle breaks the micropylar endosperm (the red area in Figure 2.1.3) and protrudes to the outside (Finch‐Savage & Leubner‐Metzger, 2006,

Avery Jr, 1933). The seed coat breaks under the pressure of the developing radicle around six to eight days after seeding. The hypocotyledonary axis (seed stem) continues elongating, while the radicle simultaneously develops ample root hairs, and the upper hypocotyl (stem) becomes slightly hairy. The cotyledons remain in the seed coat for 10 to 12 days after seeding (Avery Jr,

1933).

The seed coat and the endosperm are involved in implementing coat-imposed dormancy, which can be overcome when triggered by light, gibberellin, or cold treatment of imbibed seeds, or by seed after-ripening during dry storage at room temperature (Finch‐Savage & Leubner‐

Metzger, 2006).

Xuemei Zhang Chapter 2 11

Figure 2.1.4. The seed germination process of tobacco seeds (Avery Jr, 1933): A-M. A, dormant seed (X8). B-D, stages in germination at the end of six days (X8). E-G, same, at the end of nine days (X8). H-J, seedling stages at the 16th to 18th days (X2). K, transverse section through dormant seed at the cotyledonary level (X70). L, longitudinal section through seed just starting to germinate, showing ruptured seed coats (X50). M, longitudinal-median section through seedling at the end of nine days (X50).

Xuemei Zhang Chapter 2 12

Tobacco Seedlings

The seed root has two strands of xylem, the protoxylem, and metaxylem, which are indistinguishable from each other in newly germinated seedlings (Figure 2.1.5). The primary phloem groups are comprised of two small groups of parenchyma with one on a side of the xylem arm. The pericycle (the outer layer of the stele), where the lateral roots are initiated, become visible around 14th – 16th days after seeding (Avery Jr, 1933). The Casparian strip, a band of waterproof corky tissue, is visible in the endodermis. The rest of the cortex layers consist of parenchyma cells. The epidermis is thin-walled and produces abundant root hairs (Avery Jr,

1933). At this point, the anatomical root-to-stem change mainly occurs below the cotyledon region, and the protoxylem extending to the first leaf distal and cotyledon has been differentiated. Xylems in the stele are visible; the root xylem system dividing into several groups

(Avery Jr, 1933). By the 3rd to the 4th weeks after seeding, internal and external phloem became clear. Two to three leaves are visible above the cotyledons. By the 6th week after seeding, the root system is largely adventitious, with roots being initiated by the pericycle throughout the hypocotyl (Figure 2.1.6).

Xuemei Zhang Chapter 2 13

Figure 2.1.5. The anatomy of a 10-day-old tobacco seedling (Avery Jr, 1933). A-1, transverse section through portion of root at the level indicated in B-1 (X I50). A-2 to A-13, transverse sections of stele and endodermis at successive levels indicated in B-2 to B-13 (X I50). A-12. a, xylem of trace to first leaf distal to cotyledon. b, xylem of cotyledonary traces. B, sketch of seedling to show levels at which transverse sections A-1 to A-13 were taken. C, longitudinal- median section through hypocotyl showing transition region, divergence of cotyledonary traces, and growing point of stem.

Xuemei Zhang Chapter 2 14

Figure 2.1.6. The anatomy of a 6-week-old tobacco seedling (Avery Jr, 1933).

Xuemei Zhang Chapter 2 15

2.1.3 Tobacco Transplant Production

From colonial times to the 1960s, American tobacco growers seeded tobacco plants directly in the ground in 100 ft x 20 ft outdoor seed beds or “plant beds”. Growers burned the ground to sterilize the site and kill weeds; burning logs would be rolled over the ground and the ground would be “ironed” by heated metals (Ferrell, 2013). In the 1960s, growers started to fumigate plant bed sites using methyl bromide for weed and pest control. After the seedbeds were prepared, the seeds would be sown and covered by a piece of fabric or plastics (Ferrell,

2013, Grise, 1988). Regular maintenance activities such as weeding, fertilization, and irrigation were needed during the transplant growing stage. When it is time to transplant (set), the

Seedlings had to be pulled from the seedbed by hand, individually, and transplanting time and transported to the field. The whole process was notoriously exhausting, especially on hot days. It was labor-intensive and also risky because the pulled seedlings would die if not transplanted in a timely manner (Ferrell, 2013, Reed, 2009, Johnson & Reed, 1994, Grise, 1988).

Although there were other transplant production systems, such as indoor seedbeds and over-head watered greenhouses, nothing has been as game-changing or revolutionary in tobacco transplant production as the introduction of float-bed hydroponic (“float”, “float bed” or “float water”) greenhouses. This practice first emerged in the mid 1980’s, but didn’t become popular until the 1990’s (Ferrell, 2013, Reed, 2009, Johnson & Reed, 1994). Even though it was costly to build these plastic-covered greenhouses, growers chose to invest the capital for this for several reasons. First, it significantly reduced the labor demand for transplanting. People no longer needed to spend half of a day on hand-pulling seedlings, with the additional worry about damaging them. Second, the greenhouse system provides much better control of environmental

Xuemei Zhang Chapter 2 16

conditions; float water greenhouse transplant production provides as much as 15% more usable transplants (Ferrell, 2013). Third, greenhouse-produced seedlings tend to have more uniform growth than plant bed seedlings, benefitting the management of tobacco plants in the field.

Fourth, there is less waste of transplants. Hand-pulling inevitably would injure transplants and people had to guess how many seedlings could be pulled out and transplanted each day. In the float water greenhouses, seedlings are grown on expanded polystyrene (EPS) or plastic trays containing 200-392 plants, that are floated in shallow, water-filled bays. The flexibility of this system enables the easy transportation of tobacco transplants to tobacco fields. Growers can always return to the greenhouse anytime to pick up more trays and drop off unused transplants

(Ferrell, 2013, Reed, 2009, Johnson & Reed, 1994). Float-bed greenhouses are now the most common, and the standard, system for commercial tobacco transplant production (Niedziela et al., 2005, Reed et al., 2019, Pearce et al., 2019, Ferrell, 2013, Reed, 2009, Smith et al., 1993, Jiye

& Haiping, 2004, Chunlei et al., 1997, BU et al., 2008, Frantz et al., 1999b).

Xuemei Zhang Chapter 2 17

2.2 Tobacco Transplant Production in Float-bed Greenhouses

The transition of tobacco transplant production from outdoor plant beds to float greenhouses has had a significant impact on tobacco crop production (Ferrell, 2013, Reed, 2009,

Niedziela et al., 2005). Tobacco growers usually start transplant production in float-bed greenhouses in early spring in Virginia, so that tobacco seedlings will be ready for transplanting by May; the transplant production process takes about two to three months. After transplanting, the greenhouses are usually sanitized and remain idle until the next seedling production season.

2.2.1 Float-bed Systems in Tobacco Greenhouses

The production of plants in soilless environment is known as hydroponics, which is either achieved through liquid nutrient solution (water culture) recirculating systems or substrate-based systems (Niedziela et al., 2005, Kanatas, 2020, Raviv et al., 2008, Frantz et al., 1999a, Carrasco et al., 2003). Hydroponic greenhouse production has the advantage of protecting plants from soilborne pathogens and harsh environmental conditions. There are various types of hydroponic systems, and the float-bed system, the nutrient film technique (NFT), and the aeroponic system are the ones most suitable for greenhouse crop production, among which, the float-bed system is the most ideal, due to its high buffering capacity (Kanatas, 2020, Raviv et al., 2008). Over 90% of tobacco plants are started in float-bed hydroponic greenhouses (Niedziela et al., 2005).

When produced in float-bed systems (Figure 2.2.1), tobacco plants are grown in soilless substrate-based media (containing sphagnum peat, vermiculite, and occasionally perlite) in polystyrene or plastic trays floating on shallow beds or bays containing a nutrient solution

Xuemei Zhang Chapter 2 18

Figure 2.2.1. Several 12 x 24-cell (13.5 in x 24.5 in) expanded polystyrene (EPS) trays containing young tobacco seedlings, floating on nutrient solution (bay water) in a bed (bay).

(Niedziela et al., 2005, Kanatas, 2020, Pearce et al., 2019, Reed et al., 2019). Each tray can hold

200 to 392 plants, depending on the cell number of the tray, which directly influences the size of transplants (Johnson & Reed, 1994). Each cell in a greenhouse tray has a hole at the bottom. As the tobacco seedlings grow, the seedling roots will pass through the growth medium, through the hole at the bottom of the greenhouse tray cell and extend into the nutrient solution in the float beds (bay water). The aboveground part of the plants remains above the tray (Kanatas, 2020).

The trays are constantly floated on the nutrient solution during the transplant production process.

The design of float-bed greenhouses ties-in closely with management practices to achieve the maximum usable rate of tobacco transplants. Temperature and humidity control are critical in

Xuemei Zhang Chapter 2 19

tobacco greenhouse management. Tobacco requires 72 ℉ for seed germination; lower temperatures may slow germination and reduce uniformity in seedling emergence (Reed et al.,

2019, Pearce et al., 2019, Reed, 2009). Minimum temperatures should be maintained above 60-

65 oF in the first few weeks after germination, but later can be as low as 55 oF (Reed et al., 2019,

Reed, 2009). Overheating can also be a problem, because excessive heat (above 95 -100 oF) can stress and even damage the seedlings (Reed et al., 2019, Pearce et al., 2019, Reed, 2009).

Humidity needs to be monitored and controlled because excessive moisture helps pathogens spread and reproduce in the greenhouses. Moisture-laden air can also form droplets on cold surfaces, which may fall onto the trays, dislodging seeds or creating water-logged areas (Reed et al., 2019, Pearce et al., 2019, Reed, 2009).

A typical float-bed tobacco greenhouse (Figure 2.2.2) has several major components: heaters and horizontal airflow fans (HAF, fans for ventilation and air circulation), thermostats and thermometers, shutters, side curtains on two sides, a center walkway, and float beds made of wood frames on two sides of the walkway. The special design of the tobacco greenhouses allows the growers to manage the environmental conditions during the tobacco transplant production process, such as controlling temperature, ventilation, and air circulation, which can help cool down the greenhouse environment and reduce moisture buildup in the greenhouses (Reed et al.,

2019, Pearce et al., 2019, Reed, 2009).

Xuemei Zhang Chapter 2 20

Figure 2.2.2. The inside image of a float-bed tobacco greenhouse.

2.2.2 Tobacco Transplant Production Process

Tobacco growers usually start to seed tobacco in the greenhouses between mid-February and early March in Virginia, and the starting time may be different in other states. For example, it is usually between December and January in Georgia, and between January and February in

South Carolina. The greenhouse needs to be cleaned and sanitized prior to seeding trays. The wooden float bed (bay) frames will be covered by new plastic and filled with water. The water quality needs to be tested to ensure that it is suitable for tobacco seedling growth (Pearce et al.,

2019, Reed et al., 2019, Seebold et al., 2013).

Sanitized EPS or plastic trays are filled with soilless growth medium composed of vermiculite, peat moss, and perlite (Pearce et al., 2019). This step is critical because improper

Xuemei Zhang Chapter 2 21

media selection and tray filling will result in dry cells and spiral roots. The growth media must be relatively fresh; old media tends to lose the wetting agent and thus lose its water absorption capability. The trays cells must be completely filled but not overpacked in order to prevent dry cells, water-logging and spiral roots. In dry cells, the growth media is not wet, and the seeds cannot germinate due to undissolved seed coats. Spiral roots happen when the growth medium is packed too tight and the seedling roots cannot penetrate the growth media and therefore remain on the surface of the media. Spiral roots tend to cause seedling death (Reed et al., 2019, Pearce et al., 2019, Reed, 2009).

Seeded trays are floated on the bay water. Fertilizers with a nitrate N source are applied into bay water during the first two weeks to provide nutrients for the tobacco. There are several different fertilization programs; it is highly recommended that 150 ppm N be applied 3-5 days after seeding, followed by another 100 ppm N at 4 weeks after seeding (Reed et al., 2019, Pearce et al., 2019, Reed, 2009). The program can be adjusted depending on the specific needs, for example, to avoid a persistent disease that is associated with high or low N levels (Pearce et al.,

2019).

When the seedling buds are 2 – 2.5 inches tall, the seedling leaves need to be clipped by a mower. The clipping blade needs to be very sharp. The mower is usually set at 1 to 1.5 inches above the buds. The mower goes slowly above the buds and clips 0.5 to 1 inch from the tips of the top leaves. The seedlings need to be clipped multiple times during the growing season, usually at 3 to 5 - day intervals. With monitored and controlled temperature and humidity, as well as regular leaf clipping, the tobacco seedlings are usually ready for transplants in 7 to 9 weeks (Reed et al., 2019, Pearce et al., 2019, Reed, 2009).

Xuemei Zhang Chapter 2 22

2.2.3 Common Problems in Float Greenhouse Tobacco Transplant

Production

Compared with outdoor plant beds, greenhouse tobacco transplant production systems are less risky and provide higher quality and more usable transplants. However, there are various problems in float greenhouse tobacco transplant production, and some can be persistent and challenging. Table 2.2.1 summarizes the common problems occurring in tobacco greenhouses

(Reed et al., 2019, Pearce et al., 2019, Shew & Lucas, 1991). It is important to point out that the importance of these problems may vary among different states, tobacco types, and varieties.

Pythium diseases are widespread in float-bed tobacco greenhouses throughout the world.

Although Pythium infection usually cause root discoloration and root rot, researchers have found multiple species of Pythium associated with tobacco seedlings exhibiting root rot symptoms

(Mufunda et al., 2017, Gutiérrez et al., 2012). In addition to that, the above-tray symptoms of

Pythium diseases can vary largely among greenhouses, suggesting that Pythium infection in tobacco transplant greenhouses could be due to disease complexes. However, no research has been conducted on the species composition of the Pythium community in tobacco greenhouses.

Therefore, the causal agent of Pythium diseases or Pythium root rot are addressed vaguely as

“Pythium species”. Current management tools for Pythium diseases in tobacco transplant greenhouses are limited, with varying efficacies, but mainly rely on tray sanitation and fungicide applications to bay water (Reed et al., 2019, Pearce et al., 2019, Thiessen et al., 2020).

Xuemei Zhang Chapter 2 23

Table 2.2.1. Common problems occurring in float greenhouse tobacco transplant production Problems Description Cause Expired growth medium Dry cell The growth media are not wet properly Tray cells are not completely filled The roots of tobacco seedlings are spiral, which Spiral roots Growth medium packed too tightly Non- remain on the surface of growth media biotic The affected leaf curls on the edge and usually Cold injury Temperature too low forms a cup Fertilizer buildup at the surface of Salt injury Leaf curls and leaf chlorosis growth media

Green or brown slimy coverage on the surface Algae of nutrient solution and/ or the surface of Algal growth in the nutrient solution growth media

Brown or dark roots appeared to be soft and Pythium root rot slimy, may or may not be accompanied with Multiple species of Pythium leaf chlorosis, stunting, or damping off Biotic

Leaf lesions with alternating rings of light and Thanatephorus cucumeris Target spot dark brown, resembling targets (Teleomorph of Rhizoctonia solani)

A small black-brown lesion formed at the stem Collar rot base, which can expand to encircle the stem and Sclerotinia sclerotiorum kill the plant

A small dark or brown water-soaked area on the stem base, which can expand to girdle the stem. Sore shin Rhizoctonia solani Usually accompanied with the presence of massive white fluffy mold

The darkening of lower stems spread from leaf debris or wounded tissues. Then dark slimy and Bacterial soft rot/ necrotic lesion moves up on one side of the Pectobacterium carotovorum Blackleg stem. Usually accompanied with an unpleasant odor.

yellow leaf spots can connect to form light‐ brown necrotic lesions; the underside of the Peronospora hyoscyami f. sp. tabacina Blue mold affected leaves covered by grey to bluish (Adam) downy mold. Affected leaves can be twisted to turn the underside upward. Water-soaked leaf lesions become brown or Angular leaf spot dark necrotic lesions with angular margins, Pseudomonas syringae pv tabaci upon drying (Reed et al., 2019, Pearce et al., 2019, Shew & Lucas, 1991)

Xuemei Zhang Chapter 2 24

2.3 General Information of Pythium Genus

Pythium is a genus within the oomycetes, a group of microbes that resemble fungi but are more closely related to brown algae in terms of genetics. Along with the taxonomical shifting of oomycetes out of the Kingdom Eumycota (Fungi), the specific taxonomy of Pythium has also undergone several changes. Pythium is now the largest genus under the Family Pythiaceae, Order

Pythiales, Class Oomycetes, Phylum Oomycota, and Kingdom Chromista; there are 331 species in this genus (Mycobank, 2020, Kamoun, 2009). Pythium is widespread in natural and agricultural ecosystems throughout the world, in soil and water as saprophytes and/or pathogens, and in other microbes, plants, insects, or animals (Van der Plaats-Niterink, 1981, Robertson,

1980, Middleton, 1943, Kamoun, 2009, Ho, 2009). Due to the limited information and the variability of morphological characteristics, the classification and identification of Pythium species have been challenging, even with the assistance of molecular tools (Levesque & De

Cock, 2004, Kamoun, 2009, Mostowfizadeh-Ghalamfarsa & Salmaninezhad, 2020, Ho, 2018).

The fact that multiple species of Pythium are often present in the same sample or environment at the same time causes even more difficulties in Pythium studies (Ho, 2009, Mostowfizadeh-

Ghalamfarsa & Salmaninezhad, 2020). Although the study of Pythium genus was initiated in the mid-1900’s, there is a lack of detailed and accurate descriptions of many species of Pythium.

2.3.1 Oomycetes

Oomycetes are said to be one of the most successful eukaryotic organisms due to their biological and ecological diversity, as well as their ubiquity in various ecosystems in the world

(Beakes et al., 2012, Kamoun, 2009, Thines, 2014). For a long time, oomycetes had been

Xuemei Zhang Chapter 2 25

categorized under the Kingdom Eumycota (Fungi), due to their resemblance to true fungi in many aspects (Figure 2.3.1). However, phylogenetic evidence demonstrated that oomycetes share common ancestors with heterokonts such as diatoms and brown algae (Beakes et al., 2012,

Kamoun, 2009, Lévesque, 2011, Thines, 2014). As a matter of fact, oomycetes share many biochemical and morphological characteristics with diatoms and brown algae; for example, they all produce the energy storage chemical mycolaminarin, as well as swimming asexual spores possessing two flagella (Kamoun, 2009).

Figure 2.3.1. The similarities and differences between true fungi and oomycetes (Beakes et al., 2012, Ho, 2009, Kamoun, 2009, Thines, 2014).

Oomycetes are subdivided into five taxonomic orders: Saprolegniales, Leptomitales,

Lagenidales, Peronosporales and Pythiales. The first three mainly contain saprophytes and animal pathogens and the last two comprise the majority of oomycete plant pathogens (Beakes et al., 2012, Cooke et al., 2000, Kamoun, 2009, Lévesque, 2011). Phytophthora and Pythium are

Xuemei Zhang Chapter 2 26

the two most important genera in Order Pythiales in terms of agricultural crop production.

2.3.2 Pythium Taxonomy

The genus Pythium was created by Pringsheim in 1858, and was initially categorized as a group of fungi and placed under Family Saprolegniaceae (Ho, 2018, Levesque & De Cock, 2004,

Mostowfizadeh-Ghalamfarsa & Salmaninezhad, 2020). Since then, the taxonomy of Pythium has been changing and it is in flux (Table 2.3.1).

Table 2.3.1. The taxonomical changes of Pythium genus Year Contributor(s) Contribution(s) 1858 Pringsheim Established the genus Pythium, belonging to family Saprolegniaceae, Fungi 1952 Gäumann Placed the Order Pythiales (Phytophthora and Pythium) between primitive saprophytic oomycetes (Saprolegnia) and advanced obligate pathogenic oomycetes (Albugo and Peronospora) 1973 Waterhouse Moved Order Pythiales down to Family Pythiaceae, under Order Peronosporales 1981 Cavalier-Smith Separated Oomycota from Fungi and put it under Kingdom Chromista (algae), as Phylum Heterokonta (oomycota) 1984 Dick Created Order Pythiales and Family Pythiaceae with 10 genera including Pythium 1989 Patterson Separated colorless oomycetes (Straminopiles) from algae 1989- Phylogenetic analysis of protein patterns, isozymes and RFLPs 1993 of mitochondrial and nuclear DNA on oomycetes 2000 Cooke Validated Pythium taxonomy with ITS sequences

2000 Martin Presented 6 clusters within Pythium genus, with weak correlations with sporangial shapes 2004 Levesque and de Cock Presented 11 clades within Pythium genus, with strong correlations with sporangial shapes

The problem mainly lies in the fact that the taxonomic studies of the genus Pythium are still far from complete and mature, and thus the taxonomy of Pythium is still not stable. Many

Xuemei Zhang Chapter 2 27

factors contributing to this chaos are as follows (Cooke et al., 2000, Ho, 2018, Levesque & De

Cock, 2004, Mostowfizadeh-Ghalamfarsa & Salmaninezhad, 2020):

1) Difficulties in species characterization. Some morphological characters are not stable and

there is too much variability in the size and shape of the reproductive structures within

species, or there are similar traits across species.

2) A lack of complete and accurate identification keys.

3) Many “new” species were found after DNA sequencing became popular (especially since

2000) and some of them were given new names without clear morphological descriptions.

Those could be previously known species.

4) The disconnection between morphological and molecular characteristics: in Pythium genus,

morphological and biological differences (oogonial ornamentation, heterothallism, etc.) are

not well-correlated with genetic differences, although a correlation was found between

sporangial shapes and species clusters (clades). With more and more polygenetic evidence,

researchers started to question previous classification solely based on morphological and

biological traits.

For the time being, Pythium is classified as a genus under the Family Pythiaceae, Order

Pythiales, Class Oomycetes, Phylum Oomycota, Kingdom Chromista/Protista, and Domain

Eukarya. The most widely accepted current Pythium infrageneric classification was proposed by

Levesque and de Cock in 2004, in which Pythium was divided into 11 clades (A-K) based on morphological and genetic evidence. Clades A, B, C and D produce filamentous sporangia,

Clades E, F, G, H, I and J produce globose sporangia and Clade K ovoid sporangia (Levesque &

De Cock, 2004). Later, Clade K was separated and classified as an independent genus

Xuemei Zhang Chapter 2 28

Phytopythium (De Cock et al., 2015, Robideau et al., 2011).

2.3.3 Pythium Ecological Roles and Biological Features

Pythium species are widespread in soil, water and plants, as saprophytes or pathogens, throughout the world (Middleton, 1943, Kamoun, 2009, Van der Plaats-Niterink, 1981, Ho,

2009, Robertson, 1980, Rai et al., 2020). Pythium and Phytophthora are tied closely in many natural and agricultural ecosystems, in soil and aquatic environments. Based on the diagnostic experience in our plant disease clinic labs, Pythium and Phytophthora often co-exist on the plant roots showing root rot symptoms; both tend to cause root problems on plants. Although they had been thought to be similar, molecular evidence suggests that Pythium is closer to saprophytic oomycetes Achlya while Phytophthora is more closely related to Peronospora, another plant pathogenic genus of oomycetes. In fact, the genus Pythium does consist of a large number of soil and aquatic saprophytic species and a small number of species that are pathogenic to microbes, plants and animals (Middleton, 1943, Ho, 2018, Mostowfizadeh-Ghalamfarsa & Salmaninezhad,

2020, Van der Plaats-Niterink, 1981, Cooke et al., 2000, Levesque & De Cock, 2004, Ho, 2009,

Robertson, 1980). Pythium species are thought to be ancestral to Phytophthora, due to their less specialized parasitism and more primitive sporangial development; Phytophthora zoospores are differentiated within the sporangia while Pythium zoospores are differentiated externally in a vesicle that is transformed from the protoplast of a sporangium and transported through an exit tube on the sporangium (Ho, 2018, Mostowfizadeh-Ghalamfarsa & Salmaninezhad, 2020, Cooke et al., 2000).

Pythium species produce coenocytic or aseptate (cross-wall-free) hyphae in vegetative

Xuemei Zhang Chapter 2 29

growth. The asexual reproduction of Pythium species may produce a variety of structures, including sporangia, zoospores and chlamydospores. The shape of sporangia varies from spherical to filamentous: ranging from filamentous, pyriform, limoniform, ovoid, to globose, depending on the species. The sporangial size also varies within and among Pythium species.

Sporangial protoplasm can form vesicles, which are transported through exit/discharge tubes to the outside of sporangia. Then swimming zoospores are differentiated in the vesicles and released from the vesicles upon maturity. Hyphal swellings are common and often indistinguishable from young sporangia or sexual oogonia, which can be terminal (at the end), intercalary (in the middle), or catenulate (in chains). Thick-walled chlamydospores may be present in a few species such as Pythium dimorphum and P. tracheiphilum. Zoospores, hyphal swellings, and chlamydospores are also capable of germinating new hyphae (Middleton, 1943,

Ho, 2018, Mostowfizadeh-Ghalamfarsa & Salmaninezhad, 2020, Van der Plaats-Niterink, 1981,

Cooke et al., 2000, Robertson, 1980).

Pythium species may also produce sexual structures including oogonia (the female part), antheridia (the male part), and oospores. These sexual structures are less variable in shape and size than sporangia, but they still differ among species. The oogonia and antheridia walls can be smooth or surrounded by various ornamentations. The oogonia and antheridia may arise from the same hypha (monoclinous) or different hyphae (diclinous), from the same isolate (homothallic) or different isolates (heterothallic). Antheridia often surround oogonia at the stalk (hypogynous) or other positions (paragynous) to fertilize and produce oospores. Oospores are usually thick- walled round spores.

Xuemei Zhang Chapter 2 30

2.3.4 Pythium Classification and Identification

In Mycology, it is common to use the morphological characteristics of reproductive structures to classify or group microorganisms. Sexual reproduction is absent or not yet observed in many Pythium species. Therefore, Pythium species have been grouped based on the characteristics (shape, size, etc.) of asexual reproductive structures, sporangia, and hyphal swellings. For example, Pythium species that produce filamentous sporangia were defined as

“Group F”, and those produce lobulated sporangia were grouped in “Group T”. Pythium species that produce proliferated sporangia are in “Group P”. The ones that produce globose sporangia are in “Group G”, and the ones that only produce hyphal swellings with sporangia reproduction belong to “Group HS”. There are substantial differences in the physiology and virulence between the members of “group F”. Recent molecular studies have provided evidence that put some

“Group F” members to known described Pythium species. For example, one of the “Group F” members has been grouped into P. dissotocum (Abdelzaher et al., 2020).

Identification Methods

Currently, both morphological and molecular methods are used to identify Pythium isolates. Morphological traits used to identify Pythium species include colony (mycelial growth) patterns on different agar plates, growth rate, and cardinal temperature, as well as sexual and asexual reproductive structures (Table 2.3.2). However, it is difficult to identify many Pythium to the species level because some morphological characteristics vary greatly within species, but can also overlap across species, and the details of morphological characteristics of many Pythium species are not even available (Cooke et al., 2000, Ho, 2018, Levesque & De Cock, 2004,

Mostowfizadeh-Ghalamfarsa & Salmaninezhad, 2020, Van der Plaats-Niterink, 1981).

Xuemei Zhang Chapter 2 31

DNA barcoding/sequencing is also important in Pythium identification. Housekeeping nuclear genes (Internal Transcribed Spacers, Elongation Factor 1 α, β-tubulin, Larger Subunit

RNA and Small Subunit RNA) and cytoplasmic genes (NADH dehydrogenase subunit 1, cytochrome c oxidase subunit 1, and cytochrome c oxidase subunit 2) have been used to identify

Pythium species. ITS and cox regions are the most recommended, as they provide high interspecific resolution in Pythium genus. Therefore, they are often used as DNA barcodes in

Pythium identification. However, some species of Pythium cannot be separated by using ITS and cox barcodes (Ho, 2018, Mostowfizadeh-Ghalamfarsa & Salmaninezhad, 2020, Levesque & De

Cock, 2004, Schroeder et al., 2013, Villa et al., 2006).

Table 2.3.2. Morphological characteristics used to identify Pythium species (Van der Plaats- Niterink, 1981)). Structure Characteristics vegetative mycelia growth pattern (chrysanthemum, radiate, rosette, intermediate or no pattern), aerial mycelial growth hyphae Coenocytic hyphal swelling shape, position and size asexual sporangia Size, shape and position Vesicle forming zoospore Number, shape, and ultrastructure chlamydospore Presence or absence

sexual antheridia Position and stalk (long/short/absent) oogonia Shape, position, and cell wall ornamentation oospore Cell wall ornamentation, contents, completely/partially filled mating Homothallic or heterothallic where are antheridia The same hypha (monoclinous) or a different branched hypha (diclinous) antheridia attachment Paragynous, hypogynous or amphigynous position

The classification and identification of Pythium species is notoriously challenging and

Xuemei Zhang Chapter 2 32

problematic Progress in oomycete phylogeny studies should assist in solving the problems involved in the classification and identification of Pythium species. As the cost of the next generation sequencing (NGS) drops and more genomic data are available, researchers can start to use comparative genomics and population genetics tools to understand the genetic diversity, gene flow, and evolution of oomycetes (the so-called phylogenomic analysis of the oomycetes)

(McCarthy & Fitzpatrick, 2017, Rujirawat et al., 2019). This type of study can help reveal more single-locus or multiple-loci DNA barcodes that should be sufficient to differentiate Pythium species. Therefore, the accuracy of Pythium identification can be improved through using multiple barcodes combined with high throughput sequencing, instead of using only one or two pairs of primers to amplify isolate DNA segments with Sanger sequencing. However, the development of molecular identification of Pythium species should be premised on the connection between morphological characterization and molecular data. The molecular characterization of a Pythium species would be meaningless and misleading if the molecular data were from morphologically misidentified Pythium isolates.

2.4 Pythium Pathogens

Pythium species can be parasitic on animals, plants, and other microbes (Kamoun, 2009,

Rai et al., 2020, Matthews, 1931, Herrero et al., 2020). Parasitic Pythium species can live as saprophytes on the dead host tissues after they kill the hosts, and the vast majority of Pythium species can grow saprophytically on artificial growth media (Matthews, 1931). Over 100 species in Pythium genus are plant pathogens, causing diseases on a wide range of plant hosts in terrestrial and aquatic environments (Kamoun, 2009, Farr, 2020, Ho, 2009, Sparrow, 1943).

Xuemei Zhang Chapter 2 33

2.4.1 The Habitat and Host Ranges of Pythium Pathogens

Like other plant pathogenic oomycetes, phytopathogenic Pythium species are present in nearly all ecosystems on the earth; they have been found in the Arctic and Antarctic, tropical and subtropical regions, temperate regions, and semi-arid regions, from marine and freshwater to terrestrial ecosystems (Thines, 2014, Tojo et al., 2012, Blancard et al., 2012, Ho, 2018, Alcala et al., 2016, Mathews et al., 2016, Middleton, 1943). These Pythium pathogens include species that are pathogenic to marine alga, such as Pythium marinum, P. porphyrae, P. chondricola, etc.

(Herrero et al., 2020, Kawamura et al., 2005, Dumilag, 2019), species that are pathogenic to legumes, such as P. irregulare, P. myriotylum, P. ultimum, P. torulosum, etc. (Alcala et al., 2016,

Nzungize et al., 2012, Mathews et al., 2016), species that are pathogenic to grains, such as P. aphanidermatum, P. diclinum, P. ultimum, etc. (Al-Sheikh, 2010, McLean & Lawrence, 2001), species that are pathogenic to vegetables, such as P. aphanidermatum, P. dissotocum, P. myriotylum, etc. (Chérif et al., 1994, Stanghellini & Kronland, 1986, Bates & Stanghellini, 1984,

Kusakari & Tanaka, 1987), species that are pathogenic to ornamental plants, such as P. irregulare, P. aphanidermatum, P. dissotocum, etc. (Liptay & Tu, 2003, Liu et al., 2007,

Aegerter et al., 2002), and species that are pathogenic to grass, such as P. myriotylum, P. volutum, P. vanterpoolii, P. aristosporum, P. torulosum, etc. (Dewan & Sivasithamparam, 1988,

Kerns & Tredway, 2008, McCarter & Littrell, 1968).

It is well known that Pythium pathogens have incredibly wide host ranges across different agricultural ecosystems (Rai et al., 2020). For example, Pythium myriotylum and P. aphanidermatum are pathogenic to tomatoes, cucurbits, peanuts, ornamentals, wheat, oats, rye, corn, and turf grasses (Abd-Elsalam, 2020). Pythium ultimum is capable of infecting over 150

Xuemei Zhang Chapter 2 34

plant species across different families (Abd-Elsalam, 2020, Middleton, 1943, Hendrix &

Campbell, 1973). Most of the economically important crops are susceptible to at least one species of Pythium pathogens, from fields to greenhouses, seed beds and nurseries (Abd-

Elsalam, 2020, Hendrix & Campbell, 1973). The top four Pythium species that cause the most significant crop loss include P. ultimum, P. debaryanum, P. irregulare and P. aphanidermatum

(Abd-Elsalam, 2020, Palmucci & Wolcan, 2011). Pythium species can also colonize and infect many weedy grass species, which may serve as the alternative hosts of Pythium pathogens (Abd-

Elsalam, 2020, Kucharek & Mitchell, 2000).

2.4.2 Diversity of Pythium Pathogens in A Crop Production Ecosystem

The same species of Pythium can occur in various ecological environments or niches. In the meantime, the same ecosystem or even the same host can harbor a variety of Pythium species at the same time. There are many cases where multiple Pythium species were recovered from the same environment niches or the same samples in forest ecosystems (Augspurger & Wilkinson,

2007, Weiland, 2011) and agricultural production ecosystems of corn, soybean, tobacco, or other crops (Radmer et al., 2017, Gutiérrez et al., 2012, Blancard et al., 2012, Alejandro Rojas et al.,

2017, Lee & Hoy, 1992, Broders et al., 2007, Mulder, 1969). The results of these studies indicated the co-existence of multiple Pythium species and wide variations in host specificity or virulence among these Pythium species were observed.

For example, according to Blancard et al. (2012), as many as four different Pythium species can be recovered from tomato roots or the nutrient solution in the hydroponic greenhouse(s) on the same farm. The results of pathogenicity assays suggest considerable

Xuemei Zhang Chapter 2 35

variations in the virulence on tomato hosts among the Pythium species recovered from tomato greenhouses: Pythium torulosum, P. vexans, P. sylvaticum, and P. dissotocum are not pathogenic or mildly pathogenic to tomato hosts (nonpathogenic or low virulent species), P. ultimum, group

F Pythium and P. intermedium have medium virulence on tomato hosts, and P. irregulare, P. salpingophorum, P. myriotylum, P. aphanidermatum are highly virulent on tomato hosts. The symptoms caused by those Pythium species vary from root discoloration to seedling damping-off or fruit rot, depending on the species (Table 2.4.1).

Table 2.4.1. The symptoms caused by Pythium species on tomato (Blancard et al., 2012). Pythium species Root rot and/or stem base rot Damping-off Fruit rot Pythium aphanidermatum + + + Pythium acanthicum + Pythium arrhenomanes + + + Pythium dissotocum + Pythium group F + Pythium deliens Meurs + Pythium inflatum + Pythium intermedium + Pythium irregulare + Pythium myriotylum + + + Pythium paroecandrum + Pythium periplocum + + Pythium salpingophorum r + Pythium segnitium + Pythium spinosum + + Pythium ultimum Trow + + + Pythium ultimum var. ‘sporangiiferum’ + + Drechsler Pythium vexans +

Sometimes, multiple species of Pythium co-occurring in the same environment tend to form disease complexes on the same crop, and they might form disease complexes with fungal and nematode pathogens, such as Fusarium species, Rhizoctonia species, and Meloidogyne

Xuemei Zhang Chapter 2 36

incognita (DeVay et al., 1982, Lumsden et al., 1976, Harvey et al., 2008, Pemberton et al., 1998,

Karthikeyan et al., 2000). When multiple Pythium species co-exist in an environment, gene flow can occur between species, and therefore, several described Pythium species can be included in a species complex (Blancard et al., 2012). In that case, substantial intraspecific variation can be found in a single species (Robideau et al., 2011). The existence of species complexes would add more diversity in the Pythium community in a crop production ecosystem.

It is important to point out that the asymptomatic colonization of Pythium species on plant roots is very common. Pythium species are frequently associated with healthy-appearing roots of host plants, due to asymptomatic Pythium colonization or the underdevelopment of

Pythium diseases (Rey et al., 1998, Rey et al., 2001, Blancard et al., 2012, Coffua et al., 2016).

Therefore, root discoloration is not always a reliable diagnostic symptom of Pythium infection

(Gutiérrez et al., 2012).

2.4.3 Pythium Pathogens and Diseases in Hydroponic Crop Production

Systems

Pythium is a persistent problem in greenhouses and nurseries, and it has been causing root problems in the hydroponic production of lettuce, cucumber, tomato, spinach, pepper, cilantro, celery, chrysanthemum, hemp transplants, tobacco plants, and many other crops (Chérif et al., 1994, Stanghellini & Kronland, 1986, Miyake et al., 2014, Gull, 2006, Kageyama et al.,

2002, Bates & Stanghellini, 1984, Kusakari & Tanaka, 1987, Labuschagne et al., 2003,

Labuschagne et al., 2002, Gull et al., 2004, Larsson, 1994, Hong et al., 2004, Lin & Huang,

1993, Hockenhull & Funck-Jensen, 1982, Liptay & Tu, 2003, Anderson et al., 1997, Romero et

Xuemei Zhang Chapter 2 37

al., 2012, Sutton et al., 2006, Kumar et al., 2008, Goldberg, 1990). Although Phytophthora can also cause root problems in soil-less systems, Pythium is more common than Phytophthora in hydroponic greenhouses (Blancard et al., 2012, Rai et al., 2020). The nutrient solution or aquatic system in hydroponic greenhouses is a hotbed for Pythium pathogens, which is in favor of the infection, dissemination and reproduction of Pythium pathogens, because Pythium species produce asexual spores that are capable of swimming in water. When aggressive Pythium species are present, Pythium diseases can cause significant yield loss or crop quality reduction. For example, Pythium dissotocum can cause 35-54% yield reduction of lettuce in hydroponic greenhouses (Stanghellini & Kronland, 1986). Pythium aphanidermatum can cause as much as

50% yield loss in cucumber hydroponic production greenhouses (Chérif et al., 1994). The yield loss and disease severity vary, as some crops might be more tolerant to Pythium pathogens than others. For example, compared with cucumber, tomato grown in hydroponic systems can be more tolerant of significant root loss caused by Pythium pathogens (Blancard et al., 2012).

Common Pythium species that are associated with root problems in hydroponic greenhouses include P. aphanidermatum, P. dissotocum, P. ultimum, P. irregulare, P. myriotylum, group F Pythium, (Jenkins Jr & Averre, 1983, Goldberg, 1990, Romero et al., 2012,

Liu et al., 2007, Sutton et al., 2006, Anderson et al., 1997, Bates & Stanghellini, 1984, Gull et al., 2004, Gutiérrez et al., 2012, Huo et al., 2020, Labuchagne et al., 2002, Labuschagne et al.,

2002, Labuschagne et al., 2003, Larsson, 1994, Miyake et al., 2014, Punja & Rodriguez, 2018,

Stanghellini et al., 1998, Stanghellini & Kronland, 1986). The symptoms caused by these

Pythium species vary from no apparent symptom or slight root discoloration to wilting and plant death (Table 2.4.2).

Xuemei Zhang Chapter 2 38

Although a vague general term “Pythium disease(s)” is often used to describe the disease(s) caused by Pythium pathogens or species complexes, specific names such as “soft rot”,

“stem rot”, “root rot”, “root dysfunction” and “damping-off” have been given to differentiate different types of Pythium diseases/symptoms on some but not all crop host species (Kerns &

Tredway, 2008, Sigobodhla et al., 2010, Stanghellini & Russell, 1971, Rai et al., 2018). Among them, root rot and damping-off are the most common diseases caused by Pythium pathogens (Rai et al. 2018).

Xuemei Zhang Chapter 2 39

Table 2.4.2 Common Pythium pathogens occurring in hydroponic crop production greenhouses. Pythium species Host Symptoms Pythium aphanidermatum cucumber (Goldberg, 1990) root rot, wilting, stunting & plant death chrysanthemum (Liu et al., 2007) root necrosis, root discoloration & root rot tomato (Rafin & Tirilly, 1995, root necrosis, root rot, wilting & damping-off Kusakari & Tanaka, 1987) root rot, wilting & stunting parsley (Gull et al. 2004) root rot, stunting & plant death spinach (Bates & Stanghellini, 1984) Poinsettia (Miyake et al., 2014) root rot, wilting & defoliation

Pythium dissotocum cilantro (Romero et al., 2012) Soft rot on roots and stems chrysanthemum (Liu et al., 2007) root necrosis, root discoloration & root rot spinach (Bates & Stanghellini, 1984, root discoloration, root rot, stunting, leaf Huo et al., 2020) chlorosis & wilting tomato (Kusakari & Tanaka, 1987) root rot & wilting lettuce (Stanghellini & Kronland, yield reduction with no visible root or leaf 1986) symptoms hemp seedling (Punja & Rodriguez, root discoloration, root rot, wilting & leaf 2018) chlorosis tobacco seedling (Gutierrez et al., root discoloration 2012)

Pythium myriotylum lettuce (Stanghellini et al., 1998) root rot, stunting & plant death tomato (Kusakari & Tanaka, 1987) root rot & wilting tobacco seedling (Anderson et al., root rot, stunting & leaf chlorosis 2007, Gutierrez et al., 2012) poinsettia (Miyake et al., 2014) root rot, wilting & defoliation hemp seedling (Punja & Rodriguez, root discoloration, root rot, wilting & leaf 2018) chlorosis

Pythium group F tomato (Rafin & Tirilly, 1995) slight root necrosis at root apices and emergence points of lateral roots lettuce (Gull et al. 2004) root rot & wilting celery (Gull et al. 2002 & 2004) root rot & leaf chlorosis endive, fennel & sorrel (Labuschagne root discoloration, root rot & stunting et al., 2003)

Pythium irregulare lettuce (Gull et al. 2004) root rot & wilting cucumber (Gull et al. 2004) root rot & wilting Chinese cabbage (Gull et al. 2004) root rot & wilting tobacco seedling (Gutierrez et al., root discoloration 2012)

Pythium ultimum tomato (Rafin & Tirilly, 1995) root necrosis, root rot & damping-off spinach (Larsson, 1994) root rot & damping-off

Xuemei Zhang Chapter 2 40

2.4.4 The life Cycle of Pythium Pathogens and The Disease Cycle in

Hydroponic Crop Production Greenhouses

Pythium pathogens tend to infect the host plants at several critical growth stages including before germination, during germination, and soon after emergence (Rai et al., 2020).

Although Pythium pathogens are also capable of infecting bigger mature or adult plants, they hardly cause as much damage as to younger plants or seedlings (Zitnick-Anderson, 2014,

Blancard et al., 2012, Grabowsk, 2018, Hodges, 2003). In most cases of post-emergence attacking, Pythium infection are limited to the meristematic tips, epidermis or cortex of roots or fruits, but sometimes the pathogens can move further into the host tissues and reach the vascular tissues (Kamoun, 2009, Blancard et al., 2012). When Pythium pathogens attack the root systems, the host plants tend to show root discoloration, root rot (necrosis and decay), eventually resulting in stunting, wilting, leaf chlorosis and damping-off (McKellar & Nelson, 2003, Hendrix &

Campbell, 1973, Blancard et al., 2012, Rai et al., 2020, Miyake et al., 2014). Although the appearance of leaf and stem symptoms depends on the balance between new root production and the proportion of infected roots, the environment condition, as well as the growth status of host plants, some Pythium species never cause symptoms on the stems and leaves of host plants

(Zitnick-Anderson, 2014, Blancard et al., 2012, Grabowsk, 2018, Hodges, 2003). Many Pythium species only cause symptoms that are limited to root discoloration and root tip decaying, reduced root diameter or rootlets (Blancard et al., 2012).

Hydroponic greenhouses are relatively simpler and controlled environments, compared with the fields or outdoor plant beds. People would think plant disease is less of problem in hydroponic greenhouse crop production than traditional crop production systems. However, it is

Xuemei Zhang Chapter 2 41

not always the case. The outdoor plant beds or fields are often equipped with more complicated soil microbiome and more balanced ecosystems, and it is more difficult for certain pathogen species to build up and cause an epidemic on a crop host in such environments (Berendsen et al.,

2012). Growing crops in hydroponic greenhouse would help those pathogens take advantage of the crop hosts. Especially for Pythium pathogens, hydroponic greenhouses are conducive for

Pythium species to thrive, because Pythium species rely on water to spread and the plant density is higher in the greenhouses than in outdoor plant beds or in the field.

Inoculum Sources

Unlike outdoor environments, where the initial inoculum of Pythium pathogens mainly come from the oospores, chlamydospores or mycelial fragments in soil or plant debris, Pythium pathogens (Figure 2.4.1a) in hydroponic greenhouses are more likely to be introduced by water, growth substrates (potting medium), trays, dust, or contaminated tools and boots (Sutton et al.,

2006, Blancard et al., 2012, Rai et al., 2020, Thiessen et al., 2020). Many Pythium species have been recovered from various water sources such as ponds, dams, rivers, and wells (Ivors &

Moorman, 2014, Blancard et al., 2012). Although surface water sources are not recommended in greenhouse crop production, aggressive Pythium pathogens like P. aphanidermatum have been found in greenhouse hydroponic irrigation systems (Ivors & Moorman, 2014). Pythium aphanidermatum, P. irregulare and other pathogenic Pythium species have also been found in the growth substrates (potting medium containing peat moss, peat humus, sand, etc.) used in hydroponics (Sutton et al., 2006, Cartwright et al., 1995). Reused seedling trays, airborne dust, contaminated tools can also harbor and introduce Pythium pathogens into hydroponic greenhouses (Sutton et al., 2006, Thiessen et al., 2020, Blancard et al., 2012, Reed et al., 2019,

Xuemei Zhang Chapter 2 42

Pearce et al., 2019).

Figure 2.4.1. The life cycle of Pythium pathogens that cause diseases in hydroponic greenhouses. a. the inoculum (oospores, chlamydospores or mycelial fragments) can be introduced to hydroponic greenhouses through water, growth substrate, trays, dust, or contaminated tools and boots. b. the initial inoculum can come in contact with the roots of a host. c. the primary infection is initiated on young or weak roots. d. Pythium pathogens colonized the roots and reproduced on the host. e. secondary inoculum can spread to nearby plants and initiate infections. f. Pythium pathogens can spread to a different hydroponic unit within the greenhouse. g. plants with no or mild symptoms can be sold to fresh produce markets or (h) transplanted in the field. j&k. Pythium pathogens hiding in asymptomatic or slightly symptomatic hosts can contaminate water sources, growth substrates (potting medium), trays, dust, tools, boots, etc.

Penetration and Infection

Common Pythium pathogens infect hydroponic plant roots with zoospores and mycelia

(Sutton et al., 2006, Asran & Abd-Elsalam, 2020, Hendrix & Campbell, 1973). After the oospores, chlamydospores or mycelial fragments of Pythium pathogens enter the hydroponic systems (Figure 2.4.1b), the host root exudates will trigger the germination of oospores or

Xuemei Zhang Chapter 2 43

chlamydospores, and then sporangia and zoospores or new hyphae will be formed as the initial or primary inoculum (Sutton et al., 2006, Blancard et al., 2012, Asran & Abd-Elsalam, 2020). The primary inoculum attaches to the root surface and initiates the infection (Figure 2.4.1c) through wounds or direct penetration through epidermal tissues (Sutton et al., 2006, Blancard et al.,

2012). Appressoria, penetration pegs, or/and cellulolytic and pectinolytic enzyme activities may be involved in the direct penetration process, depending on the species of Pythium pathogens

(Sutton et al., 2006, Blancard et al., 2012). The infection court could be any part of young roots, such as root cap cells, root hairs, and regions of meristematic activity, cell elongation, and cell maturation, but root tips, elongation zones, and young root hairs are the most common penetration sites (Sutton et al., 2006). It is noticed that host root exudation plays an important role in the penetration and infection process; the root exudates attract pathogen zoospores, trigger spore germination, and provide substrates necessary for Pythium to increase the pathogen population (Sutton et al., 2006, Hockenhull & Funck-Jensen, 1982).

Colonization

Common Pythium pathogens occurring in hydroponic greenhouses are hemi-biotrophic, which are biotrophic at early colonization stages and eventually become necrotrophic (Figure

2.4.1d). Therefore, the early colonization is often asymptomatic and unnoticed until it reaches the necrotrophic stages, at which the roots become yellow, brown or dark (Sutton et al., 2006,

Blancard et al., 2012). Some species, like Pythium group F, are even capable of asymptomatic colonization on host roots, especially when environmental conditions are conducive to host plant health (Gutiérrez et al., 2012, Rey et al., 1998, Sutton et al., 2006). Aggressive Pythium species cause severe root damages that lead to symptoms on the aerial portion of the host plants in

Xuemei Zhang Chapter 2 44

hydroponic greenhouses, such as stunting, leaf chlorosis, wilting and plant death. However, as it was mentioned at the beginning of this section, the appearance of such symptoms is under the influence of environmental conditions and host growth.

Most Pythium pathogens tend to colonize the epidermis and cortex of host roots, but the colonization can be extended into the steles, which will trigger strong host defense reactions

(Sutton et al., 2006, Asran & Abd-Elsalam, 2020, Abd-Elsalam, 2020). However, root discoloration and necrosis caused by Pythium pathogens are not due to the hypersensitive reactions of hosts, but the accumulation of phenolic polymers bound to root cell walls (Sutton et al., 2006).

Reproduction and Dissemination

As Pythium pathogens establish the intracellular and intercellular colonization in host root tissues, they keep expanding within a host through sporulation or vegetative hyphal growth

(Figure 2.4.1e). Abundant sexual and asexual Pythium spores and new hyphal growth can be found in the infected root tissues or on the surface of the infected tissues (Sutton et al., 2006).

The sexual reproduction might not occur in some Pythium species. When it does, thick-walled oospores will be formed in infected root tissues or root surfaces. Oospores usually function as the survival structures in hydroponic greenhouses.

Some species of Pythium pathogens also produce thick-walled asexual chlamydospores in hydroponic systems as their survival structures. However, the asexual reproduction of Pythium species mainly produces sporangia, where vesicles of protoplasts are formed and transported to the outside of sporangia. Then flagellated and mobile zoospores are differentiated in the vesicles, and the spores are released to the outside environments when they are mature. In addition to

Xuemei Zhang Chapter 2 45

produce zoospores, sporangia can also germinate directly and initiate infections on root tissues.

Pythium pathogens produce abundant sporangia and zoospores in hydroponic systems, and the sporangia and zoospores can move along the nutrient solution or water and move towards host roots when attracted by root exudates. Therefore, sporangia and zoospores are the most important secondary inoculum of Pythium pathogens in the hydroponic crop production systems

(Sutton et al., 2006, Ho, 2009, Blancard et al., 2012).

Mycelial fragments or masses can also serve as the secondary inoculum of Pythium pathogens in hydroponic greenhouses. It is especially important for Pythium species that do not produce sporangia in hydroponic greenhouses. Mycelial masses formed by Pythium pathogens can be formed in nutrient solution around the infected roots or in fallen decayed infected root tissues and dispersed along the movement of nutrient solution (Figure 2.4.1e). The dissemination of Pythium pathogens in hydroponic systems (Figure 2.4.1f) mainly rely on the movement of nutrient solution, but the pathogens can also be dispersed by human through tools, materials and practices or water splashing (Sutton et al., 2006, Hockenhull & Funck-Jensen, 1982, Blancard et al., 2012, Thiessen et al., 2020).

Survival

Pythium pathogens in hydroponic greenhouses can form oospores, chlamydospores and mycelia as survival structure, and they can survive in hydroponic greenhouses for at least a year even without host tissues. Those survival structures have been found at various locations in hydroponic greenhouses, such as plastic films, trays, circulating pipes, mixing tanks, etc. When the materials or facilities are not sanitized thoroughly, Pythium pathogens from the previous year(s) can survive in hydroponic greenhouses and cause disease epidemics in the following

Xuemei Zhang Chapter 2 46

year, becoming a haunting nightmare (Sutton et al., 2006, Hockenhull & Funck-Jensen, 1982,

Ivors & Moorman, 2014, Al‐Sa’di et al., 2008, Blancard et al., 2012, Thiessen et al., 2020).

Pythium species are capable of colonizing and infecting many weedy grass species (Abd-

Elsalam, 2020, Kucharek & Mitchell, 2000). Therefore, the weeds in hydroponic greenhouses could be potential alternative hosts of Pythium pathogens. However, there is a lack of research testing this hypothesis.

2.5 Pythium in Tobacco Transplant Production Greenhouses

Pythium species can attack tobacco plants of all ages, causing various diseases on the host plants, such as damping-off, root rot and stem rot of seedlings, as well as feeder-root necrosis of field plants (Shew & Lucas, 1991). Pythium diseases have been found in many tobacco production areas around the world since the first damping-off disease caused by Pythium on tobacco was reported from Java in 1900 (Sigobodhla et al., 2006, Cartwright et al., 1995,

Shew & Lucas, 1991, Sigobodhla et al., 2010, Anderson et al., 1997, Ho, 2009, Middleton, 1943,

Ishiguro et al., 2013, Lee et al., 1975). There are at least 13 soil-inhabiting Pythium species known to be pathogenic to tobacco in the field, and it is not rare to find multiple Pythium species on a single diseased tobacco plant (Shew & Lucas, 1991). Due to the short history of the hydroponic greenhouse production of tobacco transplants and a lack of research, there is very limited information on Pythium species occurring in float-bed production systems and tobacco greenhouses (Mufunda et al., 2016).

Xuemei Zhang Chapter 2 47

2.5.1 Pythium Diseases in Tobacco Transplant Production Greenhouses

Pythium diseases have been common problems in the United States, where float-bed hydroponic greenhouses are commonly used for tobacco transplant production, and sometimes pose a threat to tobacco transplant production (Thiessen et al., 2020, Pfeufer & Hinton, 2017,

Gutiérrez et al., 2012, Fortnum et al., 2000, Cartwright et al., 1995, Anderson et al., 1997,

Gutiérrez & Melton, 2001). The same issue exists in Zimbabwe, where tobacco transplant production is transitioning from conventional seedbed production systems to float-bed production systems (Sigobodhla et al., 2006, Sigobodhla & Dimbi, 2014, Sigobodhla et al., 2010,

Mufunda et al., 2016, Mufunda et al., 2017, Garwe et al., 2014). According to Garwe et al.

(2014), Pythium was hardly an issue in traditional tobacco transplant production systems in

Zimbabwe, but the introduction of float-bed production systems incurred the emergence of

Pythium diseases on tobacco seedlings. Since Pythium species belong to the oomycete (water molds) group, it is not surprising that Pythium pathogens adapt so well and prevail in float-bed tobacco greenhouses.

Diseases and Symptoms

Pythium species are known to cause several diseases on tobacco seedlings in float-bed production systems, including root and stem rots, pre-emergent damping-off, post-emergent damping-off, or Pythium seedling blight (Sigobodhla et al., 2010, Pfeufer & Hinton, 2017,

Mufunda et al., 2016, Mufunda et al., 2017, Gutiérrez & Melton, 2001, Gutiérrez et al., 2012,

Fortnum et al., 2000, Anderson et al., 1997). These diseases often share some similarities in symptoms, and it is hard to determine the causative agent when multiple Pythium species are present in diseased tissues. Therefore, people often use a general name “Pythium diseases” to

Xuemei Zhang Chapter 2 48

address the problems caused by Pythium species instead of differentiating these diseases in tobacco transplant production.

Root rot and stem rot

The symptoms usually involve root discoloration (light brown, brown or dark) and root rot (the root tissues are decayed) that sometimes accompanied by stunting, leaf chlorosis, or seedling death (Sigobodhla et al., 2010, Pfeufer & Hinton, 2017, Mufunda et al., 2016, Mufunda et al., 2017, Gutiérrez & Melton, 2001, Gutiérrez et al., 2012).

Root symptoms (Figure 2.5.1) are usually first noticed approximately 4 to 6 weeks after seeding, when most seedling roots extend from float trays into the nutrient solution below the trays (the emergence of water roots), the so-called “float water” (Sigobodhla et al., 2010, Pfeufer

& Hinton, 2017, Gutiérrez & Melton, 2001). Initially, the infected water roots turn light brown, and tissue disintegration makes infected roots feel slimy; root discoloration progresses to dark brown, in a few days. Typical root rot includes brown necrosis of water roots, and outer root layers decayed and became soft and slimy (Pfeufer & Hinton, 2017, Gutiérrez & Melton, 2001,

Sigobodhla et al., 2010). Affected tobacco seedlings may be stunted, but with no other stem or leaf symptoms (Figure 2.5.1). Wilting and leaf chlorosis often follow root discoloration and root rot, starting from limited well-defined tray areas (disease hotspots) that expand quickly

(Sigobodhla et al., 2010, Pfeufer & Hinton, 2017, Gutiérrez & Melton, 2001, Gutiérrez et al.,

2012). Chlorosis of lower leaves resembles but differs from the nitrogen deficiency symptoms by leaf wilting (Gutiérrez et al., 2012). When an affected tray is removed from the float bed, it is easy to find affected water roots adhering to the bottom of the tray (Pfeufer & Hinton, 2017). As the disease progresses, infected roots fall off the seedlings; in severe cases, leading to seedling

Xuemei Zhang Chapter 2 49

death (Sigobodhla et al., 2010, Pfeufer & Hinton, 2017, Gutiérrez & Melton, 2001, Gutiérrez et al., 2012).

Figure 2.5.1. The symptoms of Pythium root rot in float-bed tobacco production greenhouses.A. The circled areas are the disease centers of Pythium root rot, where affected seedlings are stunted and showing leaf yellowing. B. The infected water roots turned brown and slimy. C. The affected water roots adhere to the bottom of the tray. D. Severe root rot leads to the loss of root systems and seedling death.

Pre-emergent and Post-emergent Damping-off

Pre-emergent damping-off refers to seedling death before or immediately after germination, and post-emergent damping-off refers to the complete death of previously established seedlings (Pfeufer & Hinton, 2017). Pythium species are known to cause both pre- emergent and post-emergent damping off. The early occurrence of Pythium damping-off often results in low apparent percent germination; in post-emergent Pythium damping-off, young seedlings fall over to one side, due to the progression of rot from roots into the lower stems

Xuemei Zhang Chapter 2 50

(Pfeufer & Hinton, 2017).

Pythium Seedling Blight

The diseased seedlings are chlorotic and stunted with water-soaked lesions on the stems, while the root systems are severely necrotic and decayed. Therefore, the infected seedlings cannot develop into usable transplants (Fortnum et al., 2000, Anderson et al., 1997).

The Disease Cycle

The known primary sources of Pythium pathogens in float-bed tobacco greenhouses include contaminated growth substrate/media, contaminated water sources, and/or improperly sanitized trays/tools/equipment used in greenhouses (Thiessen et al., 2020, Cartwright et al.,

1995, Anderson et al., 1997, Pfeufer & Hinton, 2017, Gutiérrez & Melton, 2001, Gutiérrez et al.,

2012). Oospores and mycelial fragments of Pythium pathogens can survive in contaminated growth substrate/media, water sources, or on trays/tools/equipment for a long time, and can initiate infections of tobacco seedlings directly or indirectly by producing zoosporangia and zoospores (Pfeufer & Hinton, 2017). Although airborne dust can harbor and introduce Pythium pathogens into hydroponic greenhouses (Sutton et al., 2006), and Pythium species are capable of colonizing and infecting many weedy grass species (Abd-Elsalam, 2020, Kucharek & Mitchell,

2000), it is not clear if these sources of inoculum provide significant primary inoculum sources of Pythium species in float-bed tobacco greenhouses.

Similar to Pythium pathogens in the hydroponic production systems of other crops, sporangia and zoospores are the major secondary inoculum in tobacco greenhouses. Pythium pathogens spread rapidly through sporangia and zoospores in the nutrient solution/float water/bay water (Pfeufer & Hinton, 2017, Gutiérrez & Melton, 2001, Gutiérrez et al., 2012,

Xuemei Zhang Chapter 2 51

Anderson et al., 1997). Zoospores are attracted by tobacco root exudates and encyst to develop hyphal structures to initiate possibly multiple cycles of secondary infections on root surfaces

(Pfeufer & Hinton, 2017, Shang et al., 1999). Mycelial fragments and oospores that are produced in or on the surface of root tissues can survive in the recycled float EPS trays and on the surface of tools or equipment for long periods (Pfeufer & Hinton, 2017, Gutiérrez & Melton, 2001,

Gutiérrez et al., 2012, Thiessen et al., 2020).

Impacts

Pythium diseases do not only reduce seedling vigor, resulting in poor root quality of transplants that might affect transplant survival in the field but also provide decayed tobacco materials for other plant pathogens occurring in float-bed tobacco greenhouses (Pfeufer &

Hinton, 2017, Gutiérrez & Melton, 2001, Gutiérrez et al., 2012).

Transplants surviving Pythium infection in tobacco greenhouses can survive in the field

(Fortnum et al., 2000, Sigobodhla & Dimbi, 2014), and economic losses caused by Pythium diseases are not reflected in final yields of tobacco leaves and thus are difficult to quantify.

However, transplant loss caused by Pythium diseases in tobacco greenhouses should not be ignored; Pythium diseases can cause 25% to 70% seedling loss in tobacco transplant production

(Sigobodhla et al., 2010, Sigobodhla & Dimbi, 2014), and the cost of replacing usable transplants due to Pythium diseases is high (Shew & Lucas, 1991, Gutiérrez & Melton, 2001,

Gutiérrez et al., 2012). Additionally, Pythium-infected transplants can introduce Pythium pathogens to field soil. So far, we have not found any tobacco cultivars that are not susceptible to

Pythium pathogens in float-bed greenhouses (Sigobodhla et al., 2010).

Xuemei Zhang Chapter 2 52

2.5.2 Species, Detection, and Identification

There is only limited information on Pythium species occurring in float-bed tobacco greenhouses. A few previous studies revealed that several species, including Pythium myriotylum, P. dissotocum, P. irregulare, P. volutum and P. spinosum, are associated with root rot of tobacco seedlings in float-bed greenhouses; among which, P. myriotylum appeared to be the most aggressive (Mufunda et al., 2017, Sigobodhla et al., 2010, Anderson et al., 1997, Garwe et al., 2014, Mufunda et al., 2016, Gutiérrez & Melton, 2001, Gutiérrez et al., 2012). Pythium aphanidermatum, P. irregulare, P. spinosum, P. oligandrum, and P. splendens were found in a survey of Pythium species associated with commercial potting medium (growth substrates) used in float-bed tobacco greenhouses, but only Pythium aphanidermatum showed pathogenicity on tobacco seedlings (Cartwright et al., 1995). There has been no comprehensive research on the

Pythium communities that might exist in environments outside the float beds but within tobacco greenhouses (Mufunda et al., 2016).

Diagnosis and detection of Pythium pathogens on tobacco seedlings currently relies mainly on visual symptoms, microscopic examination, and serological test kits (Pfeufer &

Hinton, 2017, Gutiérrez & Melton, 2001, Gutiérrez et al., 2012, Rai et al., 2020, Sutton et al.,

2006). Those methods may be sufficient to make the pesticide application decisions for disease management but are not accurate enough to differentiate Pythium species. Molecular methods

(DNA amplification and sequencing) could be used to identify the Pythium species recovered from tobacco seedlings at a species level. Primers targeting ITS and cox II regions (ITS1:

TCCGTAGGTGAACCTGCGG & ITS4: TCCTCCGCTTATTGATATGC, FM58:

CCACAAATTTCACTACATTGA & FM66: TAGGATTTCAAGATCCTGC) are often used in

Xuemei Zhang Chapter 2 53

Pythium species identification (Schroeder et al., 2013, Garwe et al., 2014, Mostowfizadeh-

Ghalamfarsa & Salmaninezhad, 2020, Robideau et al., 2011, Moorman & May, Villa et al.,

2006, Mufunda et al., 2016).

2.5.3 Pythium Disease Management in Tobacco Greenhouses

The management of Pythium diseases in float-bed tobacco greenhouses is challenging.

Although there are many effective chemical and biological pesticides available for oomycete control, most of them are not labeled for Pythium control in hydroponic greenhouses or tobacco transplant production (Gutiérrez et al., 2012, Gutiérrez & Melton, 2001, Pfeufer & Hinton, 2017,

Sigobodhla et al., 2006, Pearce et al., 2019, Reed et al., 2019). Currently, there are no cultivars that are known to be resistant to Pythium pathogens (Sigobodhla et al., 2010). Currently, there are no cultivars known to be resistant to Pythium pathogens (Sigobodhla et al., 2010). Therefore, management of Pythium diseases in float-bed tobacco greenhouses mainly relies on exclusion, avoidance, and protection.

Exclusion and avoidance

Exclusion and avoidance are the most effective and important strategies in Pythium management for tobacco greenhouses. In order to avoid potentially Pythium-contaminated water sources, surface water like pond or creek water should not be introduced into tobacco greenhouses (Gutiérrez et al., 2012, Gutiérrez & Melton, 2001, Reed et al., 2019). Sanitation of equipment, tools, boots, or anything else that might be used in tobacco greenhouses, will also reduce the risk of introducing Pythium pathogens (Table 2.5.1). The float EPS or plastic trays are often reused in tobacco greenhouses, and the reused trays can harbor Pythium survival structures

Xuemei Zhang Chapter 2 54

such as oospores and mycelia when the tobacco roots inevitably trapped or anchored in tray cells, increasing the risk of introducing Pythium pathogens to the following growth season (Thiessen et al., 2020, Gutiérrez et al., 2012, Gutiérrez & Melton, 2001, Pfeufer & Hinton, 2017, Reed et al.,

2019). In this case, tray sanitation is especially important. Therefore, it is recommended to steam trays, or clean the trays with soapy water or other sanitizers before seeding and after transplanting (Table 2.5.1).

Protection and Therapy

So far, there are only two fungicide products have been labeled for Pythium control in float-bed tobacco transplant production greenhouses in the United States. Terramaster 4EC and

Oxidate 2.0. Terramaster 4EC is an effective treatment when applied in float water to treat

Pythium root rot, and it has been the standard recommended chemical control for Pythium disease management in tobacco greenhouses (Hansen & Hensley, 2019, Gutiérrez et al., 2012,

Gutiérrez & Melton, 2001, Pfeufer & Hinton, 2017, Pearce et al., 2019, Reed et al., 2019). The active ingredient of Terramaster 4EC is etridiazole, which acts by activating phospholipases in mitochondrial membranes and stimulating the hydrolysis of membrane-bound phospholipids in pathogen cells (Radzuhn & Lyr, 1984). Terramaster 4EC may cause phytotoxicity on young tobacco seedlings. Therefore, the initial application is not recommended within two weeks of seeding, and the product has to be mixed and applied evenly in float water (Hansen & Hensley,

2019, Reed et al., 2019). Oxidate 2.0 is not a oomycete-targeting fungicide, and it has been approved for use in organic greenhouses (Hansen & Hensley, 2019, Pfeufer & Hinton, 2017).

The active ingredients of Oxidate 2.0 are hydrogen peroxide and peroxyacetic acid, which act by oxidizing the enzymes and proteins of Pythium pathogens and kill them on-contact

Xuemei Zhang Chapter 2 55

(biosafesystems.com).

Table 2.5.1 The management methods for Pythium control in float-bed tobacco greenhouses. (Gutiérrez & Melton, 2001, Pfeufer & Hinton, 2017, Reed et al., 2019, Pearce et al., 2019, Hansen & Hensley, 2019). Time Management Methods Before seeding 1. Tray sanitation • steaming at 160-175 F for 30 mins • soapy water • quaternary ammonium salts 2. Tool/equipment sanitation (soapy water + 10% bleach) 3. Avoid bringing soil or plant debris to greenhouses

After seeding 1 Temperature and ventilation control 2 Scouting and removing disease plants 3 Preventative treatments 3.3 Terramaster 4EC: 0.7-1.4 fl oz/100 gal float water. Follow-up applications: 1.0 fl oz/100 gal, with 3-week intervals, no early than 2 weeks after seeding and no later than 8 weeks after seeding (or 5 days before transplanting). No more than 3.8 fl oz/100 gal float water can be applied. 3.4 Oxidate 2.0: 6-24 fl oz/1000 gal float water. Treat water on a regular basis or maintain a residual 100 ppm concentration(12.8 fl oz/1,000 gal). 4 Curative treatments 4.3 Terramaster 4EC: 1.0-1.4 fl oz/100 gal float water, when symptoms first appear. Follow up applications if symptoms recur: 1.0-1.4 fl oz/100 gal, with 3-week intervals, no early than 2 weeks after seeding and no later than 8 weeks after seeding (or 5 days before transplanting). No more than 3.8 fl oz/100 gal float water can be applied. 4.4 Oxidate 2.0: 1.25-2.5 fl oz/10 gal float water.

After transplanting Clean the trays immediately to remove field soil, growth medium and plant residues, and steam (160-175 F for 30 mins) the trays before storing them in clean environments.

Xuemei Zhang Chapter 2 56

Potential Pythium Management Tools or Approaches

More effective and environmentally friendly management tools are needed for Pythium control in tobacco transplant greenhouses, especially for organic production greenhouses.

Various promising non-chemical substances have shown suppressive or inhibitory effects on

Pythium pathogens.

Ultraviolet (UV) Light

Sterilization by ultraviolet (UV) radiation can be an effective water treatment to eradicate plant pathogens occurring in greenhouses (Newman, 2014). It acts through damaging the DNA of plant pathogens, causing strand breaking, cross-linking, and dimerization of adjacent pyrimidine bases (Newman, 2014). The wavelength of UV radiation ranges from 400 to 100 nm, including the long-wavelength (400-300 nm) UV-A, the medium-wavelength (315-280nm) UV-

B, and short-wavelength (280-100) nm UV-C (Riganakos et al., 2017, Newman, 2014). UV-C is the most damaging type of UV radiation. In nature, it is completely filtered by the ozone atmosphere layer and thus cannot reach the surface of the earth (Newman, 2014).

UV-C germicidal light is widely used to disinfect circulating water in greenhouses and has been used for Pythium control in hydroponic crop production systems (Stanghellini et al.,

1984, Zhang & Tu, 2000, Newman, 2014, Runia & Boonstra, 2001, Sutton et al., 2000). In two previous studies, UV water disinfestation treatments significantly reduced the inoculum level of

P. aphanidermatum (Zhang & Tu, 2000, Stanghellini et al., 1984), but the UV treatments did not reduce root rot on hydroponically grown tomato plants in one of the studies (Zhang & Tu, 2000).

Research results on the efficacy of UV water treatments on Pythium control in tobacco transplant greenhouses have not been available. However, some tobacco growers have used small

Xuemei Zhang Chapter 2 57

commercial UV apparatuses to disinfect float water in hydroponic tobacco greenhouses, and they claim it is effective against Pythium diseases. Interestingly UV treatment of float water in tobacco transplant greenhouses could have unintended adverse effects - there has been one report of UV radiation triggering acquisition of fungicide resistance by P. ultimum (Bruin & Edgington,

1982).

Copper Ionization

Utilizing low-voltage electrolysis of copper or silver to inhibit algae and plant pathogens is common in Europe. In the copper ionization process, two copper electrodes are submerged in the water. Then an electric current is applied between the electrodes, which generates positively charged copper ions from the anode (Wohanka, 2014). When copper ions attach to the negatively charged microbial cells, they can destroy cell wall permeability and enter the cells, interfering with electron transport in respiration systems, denaturing proteins, and disrupting cell metabolism (Wohanka, 2014).

The efficacy of copper ionization treatments on Phytophthora pathogens has been widely assessed and confirmed (Toppe & Thinggaard, 1998, Toppe & Thinggaard, 2000, Wohanka,

2014, Raudales et al., 2014). However, research information on the efficacy of copper ionization treatments for Pythium control is limited. Inoculum of P. aphanidermatum in treated water was reduced by 94% in treated water when 4 ppm of Copper ions was applied and left for a 24-hour contact time (Wohanka, 2014). While there are three major concerns about the use of copper ionization in hydroponic greenhouses (environmental and human safety issues, as well as phytotoxicity to crops), research studies have shown that as long as the copper ion levels are maintained within recommended levels, copper ionization is safe to treat water for human

Xuemei Zhang Chapter 2 58

consumption and hydroponic crop production (Zheng et al., 2004, Cachafeiro et al., 2007,

Wohanka, 2014). Therefore, testing copper ionization treatments on Pythium-infested float water in tobacco transplant greenhouses could identify a new alternative control method for Pythium diseases.

Plant Extracts and Phytochemicals

Plant extracts and phytochemicals could be good biocontrol candidates for Pythium control in tobacco greenhouses. They usually act through causing changes in proton flux across the membranes of pathogen cells, leading to cell environment changes and cell death. The hydrophobic lipids in plant extracts can damage fungal cell walls and mitochondria, disturbing their structure, leading to cell leakage and cell death (Rai et al., 2020). Some evidence exists showing the inhibitory or suppressive effects of plant extracts on Pythium species. For example, garlic and turmeric had significant inhibitive effects on P. aphanidermatum in vitro, and the extracts of chaste berry suppressed P. ultimum in vitro and in vivo in tomatoes (Rai et al., 2020).

Biological Control

Utilizing a different microbial species as a biocontrol agent to control Pythium has been explored for several decades (Paulitz, 1997, Wu et al., 2020). Previous research revealed a number of biological control agents that might affect Pythium pathogens via antagonistic metabolites, direct competition, hyphal interactions, mycoparasitism, etc. (Rai et al., 2020). For example, multiple strains of Pseudomonas (Ps.) chlororaphis showed suppressive effects on

Pythium aphanidermatum and P. dissotocum, which were effective in controlling Pythium root rot of sweet peppers grown in hydroponic greenhouses (Chatterton et al., 2004, Sopher, 2012,

Khan et al., 2003). Similarly, two strains of fluorescent pseudomonads protected hydroponically

Xuemei Zhang Chapter 2 59

grown cucumbers from P. aphanidermatum infection (Ongena et al., 1999). Trichoderma harzianum significantly reduced root rot incidence caused by P. aphanidermatum and P. myriotylum by 77% and 66%, respectively, on potted tobacco plants in greenhouses (Devaki et al., 1992). However, there is no direct evidence on the efficacy of biocontrol agents on tobacco seedlings in float-bed greenhouses. However, the biocontrol agents that have been shown to be effective for Pythium control in other hydroponic crop production systems, or other tobacco production systems, are likely to be promising biocontrol tools for Pythium control in tobacco transplant greenhouses.

In addition to beneficial bacterial and fungal microbes, some Pythium species can also serve as biocontrol agents against other, pathogenic Pythium species. For example, P. oligandrum can degrade the soilborne pathogen P. ultimum by aggregating host cytoplasm and penetrating altered host hyphae (Benhamou et al., 1999). Now, the question is, how much do we know about Pythium communities in float-bed tobacco greenhouses and hydroponic crop production systems? Might interspecific interactions within Pythium communities have any impacts on Pythium diseases occurring in hydroponic greenhouses? It is possible, but more research information on this topic is needed.

Nanoparticles

Recently, there have been discussions about utilizing nanotechnology in Pythium disease management (Hussein et al., 2017, Zabrieski et al., 2015, Elshahawy et al., 2018, Rai et al.,

2018). Nanoparticles (NPs) have several benefits in agriculture use, including showing antimicrobial activities, promoting plant health, smart delivery, and long-lasting residual effects(Rai et al., 2018, Rai et al., 2020). These characteristics allow NPs such as silver, copper,

Xuemei Zhang Chapter 2 60

sulfur, zinc, and carbon nanotubes to be ideal tools in plant disease management. Previous studies (Hussein et al., 2017, Zabrieski et al., 2015, Anusuya & Sathiyabama, 2015, Mahdizadeh et al., 2015, Rai et al., 2018) suggested that β-D-glucan NPs, ZnNPs, MgONPs, AgNPs and

CuONPs can be used to manage Pythium diseases caused by P. aphanidermatum and P. ultimum.

Adapting nanotechnology in crop disease management is thrilling. However, there is a safety concern on the uptake and translocation of manufactured NPs in plants leading to potential toxicity to the environment and humans (Ma et al., 2017, Rossi et al., 2018). In recent years, there have been many research studies investigating the uptake and translocation of manufactured NPs in hydroponically grown plants, and many NPs are found to be safe for hydroponic crop production use (Ristroph et al., 2017, Ma et al., 2017, Rossi et al., 2018,

Jeyasubramanian et al., 2016, Wang et al., 2018). Therefore, it is possible to find NPs suitable for Pythium disease management in float-bed tobacco greenhouses.

2.6 Perspective

It is always recommended to implement IPM (Integrated Pest Management) programs to manage crop diseases in agricultural ecosystems. In order to achieve that, it is always important to study the distribution, epidemiology, diversities in the pathogen population and the life cycle of pathogens as well as the ecological relationships within an ecosystem. However, in reality, we do not always have the time and resources to follow such a path. Consequently, we often make disease management decisions before we are familiar with certain plant pathogens. We test the efficacies of pesticides on target pathogens and use the effective ones without knowing the details about the pathogen population and the interactions among the target ecosystems. It works

Xuemei Zhang Chapter 2 61

fine until one day we hit the rocks: we are out of options due to pesticide resistance.

Although Terramaster 4EC is still effective on Pythium control in most tobacco transplant greenhouses, we do not have a lot of options in our Pythium disease management toolbox. If we go down this road, it will just be a matter of time before we hit the rocks. So, what do we do now?

Maybe it is time to go back to the basics of the disease triangle. We need to examine each of the three factors: tobacco seedlings, Pythium pathogens and the float-bed greenhouse environments. In order to develop new management tools, we need to understand the distribution, diversity, and life cycle of Pythium species in tobacco transplant greenhouses first.

Then we can find the weak points in the Pythium disease triangle, targeting the most aggressive species and/or the most susceptible growth stages of tobacco seedlings. The further investigation of the interactions between Pythium pathogens and tobacco seedlings and interactions between aggressive Pythium pathogens and other microbes in float-bed systems may reveal possible new biological control agents against Pythium pathogens. At last, we integrate all the collected information about Pythium diseases in this ecosystem and test the possibly effective new tools.

This should be the way we tackle Pythium diseases in tobacco transplant greenhouses, and in this way, we are more likely to be successful.

Xuemei Zhang Chapter 3 62

Chapter 3

Diversity of Pythium Species Recovered from Seven Sites within Tobacco Transplant Greenhouses

Abstract

Pythium disease is a common problem in hydroponic crop production and often a threat to the greenhouse production of cucumber, tomato, lettuce, and many other crops. In tobacco transplant production, where float-bed hydroponic greenhouses are commonly used, Pythium diseases can cause up to 70% seedling loss. However, there is a lack of comprehensive studies on the composition and diversity of Pythium communities in tobacco transplant greenhouses. In a survey conducted in 2017, 424 isolates were collected and identified from 41 tobacco greenhouses across four states. Samples were collected from one to seven sites within each greenhouse. Twelve described Pythium species were identified (P. adhaerens, P. aristosporum,

P. attrantheridium, P. catenulatum, P. coloratum, P. dissotocum, P. inflatum, P. irregulare, P. myriotylum, P. pectinolyticum, P. porphyrae and P. torulosum) among the isolates obtained.

Approximately 80% of the surveyed greenhouses harbored Pythium in at least one of four sites within the greenhouse (the center walkway, weeds, bay water and tobacco seedlings). The structure of the Pythium communities was diverse among the surveyed greenhouses; this diversity appeared to be dependent on the sampling location within the surveyed tobacco greenhouses, sample type and sampling time. Intraspecific variation may exist in the collected P. dissotocum population, and a possible P. adhaerens-P. porphyrae complex was also found in this study. The results provide critical new information to understand the sources and diversity of

Xuemei Zhang Chapter 3 63

Pythium communities in tobacco float-bed hydroponic transplant greenhouses.

Keywords: Pythium, hydroponic greenhouse, tobacco, species, population, diversity, life cycle

3.1 Introduction

Pythium is a common, and often a persistent, disease problem in greenhouses and nurseries, usually causing root problems in the hydroponic production of lettuce, cucumber, tomato, spinach, pepper, cilantro, celery, chrysanthemum, hemp transplants, tobacco transplants, and many other crops (Chérif et al., 1994, Stanghellini & Kronland, 1986, Miyake et al., 2014,

Gull, 2006, Kageyama et al., 2002, Bates & Stanghellini, 1984, Kusakari & Tanaka, 1987,

Labuschagne et al., 2003, Labuschagne et al., 2002, Gull et al., 2004, Larsson, 1994, Hong et al.,

2004, Lin & Huang, 1993, Hockenhull & Funck-Jensen, 1982, Liptay & Tu, 2003, Anderson et al., 1997, Romero et al., 2012, Sutton et al., 2006, Kumar et al., 2008, Goldberg, 1990). Pythium is a group of oomycetes (also known as water molds) that thrive in aquatic environments.

Hydroponic systems are conducive to Pythium pathogens, favoring the infection, dissemination, and reproduction of these oomycetes, because these pathogens produce motile asexual spores in water (Pfeufer & Hinton, 2017, Gutiérrez & Melton, 2001, Gutiérrez et al., 2012, Anderson et al., 1997, Sutton et al., 2006, Blancard et al., 2012).

Tobacco is a valuable crop due to its commercial value in smoking products and its scientific value in genetic, molecular, and physiological research (Sutton et al., 2006). Beyond that, tobacco is also used for molecular farming of biopharmaceuticals (Tremblay et al., 2010,

Cornell University, 2019, Erickson et al., 2013, Komarnytsky et al., 2000, Benjamin, 2019), including use to develop covid-19 vaccines (Daley, 2020, Molina et al., 2004, Griffin, 2020,

Cavale, 2020). Tobacco production often starts in float-bed hydroponic greenhouses used to

Xuemei Zhang Chapter 3 64 produce uniform and healthy transplants (Niedziela et al., 2005, Reed et al., 2019, Pearce et al.,

2019, Ferrell, 2013, Reed, 2009, Smith et al., 1993, Jiye & Haiping, 2004, Chunlei et al., 1997,

BU et al., 2008, Frantz et al., 1999b). In float greenhouses, tobacco seedlings are often grown in expanded polystyrene (EPS) trays that are filled with soilless substrate-based media (containing sphagnum peat, vermiculite, and occasionally perlite) and floated in plastic-lined bays filled with nutrient solution or bay water (Figure 3.1.1). Pythium diseases are very common in tobacco transplant production greenhouses (Thiessen et al., 2020, Pfeufer & Hinton, 2017, Gutiérrez et al., 2012, Fortnum et al., 2000, Cartwright et al., 1995, Anderson et al., 1997, Gutiérrez &

Melton, 2001). When severe epidemics are present, Pythium diseases can cause up to 70% seedling loss in tobacco transplant production greenhouses (Sigobodhla et al., 2010, Sigobodhla

& Dimbi, 2014).

Pythium species are known to be associated with root and stem rots, causing pre- emergence and post-emergence damping-off, and seedling blight of tobacco seedlings in float- bed production greenhouses (Sigobodhla et al., 2010, Pfeufer & Hinton, 2017, Mufunda et al.,

2016, Mufunda et al., 2017, Gutiérrez & Melton, 2001, Gutiérrez et al., 2012, Fortnum et al.,

2000, Anderson et al., 1997). The typical symptoms of Pythium diseases are below-tray symptoms including light-to-dark brown discoloration and decay of root tissue. Seed death (pre- emergence damping-off) and above-tray post-emergence symptoms such as stunting, leaf chlorosis, and seedling death may or may not be present later on. Pythium myriotylum, P. dissotocum, P. irregulare, P. volutum and P. spinosum are known to be associated with root rot of seedlings in float-bed tobacco greenhouses, with P. myriotylum appearing to be the most aggressive species (Mufunda et al., 2017, Sigobodhla et al., 2010, Anderson et al., 1997, Garwe et al., 2014, Mufunda et al., 2016, Gutiérrez & Melton, 2001, Gutiérrez et al., 2012). However,

Xuemei Zhang Chapter 3 65 the composition, diversity, sources, and survival of Pythium communities in tobacco transplant greenhouses remain largely unknown.

The management of Pythium diseases in tobacco greenhouses is challenging, mainly relying on sanitation and oomyceticide water treatments; there is only one oomyceticide product currently labeled for Pythium control in tobacco transplant greenhouses (Gutiérrez et al., 2012,

Gutiérrez & Melton, 2001, Pfeufer & Hinton, 2017, Sigobodhla et al., 2006, Pearce et al., 2019,

Reed et al., 2019). The objective of this study was to investigate the composition and distribution of Pythium communities in tobacco transplant greenhouses. Expanding our knowledge of

Pythium communities and Pythium diseases in tobacco transplant greenhouses should be beneficial in improving Integrated Pest Management (IPM) of Pythium diseases in tobacco transplant greenhouses.

3.2 Materials and Methods

3.2.1 Sample Collection and Pythium isolation

A survey of Pythium species in float-bed tobacco transplant production greenhouses was conducted in 41 greenhouses (Appendix A. Table S3.1 - S3.2) across four states in 2017, including 31 individual greenhouses belonging to 23 farms in Virginia, four greenhouses in

Maryland, three greenhouses in Georgia, and three greenhouses in Pennsylvania. Greenhouses were randomly selected, except for five Virginia greenhouses (Greenhouses 37 – 41), which were selected based on their known history of Pythium diseases. These five greenhouses were visited and sampled two to four times (Table S3.2). Samples from tobacco greenhouses in

Virginia were collected by the author and Virginia Tech extension personnel. Samples from tobacco greenhouses in Georgia, Maryland, and Pennsylvania were collected by extension (or

Xuemei Zhang Chapter 3 66 land grant university) personnel and consisted of tobacco seedling and greenhouse bay water samples. In total, 24 greenhouses in Virginia were sampled by the author, and the samples from the remaining 17 greenhouses in this survey were collected by the collaborators. The sample collection occurred from February 02 to May 29, 2017.

A total of 424 samples were collected from one-to-seven sites (Figure 3.2.1) within these

41 tobacco greenhouses (Table S3.1 – S3.2): tobacco seedlings, bay water, weedy plants, center walkways, growth substrate/medium in tray cells, reused trays, and the surface of plastic-lined, wooden float bed frames. Four types of tobacco seedling samples were collected: healthy- appearing (asymptomatic) seedlings, stunted seedlings with no apparent root symptoms, seedlings with root rot (discolored and/or necrotic roots) but no apparent stem or leaf symptoms, and stunted seedlings with root rot symptoms.

Figure 3.2.1. Sample sites or types in the 2017 tobacco greenhouse survey. A. tobacco seedlings. B. growth substrate/medium in tray cells with seed germination failure. C. the surface of plastic- lined, wooden float bed frames covered by tobacco leaf tissues. D. bay water. E. clover floating in bay water. F. weedy plants grown in a tobacco greenhouse. G. a center walkway covered with dirt and organic tissues. H. a reused tray filled with growth medium.

Xuemei Zhang Chapter 3 67

All greenhouses were not sampled equally (Table 3.2.2 & S3.1) because the number of sample environments and/or types varied among greenhouses, and some types were not available in some greenhouses at the time of sampling.

Samples were collected from the nutrient solution (“bay water”) in greenhouse bays in 36 greenhouses (Table 3.2.1). Of these 36 greenhouses, asymptomatic seedlings were also sampled from 22 greenhouses. Asymptomatic seedlings were also sampled from two additional greenhouses from which bay water samples could not be collected, for a total of 24 greenhouses from which asymptomatic plants were sampled. Both bay water and stunted plants were sampled from nine greenhouses. Stunted plants were also collected from an additional two greenhouses from which bay water samples were unavailable, leading to a total of 11 greenhouses from which stunted plant samples were obtained. Tobacco plant samples exhibiting only root rot symptoms were collected from seven greenhouses where bay water samples were also collected, and from an additional two greenhouses without bay water samples. Samples of stunted tobacco seedlings that also exhibited root rot symptoms were collected from five greenhouses, from all of which bay water samples were also obtained. Weed samples were collected from 11 greenhouses where greenhouse bay water was also sampled, plus an additional greenhouse where no bay water sample was collected.

Samples were also collected from the center walkway of eight greenhouses where bay water samples were collected, plus an additional greenhouse where no bay water sample was collected. Reused trays with embedded organic residues (dried root pieces) were obtained from three greenhouses where bay water samples were collected and from two greenhouses where water samples were not obtained. Samples containing a mixture of soil and tobacco leaf debris were also collected from the sides of the wooden bay supports along greenhouse center

Xuemei Zhang Chapter 3 68 walkways

Table 3.2.1. The sampling structure of the 2017 tobacco transplant greenhouse survey. Sampling Sample type or sampling substrate Number of sampled Number of samples environment greenhouses

Bay water* Total: 36 Total: 145 • direct plating (DP) 36 145 • baiting: 36 145 fescue leaves (F) 36 145 sunflower seeds (S) 36 145 hemp seeds (H) 36 145 tobacco seedlings (T) 36 145

Tobacco seedlings Total: 30 Total: 218 • asymptomatic tobacco seedlings 24 107 • symptomatic tobacco seedlings 25 111 stunting only 11 49 root rot only 9 45 stunting & root rot 5 17

Weeds Total: 12 Total: 29 • Within-bay (in trays or bay water) 6 6 • Outside-bay 11 23

The center walkway dirt-tobacco debris mixture 9 11 Used trays 5 7 Bay surface 2 7 Growth medium in 2 7 tray cells *each bay water sample was processed with direct plating and baiting with 4 baits F, S, H & T.

from two greenhouses. Samples from the growth medium in tray cells containing ungerminated seeds were also collected from two greenhouses. The detailed sampling structure within each greenhouse are shown in Table S3.1 - S3.2.

Xuemei Zhang Chapter 3 69

Bay Water Samples

In the 17 tobacco greenhouses surveyed by the collaborators, one to four (typically two) water samples were collected from individual bays in the greenhouse. In the 24 greenhouses that were visited by the author, water samples were typically collected from each bay in each greenhouse. Sampled greenhouses typically contained six bays, but the number of bays ranged from four to eight. At the early stage of the survey (before mid-March), when tobacco trays had not yet been seeded, or recently seeded in most surveyed greenhouses, only one or two water samples were collected from the surveyed greenhouses, because the bays were lined with new plastic and all the bays were filled with water coming from the same source.

Each water sample (50 – 500 ml) contained three subsamples collected using a 50-ml Falcon tube containing water sampled from each end as well as from the middle of the sampled bay; three subsamples were then bulked into a single composite water sample from each bay. Water samples shipped to the author by collaborators usually contained two samples: a water sample collected from a bay that contained apparently diseased tobacco seedlings, and a water sample from a bay that did not contain any symptomatic seedlings.

Two milliliters were subsampled from each composited water sample from each bay and spread onto four 100 mm x 15 mm Petri dishes (Fisherbrand, Pittsburgh, PA) containing V8-

PARP medium in order to obtain oomycete isolates. A 40-ml aliquot from each composite bay water sample was poured into a 50 ml Falcon centrifuge tube for Pythium baiting. Three pieces of sterilized fescue leaves (2.5-cm long), three sterilized whole hemp seeds, three sterilized whole sunflower seeds, and three sterilized whole newly germinated (10-day-old) healthy tobacco seedlings were added to each water sample in a sterile environment (laboratory transfer hood) using sterile tweezers. The Falcon tubes were shaken and set still at room temperature (25

Xuemei Zhang Chapter 3 70

ºC) for 7 days, after which, the baits were cultured on V8-PARP agar plates.

Tobacco Seedlings

Four seedlings were collected randomly across all bays in a surveyed greenhouse when no symptomatic seedlings were observed. One to six symptomatic tobacco seedlings, depending on availability, were randomly collected from each surveyed tobacco greenhouse when symptomatic tobacco seedlings were observed. Typically, four symptomatic and four asymptomatic seedlings were randomly collected for culture isolation when symptomatic tobacco seedlings were present. Samples collected by collaborating extension personnel and shipped to the author contained four to eight seedlings per greenhouse.

Symptomatic tobacco seedlings were categorized into three types: Seedlings categorized as “stunted” were visibly shorter and smaller than most others in the same EPS greenhouse tray, or other trays within the same bay, but had no other apparent symptoms; plants with “root rot” only exhibited root discoloration and decay, but their stems and foliage appeared to be normal in color and size; seedlings classified as the “stunting & root rot” type exhibited stunting, often accompanied with leaf chlorosis and wilting, in addition to root discoloration and decay. Stunted tobacco seedlings were observed and collected throughout the survey (transplant production season), while seedlings with root rot were mainly observed and collected at later stages of the season; stunted root-rot tobacco seedlings were more common at early or mid stages of the season.

The roots of tobacco seedling samples were rinsed in tap water and then sterile distilled water (SDW) in order to remove any plant growth medium attached to their surface. Four 2.54- cm-long root fragments were then randomly subsampled from the entire root system and surface- sterilized using 75% ethanol for 20s and 10% bleach for 40s (for healthy-looking roots) or using

Xuemei Zhang Chapter 3 71

10% bleach for 5s to 30s (for discolored and/or decayed roots), depending on the softness of the root tissues. The four surface-sterilized root fragments were subsequently rinsed three times with

SDW, and then embedded in V8-PARP agar in a 100 mm x 15 mm plastic Petri plate

(Fisherbrand, Pittsburgh, PA). This process was repeated three times for each sample.

Organic Residue Samples

Seven samples of growth medium were also collected from tray cells containing seeds that had not germinated. These samples were also plated directly in V8-PARP agar plates in a sterile environment with sterile tweezers. This process was repeated three times for each sample.

Seven reused trays with dry tobacco root tissues anchored within the cell walls were also randomly collected from five greenhouses where trays were a suspected source of initial inocula.

Tray pieces (1 cm3) were then broken from 12 randomly selected locations from within each sampled tray using sterile tweezers. Four of these pieces were then randomly selected and transferred to each of three V8-PARP agar plates in a sterile environment with sterile tweezers.

Mixtures of dry soil and tobacco tissues were also sometimes observed in surveyed tobacco greenhouses on the floor of the center walkway (Figure 3.2.1G); dry tobacco root-leaf debris was also sometimes observed on the surface of the plastic-lined wooden bay support walls (Figure

3.2.1C) along the greenhouse center walkways (Table 3.2.1.1). These residue mixtures were collected whenever they were observed. Four 0.5-ml subsamples were taken and placed directly by embedding the samples into four V8-PARP agar plates.

Xuemei Zhang Chapter 3 72

Weedy Plants

Weedy plant samples were collected whenever they were present in the greenhouses

(Table 3.2.1). Five weed samples originated from within the float trays in the bays, one weed sample was found floating in bay water (Figure 3.2.1E), and 23 weed samples were found growing along the bays and center walkways (Figure 3.2.1F). The roots of weed samples were rinsed in tap water followed by SDW in order to remove the soil or growth medium attached to the root surface. Four 2.54-cm-long root fragments were randomly subsampled from the weed root systems and then surface-sterilized with 75% ethanol for 30 s and 10% bleach for 40 s, followed by three SDW rinses. The four root fragments were then embedded in a V8-PARP agar plate. This process was repeated three times for each sample.

3.2.2 Morphological and Molecular Identification

Hyphal tips from all isolates growing on 10-day-old V8-PARP media were transferred to

10% V8 agar medium to generate active pure cultures. Pure cultures were also transferred onto water agar (WA) and corn meal agar (CMA) medium to observe the morphological characteristics of the cultures.

Morphological Identification

The mycelial patterns formed by all pure cultures were observed and compared on 10%

V8, CMA and WA media. Sexual and asexual reproductive structures, hyphal swellings and/or other morphological characteristics (see Chapter 2, Table 2.3.2) produced on these three different agar media were also observed using a compound microscope (Motic AE2000, Hong Kong).

Isolates were initially identified to genus or species based on their morphological characteristics using the Van der Plaats-Niterink Pythium identification keys (Van der Plaats-Niterink, 1981).

Xuemei Zhang Chapter 3 73

DNA Extraction

Three discs were cut from each 10-day-old pure culture on 10% V8 culture using a 7.5 mm diameter cork borer and transferred into a 100 mm x 15 mm sterile Petri dish (Fisherbrand,

Pittsburgh, PA) filled with 10 ml of autoclaved potato dextrose broth (PDB). The original agar plugs were removed from PDB one week later, and the mycelial mats remaining in PDB plates were harvested and dried using 3 pieces of sterilized filter paper. The dry mycelia were transferred to 2-ml tubes and processed in a FastPrep-24 homogenizer (MP Biomedicals). DNA was extracted from the homogenized mycelial samples using FastDNA Spin kits (MP

Biomedicals), following the protocol in the kits. Sample DNA concentrations were measured using a NanoDrop 2000 (Thermo Scientific).

DNA Amplification and Sequencing

The DNA samples were diluted with sterile ddH2O to 10-50 ng/µl before DNA amplification. Diluted DNAs were amplified with primers targeting ITS (ITS1:

TCCGTAGGTGAACCTGCGG & ITS4: TCCTCCGCTTATTGATATGC) and cox II regions (

FM58: CCACAAATTTCACTACATTGA & FM66: TAGGATTTCAAGATCCTGC), using

PCR protocols adapted from previous studies (Schroeder et al., 2013, Garwe et al., 2014,

Mostowfizadeh-Ghalamfarsa & Salmaninezhad, 2020, Robideau et al., 2011, Moorman & May,

Villa et al., 2006, Mufunda et al., 2016). In this study, DNAs were amplified using MyTaq HS

Red Mix (Bioline) for a final volume of 20 µl in a StepOnePlus Real-Time PCR Cycler (ABI), with a 1-min denaturing step at 95 ºC, 34 cycles consisting of 15 seconds of 95 ºC, 15 seconds of

55 ºC and 10 seconds of 72 ºC, and a 10-minute extension step at 72 ºC. The PCR products were analyzed by electrophoresis on 1% agarose gels, and products indicated by clear bands in a gel imager (Bio-Rad) were sent to Eurofins Genomics in PlateSeq Kits for PCR product purification

Xuemei Zhang Chapter 3 74 and sequencing. Due to the high PCR failure rate with cox II primers in this study, over 90% of the Pythium isolates were amplified and sequenced with ITS primers (identified with ITS sequences).

Sequence Analysis

Each sample generated a forward (from 5’ to 3’) and a reverse (from 3’ to 5’) read of ITS sequences. The reverse complete sequence of each reverse read was used to aligned with the corresponding forward read using DNASTAR Lasergene 15.2, and the consensus sequence data were compared in the National Center for Biotechnology Information (NCBI) GenBank database. Polygenetic analyses were performed following published protocols (Newman et al.,

2016, Hall, 2013). Selected ITS sequence data with over 99% coverage and similarity to a reference species in the NCBI Genbank database were aligned using the CLUSTAL W program and trimmed in MEGA X-10.1.7. Polygenetic trees were constructed using the neighbor-joining

(NJ) method with 1,000 bootstrap replications. The branches with bootstrap values less than 50 were considered as “false branches” due to the poor statistical support (Al‐Sa'di et al., 2007,

Senda et al., 2009, Villa et al., 2006).

3.3 Results

3.3.1 Pythium Isolation and Identification

A total of 629 isolates were established from the tobacco greenhouses surveyed. After excluding 67 duplicate or dead isolates, 562 were available for identification; 424 (75.4%) of these were successfully sequenced using ITS1/4 primers.

Xuemei Zhang Chapter 3 75

Figure 3.3.1. The composition of isolate collection in the 2017 tobacco greenhouse survey. The colors of the pie chart represent different groups of microbial organisms collected in the survey. The space in the pie chart indicates the proportion of different groups and species in the isolation collection.

Among the 424 sequenced isolates, 360 (84.9%) were Pythium species, 27 (6.4%) were other oomycetes and 37 (8.7%) were fungal species (Figure 3.3.1). The 360 Pythium isolate included 12 described and one undescribed species: P. adhaerens, P. aristosporum, P. attrantheridium, P. catenulatum, P. coloratum, P. dissotocum, P. inflatum, P. irregulare, P. myriotylum, P. pectinolyticum, P. porphyrae, P. torulosum, and an undescribed Pythium species

(Figure 3.3.1). The majority (73.3%) of Pythium isolates were recovered from bay water samples

(Figure 3.3.2).

Xuemei Zhang Chapter 3 76

Figure 3.3.2. Number of Pythium isolates recovered from different sampling sites, types, or substrates within tobacco greenhouses in the 2017 tobacco greenhouse survey. FHST represents four types of baits used in water sample isolation, where F indicates sterilized fescue leaves, H indicates sterilized whole hemp seeds, S indicates sterilized whole sunflower seeds, and T indicates healthy 10-day-old tobacco seedlings. The entire Pythium collection consisted of 264 isolates recovered from bay water samples, 85 isolates recovered from tobacco seedlings, 10 isolates recovered from weedy plants and one isolate from the center walkway. Sixty-four of the 264 bay water isolates were obtained through direct plating of the samples, 53 were baited by fescue leaves, 50 were baited by hemp seeds, 55 were baited by sunflower seeds and 42 were baited by 10-day-old tobacco seedlings. Among the Pythium isolates recovered from tobacco seedlings, 34 isolates were from asymptomatic healthy-appearing seedlings, 32 were from root- rot seedlings, 10 were from stunted seedlings and nine were from stunted root-rot seedlings.

Pythium-positive Greenhouses and Sampling Environments

Pythium species were found in 33 of the 41 (80.5%) tobacco transplant greenhouses surveyed in this study. Pythium species were detected in bay water in 27 of the 36 (75.0%) greenhouses from which bay water samples were collected (Table 3.3.1). Among the 30 sampled greenhouses where tobacco seedlings were collected from, Pythium species were recovered from the roots of asymptomatic or symptomatic tobacco seedlings in 22 of these sampled (73.3%) greenhouses (Table 3.3.1). Pythium was also found in the roots of weeds in seven of the 11

(63.6%) greenhouses where weed samples were collected, and Pythium was detected in the

Xuemei Zhang Chapter 3 77 center walkway in one of the eight (12.5%) greenhouses where such samples were obtained

(Table 3.3.1).

Table 3.3.1. The summary of sample isolation efficiency in the 2017 tobacco transplant greenhouse survey.

by greenhouse by sample Sampling Sample type Pythium- Number of Number of Pythium- sitea or substrate isolation Pythium-positive Pythium- isolation frequencyb greenhouses positive frequency samples Bay water Total 75% 27 58% 84 • direct plating (DP) 44% 16 31% 45 • baiting: 72% 26 54% 78 fescue leaves (F) 67% 24 37% 53 sunflower seeds (S) 56% 20 38% 55 hemp seeds (H) 61% 22 35% 51 tobacco seedlings (T) 50% 18 34% 49

Tobacco Total 73% 22 39% 85 seedlings • asymptomatic tobacco seedlings 54% 13 32% 34 • symptomatic tobacco seedlings 68% 17 46% 51 stunting only 64% 7 20% 10 root rot only 78% 7 71% 32 stunting & root rot 60% 3 53% 9

Weeds Total 58% 7 35% 10 • Within-bay 17% 1 17% 1 • Outside-bay 64% 7 39% 9

The center dirt-tobacco debris mixture 11% 1 9% 1 walkway a No Pythium was recovered from reused trays, bay surface, or growth medium in tray cells. b Pythium isolation frequency by greenhouse was calculated via dividing the number of Pythium-positive greenhouses by the number of sampled greenhouses. Pythium isolation frequency by sample was calculated via dividing the Pythium-positive samples by the total number of samples in each type. some samples were associated with more than one Pythium isolates or species.

Xuemei Zhang Chapter 3 78

3.3.2 Analysis by Sampling Site

In this study, Pythium species were recovered from four sites including bay water, tobacco seedlings, weedy plants, and the center walkway, within the surveyed tobacco transplant greenhouses (Table 3.3.2).

Table 3.3.2. Presence of Pythium spp. at different sites within tobacco greenhouses. Survey Number Identities of Pythium-positive Greenhouses Pythium species Bay water Tobacco seedlings Weeds Walkway Pythium sp. 33 P. attrantheridium 41 P. aristosporum 4 P. irregulare 39 3, 39 39 P. pectinolyticum 15 P. torulosum 33 P. inflatum 33 P. adhaerens 19, 22, 33 P. porphyrae 7, 22 9, 31 P. catenulatum 19, 31 31 P. coloratum 5, 10, 18, 32, 38, 39, 40 26, 34, 39 P. dissotocum 1, 4, 5, 6, 9, 10, 11, 12, 3, 9, 10, 11, 17, 20, 29, 5, 11, 41 15, 17, 18, 20, 30, 32, 30, 34, 36, 37, 39, 41 33, 34, 35, 36, 37, 38, 39, 40, 41 P. myriotylum 7, 12, 15, 18, 19, 22, 1, 13, 18, 21, 22, 25, 29, 18 30, 31, 36, 37 31, 32, 34, 37

Pythium Species in Bay Water

A total of 264 Pythium isolates were recovered from 84 bay water samples collected from

27 greenhouses (Figure 3.3.2, Table 3.3.1). These isolates belong to 11 Pythium species: P. irregulare, P. pectinolyticum, P. torulosum, P. inflatum, P. adhaerens, P. porphyrae, P. catenulatum, P. coloratum, P. dissotocum, P. myriotylum, and an undescribed Pythium species

(Table 3.3.2). Pythium coloratum, P. dissotocum and P. myriotylum were found to be associated with bay water in more than three greenhouses (Table 3.3.2). Pythium dissotocum was the most

Xuemei Zhang Chapter 3 79 common species in bay water within tobacco transplant production greenhouses (Table 3.3.2).

Baiting captured more Pythium species from bay water samples than direct plating in this study,

(Table 3.3.3). More than one Pythium species were recovered from an individual sample in 19 bay water samples that had been collected from 17 different greenhouses (Table 3.3.5 – 3.3.6), because different isolation methods (direct plating and baiting) or different baits were able to capture different species in the same bay water sample.

Table 3.3.3. Presence of Pythium spp. on directly plated cultures and different types of baits in water samples. Survey Number Identities of Greenhouses with Pythium-positive bay water samples Pythium species tobacco direct plating fescue leaf sunflower seed hemp seed seedling Pythium sp. 33 P. pectinolyticum 15 P. torulosum 33 33 33 P. inflatum 33 33 33 33 P. adhaerens 22 33 19, 33 P. porphyrae 22 7 P. catenulatum 19, 31 19, 31 19, 31 19, 31 19, 31

P. coloratum 5, 10, 32, 39, 40 10, 18, 38, 39 18 18 P. dissotocum 5, 6, 11, 12, 1, 4, 6, 9, 10, 11, 1, 4, 10, 11, 17, 1, 4, 6, 10, 10, 11, 17, 18, 17, 20, 30, 32, 15, 17, 20, 30, 20, 32, 33, 34, 35, 11, 15, 17, 20, 30, 32, 33, 33, 39, 40, 41 32, 33, 34, 35, 39, 40, 41 20, 30, 32, 35, 37, 39, 40, 36, 37, 38, 39, 33, 35, 38, 41 40, 41 39, 40, 41 P. myriotylum 37 7, 15, 30, 37 7, 12, 18, 19, 36 7, 22, 31, 37 19. 22. 30. 36

Xuemei Zhang Chapter 3 80

Pythium species in Tobacco Seedlings

A total of 85 Pythium isolates were recovered from 85 tobacco seedling samples collected from 22 greenhouses (Figure 3.3.2, Table 3.3.1). These isolates belonged to five species: P. catenulatum, P. porphyrae, P. coloratum, P. dissotocum and P. myriotylum (Table

3.3.4). Pythium coloratum, P. dissotocum and P. myriotylum were found to be associated with tobacco seedlings in multiple greenhouses (Table 3.3.4). Pythium dissotocum appeared to be the most common species on asymptomatic and seedlings showing stunting but no other apparent symptoms, while Pythium myriotylum were the most common species on stunted tobacco seedlings showing root rot, sometimes accompanied with leaf chlorosis and wilting (Table 3.3.4).

More than one Pythium species were recovered from the same or the same type of tobacco seedling samples within the greenhouse in five greenhouses (Grhs: 9, 29, 31, 34 & 39, Table

3.3.5 - 3.3.6).

Table 3.3.4. Presence of Pythium spp. in tobacco seedling samples according to disease symptoms exhibited. Survey Number Identities of Greenhouses with Pythium-positive tobacco seedlings Pythium species asymptomatic stunted root rot stunted & root rot P. catenulatum 31 P. porphyrae 31 9 P. coloratum 9, 26, 34 39 3, 10, 11, 17, 20, 36, 37, 3, 17, 30, 36, 39, P. dissotocum 29, 34 9 39, 41 41 21, 22, 25, 29, P. myriotylum 31 13 1, 18 32, 34, 37

Xuemei Zhang Chapter 3 81

Pythium Species in Weedy Plants and Walkways

Ten Pythium isolates were recovered from 10 weed samples collected from seven greenhouses (Figure 3.3.2, Table 3.3.1). Those 10 isolates belonged to five species: P. attrantheridium, P. aristosporum, P. irregulare, P. dissotocum, and P. myriotylum (Table 3.3.2).

Pythium irregulare and P. dissotocum were associated with weed samples in two or more greenhouses (Table 3.3.2). Only one greenhouse had Pythium in the soil and plant debris mixtures on the center walkway, and this isolate was identified as Pythium irregulare (Table

3.3.2).

3.3.3 Isolation Frequency (IF) of Pythium species

The isolation frequency (IF) of samples was estimated from the percentage of the samples that provided Pythium isolates on V8-PARP medium, indicating the percentage of collected samples that were associated with Pythium isolates. The overall IF of Pythium isolates from bay water was 57.9%; from tobacco seedlings 39.0%; from weeds 34.5%; or from walkways 9.1%. Pythium isolates were not obtained from the growth medium, used trays, or bay surface samples (Table 3.3.1). The IF of Pythium species from different environments varied greatly within (Table 3.3.5 – 3.3.6) and among (Table 3.3.1) the surveyed greenhouses. Nineteen out of 30 greenhouses harbored Pythium species in two or more environments (Table 3.3.2). The species of Pythium and their IFs changed over time within some greenhouses that were visited multiple times during the survey or seedling production season (Table 3.3.6).

IF of Pythium from Bay Water

The IF of Pythium from bay water was influenced by the isolation method (Table 3.3.1):

The IF of Pythium from bay water was 31.0% by direct plating, 53.8% when any of the four baits

Xuemei Zhang Chapter 3 82 was used. The IF was 36.6% when fescue leaves were used alone for baiting, 37.9% when sunflower seeds were used alone, 35.2% when hempseeds were used alone, and 33.8% when tobacco seedlings were used alone for baiting bay water samples. The total IF of Pythium species from bay water from each greenhouse ranged from 0% to 100% among the 36 sampled greenhouses, with a mean of 59.3% and a median of 66.7% (Table 3.3.5 – 3.3.6).

Table 3.3.5. Isolation frequencies (presented by sampling site) of Pythium spp. within greenhouses visited only once in the 2017 tobacco transplant greenhouse survey. Greenhouse Sources and Isolation Frequency of Pythium spp. in sampled environments Sample Tobacco seedlings date ID State root stunted & bay water weeds asymptomatic Stunted rot root rot 8 VA 03/29 0% 0% 0% 2 GA 03/20 0% 0% 0% 14 PA 03/30 0% 23 VA 03/30 0% 24 MD 04/13 0% 27 VA 04/18 0% 28 VA 04/19 0% 100%: 50% 4 VA 03/08 P. dissotocum P. aristosporum 100%: 100% 5 VA 03/08 P. dissotocum, P. dissotocum P. coloratum 100%: 6 VA 03/08 P. dissotocum 100%: 7 VA 03/22 P. myriotylum, P. porphyrae 100%: P. adhaerens 19 MD 03/30 P. myriotylum, P. catenulatum 75%: P. inflatum, P. torulosum, 33 VA 04/24 P. dissotocum, P. adhaerens Pythium sp. (to be continued on the next page)

Xuemei Zhang Chapter 3 83

Table 3.3.5. Isolation frequencies (presented by sampling site) of Pythium spp. within greenhouses visited only once in the 2017 tobacco transplant greenhouse survey (continued). Greenhouse Sources and Isolation Frequency of Pythium spp. in sampled environments Sample Tobacco seedlings date ID State root stunted & bay water weeds asymptomatic Stunted rot root rot 33.3%: 16.7%: 100%: 3 VA 02/16 P. dissotocum P. dissotocum P. irregulare

100%: 50%: 1 GA 03/03 0% P. myriotylum P. dissotocum 83.33%: 75%: 10 VA 03/29 P. dissotocum P. dissotocum P. coloratum 25%: 12 VA 03/29 0% P. dissotocum P. myriotylum

100%: 66.67%: 50%: 11 VA 03/29 0% P. dissotocum P. dissotocum P. dissotocum 50%: 50%: 16.7%: 9 VA 03/29 P. dissotocum P. coloratum P. dissotocum P. porphyrae 100%: 13 PA 03/30 0% P. myriotylum 100%: P. dissotocum 15 PA 03/30 0% P. myriotylum P. pectinolyticum

25%: 50%: 80%: 17 VA 03/30 P. dissotocum P. dissotocum P. dissotocum 100%: 100%: P. myriotylum 100%: 18 VA 03/30 0% P. myriotylum P. dissotocum P. myriotylum P. coloratum 100%: 100%: P. myriotylum 31 VA 04/08 P. myriotylum 50% P. catenulatum P. catenulatum P. porphyrae 100%: 100%: 25%: 36 VA 04/08 P. dissotocum P. dissotocum P. dissotocum P. myriotylum

66.7%: 75%: 30 VA 04/19 0% P. dissotocum P. dissotocum P. myriotylum

100%: 100%: 20 VA 04/26 P. dissotocum P. dissotocum (to be continued on the next page)

Xuemei Zhang Chapter 3 84

Table 3.3.5. Isolation frequencies (presented by sampling site) of Pythium spp. within greenhouses visited only once in the 2017 tobacco transplant greenhouse survey (continued).

Greenhouse Sources and Isolation Frequency of Pythium spp. in Sampled Environments Sample date Tobacco seedlings ID State stunted & bay water weeds asymptomatic stunted root rot root rot 75%: 29 GA 04/07 0% P. dissotocum 0% P. myriotylum 50%: 100%: 66.7%: P. myriotylum 34 VA 04/07 P. dissotocum P. coloratum P. dissotocum

100%: 25%: 32 VA 04/08 50% P. dissotocum 0% P. myriotylum P. coloratum

50%: 35 VA 04/08 0% 0% 0% P. dissotocum

100%: 21 VA 04/10 P. myriotylum

50%: 87.5%: P. myriotylum 22 VA 04/24 P. myriotylum P. porphyrae P. adhaerens 75%: 25 VA 05/15 0% P. myriotylum

20%: 26 VA 05/29 0% P. coloratum

No Pythium isolates were recovered from walkways, reused trays or growth medium in trays. Therefore, those three sampling environments are not included in this table. There was only one type of samples (reused trays) were taken from Greenhouse No. 16 and no Pythium isolates were recovered from the tray samples. Therefore, Greenhouse No.16 is not included in this table. Frequencies are presented by sampling site.

Xuemei Zhang Chapter 3 85

Table 3.3.6. Isolation frequencies (presented by sampling site) of Pythium spp. within greenhouses visited multiple times in the 2017 tobacco transplant greenhouse survey. Greenhouse Sources of Pythium species and Isolation Frequency of Pythium spp. In sampled environments Sample Date growth Tobacco seedlings reused ID State (weeks after seeding) bay water weeds walkway medium trays asymptomatic stunted root rot in trays 02/02 (before seeding) 0%

VA 66.7%: 37 25%: 100%: 05/04 (10 WAS) P. myriotylum P. dissotocum P. myriotylum P. dissotocum 50%: 03/08 (2 WAS) P. dissotocum 0% 38 VA P. coloratum 03/23 (4 WAS) 0% 0% 0% 20%: 100%: 100%: 02/16 (0 WAS) 0% P. irregulare P. irregulare P. irregulare 50%: 03/08 (3 WAS) 0% P. irregulare 39 VA 50%: 20%: 33.3%: 03/23 (5 WAS) P. dissotocum P. dissotocum P. dissotocum 0% P. coloratum P. coloratum 100%: 100%: 60%: 04/18 (8 WAS) P. dissotocum P. dissotocum P. dissotocum P. coloratum 100%: 03/08 (2 WAS) P. dissotocum 0% P. coloratum 40 VA 66.7%: 04/18 (8 WAS) 0% P. dissotocum P. coloratum 33.33%: 03/08 (2 WAS) 0% P. attrantheridium 100%: 41 VA 03/15 (3 WAS) 0% 0% 0% P. dissotocum 25%: 40%: 83.33%: 100%: 03/23 (4 WAS) 0% P. dissotocum P. dissotocum P. dissotocum P. dissotocum

Xuemei Zhang Chapter 3 86

IF of Pythium from Tobacco Seedlings

In total, the IF of Pythium isolates from asymptomatic seedlings was 31.8%; that from symptomatic seedlings was 46.0%; with stunting only, 20.4%; with root rot only, 71.1%; with both stunting and root rot, 52.9% (Table 3.3.1). The total IF of Pythium species from asymptomatic tobacco seedlings in individual greenhouses ranged from 0% to 100% among the

24 sampled greenhouses, with a mean of 35.0%, and a median of 16.3% (Table 3.3.5 – 3.3.6).

The total IF of Pythium species from stunted tobacco seedlings in individual greenhouses ranged from 0% to 100% among the 11 sampled greenhouses, with a mean of 31.8%, and a median of

18.8% (Table 3.3.5 – 3.3.6). The total IF of Pythium species from root-rot tobacco seedlings in individual greenhouses ranged from 0% to 100% among the nine sampled greenhouses, with a mean of 68.6% and a median of 80% (Table 3.3.5 – 3.3.6). The total IF of Pythium species from stunted root-rot tobacco seedlings in individual greenhouses ranged from 0% to 100% among the five sampled greenhouses, with the mean and median at 50 (Table 3.3.5 – 3.3.6).

IF of Pythium from Weedy Plants and Walkways

The IF of Pythium species from weedy plants in the seven greenhouses ranged from 0% to 100%, with a mean of 49.2%, and a median of 50% (Table 3.3.5-3.3.6). The only Pythium isolate recovered from the single walkway sample belonged to Pythium irregulare (Table 3.3.6).

Xuemei Zhang Chapter 3 87

3.3.4 Phylogenetic Analysis

A total number of 346 high-quality ITS1-5.8S-ITS2 sequences of the oomycete isolates collected in the 2017 greenhouse survey were analyzed and used to construct phylogenetic trees.

Isolates (sequences) from the same species of Pythium that shared high similarities were collapsed to simplify the oomycete phylogenetic tree (Figure 3.3.3). Due to the large number of isolates, the sequences of P. coloratum and P. catenulatum (Figure 3.3.4), P. myriotylum (Figure

3.3.5), and P. dissotocum (Figure 3.3.6) were used to construct three separate trees to examine the intraspecific variation within these four species.

The results of oomycete phylogenetic analysis (Figure 3.3.3) showed that the isolates collected in the 2017 survey were clearly separated into different branches or clades on the phylogenetic trees, with the support of high bootstrap values. Two species belonging to Clade A,

Pythium adhaerens and P. porphyrae were in two subclades and formed a separate branch (93%) on this tree (Figure 3.3.3). Pythium coloratum and P. dissotocum were clustered (bp=85%) on one end of Clade B (81%).

Figure 3.3.3. The phylogenetic tree of the oomycete isolates collected in the 2017 greenhouse survey. Bootstrap values under 50 were not shown. The branch lengths are drawn to scale to show 0.05 substitutions per site (5% changes between two sequences). Branch lengths less than 0.001 are not shown on this tree. Pythium species with five or more isolates in this collection were collapsed to simplify the tree. Each species of oomycetes is separated clearly at correct branches (clades) on this tree, and the Pythium isolates belong to three clades: Clade A, B and F.

Xuemei Zhang Chapter 3 88

Clade A

Clade F

(To be continued on the next page)

Xuemei Zhang Chapter 3 89

Clade B

Xuemei Zhang Chapter 3 90

One isolate of P. dissotocum was closer to P. coloratum than to the P. dissotocum cluster, but it was distant (0.113 substitution per site) from P. coloratum (Figure 3.3.3). Two other species belonging to Clade B, P. pectinolyticum and P. myriotylum were in two subclades that were clustered and adjacent to the other species in Clade B including P. aristosporum, P. inflatum, P. catenulatum, and P. torulosum subclades (Figure 3.3.3).

The isolates belonging to Clade F, P. attrantheridium and P. irregulare, were in two subclades

(92%) and formed a different branch (99%) that was relatively distant from both Clade A and

Clade B (Figure 3.3.3). The undescribed/unknown Pythium species was closer to P. attrantheridium (Figure 3.3.3). Other oomycetes in the isolate collection, Aphanomyces spp.,

Achlya spp. and Saprolegnia spp. were also well separated on this tree with high bootstrap values

(Figure 3.3.3).

Pythium coloratum (Figure 3.3.4), P. catenulatum (Figure 3.3.4), and P. myriotylum polygenetic trees (Figure 3.3.5) suggested there was not much genetic variation among the P. coloratum, P. catenulatum, or P. myriotylum isolates collected in this study. Although sub- branches were formed on these trees, they were not well supported by high bootstrap values, and the branch lengths indicating genetic distances were not as significant as those in the P. dissotocum tree. The Pythium dissotocum tree suggested that there was genetic variation in one third of the P. dissotocum population collected in the 2017 survey, with high bootstrap values but short branch lengths (Figure 3.3.6).

Xuemei Zhang Chapter 3 91

Figure 3.3.4. Phylogenetic tree of Pythium coloratum and P. catenulatum isolates collected in the 2017 greenhouse survey.Bootstrap values under 50 were not shown on this tree. The branch lengths are drawn to scale to show 0.01 of substitutions per site (1% changes between two sequences). Branch lengths less than 0.001 are not shown on this tree.

Xuemei Zhang Chapter 3 92

Clade B

Figure 3.3.5. Phylogenetic tree of Pythium myriotylum isolates collected in the 2017 greenhouse survey. Bootstrap values under 50 were not shown on this tree. The branch lengths are drawn to scale to show 0.01 of substitutions per site (1% changes between two sequences). Branch lengths less than 0.001 are not shown on this tree.

Xuemei Zhang Chapter 3 93

Figure 3.3.6. Phylogenetic tree of Pythium dissotocum isolates collected in the 2017 greenhouse survey. Bootstrap values under 50 were shown on this tree. The branch lengths are drawn to scale to show 0.02 substitutions per site (2% changes between two sequences). Branch lengths less than 0.001 are not shown on this tree.

Xuemei Zhang Chapter 3 94

3.4 Discussion

3.4.1 Composition of the Isolate Collection

Among the isolates collected in the 2017 tobacco greenhouse survey, 85% were Pythium species. The rest of the isolates consisted of 6% other oomycetes, 6% Mortierella spp., and 3% other fungi. Other oomycete species including Saprolegnia species, Achlya species, and

Aphanomyces species were all recovered from the bay water. These “primitive” oomycete species are usually abundant in freshwater, and they are more likely to be saprophytic rather than pathogenic to plants (Thines, 2014, Cooke et al., 2000, Beakes et al., 2012). Little research has been conducted on the ecology of oomycete communities in tobacco float-bed transplant production greenhouses or other hydroponic crop production systems. Therefore, the roles and influence of Saprolegnia species, Achlya species, and Aphanomyces species in tobacco float greenhouses are unknown.

Mortierella species are a group of true fungi that resemble Pythium species in many aspects including growing fast and forming white colonies with flower-like patterns on agar medium plates. Like Pythium and other oomycetes, Mortierella species also produce coenocytic hyphae and produce sporangia resembling those produced by Pythium species, as well as sexual zygospores resembling oospores produced by Pythium species (Gams, 1977). Mortierella species are abundant in soil and often co-occur with Pythium species on oomycete-selective agar medium plates (PPEM, Vaartaja, 1968, Tsao & Guy, 1977, Gómez et al., 2019). In this study,

Mortierella species were mainly detected in tobacco seedlings (including asymptomatic and symptomatic seedlings), weedy plants and growth medium in trays cells with no seed germination. Mortierella is antagonistic to Rhizoctonia species (Maciejowska, 1962), and

Mortierella hyalina is capable of interacting with Arabidopsis roots and protecting them from

Xuemei Zhang Chapter 3 95 fungal infections (Johnson et al., 2019, Meents et al., 2019). However, little research information is available regarding the interaction/relationship between Mortierella and Pythium or the influence of Mortierella species on Pythium diseases. No correlation was detected between

Mortierella and Pythium population densities in soil samples from a survey of forest nursery seedbeds (Vaartaja, 1968). Since Mortierella species were common in tobacco seedlings, weedy plants, and growth medium in trays cells in tobacco transplant production greenhouses in our

2017 survey, future research on their possible roles and influence on Pythium-tobacco interactions might identify possible biocontrol strategies.

Pythium Species

Common Pythium species that have been associated with root problems in hydroponic greenhouses include P. aphanidermatum, P. dissotocum, P. ultimum, P. irregulare, P. myriotylum, etc. (Jenkins Jr & Averre, 1983, Goldberg, 1990, Romero et al., 2012, Liu et al.,

2007, Sutton et al., 2006, Anderson et al., 1997, Bates & Stanghellini, 1984, Gull et al., 2004,

Gutiérrez et al., 2012, Huo et al., 2020, Labuchagne et al., 2002, Labuschagne et al., 2002,

Labuschagne et al., 2003, Larsson, 1994, Miyake et al., 2014, Punja & Rodriguez, 2018,

Stanghellini et al., 1998, Stanghellini & Kronland, 1986). Previous float-bed tobacco greenhouse surveys showed that Pythium myriotylum, P. dissotocum, P. irregulare, P. volutum and P. spinosum were associated with root-rot of tobacco seedlings (Mufunda et al., 2017, Sigobodhla et al., 2010, Anderson et al., 1997, Garwe et al., 2014, Mufunda et al., 2016, Gutiérrez & Melton,

2001, Gutiérrez et al., 2012). The results of this present study shared some similarities with those previous tobacco root rot studies but revealed some other species whose occurrence in tobacco or other hydroponic crop production greenhouses has not been discovered or reported. Such differences could be due to the extensive sampling method used in this survey or to the

Xuemei Zhang Chapter 3 96 differences in geographic distribution among Pythium species.

The results of this survey suggested that the most common Pythium species in tobacco transplant greenhouses was P. dissotocum, followed by P. myriotylum, which were recovered from bay water, tobacco seedlings, and weedy plants in tobacco transplant production greenhouses (Table 3.3.2). The least common species were P. aristosporum, P. attrantheridium, and P. pectinolyticum, which were only found in weedy plants or bay water in surveyed tobacco greenhouses (Table 3.3.2). The ecological niches and/or host ranges of these Pythium species are very different, as shown in Table 3.4.1.

Pythium myriotylum, P. dissotocum and P. irregulare are very common in hydroponic crop production and have been found in tobacco seedlings collected in North Carolina and

Zimbabwe (Mufunda et al., 2017, Sigobodhla et al., 2010, Anderson et al., 1997, Garwe et al.,

2014, Mufunda et al., 2016, Gutiérrez & Melton, 2001, Gutiérrez et al., 2012). Pythium myriotylum is an aggressive pathogen on many hydroponically grown crops, including tobacco seedlings, often causing root discoloration or necrosis, root rot, stunting, leaf chlorosis, wilting and plant death (Mufunda et al., 2016, Hong et al., 2004, Pantelides et al., 2017, Stanghellini et al., 1998, Anderson et al., 1997, Sigobodhla et al., 2010, Blancard et al., 2012, Sutton et al.,

2006). Pythium myriotylum favors relatively high temperatures. Its cardinal temperatures range from 5 ºC to over 40 ºC, with the optimum temperature at 37 ºC (Van der Plaats-Niterink, 1981).

This can explain why we tended to collect more P. myriotylum from tobacco seedlings at middle- to-late tobacco seedling growth stages (from late March to May) in Virginia tobacco greenhouses, and it was first found in Georgia greenhouses in this study (Table 3.3.5-3.3.6). In addition to tobacco seedlings, P. myriotylum was also found in bay water and weedy plants

Xuemei Zhang Chapter 3 97

Table 3.4.1. Distribution and host ranges of Pythium species identified in the 2017 tobacco greenhouse survey. Pythium species Distribution Host range Substrate Diseases Occurrence in hydroponic greenhouses P. myriotylum Widespread, especially Multiple genera in multiple families Seeds; roots and Seed rot, crown rot, Tomato, lettuce, spinach, in warmer regions, also including legumes, nightshades, the hemp stems of plants or root rot, blight, stunts, tobacco seedling, hemp in temperate glasshouses family, the grass family, etc. seedlings and damping-off seedling, peppermint, etc. P. dissotocum Cosmopolitan Multiple genera in multiple families Roots; agricultural Root rot and wilting Lettuce, spinach, cilantro, including legumes, nightshades, the hemp run-off sediment floriculture crops, tobacco family, the grass family, etc. reservoirs seedling, hemp seedling, etc. P. irregulare Cosmopolitan Multiple genera in multiple families Roots; agricultural Seed rot, root rot, and Lettuce, spinach, cilantro, including legumes, nightshades (tobacco), run-off sediment damping-off floriculture crops, run-off the hemp family, the grass family, etc. reservoirs & water water, growth substrate etc. P. coloratum Worldwide Legumes, Umbellifers, night shades, etc. Seeds; roots; soil; Root rot and damping- Lettuce, run-off water and water tanks off growth medium (Gull et., 2004) P. aristosporum Widespread Legumes, sedges, the grass family, etc. Roots; soil Root dysfunction, Mentioned in (Gull et., Root browning and 2004), but no specific crop root rot species information P. torulosum Worldwide The mustard family, the grass family, the Roots; soil; water; Seedling blight. Root Mentioned in (McLeod et al., pine family, nightshades (tobacco), etc. mosses rot and damping-off 2009) P. catenulatum Cosmopolitan The mustard family, the daisy family, the Plant debris in root rot and blight Mentioned in (McLeod et al., hemp family, the grass family, water; water; soil 2009) nightshades, legumes, green algae, etc. P. inflatum Cosmopolitan Legumes, night shades, the flowering rush Roots; soil Root rot No reports family, the grass family, etc. P. attrantheridium North America (USA & The rose family, Umbellifers and legumes Roots and soil root rot and cavity spot No reports Canada) P. adhaerens Asia (Malaysia); North Legumes, cucurbits, nightshade, algae, and Roots and collar; Root rot, fruit rot and No reports America (USA) the grass family fruits damping-off P. porphyrae Asia (Japan, Korea, etc.) Seaweed and 8 crop species (in laboratory Roots Red rot and root rot No reports tests) P. pectinolyticum France No reports soil No reports No reports

The distribution and host range information mainly came from the USDA Fungal Database (Farr & Rossman).

Xuemei Zhang Chapter 3 98 within surveyed tobacco greenhouses in the present study (Table 3.3.2). Although there is no published information on the occurrence of P. myriotylum in nutrient solution or weedy plants in hydroponic greenhouses, P. myriotylum is capable of colonizing or infecting multiple grass species (Table 3.4.1, (Farr & Rossman).

Pythium dissotocum is a moderately virulent species on hydroponically grown crops, causing root rot that is sometimes accompanied by stunting, leaf chlorosis, wilting, and/or plant death (Stanghellini & Kronland, 1986, Bates & Stanghellini, 1984, Patekoski & Zottarelli, 2009,

Huo et al., 2020, Romero et al., 2012, Bates, 1983, Blancard et al., 2012, Gutiérrez et al., 2012).

Pythium dissotocum can grow at a temperature as low as 5 ºC and up to over 35 ºC, with the optimum temperature ranging from 20 to 25 ºC(Van der Plaats-Niterink, 1981). Its cardinal temperatures can explain why we tended to collect more P. dissotocum from tobacco seedlings at early-to-middle tobacco seedling growth stages (from late February to early April) and shaded places (like in bay water) in Virginia tobacco greenhouses. It is not surprising that P. dissotocum was found in weedy plants in multiple greenhouses in our survey since it is known to be able to colonize or infect multiple grass species (Table 3.4.1).

Pythium irregulare has a wide host range and often causes root rot, without severe damage, on various crops, including tobacco(Gutiérrez et al., 2012, Blancard et al., 2012,

Herrero et al., 2003, Sutton et al., 2006, Steinberg, 1950, Chellemi et al., 2000). Although it has previously been recovered from the roots of hydroponically-grown tobacco seedlings (Gutiérrez et al., 2012, Mufunda et al., 2017), P. irregulare was not found in the tobacco seedlings collected in this study. Its cardinal temperatures range from 1 to 35 ºC, with the optimum temperature at

30 ºC. In this study, P. irregulare was found in weedy plants within two independent tobacco greenhouses (greenhouse No. 3 and No. 39) and in bay water and the dirt-plant-debris mix on a

Xuemei Zhang Chapter 3 99 center walkway in Greenhouse No. 39 (Table 3.3.2). Pythium irregulare has been found in grasses and run-off water from hydroponic greenhouses, but not in soil, dirt or plant debris

(Table 3.4.1, (Farr & Rossman).

Pythium coloratum causes root rot and damping-off on a wide range of plants and has also been recovered from run-off water and growth medium in hydroponic greenhouses (Table

3.4.1). Although it was not found associated with tobacco seedlings before, P. coloratum was recovered from bay water and tobacco seedlings within multiple greenhouses in this survey

(Table 3.3.2). It is important to point out that P. dissotocum and P. coloratum belong to Pythium

Clade B2 cluster and are so closely related that their differences are often not well-detected by

ITS1/4 primers (Levesque & De Cock, 2004, Punja & Rodriguez, 2018, Robideau et al., 2011).

Pythium coloratum shares similar cardinal temperatures and morphological characteristics with

P. dissotocum, and it only differs from P. dissotocum by the occasional presence of diclinous antheridia and branched antheridial stalks (Van der Plaats-Niterink, 1981).

Pythium aristosporum is a low-virulence oomycete species that mainly colonizes grass hosts (Hodges & Coleman, 1985, Ichitani & Kinoshita, 1990, Nelson & Craft, 1991). On occasions, P. aristosporum causes root discoloration and root lesions, but often colonizes root tissues without causing any apparent symptoms, or it causes root dysfunction that becomes symptomatic only when infected hosts are under stress (Hodges & Coleman, 1985, Feng &

Dernoeden, 1999, Kerns & Tredway, 2008). The minimum growth temperature of P. aristosporum is 5 ºC, the maximum is 30 ºC and the optimum temperature is 25 ºC. In this study,

P. aristosporum was only recovered from a single weedy plant in one greenhouse (Table 3.3.2).

Pythium torulosum is also a low-virulence pathogen (Asano et al., 2010, Van der Plaats-

Niterink, 1981, Nelson & Craft, 1991) and mainly causes root rot, and/or rarely damping-off, on

Xuemei Zhang Chapter 3 100 members of the mustard family, the grass family, the pine family, nightshades (including tobacco), etc. (Table 3.4.1). Its cardinal temperatures range from 5 to 35 ºC, with the optimum temperature ranging from 25 to 30 ºC (Van der Plaats-Niterink, 1981). Although it is pathogenic to tobacco (Shang et al., 1999), P. torulosum was only found in bay water in one greenhouse in this study (Table 3.3.2). Pythium torulosum has also been recovered from water before (Table

3.4.1).

Pythium catenulatum causes root rot and blight on several plant families, including the grass family and nightshades, where tobacco belongs (Table 3.4.1). The virulence of P. catenulatum is often low to medium, sometimes colonizing hosts without causing apparent root diseases (Sánchez & Gallego, 2001, Chellemi et al., 2000, Roudsary et al., 2010). The cardinal temperature of P. catenulatum is relatively high, with the minimum at 10 ºC, the maximum at 40

ºC, and the optimum ranges from 30 to 35 ºC (Van der Plaats-Niterink, 1981). There is no evidence showing whether P. catenulatum is capable of colonizing tobacco seedlings, but it was found in bay water in two greenhouses, and tobacco seedlings from one greenhouse, in the 2017 survey (Table 3.3.2).

Pythium inflatum is a major concern in corn production, causing an important stalk rot

(Ruhuai et al., 1996, Cao et al., 2016, SONG et al., 2012). It affects some members in the grass family and nightshades (Table 3.4.1) but is not pathogenic to tobacco plants (Van der Plaats-

Niterink, 1981). The cardinal temperatures of P. catenulatum range from 5 to 37 ºC, with the optimum temperature at 30 ºC(Van der Plaats-Niterink, 1981). It has not been reported from hydroponic greenhouses previously, and in this study was only found in bay water in one greenhouse (Table 3.3.2).

Pythium attrantheridium is a soilborne pathogen that causes cavity spot on carrots

100

Xuemei Zhang Chapter 3 101

(Allain-Boulé et al., 2004a, Allain-Boulé et al., 2004b), and root rot on soybean seedlings

(Alejandro Rojas et al., 2017) and Queen Anne's lace (Jung et al., 2017). The cardinal temperatures of P. attrantheridium vary depending on mating types and their origin, but the minimum is 5 ºC or below, the maximum at 30 ºC, and the optimum temperature is 22 or 25 ºC

(Allain-Boulé et al., 2004b). It has not been reported before in hydroponic greenhouses (Table

3.4.1) but was found in a weedy plant within a single greenhouse in this study (Table 3.3.2).

Pythium adhaerens is pathogenic to algae and also causes root rot of corn and peas, as well as damping-off of sugar-beet seedlings (Van der Plaats-Niterink, 1981, Raftoyannis & Dick,

2006, Lodhi et al., 2004). Pythium adhaerens can live at temperatures as low as 5 ºC and thrives at 21 ºC (Sparrow, 1931). There are no reports on the occurrence of P. adhaerens in hydroponic greenhouses (Table 3.4.1), but it was found in bay water in three independent greenhouses in this study (Table 3.3.2). It is important to point out that Pythium adhaerens is a parasite on green algae (Sparrow, 1931), and green algae are very common in tobacco greenhouse bays in the 2017 survey. It was highly possible that the Pythium adhaerens isolates came from the green algae in bay water.

Pythium porphyrae was first found to be pathogenic to seaweeds such as Pyropia species and Chondrus species, causing red rot of seaweeds (Klochkova et al., 2017, Kawamura et al.,

2005, Dumilag, 2019, Van der Plaats-Niterink, 1981). Later, Klochkova et al. (2017) discovered that P. porphyrae grows better in low-salinity water than full seawater and is capable of infecting the seedlings of a variety of crops including carrots, Napa cabbage, radish, rice, cucumber, onion, and pumpkin. Pythium porphyrae caused root rot on those crop species and killed carrot,

Napa cabbage, radish, and rice seedlings completely. The minimum growth temperature of P. porphyrae is 15 ºC, the maximum is 35 ºC, and the optimum is 30 ºC (Van der Plaats-Niterink,

101

Xuemei Zhang Chapter 3 102

1981). Pythium porphyrae grows on non-saline medium, but not as well as in low-salinity medium (Van der Plaats-Niterink, 1981, Klochkova et al., 2017). It grows slowly on agar- the daily growth rate on seawater-cornmeal agar at 25 ºC is 5 mm (Van der Plaats-Niterink, 1981).

In this study, non-saline V8-PARP medium was used to isolate P. porphyrae from survey samples and six P. porphyrae isolates were obtained. Klochkova et al.’s study provided evidence to support their hypothesis that terrestrial run-off water could be a source of the P. porphyrae inoculum initiating red-rot disease in seaweed farms. Their research also suggested that P. porphyrae might have more hosts in addition to seaweed. Our survey results matched Klochkova et al.’s hypothesis: in this survey, P. porphyrae was recovered from bay water within two greenhouses and was recovered from tobacco seedlings in two additional greenhouses (Table

3.3.2).

Pythium pectinolyticum is a relatively new species that was first discovered in soil samples collected in the Burgundy region of France (Paul, 2001). There is no research information on its pathogenicity or host range. The cardinal temperatures of P. pectinolyticum have not been studied, but it is known that P. pectinolyticum produces sexual and asexual reproductive structures on hemp seeds at 18 - 25 ºC (Paul, 2001). In this study, only one isolate of P. pectinolyticum was collected from a bay water sample baited by tobacco seedlings in a greenhouse (Table 3.3.2).

3.4.2 Isolation Frequency of Pythium species from Seven Sites in Tobacco

Transplant Greenhouses

Although Pythium was never detected in samples from used trays, bay surface, or growth medium in tray cells in this study. we cannot conclude that these three sites could not be

102

Xuemei Zhang Chapter 3 103 potential Pythium sources in tobacco greenhouses, as the sample sizes from these environments were very small. Pythium species were recovered from four sites within tobacco transplant greenhouses: bay water, tobacco seedlings, weedy plants, and a center walkway. Approximately

80% of the surveyed tobacco greenhouses harbored at least one Pythium species in at least one environment, suggesting that Pythium species are very common in tobacco greenhouses. Our isolation frequency (IF) results suggest that the probability of detecting a Pythium species in tobacco transplant greenhouses should be highest from bay water samples, followed by tobacco seedlings, weeds, and center walkways.

Pythium myriotylum, P. irregulare, and/or P. dissotocum were found to be associated with root rot of tobacco seedlings in previous research in North Carolina and Zimbabwe.

Pythium irregulare was the most common species associated with root rot of tobacco seedlings in Gutiérrez et al. (2012) ’s tobacco seedling surveys, followed by P. dissotocum and P. myriotylum. Mufunda et al. (2017)’s tobacco seedling surveys collected 83 isolates of P. myriotylum and one isolate of P. irregulare from tobacco seedlings exhibiting root rot symptoms. All the above-mentioned Pythium species were found in this study, and many additional species were found, but we did not find P. irregulare from any tobacco seedlings. The fact that Gutiérrez et al. (2012) ’s and Mufunda et al. (2017)’s studies only focused on root rot seedlings collected from tobacco transplant greenhouses may help explain the differences in results among surveys for Pythium species in tobacco transplant production greenhouses. The asymptomatic tobacco seedlings collected in our survey appeared to be healthy with no apparent abnormality. It is possible that those healthy-appearing seedlings had been infected but were not yet showing symptoms at the time of sample collection. Or the asymptomatic plants could have been infected by one of the many Pythium species capable of causing infections without causing

103

Xuemei Zhang Chapter 3 104 symptoms, or only causing symptoms when the hosts are under stresses (Blancard et al., 2012,

Sutton et al., 2006, Hodges & Coleman, 1985, Feng & Dernoeden, 1999, Kerns & Tredway,

2008, Chellemi et al., 2000). The IF of Pythium species from tobacco seedlings was dependent on the seedling types. In this survey, there were a few cases where different types of seedlings were associated with the same species of Pythium in the same greenhouse. For example, both asymptomatic and stunted seedlings were associated with P. dissotocum in Greenhouse 3 and 17.

In five greenhouses, more than one Pythium species were recovered from the same or the same type of tobacco seedling samples within the greenhouse. For example, asymptomatic seedlings were associated with P. catenulatum, P. porphyrae, and P. myriotylum in Greenhouse 31. Five

Pythium species were recovered from tobacco seedling samples in this study: P. porphyrae, P. catenulatum, P. coloratum, P. dissotocum, and P. myriotylum. All five were recovered from asymptomatic seedlings, but only four from symptomatic plants. Pythium coloratum, P. dissotocum, and P. myriotylum were also associated with stunted tobacco seedlings. However, only Pythium dissotocum and P. myriotylum were recovered from seedlings with root rot.

Pythium porphyrae was found on stunted, root rot seedlings, together with P. dissotocum, in

Greenhouse #9.

Our survey also investigated the possible presence of Pythium spp. in tobacco float bed greenhouses beyond those that had already infected and damaged seedlings. The number of

Pythium isolates in our study was approximately three times the number of water samples because four different baits, as well as direct plating, were used to isolate Pythium from each bay water sample, generating multiple Pythium isolates from each sample. That is how we discovered that 19 (13.1%) bay water samples collected from 17 (47.2%) different greenhouses had more than one Pythium species in each individual sample. Different baits often captured

104

Xuemei Zhang Chapter 3 105 different Pythium species when there were multiple Pythium species coexisting in the water. Ten

Pythium species were recovered from bay water samples in this study: P. irregulare, P. pectinolyticum, P. torulosum, P. inflatum, P. adhaerens, P. porphyrae, P. catenulatum, P. coloratum, P. dissotocum, and P. myriotylum. Pythium dissotocum, followed by P. myriotylum, were the most common species in bay water, found in 20 (55.6%) greenhouses in this survey.

Pythium pectinolyticum, P. torulosum, and P. inflatum were rare in the bay water samples.

Directing plating of water samples were able to capture them except P. pectinolyticum, P. torulosum, and P. inflatum. Baiting was generally as efficient as direct plating, or even better in some cases, but direct plating captured species missed by baits in a few greenhouses (Table

3.3.3). Those results suggest that both baiting and direct plating were necessary in isolating

Pythium from water samples in this survey. Therefore, multiple types of plating methods should be used when isolating Pythium from the water in tobacco greenhouse “float bays” in order to avoid missing the full spectrum of species that might be present.

Pythium aristosporum, P. attrantheridium, P. irregulare, P. dissotocum, and P. myriotylum were also found in weedy plants in multiple surveyed greenhouses in this study, all associated with the grass family (Table 3.4.1). Unfortunately, the weedy plants collected in this survey were not identified. Only one greenhouse had Pythium in the mixtures of dirt and plant debris on the center walkway; that one isolate belongs to Pythium irregulare. According to

Gutiérrez et al. (2012) and Mufunda et al. (2017), P. irregulare is a common pathogen on tobacco seedlings in tobacco transplant production greenhouses in North Carolina and

Zimbabwe. These results suggested the soil-organic-debris could be a source of P. irregulare initial inoculum within tobacco transplant production greenhouses.

105

Xuemei Zhang Chapter 3 106

3.4.3 Diversity of Pythium Communities in Tobacco Transplant Greenhouses

The results of this study reflect a substantial diversity of Pythium species among tobacco greenhouses because the species of Pythium varied among surveyed tobacco greenhouses and also among the sampled sites within the greenhouses. Eighty percent of sampled greenhouses harbored Pythium species in at least one environment within the greenhouse, but 23.8% of sampled greenhouses and 57.6% of Pythium-infested greenhouses had Pythium species in two or more environments. Although the availability of Pythium sources (sampling sites/types) was different among the surveyed greenhouses, the population of Pythium species in different sites was different. The population of Pythium species residing in a certain site among greenhouses was also different. For instance, the species recovered from bay water and tobacco seedling were significantly different among the surveyed greenhouses.

In the survey, five greenhouses were visited multiple times, and the results showed that the Pythium community structures changed over time. One of the reasons for these differences was the differing availability of sample types over time. For example, tobacco seedling samples were not available at the beginning of the growing season, and the availability of weedy plants changed over time. Different Pythium species may also have different cardinal temperatures, and temperatures change significantly throughout the tobacco seedling production season, although growers attempt to maintain ambient air temperature at a level beneficial to the seedling growth.

Therefore, the differences in sampling results at different times may result from the temperature changes during the growing season. Additionally, as the seedlings grow bigger, they may be less susceptible to some Pythium species (Zitnick-Anderson, 2014, Blancard et al., 2012, Grabowsk,

2018, Hodges, 2003).

The Pythium species and groups on the oomycete phylogenetic tree were compared to

106

Xuemei Zhang Chapter 3 107 those in previously published Pythium taxonomy studies (Levesque & De Cock, 2004, Robideau et al., 2011). Pythium adhaerens and P. porphyrae were closely related, although clearly separated in different subclades on this tree, suggesting a species complex might have been formed (Dumilag, 2019). Pythium coloratum and P. dissotocum are also closely related, and the genetic difference between these two species are often not detectable in ITS1-5.8S-ITS2 regions

(Levesque & De Cock, 2004, Punja & Rodriguez, 2018, Robideau et al., 2011). It is also possible for them to form species complexes in a single environment (Mostowfizadeh-Ghalamfarsa &

Salmaninezhad, 2020).

Due to the influence of different Pythium community structures among tobacco transplant greenhouses, the genetics of Pythium populations in tobacco transplant greenhouses are complicated and interesting. Distinct Pythium species may form species complexes in natural environments (Mostowfizadeh-Ghalamfarsa & Salmaninezhad, 2020, Eggertson, 2012, McLeod et al., 2009, Hendrix & Campbell, 1970, Garzón et al., 2007). The survey results revealed the coexistence of multiple Pythium species in a single environment in multiple independent greenhouses in this survey. It is likely for closely related and closely interacting species to form species complexes in tobacco greenhouses, such as the possible P. adhaerens-P. porphyrae complex indicated in the oomycete phylogenetic tree (Figure 3.3.3).

Although no significant intraspecific variation was detected in Pythium species other than the P. dissotocum populations in this study, P. catenulatum isolates tended to group by greenhouses on the phylogenetic tree. Such a disease progress was not found in the P. dissotocum or P. myriotylum trees. The genetic variation of Pythium populations did not seem to be influenced by the sampling environment, sample type, or substrates.

The results of this study identified four potential sources (sites) of Pythium species within

107

Xuemei Zhang Chapter 3 108 tobacco transplant greenhouses: bay water, tobacco seedlings, weedy plants, and walkways.

Some of the surveyed greenhouses had diverse Pythium populations within the greenhouse. For instance, among the 19 greenhouses that harbored Pythium species in two or more environments,

13 of them had different Pythium species composition in different environments. In eight greenhouses, P. porphyrae, P. catenulatum, P. coloratum, P. dissotocum, and P. myriotylum recovered from tobacco seedlings were also found in bay water within that greenhouse, but there were additional species (P. coloratum, P. dissotocum, P. adhaerens, P. porphyrae, P. myriotylum, and P. irregulare) in bay water that were not found in any other environments in that greenhouse. In four greenhouses, the species (P. myriotylum, P. porphyrae, or P. coloratum) recovered from tobacco seedlings were different with those (P. dissotocum) recovered from bay water within that same greenhouse. In Greenhouse #31, the bay water and tobacco seedling samples shared P. myriotylum and P. catenulatum, but P. porphyrae was only found in seedling samples. Perhaps recovering P. porphyrae from water is more difficult, or P. porphyrae may be less competitive than P. myriotylum and P. catenulatum in water. There were 19 (13.1%) cases where multiple Pythium species coexisted in bay water (Table 3.3.3) and there were four (1.8%) cases where multiple Pythium species were found from the same type of tobacco seedlings in a greenhouse (Table 3.3.4). In this survey, it was also found that Pythium species composition or community structure in float-bed greenhouses changed over time during the tobacco seedling production season.

The results of this study provide new information for us to better understand the distribution of Pythium species in tobacco float-bed hydroponic transplant greenhouses. Previous studies revealed that the primary sources of Pythium pathogens in float-bed tobacco greenhouses include contaminated growth substrate/media, contaminated water sources and/or improper

108

Xuemei Zhang Chapter 3 109 sanitized trays/tools/equipment used in greenhouses (Thiessen et al., 2020, Cartwright et al.,

1995, Anderson et al., 1997, Pfeufer & Hinton, 2017, Gutiérrez & Melton, 2001, Gutiérrez et al.,

2012). It was found in this study that weedy plants, and soil-plant-debris mixes were common in tobacco transplant greenhouses, and some of these sample types were associated with Pythium species. These results suggested that they can be potential sources of Pythium in tobacco greenhouses. During the survey, there were a few cases where the weedy plants were blown from a side of greenhouse into the bays or tobacco seedlings, weedy plants were removed from the ground and discarded into bay water, or tobacco seedlings grew together with weedy plants in tray cells. Such things could help Pythium spread within a tobacco greenhouse. Therefore, we should consider how these factors may influence Pythium disease management programs.

3.5 Conclusions

Summaries

Pythium species were very common (80%) in surveyed tobacco greenhouses, even in those greenhouses where Pythium symptoms were not noticed, suggesting that root symptoms may not be a reliable indicator of Pythium presence in a tobacco greenhouse. Pythium species were most common and abundant in bay water, followed by tobacco seedlings, weeds, and walkways. Combining direct plating and baiting was necessary to capture the full picture of the

Pythium community in float bay water. Four types of tobacco seedling were also sampled: asymptomatic, stunted without root rot, root rot but no stunted, and both stunted exhibiting root rot. All four types of seedling were associated with Pythium species, although the isolation frequency of Pythium differed among these sample types or symptom categories. The results of this study identified 12 described Pythium species, and 4 potential sources of Pythium in tobacco

109

Xuemei Zhang Chapter 3 110 greenhouses, including bay water, tobacco seedlings, weedy plants, and soil-tobacco-debris mixes on walkways. Pythium irregulare, P. pectinolyticum, P. torulosum, P. inflatum, P. adhaerens, P. porphyrae, P. catenulatum, P. coloratum, P. dissotocum, and P. myriotylum were associated with bay water, P. porphyrae, P. catenulatum, P. coloratum, P. dissotocum, and P. myriotylum were detected in tobacco seedlings, P. aristosporum, P. attrantheridium, P. irregulare, P. dissotocum, and P. myriotylum were associated with weeds both inside or outside the bays, and P. irregulare was also isolated from dirt-tobacco-debris mixes on a walkway.

Pythium communities in the surveyed greenhouses were diverse in distribution, structural composition, and genetics. This diversity may be associated with the availability of potential sources in tobacco greenhouses and sampling time. Intraspecific genetic variation was identified within P. dissotocum populations and a possible P. adhaerens-P. porphyrae complex was also detected. The outcome of this study revealed new information on the composition, distribution, and diversity of Pythium communities that may impact Pythium disease management in float greenhouse tobacco transplant production.

Future research directions

The specific pathogenicity of all the Pythium species found in this survey to tobacco is not fully known. Even the species recovered from symptomatic tobacco seedlings could simply be saprophytes. It is important to conduct further research to test the pathogenicity and virulence of the collected Pythium species. Further additional experiments should explore options in the management of aggressive Pythium species in tobacco transplant production greenhouses.

Multiple Pythium species were isolated from the same environments or from the same host symptom categories from the same individual samples collected from individual tobacco greenhouses. How different Pythium species interact with each other, and how such interactions

110

Xuemei Zhang Chapter 3 111 may influence tobacco seedlings, are unclear. Further investigations of the ecological relationships within the Pythium communities in tobacco transplant greenhouses and their implications could be important in improving integrated disease management in tobacco transplant production greenhouses.

111

Xuemei Zhang Chapter 4 112

Chapter 4

Pathogenicity and Virulence of Pythium Species Recovered from Tobacco Transplant Greenhouses

Abstract

Pythium disease is a common problem in tobacco transplant production. The disease symptoms often vary among greenhouses, which may include pre-emergence damping-off, root discoloration, root rot, stunting, leaf chlorosis, and/or seedling death. In a recent survey of 41 tobacco transplant greenhouses, 360 Pythium isolates were collected and identified to 12 described Pythium species, including P. adhaerens, P. aristosporum, P. attrantheridium, P. catenulatum, P. coloratum, P. dissotocum, P. inflatum, P. irregulare, P. myriotylum, P. pectinolyticum, P. porphyrae and P. torulosum. Laboratory and greenhouse pathogenicity test results indicated that the collected Pythium species fell into three categories. Strong pathogens suppressed seed germination and caused root rot, stunting, foliar chlorosis, and death of tobacco seedlings. Weak pathogens were able to cause root symptoms without affecting the upper part of tobacco seedlings. Nonpathogens exhibited no apparent effects on tobacco seeds or seedlings.

The strong pathogens (P. coloratum, P. dissotocum, and P. myriotylum) were collected from tobacco seedlings, bay water, and weeds, and the nonpathogens (P. adhaerens, P. attrantheridium, and P. pectinolyticum) were found only in weeds or bay water samples. P. myriotylum was the most aggressive species. A high level of intraspecific variation in virulence was observed within P. dissotocum isolates, the most common species found in the survey. The results of this study also provided strong evidence to demonstrate that pathogen (Pythium)

112

Xuemei Zhang Chapter 4 113 species, host (tobacco) growth stages, and environmental conditions are three important factors that can cause symptom variability of Pythium diseases among tobacco greenhouses, and the symptom variability was under the influence of the complicated interactions among these three factors.

Key terms: Pythium, pathogenicity, virulence, diversity, growth stages, tobacco, hydroponic greenhouses

4.1 Introduction

Pythium disease is a common problem in tobacco transplant production, which can cause as much as 70% seedling loss in tobacco transplant greenhouses (Sigobodhla et al., 2010,

Sigobodhla & Dimbi, 2014). Tobacco transplant greenhouses are “float-bed” hydroponic systems, in which tobacco seeds are sown in plastic or expanded polystyrene (EPS) trays filled with soilless growth media and floated on nutrient solution contained within plastic-lined “bays”

(Reed et al., 2019, Pearce et al., 2019, Reed, 2009). These float-bed systems are naturally conducive to Pythium species to disseminate via swimming asexual zoospores and long-living sexual spores (Thines, 2014, Beakes et al., 2012). Therefore, Pythium diseases have been widespread and sometimes persistent in tobacco transplant production greenhouses since this hydroponic system was adapted to produce tobacco transplants (Pfeufer & Hinton, 2017,

Gutiérrez & Melton, 2001, Gutiérrez et al., 2012, Anderson et al., 1997, Sutton et al., 2006,

Blancard et al., 2012). The symptoms of Pythium diseases often vary among greenhouses, which may include pre-emergence damping-off, root discoloration, root rot, stunting, leaf chlorosis, and/or seedling death (Sigobodhla et al., 2010, Pfeufer & Hinton, 2017, Mufunda et al., 2016,

Mufunda et al., 2017, Gutiérrez & Melton, 2001, Gutiérrez et al., 2012, Fortnum et al., 2000,

Anderson et al., 1997).. Currently, there are no Pythium-resistant tobacco cultivars (Sigobodhla

113

Xuemei Zhang Chapter 4 114 et al., 2010), and management of Pythium diseases in float-bed tobacco greenhouses mainly relies on sanitation and application of a limited number of pesticide product options (Gutiérrez et al., 2012, Gutiérrez & Melton, 2001, Pfeufer & Hinton, 2017, Sigobodhla et al., 2006, Pearce et al., 2019, Reed et al., 2019).

In order to investigate the symptom variability of Pythium diseases among tobacco transplant production greenhouses, a comprehensive research study on the composition and diversity of Pythium communities in tobacco transplant greenhouses was conducted in 2017

(Chapter 3). Forty-one tobacco transplant production greenhouses in Virginia and nearby states were surveyed, from which 360 Pythium isolates were collected from bay water, asymptomatic tobacco seedlings, tobacco seedlings showing typical Pythium disease symptoms (stunted tobacco seedlings, root rot tobacco seedlings, or stunted and root rot tobacco seedlings), weedy plants and plant-debris-soil mixes on a center walkway within the surveyed tobacco greenhouses.

Twelve described Pythium species including P. adhaerens, P. aristosporum, P. attrantheridium,

P. catenulatum, P. coloratum, P. dissotocum, P. inflatum, P. irregulare, P. myriotylum, P. pectinolyticum, P. porphyrae and P. torulosum were found in this Pythium isolate collection.

Although P. porphyrae, P. coloratum, P. dissotocum and P. myriotylum were associated with symptomatic tobacco seedlings in the 2017 survey, it was not clear whether those Pythium species were the causal agents of Pythium diseases on those seedlings, and it was unclear if those

Pythium species were able to colonize or infect tobacco seeds or seedlings. A large number of P. dissotocum (240) and P. myriotylum (61) isolates were collected in the 2017 tobacco survey, and the results of phylogenetic analysis suggested there might be genetic variation within P. dissotocum. However, it was not clear if the intraspecific variation also existed within P. dissotocum or P. myriotylum in terms of the virulence on tobacco seeds and seedlings.

114

Xuemei Zhang Chapter 4 115

The objective of this study was to test the pathogenicity of selected isolates from the twelve

Pythium species collected in the tobacco greenhouse survey. Tobacco seeds and seedlings were used under laboratory and greenhouse conditions in order to compare the virulence of the twelve

Pythium species, to investigate intraspecific virulence variation within P. dissotocum and P. myriotylum populations, as well as to investigate the influence of seedling age (host phenology) on Pythium infection and symptom causation.

4.2 Materials and Methods

4.2.1 Pythium Inoculum Preparation

All the isolates evaluated in this study were collected from a recent tobacco greenhouse survey (Chapter 3). Sixteen isolates of P. myriotylum and 50 isolates of P. dissotocum recovered from different sample sources and greenhouses were randomly selected and used to compare the vegetative growth rate and virulence within P. myriotylum and P. dissotocum in this study. A randomly selected isolate from each species of P. adhaerens, P. aristosporum, P. attrantheridium, P. catenulatum, P. coloratum, P. inflatum, P. irregulare, P. pectinolyticum, P. porphyrae, and P. torulosum collected in the greenhouse survey, as well as a representative P. myriotylum and two representative isolates of P. dissotocum based on the results of initial virulence comparison tests, were used in this study for pathogenicity and virulence tests on tobacco TN 90LC seeds and seedlings.

Pythium inoculum used in Petri dish laboratory pathogenicity tests were agar plugs cut using a 7.5 mm diameter cork borer from active 10-day-old cultures of Pythium species on 10%

V8 medium (Taylor et al., 2002). In order to prepare Pythium inoculum for greenhouse pathogenicity tests, active 10-day-old cultures of Pythium species on 10% V8 medium were

115

Xuemei Zhang Chapter 4 116 blended with sterile distilled water to prepare an agar puree inoculum. The mycelial growth and sporulation on the cultures were observed with a compound microscope (Motic AE2000, Hong

Kong) to confirm the purity and maturity status (sporulation) of each isolate. Ten plates (100 mm x 15 mm) of mature cultures of each Pythium species were then blended with 1,100 ml of sterile distilled water in a blender (Waring laboratory blender, CT) to make 1,100 ml of puree-like ground inoculum. The inoculum was stirred before and during the inoculation process to ensure the even distribution of the inoculum.

4.2.2 Vegetative Growth Comparisons within Pythium myriotylum and

Pythium dissotocum on V8 Growth Medium

Each of the 16 isolates of P. myriotylum and 50 isolates of P. dissotocum was transferred to four 100 mm x 15 mm plates of 10% V8 agar medium, by cutting hyphal tips from the original, active 10-day-old cultures using a 7.5 mm diameter cork borer, and placing the agar plugs on new 10% V8 agar plates. Cultures were then laid down without stacking and stored at

27 ºC. The radius of mycelial growth (with the radius of the agar plug deducted) was measured in centimeters at 24 and 48 hours after culture transfer; four measurements were taken from each plate. Clean 10% V8 agar plugs were transferred to four 100 mm x 15 mm plates of 10% V8 agar medium to serve as the blank control. The experiment was arranged in a Randomized Complete

Block Design (RCBD) with four replications, and the entire experiment was conducted twice under the same experimental conditions.

4.2.3 Laboratory Pathogenicity Tests and Virulence Comparison

In laboratory pathogenicity tests, pelleted tobacco seeds and seedlings in Petri dishes

116

Xuemei Zhang Chapter 4 117 were inoculated with Pythium species (Figure 4.2.1). A layout template (Figure 4.2.1) was drawn on a piece of 100-mm-diameter filter paper (Whatman®) 10 days before the inoculation experiment, by marking-out a 7.5 mm diameter circle in the center (the inoculum zone), a 37.5 mm diameter circle (the inner layer), and a 67.5 mm diameter circle (the outer layer). Eight evenly distributed positions were marked along the two outer circles. On the same day, pelleted tobacco seeds (Workman Tobacco Seed Inc., KY) were placed at the marked positions in Petri dishes (Fisherbrand, 100 mm x 15 mm) filled with 10 ml of sterilized distilled water (SDW).

Seeded Petri plates were kept at 22 ºC with 10-hour artificial light for 10 days prior to inoculation.

Figure 4.2.1. Demonstration of the tobacco seed or seedling layout used in laboratory pathogenicity tests. A layout template with tobacco seed or seedling position marks (left), and an example of an experimental unit in laboratory pathogenicity tests (right).

A sterile Petri dish (Fisherbrand, 100 mm x 15 mm) was placed upside down at inoculation, and a piece of 10-mm-diameter filter paper was placed at the bottom of the Petri dish lid. The filter paper was moistened using 2.5 ml of sterile distilled water (SDW). The layout template was then placed beneath the Petri dish, and 16 pelleted tobacco seeds or 10-day-old tobacco seedlings were placed at the 16 marked positions along the inner and outer circles.

Finally, an agar plug of Pythium inoculum was placed in the center of each Petri dish (the

117

Xuemei Zhang Chapter 4 118 inoculum zone). The inoculated Petri dishes were then sealed with a piece of Parafilm wrap and stored at a temperature beneficial for the growth of most Pythium species and seed germination, or seedling growth (Table 4.2.1).

Table 4.2.1. The cardinal temperatures of the Pythium species evaluated in the laboratory pathogenicity tests (Van der Plaats-Niterink, 1981, Sparrow, 1931, Paul, 2001) Cardinal temperatures (ºC) Pythium species Minimum Optimum Maximum P. myriotylum 5 37 >40 P. dissotocum 5 20-25 >35 P. coloratum 5 30 35 P. irregulare 1 30 35 P. aristosporum 5 25 30 P. torulosum 5 25-30 35 P. catenulatum 10 30-35 40 P. inflatum 5 30 37 P. attrantheridium <5 22-25 30 P. porphyrae 15 30 35 P. pectinolyticum - 18-25 - P. adhaerens 5 21 -

Inoculated Petri dishes were stored at 22 ºC with 10-hour light and 70% relative humidity

(RH) in seed inoculation experiments, while inoculated Petri dishes were stored at 27 ºC in seedling inoculation experiments. All the laboratory pathogenicity tests were repeated under the same experimental conditions.

Data Collection

Data were collected seven and 10 days after inoculation (DAI) in laboratory pathogenicity tests. Seedling stand was recorded and transformed into percentage data (percent seedling stand) in seed inoculation experiments. Percent seedling stand at 10 DAI was considered as percent seed germination. Disease incidence and severity were evaluated in seedling inoculation experiments. Disease incidence was defined as the percentage of seedlings exhibiting root rot (root discoloration and root decay). Root rot severity was evaluated using a 0-

118

Xuemei Zhang Chapter 4 119

5 scale, where 0 indicated healthy with no apparent symptoms, 1 indicated less than 25% radicle

(root) discoloration with no radicle decay or other symptoms, 2 indicated 25-50 % radicle discoloration with less than 25% radicle decay but no other symptoms, 3 indicated more than 50

% radicle discoloration with 25 - 50% radicle decay but no other symptoms, 4 indicated more than 50% radicle discoloration and more than 50% radicle decay, along with damping-off

(virtually complete turgor loss) with cotyledon (leaf) chlorosis, and 5 indicated completely seedling death. Then the root rot disease severity index (DSI) was calculated using the formula

(where NRi indicates number of seedlings showing the corresponding disease level i; i ranges from 0 to 5):

(0 × N ) + (1 × N ) + (2 × N ) + (3 × N ) + (4 × N ) + (5 × N ) DSI (%) = R0 R1 R2 R3 R4 R5 × 100% 5 × Ntotal

After the final data collection at 10 DAI, five randomly selected seeds or seedlings from each Petri dish were observed with a dissecting microscope (OLYMPUS SZ-PT) and compound microscope (Motic AE2000, or Leica DME), in order to count the number of oospores (the sexual spores) per 2-mm-radicle (seedling roots) in the seedling inoculation experiments. At the end of the inoculation experiments, four random seeds or seedlings were also sampled from each

Petri dish for Pythium isolation: they were surface-sterilized with 10% bleach for 5-10s, depending on the tissue softness, triple-rinsed three times with SDW, and then cultured on V8-

PARP agar medium. Cultures were stored at 27 ºC for a week, during which culture growth was monitored at 24-hour intervals. Any fungal-like microbes produced on cultures were observed using a compound microscope for morphological identification.

4.2.4 Greenhouse Pathogenicity Tests

Pythium species that colonized tobacco seeds or seedlings in laboratory pathogenicity

119

Xuemei Zhang Chapter 4 120 tests were further tested in greenhouse pathogenicity tests. These trials were performed in a

“mini-bay” experimental setting, in which clear 2-gallon (Sterilite) plastic storage containers were wrapped with Gorilla-brand duct tape to minimize sunlight exposure and filled with 1 gallon of water to be used as mini float-beds or bays (Figure 4.2.2). Mini-bays were filled with municipal water and left to sit in the greenhouse for 3 days to let chlorine dissipate before seeding.

5x5 mini tray

2-gal mini bay filled with 1 gal of water

Figure 4.2.2. Demonstration of a mini-bay float water system: A 25-cell mini tray floating in a mini-bay filled with 1 gallon of water.

A 5X5 square section from an EPS greenhouse tray that had been filled with growth medium (Carolina Choice) was then floated in each mini-bay. A TN 90LC tobacco seed

(Workman Tobacco Seed Inc.) had been placed in each cell. Each such experiment was arranged in a randomized complete block design (RCBD) with 4 replications. Mini-bays were randomly arranged on four Redi-Heat heating mats (Model: RHD2110, Phytotronics Inc.) with the temperature set at 27 ºC. Inoculum treatments (Table 4.2.2) were randomly assigned to each of the mini-bays.

120

Xuemei Zhang Chapter 4 121

Table 4.2.2. Pythium inoculation treatments in mini-bay greenhouse pathogenicity tests. Inoculation time Inoculum speciesz At seeding 10 days after seeding (DAS) 4 weeks after seeding (WAS)

06/04/2019-08/28/2019 06/18/2019-09/06/2019 01/27/2020-03/23/2020 (Trial 1) (Trial 3) (Trial 5) Uninoculated Control 10/07/2019-12/19/2019 10/14/2019-12/19/2019 01/30/2020-03/24/2020 (Trial 2) (Trial 4) (Trial 6) Pythium inflatum Trial 1 & 2 -y - Pythium porphyrae Trial 1 & 2 Trial 3 & 4 Trial 5 & 6 Pythium aristosporum Trial 1 & 2 Trial 3 & 4 Trial 5 & 6 Pythium catenulatum - Trial 3 & 4 Trial 5 & 6

Pythium torulosum Trial 1 & 2 Trial 3 & 4 Trial 5 & 6

Pythium dissotocum Trial 1 & 2 - - Pythium irregulare Trial 1 & 2 Trial 3 & 4 Trial 5 & 6 Pythium coloratum Trial 1 & 2 Trial 3 & 4 Trial 5 & 6 Pythium dissotocum-1 Trial 1 & 2 Trial 3 & 4 Trial 5 & 6 Pythium myriotylum Trial 1 & 2 Trial 3 & 4 Trial 5 & 6 z Only Pythium species that colonized tobacco seeds in laboratory pathogenicity tests were tested in the greenhouse pathogenicity trials with water inoculation at seeding, and only the species that colonized tobacco seedlings in the laboratory tests were tested in greenhouse trials with water inoculation at 10 DAS and 4 WAS. y “-” indicates the species was not tested in the corresponding trials.

Separate experiments then compared the effects of inoculating bay water among the 12 selected Pythium species at one of three seedling ages or phenological stages: inoculation at seeding, seedling emergence (approximately 10 days after seeding), or when the seedling roots extended from the tray bottoms into bay water (the emergence of water roots), approximately 4 weeks after seeding. Each bay was inoculated with 100 ml of agar puree inoculum. All of the mini-bays were fertilized with 2.5 g of fertilizer (16-5-16) three weeks after trays were seeded and floated in them. Seedling leaves were clipped weekly once seedling height reached 7.6 cm above the trays. Bays were refilled with municipal water every week to maintain a constant water volume. All the greenhouse pathogenicity tests were repeated once under the same greenhouse conditions.

121

Xuemei Zhang Chapter 4 122

Date Collection

Data were collected every week after seeding or inoculation in all greenhouse trials. The number of tobacco seedlings in each tray in each mini-bay was counted, and the seedling stand was used to calculate percent seed germination, leaf chlorosis, and mortality incidence. Incidence data were defined as the percentage of plants showing corresponding symptoms in the entire sampling population in each tray. Specifically, leaf chlorosis incidence was defined as the percentage of seedlings showing leaf yellowing or bleaching in the total tobacco seedling population in a tray. Mortality incidence was defined as the percentage of dead seedling in the total tobacco seedling population in a tray. Root rot referred to the percent of seedlings exhibiting visible root discoloration and decay of the roots extending from tray bottoms into the float water or nutrient solution relative to the total tobacco seedling population in a tray. Root rot incidence and root rot severity (the average percentage of the water roots on an individual seedling showing discoloration and decaying) were evaluated weekly after inoculation. Vigor data were rated by comparing the size of a seedling root system or seedling to the size of the biggest root system or tobacco seedling in a block. Root vigor indicates the size of the root system. Seedling vigor reflects the size of the above-tray parts (stems and leaves) of the seedlings. Therefore, poor seedling vigor indicates the plant growth is stunted.

The final assessment of the greenhouse trial was conducted approximately 9 weeks after inoculation (WAI). Five seedlings were randomly collected from each bay at each of these final assessments in order to measure root length and fresh root weight in order to assess root rot incidence and severity, and to count the number of oospores in root tissues. The disease severity assessment method was adapted from previous Pythium studies (Rafin & Tirilly, 1995,

Kageyama et al., 2002, Fortnum et al., 2000). A 0-5 scale was used to indicate the severity of

122

Xuemei Zhang Chapter 4 123 root rot, where 0 indicates healthy, 1 indicates 1-5% roots on a plant were affected, 2 indicates 6-

25% roots were affected, 3 indicates 26-50% roots were affected, 4 indicates 51-75% were affected, and 5 indicates more than 75% of roots were affected. Then the root rot disease severity index (DSI) was calculated as described earlier in Section 4.2.3.

Four pieces of 2 mm-long root tissues were randomly collected from each of the five seedlings collected from each mini-bay and were mounted on slides, stained using 0.05% aniline blue, and then observed with a compound microscope. The number of oospores in each 2 mm- root tissue was counted and recorded.

4.2.5 Data Analysis

The final assessment data were analyzed using JMP 10 pro and R 3.6.1 with ANOVA-

Fisher’s LSD (for parametric data) or Wilcoxon each pair comparison (nonparametric data), and the significance (alpha) level was set at 0.05. All the data collected multiple times during the trials were analyzed using repeated measures ANOVA followed by Fisher’s LSD post hoc analysis with a significance (α) level of 0.05. Linear associations between factors were analyzed using multivariate correlation in JMP 10 pro. The area under the disease progress curves

(AUDPC) were calculated based on root rot severity index data for water roots using the

Agricolae package for R, with the trapezoidal method (Sparks et al., 2008). AUDPC was

푦 +푦 determined by 퐴푈퐷푃퐶 = ∑푛−1[( 푖 푖+1) (푡 − 푡 )], where n is the number of readings, y is 푖 2 푖+1 푖 the measure of disease level, and t is the time interval between each reading (Simko & Piepho,

2012, Sparks et al., 2008). AUDPC data were also analyzed with ANOVA followed by Fisher’s

LSD post hoc analysis with a significance (α) level of 0.05. All the data that were transformed

(Arcsine/Log) before being used in statistical models to meet the analysis assumptions, were

123

Xuemei Zhang Chapter 4 124 back-transformed later in the reported results. 4.3 Results

4.3.1 Intraspecific Variation in Vegetative Growth Rates among Pythium

myriotylum and Pythium dissotocum Isolates

No mycelial growth was observed in the blank control (clean media) group. Mycelial growth measurements of Pythium myriotylum isolates ranged from 1.4 to 1.5 cm after 24 hours and from 2.6 to 2.7 cm after 48 hours (Table 4.3.1). No significant differences were observed among P. myriotylum isolates in mycelial growth measurements at 48 hours in either experiment.

The mycelial growth measurements of most P. myriotylum isolates at 24 hours were not significantly different, except that P. myriotylum isolate C12 grew significantly (P<0.02) faster

Table 4.3.1. Mycelial growth measurements of Pythium myriotylum isolates on 10% V8 medium. Radius of mycelial growth (cm) Pythium myriotylum 24 hours 48 hours isolates Experiment 1 Experiment 2 Experiment 1 Experiment 2 D02 1.4 a 1.4 a 2.6 2.7 C11 1.5 ab 1.4 ab 2.6 2.6 G06 1.5 ab 1.4 ab 2.7 2.7 A20 1.5 ab 1.4 ab 2.7 2.6 A89 1.5 ab 1.4 ab 2.6 2.7 D03 1.5 ab 1.5 ab 2.6 2.6 D04 1.5 ab 1.5 ab 2.7 2.6 E40 1.5 ab 1.5 ab 2.7 2.7 E54 1.5 ab 1.5 ab 2.7 2.6 F73 1.5 ab 1.5 ab 2.6 2.6 A90 1.5 ab 1.5 b 2.6 2.6 A91 1.5 ab 1.5 b 2.7 2.7 F96 1.5 ab 1.5 b 2.6 2.6 C13 1.5 ab 1.5 b 2.6 2.6 E53 1.5 ab 1.5 b 2.6 2.7 C12 1.5 b 1.5 b 2.7 2.7 data were mean values of four replicate plates. Data followed by the same letters were not significantly different in Fisher’s LSD tests, α=0.05. No statistical differences were detected among means in columns where means are not followed by letters.

124

Xuemei Zhang Chapter 4 125 than P. myriotylum isolate D02 in Experiment 1, and P. myriotylum isolate A90, A91, F96, C13,

E53 & C12 grew significantly (P<0.01) faster than P. myriotylum isolate C11 in Experiment 2. It is important to point out that the numeric mean of mycelial growth rates for all isolates was very close in both experiments (Table 4.3.1).

Table 4.3.2. Mycelial growth measurements of Pythium dissotocum isolates on 10% V8 medium. Radius of mycelial growth (cm) Pythium dissotocum 24 hours 48 hours isolates Experiment 1 Experiment 2 Experiment 1 Experiment 2 E72 0.1 s 0.1 l 0.3 n 0.3 m E73 0.2 r 0.2 k 0.3 n 0.3 m C53 0.6 q 0.6 j 1.6 m 1.6 k D14 0.7 p 0.7 i 1.6 m 1.6 k F29 0.8 op 0.8 h 2.2 l 2.2 j D50 0.8 no 0.8 h 2.5 k 2.5 i F12 0.9 mn 0.9 g 2.6 j 2.6 h E75 0.9 lm 0.9 g 2.5 k 2.6 h B57 1.0 kl 0.9 g 2.6 j 2.6 h B66 1.0 k 1.0 f 1.3 n 1.3 l B05 1.0 k 1.0 f 2.7 i 2.6 h B90 1.1 j 1.0 f 2.5 k 2.5 i D58 1.1 ij 1.1 e 2.5 k 2.5 i B75 1.1 ij 1.1 e 2.7 i 2.7 g C88 1.1 ij 1.1 e 2.8 fg 2.8 f D96 1.1 hi 1.2 d 2.6 jk 2.6 h F68 1.1 hi 1.1 e 2.2 l 2.3 j C78 1.1 hi 1.1 e 2.7 hi 2.7 g E01 1.2 ghi 1.2 c 2.8 fg 2.8 f F28 1.2 ghi 1.2 c 2.8 fg 2.8 f B74 1.2 ghi 1.1 e 3.0 ab 3.0 a E24 1.2 ghi 1.2 c 2.5 k 2.5 i F64 1.2 fgh 1.2 c 2.2 l 2.3 j D97 1.2 efg 1.2 c 3.0 abc 3.0 ab B14 1.2 efg 1.2 c 2.9 de 2.8 f B55 1.2 efg 1.2 c 3.0 ab 3.0 a F35 1.2 efg 1.2 c 3.0 abc 3.0 ab D95 1.2 efg 1.2 c 2.8 fg 2.8 ef E19 1.2 efg 1.2 c 2.7 i 2.7 g To be continued on the next page

125

Xuemei Zhang Chapter 4 126

Table 4.3.2. Mycelial growth measurements of Pythium dissotocum isolates on 10% V8 medium (continued). Radius of mycelial growth (cm) Pythium dissotocum isolates 24 hours 48 hours Experiment 1 Experiment 2 Experiment 1 Experiment 2 E14 1.2 efg 1.2 c 2.9 de 2.9 cd D63 1.2 efg 1.2 c 2.9 cd 2.9 de D56 1.2 efg 1.2 c 2.9 cd 2.9 bcd D92 1.2 efg 1.2 c 2.9 de 2.9 cd B13 1.2 def 1.2 c 2.8 fg 2.8 f D67 1.3 cde 1.2 c 2.9 de 2.9 cd D51 1.3 cde 1.2 c 3.0 bcd 3.0 abc E15 1.3 cde 1.2 c 2.8 fg 2.8 f D24 1.3 cde 1.2 c 2.9 ef 2.8 f E23 1.3 cde 1.2 c 2.7 hi 2.7 g B63 1.3 bcd 1.3 b 2.6 j 2.6 h F21 1.3 bcd 1.3 b 2.7 gh 2.8 f B29 1.3 bcd 1.3 b 3.0 ab 3.0 a B32 1.3 bcd 1.3 b 3.0 ab 3.0 a B76 1.3 bc 1.3 b 3.0 a 3.0 a D38 1.3 bc 1.3 b 2.9 cd 2.9 bcd A70 1.3 bc 1.4 a 3.0 ab 3.0 a A69 1.3 b 1.3 b 2.6 j 2.6 h F40 1.3 b 1.3 b 3.0 ab 3.0 a A03 1.4 a 1.4 a 3.0 ab 3.0 a A32 1.4 a 1.4 a 3.0 ab 3.0 a data were mean values of four replicate plates. Data followed by the same letters were not significantly different in Fisher’s LSD tests, α=0.05.

No mycelial growth was observed in the blank control group. Large variation was observed in the mycelial growth rates of Pythium dissotocum isolates on 10% V8 medium (Table

4.3.2). The mycelial growth measurements of Pythium dissotocum isolates at 24 hours ranged from 0.1 to 1.4 cm (1.1 +/- 0.3 cm), and their mycelial growth at 48 hours ranged from 0.3 to 3.0 cm (2.6 +/- 0.6).

126

Xuemei Zhang Chapter 4 127

4.3.2 Intraspecific Variation in Virulence among Pythium myriotylum and

Pythium dissotocum isolates

Intraspecific Variation in Virulence among Pythium myriotylum Isolates

Seed inoculation results (Table 4.3.3) showed that all 16 Pythium myriotylum isolates significantly (P<0.01) reduced percent seedling stand at 10 DAI (percent seed germination).

Significant (P<0.05) differences were detected among P. myriotylum isolates. However, such differences were not consistent across two experiments (Table 4.3.3).

Table 4.3.3. Germination of tobacco TN 90LC seeds inoculated with Pythium myriotylum isolates in Petri dishes, 10 days after inoculation. Seed germination/Seedling stand (%) Pythium myriotylum isolates Experiment 1 Experiment 2 Uninoculated control 100 a 98.4 a D02 73.4 b 46.9 b C11 48.4 c-f 35.9 b-e D03 50 cde 32.8 c-f C13 54.7 bcd 43.8 bc E40 54.7 bcd 25 efg A90 65.6 bc 14.1 g C12 50 cde 32.8 c-f D04 32.8 ef 32.8 c-f F73 46.9 c-f 32.8 c-f A91 46.9 c-f 21.9 fg F96 34.4 def 42.2 bcd G06 46.9 c-f 34.4 b-f E54 42.2 def 32.8 c-f E53 34.4 def 29.7 def A20 35.9 def 32.8 c-f A89 28.1 f 34.4 b-f data were mean values of four replicate plates. Data followed by the same letters were not significantly different in Fisher’s LSD tests, α=0.05.

All 16 P. myriotylum isolates caused 100% root discoloration and necrosis on newly germinated tobacco seedlings (Table 4.3.4). However, significant (P<0.04) differences in disease

127

Xuemei Zhang Chapter 4 128 severity index were detected among P. myriotylum isolates. Pythium myriotylum E40 was consistently associated with significantly (P<0.02) lower disease severity indices when compared with other P. myriotylum isolates. Pythium myriotylum D04 and C12 were significantly (P<0.01) different with other isolates in one of the experiments (Table 4.3.4).

Table 4.3.4. Root rot incidence and severity index of 10-day-old tobacco TN 90LC seedlings inoculated with Pythium myriotylum isolates in Petri dishes, 7 days after inoculation. Root rot disease Pythium myriotylum Disease incidence (%) Disease severity index (%) isolates Experiment 1 Experiment 2 Experiment 1 Experiment 2 Uninoculated control 0 a 0 a 0 a 0 a E40 100 b 100 b 95.3 b 95 b D04 100 b 100 b 95.6 b 99.7 c C12 100 b 100 b 96.9 bc 100 c C13 100 b 100 b 98.4 cd 100 c G06 100 b 100 b 98.4 cd 100 c A20 100 b 100 b 99.1 cd 100 c A89 100 b 100 b 99.4 cd 100 c A90 100 b 100 b 100 d 100 c A91 100 b 100 b 100 d 100 c C11 100 b 100 b 100 d 100 c D02 100 b 100 b 100 d 100 c D03 100 b 100 b 100 d 100 c E53 100 b 100 b 100 d 100 c E54 100 b 100 b 100 d 100 c F73 100 b 100 b 100 d 100 c F96 100 b 100 b 100 d 100 c data were mean values of four replications. Data followed by the same letters were not significantly different in Fisher’s LSD tests, α=0.05.

Intraspecific Variation in Virulence among Pythium dissotocum Isolates

Seed inoculation results (Table 4.3.5) showed that 46 out of 50 Pythium dissotocum isolates significantly (P<0.01) reduced the percentage of germinated seeds, and significant

(P<0.05) differences in reduction of tobacco seed germination were detected among P. dissotocum isolates, with differences consistent across two experiments (Table 4.3.5).

128

Xuemei Zhang Chapter 4 129

Table 4.3.5. Germination of tobacco TN 90LC seeds inoculated with Pythium dissotocum isolates in Petri dishes, 10 days after inoculation. Seed germination (%) Pythium dissotocum isolates Experiment 1 Experiment 2 Uninoculated control 96.9 a 98.4 a D58 96.9 a 93.8 ab D14 95.3 ab 92.2 abc C53 89.1 ab 96.9 abc E73 85.9 abc 73.4 cde E75 84.4 bcd 78.1 bcd B76 75 cde 57.8 efg A32 73.4 de 79.7 a-d E72 70.3 e 64.1 def B66 70.3 e 70.7 de B05 67.2 ef 78.1 bcd A69 56.3 fg 48.4 fgh B75 54.7 g 34.4 h-k D50 51.6 gh 39.1 g-j F12 48.4 ghi 73.4 cde B63 39.1 ijk 48.4 fgh D51 39.1 ijk 25 i-m F35 31.3 jkl 25 i-m F21 29.7 kl 45.3 fgh B57 29.7 kl 48.4 fgh F29 29.7 kl 48.4 fgh B74 21.9 lm 40.6 ghi B90 10.9 mn 29.7 h-l B14 9.4 n 15.6 k-o A03 7.8 n 4.7 no B13 6.3 n 12.5 l-o A70 4.7 n 10.9 l-o E19 4.7 n 20.3 j-n F28 4.7 n 10.9 l-o F40 4.7 n 7.8 mno D97 3.1 n 14.1 l-o E15 3.1 n 6.3 mno B55 3.1 n 9.4 mno To be continued the next page

129

Xuemei Zhang Chapter 4 130

Table 4.3.5. Germination of tobacco TN 90LC seeds inoculated with Pythium dissotocum isolates in Petri dishes, 10 days after inoculation (continued). Seed germination (%) Pythium dissotocum isolates Experiment 1 Experiment 2 B32 3.1 n 7.8 mno C78 1.6 n 3.1 no D24 1.6 n 0 o D56 1.6 n 4.7 no D96 1.6 n 0 o F64 1.6 n 6.3 mno E24 0 n 15.6 k-o D92 0 n 0 o D95 0 n 1.6 no C88 0 n 4.7 no B29 0 n 6.3 mno E23 0 n 0 o E01 0 n 0 o E14 0 n 0 o D38 0 n 0 o D63 0 n 9.4 mno D67 0 n 1.6 no F68 0 n 1.6 no data were mean values of four replications. Data followed by the same letters were not significantly different in Fisher’s LSD tests, α=0.05.

All 50 P. dissotocum isolates caused root symptoms on newly germinated tobacco seedlings (Table 4.3.6). However, the disease incidence and severity caused by the pathogen varied widely among the 50 P. dissotocum isolates. Significant (P<0.05) differences were detected within the P. dissotocum population and the results were consistent across two experiments except for P. dissotocum D14, B63, and B05.

130

Xuemei Zhang Chapter 4 131

Table 4.3.6. Root rot incidence and severity index of 10-day-old tobacco TN 90LC seedlings inoculated with Pythium dissotocum isolates in Petri dishes, 7 days after inoculation. Pythium dissotocum Root rot incidence (%) Root rot severity index (%) isolates Experiment 1 Experiment 2 Experiment 1 Experiment 2 Uninoculated control 0 a 0 a 0 a 0 a D14 64.1 b 90 de 23 bc 43 d-j B63 65.6 b 80 bc 9 ab 37 b-f C53 69.7 bc 85 cd 38 c-g 44 e-k B57 71.9 bc 75 b 25 bcd 33 b-e D58 75 bcd 90 de 42 d-i 55 k-o A32 82.8 cde 95 ef 66 j-p 58 m-p B66 87.5 def 100 b 52 f-k 46 f-l E73 87.5 def 100 f 32 cde 30 bc D56 89.1 def 80 bc 66 j-p 56 l-o E75 90.6 ef 100 f 35 c-f 37 b-f B05 92.2 ef 95 ef 92 st 48 f-m B14 92.2 ef 100 f 85 q-t 94 vw B90 92.2 ef 80 bc 63 j-o 44 e-k B76 93.8 ef 88.8 cde 75 m-s 55 k-o F12 93.8 ef 100 f 35 c-f 38 b-g B32 95.3 ef 100 f 79 o-t 69 pqr B75 95.3 ef 95 ef 59 i-n 42 d-i A69 98.4 f 100 f 90 rst 78 rst B55 98.4 f 100 f 87 q-t 88 t-w A03 100 f 100 f 76 n-s 72 qrs D97 100 f 100 f 57 h-m 51 h-n E01 100 f 100 f 85 q-t 81 stu A70 100 f 100 f 95 t 90 uvw E14 100 f 100 f 66 j-p 49 g-n B13 100 f 100 f 95 t 93 uv E15 100 f 100 f 50 e-j 53 i-n B29 100 f 100 f 91 rst 96 w E19 100 f 100 f 57 h-m 60 nop E23 100 f 100 f 59 i-n 53 i-n E24 100 f 100 f 53 f-k 48 f-m E72 100 f 100 f 38 c-g 33 b-e To be continued the next page

131

Xuemei Zhang Chapter 4 132

Table 4.3.6. Root rot incidence and severity index of 10-day-old tobacco TN 90LC seedlings inoculated with Pythium dissotocum isolates in Petri dishes, 7 days after inoculation (continued). Root rot incidence (%) Root rot severity index (%) Pythium dissotocum isolates Experiment 1 Experiment 2 Experiment 1 Experiment 2 F21 100 f 100 f 31 cd 27 b B74 100 f 95 ef 70 k-q 54 j-o F28 100 f 100 f 40 c-h 33 b-e F29 100 f 100 f 31 cd 32 bcd F35 100 f 100 f 26 bcd 37 b-f F40 100 f 100 f 33 cde 40 c-h C78 100 f 100 f 97 t 88 t-w C88 100 f 100 f 73 l-r 92 uvw F64 100 f 100 f 55 g-l 54 j-o F68 100 f 100 f 35 c-f 54 j-o D24 100 f 100 f 95 t 83 s-v D38 100 f 100 f 86 q-t 88 t-w D50 100 f 100 f 93 st 88 t-w D51 100 f 100 f 80 o-t 60 nop D63 100 f 100 f 76 n-s 30 bc D67 100 f 100 f 59 i-n 73 qrs D92 100 f 100 f 80 o-t 73 qrs D95 100 f 100 f 82 p-t 78 rst D96 100 f 100 f 75 m-s 65 opq data were mean values of four replications. Data followed by the same letters were not significantly different in Fisher’s LSD tests, α=0.05.

4.3.3 Pathogenicity and Virulence of Pythium Species in Laboratory Assays

Seed Inoculation

Pythium catenulatum, P. pectinolyticum, P. attrantheridium, and P. adhaerens did not have any significant effects (P>0.05) on percent seedling stand within seven or ten days after inoculation, compared to the uninoculated control in this study (Table 4.3.7). Percent seedling stand associated with P. torulosum, P. inflatum, P. porphyrae and an isolate of P. dissotocum at

7 DAI differed between the two experiments but they did not cause significant (P>0.05) reductions in seed germination at 10 DAI (Table 4.3.7). Pythium aristosporum significantly

132

Xuemei Zhang Chapter 4 133

(P<0.05) reduced percent seedling stand at 7 DAI and 10 DAI in the first experiment but not in the repeated experiment (Table 4.3.7).

Table 4.3.7. Seedling stand (%) of Tobacco TN 90LC inoculated with Pythium species at seeding in Petri dishes. Results are from two laboratory experiments. Seedling stand % Pythium species Experiment 1 Experiment 2 7 DAIz 10DAI 7 DAI 10DAI Uninoculated control 87.5 abcy 95.3 ab 100.0 a 98.4 a P. catenulatum 96.9 a 100.00 a 93.8 abc 92.2 ab P. pectinolyticum 95.3 a 95.3 ab 96.9 ab 96.9 a P. attrantheridium 93.8 ab 92.2 ab 93.8 abc 98.4 a P. adhaerens 75.0 bcde 90.6 ab 93.8 abc 98.4 a P. dissotocum 84.4 abcd 92.2 ab 90.6 bc* 96.9 a P. porphyrae 73.4 cde 92.2 ab 85.9 c* 90.6 ab P. inflatum 64.1 ef* 85.9 ab 93.8 abc 95.3 ab P. torulosum 46.9 fg* 79.7 b 93.8 abc 90.6 ab P. aristosporum 42.2 g* 53.1 c* 95.3 ab 93.8 ab P. myriotylum 67.2 de* 21.9 d* 95.3 ab 87.5 b* P. irregulare 40.6 g* 3.1 e* 14.1 d* 15.6 c* P. coloratum 28.1 gh* 21.9 d* 1.6 e* 0 d* P. dissotocum-1 17.2 h* 0 e* 3.1 e* 0 d* z DAI: Days after Inoculation. y Data presented are means of four replications. Data were transformed prior to statistical analysis, and means presented in the table are back-transformed. Means within a column followed by the same letter(s) are not significantly different in Fisher’s LSD tests, α=0.05. “*” indicates means significantly different from the untreated control.

Pythium myriotylum, P. irregulare, P. coloratum, and another P. dissotocum isolate (P. dissotocum-1) significantly (P<0.05) reduced % seedling stand at seven and ten days after inoculation (DAI) in both experiments compared to the uninoculated control, except P. myriotylum did not have any significant (P>0.05) effects on % seedling stand at 7 DAI in the repeated experiment (Table 4.3.7). However, the treatment effect of P. myriotylum was significantly smaller than the treatment effects of P. irregulare, P. coloratum, and P. dissotocum-

1 (Table 4.3.7). There was a decrease in % seedling stand from 7 DAI to 10 DAI in P. irregulare, P. coloratum, and P. dissotocum-1, and P. myriotylum treated groups (Table 4.3.7).

133

Xuemei Zhang Chapter 4 134

Figure 4.3.1. The results of tobacco seed inoculation with other Pythium species in Petri dishes. a. tobacco seedlings germinated from uninoculated seeds had abundant root hairs and appeared to be healthy. b. tobacco seedlings germinated from P. irregulare inoculated seeds showed root discoloration and root decaying, with numerous oospores in the root tissue. c. tobacco seedlings germinated from P. coloratum inoculated seeds showed root discoloration and root decaying, with mycelia growing in and on the root tissue. d. tobacco seedlings germinated from P. aristosporum inoculated seeds showed no apparent symptoms except root hair loss, and a few hyphae were found on the root surface. e-f, tobacco seedlings germinated from P. dissotocum inoculated seeds appeared to be healthy, but the root hairs of some seedlings were significantly reduced, and hyphae were found on the surface of root tissues

The inoculated seeds and seedlings germinated from the inoculated seeds were observed under a microscope and cultured on V8-PARP agar media. No colonization of P. adhaerens, P. attrantheridium, P. pectinolyticum, or P. catenulatum on germinated seedlings was observed, and they were absent on re-isolation cultures. Similar to the uninoculated control (Figure 4.3.1a), seedlings germinated from seeds inoculated with these species (P. adhaerens, P. attrantheridium, P. pectinolyticum, or P. catenulatum) appeared to be healthy. Seedlings germinated from seeds that were inoculated with P. aristosporum (Figure 4.3.1d), P. torulosum,

134

Xuemei Zhang Chapter 4 135

P. inflatum, P. adhaerens, or P. dissotocum (Figure 4.3.1e) appeared to be healthy. Mycelia of P. aristosporum (Figure 4.3.1d) and P. dissotocum (Figure 4.3.1f) were observed on some seedlings, and the root hair of those seedlings were significantly reduced. The presence of P. aristosporum, P. torulosum, P. inflatum, P. porphyrae, and P. dissotocum on re-isolation cultures was confirmed, but the results were inconsistent among four replications.

Figure 4.3.2. The results of tobacco seed inoculation with Pythium myriotylum in Petri dishes. a-b, tobacco seedlings germinated from P. myriotylum inoculated seeds showed root rot and turned dark after seed germination. c, P. myriotylum produced appressoria within 8 hours after inoculation. d-e, P. myriotylum produced abundant oospores within 10 days after inoculation in the root tissues of the seedlings germinated from inoculated tobacco seeds.

Seeds inoculated with P. coloratum, P. irregulare, or P. myriotylum turned into root-rot seedlings (showing root discoloration and decaying) at 17 DAI: P. myriotylum-infected seedlings turned dark and dry (Figure 4.3.1a-b), and seedlings infected with P. irregulare (Figure 4.3.1b), or P. coloratum (Figure 4.3.1c) turned brown and slimy. The presence of P. myriotylum (Figure

4.3.2 c-e), P. irregulare (Figure 4.3.1b), P. coloratum (Figure 4.3.1c), and P. dissotocum-1 in the

135

Xuemei Zhang Chapter 4 136 inoculated tobacco seedling tissues was confirmed with microscopic observation and re-isolation cultures.

Seedling Inoculation

No symptoms or root colonization were observed on tobacco seedlings after inoculation with P. inflatum, P. adhaerens or P. pectinolyticum (Table 4.3.8 - 4.3.9). A few tobacco seedlings inoculated with P. attrantheridium showed slight discoloration on radicles (Table 4.3.8

- 4.3.9), but root colonization was not observed. Additionally, P. attrantheridium, P. inflatum, P. adhaerens, and P. pectinolyticum were absent on re-isolation cultures.

Table 4.3.8. Disease incidence at 7 and 10 days after inoculating of 10-day-old tobacco TN 90LC seedlings with individual Pythium species in Petri dishes. Results are from two laboratory experiments. Disease incidencez (%) Pythium species Experiment 1 Experiment 2 7DAIy 10 DAI 7DAI 10DAI Uninoculated control 0 dx 0 d 0 f 0 e P. inflatum 0 d 0 d 0 f 0 e P. adhaerens 0 d 0 d 0 f 0 e P. pectinolyticum 0 d 0 d 0 f 0 e P. attrantheridium 0 d 0 d 4.7 f 4.7 de P. aristosporum 4.7 d 0 d 9.4 ef 17.2 d* P. porphyrae 0 d 0 d 28.1 cd* 81.2 b* P. dissotocum 0 d 75.0 b* 7.8 f 9.4 de P. catenulatum 15.0 cd 67.5 b* 42.2 bc* 90.6 ab* P. torulosum 3.1 d 47.5 c* 81.3 a* 93.8 ab* P. irregulare 29.7 c* 10.0 d 46.9 b* 93.8 ab* P. coloratum 63.4 b* 100 a* 89.1 a* 98.4 a* P. dissotocum-1 100 a* 92.5 a* 25.0 de* 64.1 c* P. myriotylum 100 a* 100 a* 90.6 a* 100 a* z Disease incidence defined as the percentage of seedlings showing discoloration and decaying on radicles, hypocotyl or cotyledon). y DAI: Days after Inoculation. x Data presented are means of four replications. Data were transformed prior to statistical analysis, and means presented in the table are back-transformed. Means within a column followed by the same letter(s) are not significantly different in Fisher’s LSD tests, α=0.05. “*” indicates means significantly different from the untreated control.

136

Xuemei Zhang Chapter 4 137

Pythium myriotylum, P. dissotocum-1, and P. coloratum consistently infected a high proportion of young seedlings in both experiments (Table 4.3.8), causing high levels of disease severity (Table 4.3.9). Pythium irregulare, P. torulosum and P. catenulatum attacked 10-day-old tobacco seedlings less consistently than Pythium myriotylum, P. dissotocum-1, and P. coloratum

(Table 4.3.8), but still caused significant (P<0.05) damages to inoculated seedlings (Table 4.3.9).

Disease incidence (Table 4.3.8) and severity (Table 4.3.9) caused by P. dissotocum, P. porphyrae and P. aristosporum were lower and less consistent on 10-day-old tobacco seedlings compared to those caused by Pythium myriotylum, P. dissotocum-1, P. coloratum, P. irregulare,

P. torulosum and P. catenulatum.

Table 4.3.9. Disease severity at 7 and 10 days after inoculating of 10-day-old tobacco TN 90LC seedlings with individual Pythium species in Petri dishes. Disease severity indexz (%) Pythium species Experiment 1 Experiment 2 7DAIy 10DAI 7DAI 10DAI Uninoculated control 0 cx 0 e 0 e 0 e P. inflatum 0 c 0 e 0 e 0 e P. adhaerens 0 c 0 e 0 e 0 e P. pectinolyticum 0 c 0 e 0 e 0 e P. attrantheridium 0 c 0 e 0.9 de 0.9 e P. aristosporum 2.5 c 0 e 2.5 de 4.4 e P. dissotocum 0 c 45.0 c* 2.5 de 4.4 e P. porphyrae 0 c 0 e 9.4 cde 48.8 d* P. catenulatum 12.5 bc 58.8 b* 19.1 c* 63.8 c* P. torulosum 2.5 c 26.3 d* 43.8 b* 52.5 d* P. irregulare 17.5 b* 13.8 d* 16.6 c* 73.8 bc* P. dissotocum-1 65.0 a* 48.8 bc* 11.6 cd* 47.8 d* P. coloratum 21.3 b* 58.8 b* 55.0 ab* 81.6 ab* P. myriotylum 67.5 a* 93.8 a* 65.3 a* 90.0 a* z Disease severity defined as the level of discoloration and decaying on radicles, hypocotyl or cotyledons y DAI: Days after Inoculation. x Data presented are means of four replications. Data were transformed prior to statistical analysis, and means presented in the table are back-transformed. Means within a column followed by the same letter(s) are not significantly different in Fisher’s LSD tests, α=0.05. “*” indicates means significantly different from the untreated control.

137

Xuemei Zhang Chapter 4 138

Figure 4.3.3. The results of tobacco seedling inoculation with Pythium species in Petri dishes. a. uninoculated tobacco seedlings were healthy, with copious root hairs and robust tissues/cells. b. tobacco seedlings inoculated with P. myriotylum turned decayed brown tissues and the cotyledons became dark or transparent. The tissues outside the steles were severely destroyed, and numerous oospores were found in those tissues. c-d. tobacco seedlings inoculated with P. coloratum (c) or P. dissotocum-1 (d) had brown and decayed radicles and hypocotyls with yellow cotyledons. The tissues and cells outside the steles were deformed by massive mycelial colonization. e. tobacco seedlings inoculated with P. irregulare showed discoloration and decaying on radicles and hypocotyls, but the cotyledons were green. Mycelia and oospores were found in the cortex tissues of the infected seedlings. f-g. tobacco seedlings inoculated with P. torulosum (f) or P. catenulatum (g) showed discoloration and decaying on radicles and slightly on the hypocotyls. The cotyledons turned yellow or greenish yellow. The cells were not deformed as severely as in P. irregulare-infected tissues, but the cortex and epidermis tissues were occupied by mycelia. h-i. tobacco seedlings inoculated with P. porphyrae (h) and P. dissotocum (i) caused the discoloration of radicles, without apparent hypocotyl or cotyledon symptoms. The cortex and epidermis cells seemed to be intact. J. tobacco seedlings inoculated with P. aristosporum did not result in any apparent symptoms except root hair loss and slight root discoloration. The seedling tissues seemed to be intact and healthy.

138

Xuemei Zhang Chapter 4 139

Pythium myriotylum (Figure 4.3.3b), P. coloratum (Figure 4.3.3c), and P. dissotocum-

1(Figure 4.3.3d) consistently caused discoloration and decay of radicles (roots), hypocotyls

(stems), and cotyledons (leaves) that led to the death of infected seedlings. The cells outside the steles of seedling tissues infected by P. myriotylum (Figure 4.3.3b), P. coloratum (Figure 4.3.3c), or P. dissotocum-1(Figure 4.3.3d) were damaged and occupied by hyphae, and numerous oospores were found in decayed radicles (mainly in the cortex), hypocotyl, and cotyledon tissues of P. myriotylum-inoculated seedlings. These species were present on the re-isolation cultures.

Pythium irregulare (Figure 4.3.3e), P. torulosum (Figure 4.3.3f), and P. catenulatum

(Figure 4.3.3g) caused the discoloration and decay of radicles, hypocotyls, and cotyledons on infected seedlings. The microscopic results showed that the mycelial colonization of P. irregulare (Figure 4.3.3e), P. torulosum (Figure 4.3.3f), or P. catenulatum (Figure 4.3.3g) on tobacco seedlings damaged the cortex and epidermal tissues. These species were present and confirmed on re-isolation cultures.

Pythium porphyrae (Figure 4.3.3h) and P. dissotocum (Figure 4.3.3i) mainly caused the discoloration of radicles (the affected radicles were a little slimy) without apparent hypocotyl or cotyledon symptoms; the cortex and epidermis tissues/cells were intact. Pythium aristosporum did not result in any apparent symptoms except root hair loss and slight root discoloration on a few inoculated seedlings (Figure 4.3.3j).

Mycelial colonization by P. porphyrae (Figure 4.3.3h) and P. aristosporum (Figure

4.3.3j) was observed in seedling radicles, which showed discoloration and/or decay symptoms.

P. porphyrae and P. aristosporum were present on re-isolation cultures, although the culture results were inconsistent among the four replications in each experiment. However, mycelial colonization by P. dissotocum was only observed on the surface of the radicle of two infected

139

Xuemei Zhang Chapter 4 140 seedlings (less than 5%), and no P. dissotocum isolates were present on the re-isolation cultures.

4.3.4 Consequences of Pythium infections at Seeding in Greenhouse Trials

Pythium species (Table 4.3.7) that had significantly reduced seed germination and colonized tobacco seeds or seedlings germinated from inoculated seeds in laboratory pathogenicity assays were tested in greenhouse trial 1 and 2 (Table 4.2.2), where the bay water was inoculated with Pythium species at seeding.

Impacts of Pythium infections at Seeding on Seed Germination

The results (Table 4.3.10) showed that Pythium myriotylum, P. dissotocum-1 and P. coloratum significantly (P<0.05) reduced seed germination compared with the uninoculated control in both trials. Pythium irregulare significantly (P<0.05) reduced seed germination only in the second experiment. P. dissotocum, P. torulosum, P. aristosporum, P. porphyrae and P. inflatum did not reduce seed germination in either greenhouse trial.

Table 4.3.10. Germination of TN 90LC tobacco seeds in two greenhouse trials following bay water inoculation with individual Pythium species at seeding. Research was conducted at the Virginia Tech Southern Piedmont AREC in Blackstone, VAz. Seed germination (%) Treatment Trial 1 Trial 2 Uninoculated Control 95.5 aby 91.5 a Pythium inflatum 96.3 ab 87.8 ab Pythium porphyrae 99.0 a 88.3 ab Pythium aristosporum 94.2 abc 80.2 abc Pythium torulosum 94.2 abc 86.1 abc Pythium dissotocum 82.0 bcd 86.6 abc Pythium irregulare 99.0 a 78.1 bc* Pythium coloratum 73.7 cde* 77.7 bc* Pythium dissotocum-1 68.2 de* 72.4 c* Pythium myriotylum 53.5 e* 76.2 bc* z Trial 1 was conducted between June 4 and August 28, 2019. Trial 2 was conducted between October 7 and December 19, 2019. y Data presented are means of four replications. Data were transformed prior to statistical analysis and means presented in the table are back-transformed. Means within a column followed by the same letter(s) are not significantly different in Fisher’s LSD tests, α=0.05. “*” indicates means significantly different from the untreated control.

140

Xuemei Zhang Chapter 4 141

Impacts of Pythium infections at Seeding on Seedling Roots

Tobacco seedlings in bays inoculated with Pythium myriotylum, P. dissotocum-1, or P. coloratum at seeding exhibited significant root rot incidence and severity and more spores in root tissue (Table 4.3.11). Pythium irregulare caused root rot in both trials, but root rot severity was statistically significant (P<0.05) in trial 2 and not in trial 1. Oospore numbers were significantly higher in roots after at-seeding inoculation with P. irregulare compared to the untreated controls in trial 1 (P<0.05), but not in trial 2. Numerical increases in root rot incidence and severity after at-seeding inoculation with the second isolate of Pythium dissotocum were not significant in trial

1 but were in trial 2 (P<0.05). On the other hand, Pythium oospore counts in roots after at- seeding inoculation with P. dissotocum were significantly higher than those for the untreated controls in trial 1 (P<0.05) but not in trial 2. At-seeding inoculation with P. torulosum resulted in significantly greater root rot incidence (P<0.05) compared to the untreated control in trial 2, but numerically higher root rot incidence in trial 1 was not statistically significant. Apparent increases in root rot severity and oospore numbers within root tissue after at-seeding inoculation with P. torulosum likewise were not statistically significant (Table 4.3.11). Inoculation with P. aristosporum at seeding resulted in very low root rot incidence and severity in trial 1, as well as spore count in root tissues, in only one of the greenhouse trials, and these were not statistically higher than the uninoculated control. No root rot disease or Pythium spores were detected in the uninoculated control, or in P. porphyrae- or P. inflatum-inoculated seedlings (Table 4.3.11).

141

Xuemei Zhang Chapter 4 142

Table 4.3.11. Effects of float water inoculation with individual Pythium species at seeding on root rot incidence and severity and the number of oospores in the root tissues of TN 90LC tobacco seedlings in two greenhouse trials. Research was conducted at the Virginia Tech Southern Piedmont AREC in Blackstone, VAz. Spore count Root Rot incidence % Root rot severity (%) Treatment (per 2mm root tissue) Trial 1 Trial 2 Trial 1 Trial 2 Trial 1 Trial 2 Uninoculated Control 0 ay 0 a 0 a 0 a 0 a 0 a Pythium inflatum 0 a 0 a 0 a 0 a 0 a 0 a Pythium porphyrae 0 a 0 a 0 a 0 a 0 ab 0 a Pythium aristosporum 14.6 ab 0 a 5.0 ab 0 a 1 abc 0 a Pythium torulosum 50.0 abc 58.0 b* 20.0 ab 18.0 ab 3 a-d 0 a Pythium dissotocum 50.0 abc 85.4 b* 30.0 ab 23.0 b* 7 cd* 4 ab Pythium irregulare 65.8 bc* 97.1 b* 31.0 ab 23.0 b* 14 d* 7 ab Pythium coloratum 93.3 c* 100 c* 38.0 b* 55.0 c* 69 ef* 21 c* Pythium dissotocum-1 85.4 bc* 100 c* 35.0 b* 44.0 c* 20 def* 13 bc* Pythium myriotylum 100 c* 100 c* 100 c* 100 d* 173 f* 55 d* z Trial 1 was conducted between June 4 and August 28, 2019. Trial 2 was conducted between October 7 and December 19, 2019. y Data presented are means of four replications. Data were transformed prior to statistical analysis, and means presented in the table are back-transformed. Means within a column followed by the same letter(s) are not significantly different in Fisher’s LSD tests, α=0.05. “*” indicates means significantly different from the untreated control.

Pythium myriotylum, P. dissotocum-1, P. coloratum, P. irregulare, and P. dissotocum significantly (P<0.05) reduced the vigor of tobacco seedlings in both trials, compared with the uninoculated control (Table 4.3.12). Pythium torulosum significantly (P<0.05) reduced root vigor of seedlings in trial 1 but not trial 2. Pythium myriotylum was the only species that caused a significant reduction in the root length of tobacco seedlings (Table 4.3.12). Pythium myriotylum,

P. dissotocum-1, P. coloratum, P. irregulare, P. dissotocum, and P. torulosum significantly

(P<0.05) reduced the root ball weight of tobacco seedlings in both greenhouse trials. The treatment effect of P. myriotylum on tobacco seedling root vigor, length, and weight was significantly (P<0.05) stronger than any of the other Pythium species (Table 4.3.12). Pythium aristosporum, P. porphyrae and P. inflatum did not have any significant effects on tobacco seedling root vigor, root length or root weight in these greenhouse trials (Table 4.3.12).

142

Xuemei Zhang Chapter 4 143

Table 4.3.12. Effects of float water inoculation with induvial Pythium species at seeding on root vigor, length, and weight of TN 90LC tobacco seedlings. Research was conducted at the Virginia Tech Southern Piedmont AREC near Blackstone, VAz. Root vigor (%) Root length (cm) Root weight (g) Treatment Trial 1 Trial 2 Trial 1 Trial 2 Trial 1 Trial 2 Uninoculated Control 99.4 ay 99.4 ab 20.4 a 26.0 ab 19.5 a 10.9 a Pythium inflatum 91.4 ab 88.8 bc 19.3 a 27.2 a 17.9 ab 10.0 ab Pythium porphyrae 88.1 abcd 99.7 a 18.5 a 23.7 ab 17.6 ab 8.0 abc Pythium aristosporum 89.0 abc 92.5 abc 21.2 a 24.9 ab 19.4 a 8.0 abc Pythium torulosum 55.6 cde* 94.9 abc 19.5 a 21.9 bc 11.4 c* 6.8 cd* Pythium dissotocum 70.9 bcd* 61.5 de* 17.1 a 24.4 ab 12.7 bc* 7.5 bcd* Pythium irregulare 57.1 cde* 80.8 cd* 20.0 a 26.5 a 12.2 bc* 6.5 cd* Pythium coloratum 29.4 e* 55.0 de* 17.9 a 21.9 bc 11.1 c* 4.9 cde* Pythium dissotocum-1 53.8 de* 50.0 e* 19.6 a 23.3 ab 10.3 c* 4.3 de* Pythium myriotylum 0.1 f* 17.2 f* 7.9 b* 18.4 c* 1.2 d* 2.7 e* z Trial 1 was conducted between June 4 and August 28, 2019. Trial 2 was conducted between October 7 and December 19, 2019. y Data presented are means of four replications. Data were transformed prior to statistical analysis, and means presented in the table are back-transformed. Means within a column followed by the same letter(s) are not significantly different in Fisher’s LSD tests, α=0.05. “*” indicates means significantly different from the untreated control.

Impacts of Pythium infections at Seeding on Aerial Parts of Tobacco Seedlings

Pythium myriotylum and P. dissotocum-1 significantly (P<0.05) reduced tobacco seedling vigor in both trials; P. coloratum, P. irregulare, and P. dissotocum also significantly (P<0.05) reduced seedling vigor in trial 2, but not in trial 1 (Table 4.3.13). Seedling vigor was not significantly different from the control when float water had been inoculated at seeding with P. torulosum, P. aristosporum, P. porphyrae, or P. inflatum (Table 4.3.13). Tobacco seedlings inoculated at seeding with P. myriotylum, P. dissotocum-1, or P. coloratum exhibited significant

(P<0.05) leaf chlorosis incidence, but seedlings inoculated with the other species and uninoculated seedlings did not show leaf chlorosis (Table 4.3.13). Pythium myriotylum was consistently associated with significant (P<0.05) tobacco mortality incidence in both trials (Table

4.3.13). Pythium dissotocum-1, P. coloratum, P. irregulare, and P. aristosporum only significantly (P<0.05) increased mortality incidence in Trial 2, but not in trial 1(Table 4.3.13).

143

Xuemei Zhang Chapter 4 144

Table 4.3.13. Effects of float water inoculation with individual Pythium species at seeding on seedling vigor, foliar chlorosis and mortality of TN 90LC tobacco seedlings. Results are from two greenhouse experiments conducted at the Virginia Tech Southern Piedmont AREC near Blackstone, VAz. Seedling vigor % Leaf chlorosis incidence (%) Mortality incidence (%) Treatment Trial 1 Trial 2 Trial 1 Trial 2 Trial 1 Trial 2 Uninoculated Control 97.5 ay 100 a 0 a 0 a 0 a 1.0 a Pythium inflatum 91.6 ab 99.7 a 0 a 0 a 0 a 8.9 abcd Pythium porphyrae 83.8 ab 100 a 0 a 0 a 0 a 9.0 abcd Pythium aristosporum 94.3 ab 97.4 ab 0 a 0 a 0 a 11.2 bcd* Pythium torulosum 92.7 ab 100 a 0 a 0 a 0.3 a 6.1 abc Pythium dissotocum 89.5 ab 82.7 c* 0 a 0 a 0 a 1.9 a Pythium irregulare 64.4 ab 86.9 bc* 0 a 0 a 6.6 a 13.9 cd* Pythium coloratum 58.5 ab 82.7 c* 25.0 a* 8.0 b* 11.1 ab 16.9 cd* Pythium dissotocum-1 40.0 b* 80.1 c* 15.0 a* 5.0 ab* 0.9 a 18.2 d* Pythium myriotylum 0.1 c* 45.0 d* 75.0 b* 89.0 c* 44.3 b* 19.7 d* z Trial 1 was conducted between June 4 and August 28, 2019. Trial 2 was conducted between October 7 and December 19, 2019. y Data presented are means of four replications. Data were transformed prior to statistical analysis, and means presented in the table are back-transformed. Means within a column followed by the same letter(s) are not significantly different in Fisher’s LSD tests, α=0.05. “*” indicates means significantly different from the untreated control.

4.3.5 Consequences of Pythium infections at Seedling Emergence in

Greenhouse Trials

Pythium species (Table 4.3.8 – 4.3.9) that colonized 10-day-old tobacco seedlings and/or cause disease symptoms on the seedlings in laboratory pathogenicity assays were additionally tested in greenhouse trials 3 and 4 (Table 4.2.2), where the bay water was inoculated with

Pythium species when most seeds had germinated, approximately ten days after seeding.

Impacts on Seedling Roots

Tobacco seedlings inoculated with Pythium myriotylum, P. dissotocum-1, and P. coloratum at seedling emergence exhibited significantly (P<0.05) high root rot disease incidence and severity, as well as significant numbers of oospores within root tissue (Table 4.3.14).

Numeric differences in root rot incidence after inoculation with P. irregulare at seeding were significant (P<0.05) in trial 4, but not in trial 3 (Table 4.3.14); similar trends were observed in

144

Xuemei Zhang Chapter 4 145 numbers of oospores in roots. Inoculation of P. irregulare at seedling emergence never resulted in significant differences in root rot severity or oospore numbers in roots compared to the untreated control. Although root rot occurred and oospores were observed after inoculation with

P. torulosum, P. catenulatum or P. aristosporum at seedling emergence, mean levels of these variables were not significantly different from the untreated control (Table 4.3.14). No root rot disease or Pythium spores were detected in uninoculated control, or P. porphyrae-inoculated seedlings in these greenhouse trials (Table 4.3.14).

Table 4.3.14. Effects of float water inoculation with individual Pythium species at seedling emergence on root rot incidence and severity and on the numbers of oospores within root tissues of TN 90LC tobacco seedlings. Results are from two greenhouse trials conducted at the Virginia Tech Southern Piedmont AREC, Blackstone, VAz Spore count Root rot incidence % Root rot severity (%) Treatment (per 2mm root tissue) Trial 3 Trial 4 Trial 3 Trial 4 Trial 3 Trial 4 Uninoculated control 0 ay 0 a 0 a 0 a 0 a 0 d Pythium porphyrae 0 a 0 a 0 a 0 a 0 a 0 d Pythium aristosporum 50 ab 0 a 23 ab 0 a 0 a 0 d Pythium catenulatum 25 ab 0 a 25 ab 0 a 12 b* 0 d Pythium torulosum 50 ab 0 a 40 ab 0 a 32 bc* 1 d Pythium irregulare 50 ab 50 b* 44 ab 17 a 32 bc* 19 c* Pythium dissotocum-1 95 c* 100 c* 57 bc* 74 b* 12 b* 48 b* Pythium coloratum 75 bc* 100 c* 65 bc* 66 b* 20 b* 34 b* Pythium myriotylum 100 c* 100 c* 100 c* 99 c* 84 c* 67 a* z Trial 3 was conducted between June 18 and September 6, 2019. Trial 4 was conducted between October 14 and December 19, 2019. y Data presented are means of four replications. Data were transformed prior to statistical analysis, and means presented in the table are back-transformed. Means within a column followed by the same letter(s) are not significantly different in Fisher’s LSD tests, α=0.05. “*” indicates means significantly different from the untreated control.

Pythium myriotylum, P. coloratum and P. dissotocum-1 significantly (P<0.05) reduced the vigor of tobacco seedlings and root weight compared with the uninoculated control, in both

Trial 3 and Trial 4 (Table 4.3.15). Pythium myriotylum and P. dissotocum-1 significantly

(P<0.05) reduced root length only in Trial 3 (Table 4.3.15). Pythium irregulare did not have any significant effect on root vigor or root length, although it did significantly (P<0.05) reduce root

145

Xuemei Zhang Chapter 4 146 weight in Trial 4 (Table 4.3.15). Pythium torulosum, P. catenulatum, P. aristosporum, and P. porphyrae did not have any significant effects on tobacco seedling root vigor, root length, or root weight in Trial 3 and Trial 4 (Table 4.3.15). The treatment effects of P. myriotylum on root vigor, root length, and root weight were significantly (P<0.05) stronger than any of the other Pythium species tested in Trial 3 and Trial 4 (Table 4.3.15).

Table 4.3.15. Effects of float water inoculation with individual Pythium species at seedling emergence on root vigor, length, and fresh weight of TN 90LC tobacco seedlings in greenhouse trials. Results are from two greenhouse trials conducted at the Virginia Tech Southern Piedmont AREC, Blackstone, VAz Root vigor (%) Root length (cm) Root weight (g) Treatment Trial 3 Trial 4 Trial 3 Trial 4 Trial 3 Trial 4 Uninoculated control 98.8 ay 98.8 ab 23.8 a 26 ab 22.4 ab 25 ab Pythium porphyrae 97.5 a 100 a 26.1 ab 27.2 a 28.1 a 25.8 a Pythium aristosporum 96.3 a 100 a 24.0 ab 23.7 ab 23.9 ab 23.6 abc Pythium catenulatum 82.5 a 96.3 ab 24.5 ab 24.9 ab 23.1 ab 25.3 ab Pythium torulosum 66.3 abc 95 ab 24.6 ab 21.9 bc 17.1 bc 22.3 bcd Pythium irregulare 76.3 ab 75 b 23.9 a 24.4 ab 14.9 bc 21.1 cd* Pythium dissotocum-1 46.3 bc* 23.8 cd* 20.4 b* 26.5 a 11.5 cd* 20.4 d* Pythium coloratum 38.8 cd* 42.5 c* 22.4 ab 21.9 bc 11.0 cd* 21.4 cd* Pythium myriotylum 6.3 d* 17.5 d* 14.0 c* 23.3 ab 1.8 d* 17.2 e* z Trial 3 was conducted between June 18 and September 6, 2019. Trial 4 was conducted between October 14 and December 19, 2019. y Data presented are means of four replications. Data were transformed prior to statistical analysis, and means presented in the table are back-transformed. Means within a column followed by the same letter(s) are not significantly different in Fisher’s LSD tests, α=0.05. “*” indicates means significantly different from the untreated control.

Impacts on the Aerial Parts of Tobacco Seedlings

Pythium myriotylum and P. coloratum significantly (P<0.05) reduced tobacco seedling vigor in both Trial 3 and Trial 4 (Table 4.3.16). Pythium dissotocum-1 and P. irregulare only significantly (P<0.05) reduced seedling vigor in Trial 4 (Table 4.3.16). Tobacco seedlings inoculated with P. myriotylum were consistently associated with significant leaf chlorosis and mortality in both trials (Table 4.3.16). However, P. dissotocum-1 and P. coloratum caused significant (P<0.05) increases in the incidence of leaf chlorosis in Trial 3 (Table 4.3.16). Both P.

146

Xuemei Zhang Chapter 4 147 dissotocum-1 and P. coloratum were associated with significant (P<0.05) mortality in Trial 3, but mortality after inoculation with P. dissotocum-1 at seedling emergence in Trial 4 did not result in a significant increase in mortality (Table 4.3.16).

Table 4.3.16. The effects of water inoculation with individual Pythium species at seedling emergence on seedling vigor, leaf chlorosis and mortality of TN 90LC tobacco seedlings in greenhouse trials. Results are from two greenhouse trials conducted at the Virginia Tech Southern Piedmont AREC, Blackstone, VAz Seedling vigor % Leaf chlorosis incidence (%) Mortality incidence(%) Treatment Trial 3 Trial 4 Trial 3 Trial 4 Trial 3 Trial 4 Uninoculated control 100 ay 92.5 a 0 a 0 a 0 a 0 a Pythium porphyrae 93.8 ab 96.3 a 0 a 0 a 0 ab 6.1 ab Pythium aristosporum 100 a 97.5 a 0 a 0 a 0 a 0 a Pythium catenulatum 100 a 98.8 a 0 a 0 a 0 a 4.2 ab Pythium torulosum 97.5 ab 95 a 0 a 0 a 0 a 6.3 ab Pythium irregulare 93.8 ab 76.3 b* 25 ab 0 a 0. ab 4.1 ab Pythium dissotocum-1 63.8 ab 66.3 b* 50 b* 4.8 a 2.9 bc* 7 ab Pythium coloratum 60 bc* 63.8 b* 50 b* 0 a 7.7 cd* 9.9 b* Pythium myriotylum 25 c* 47.5 c* 100 c* 95 b* 40.7 d* 9.6 b* z Trial 3 was conducted between June 18 and September 6, 2019. Trial 4 was conducted between October 14 and December 19, 2019. y Data presented are means of four replications. Data were transformed prior to statistical analysis, and means presented in the table are back-transformed. Means within a column followed by the same letter(s) are not significantly different in Fisher’s LSD tests, α=0.05. “*” indicates means significantly different from the untreated control.

4.3.6 Consequences of Pythium infections at Water-Root Emergence in

Greenhouse Trials

Pythium species (Table 4.3.8 – 4.3.9) that colonized 10-day-old tobacco seedlings and/or caused disease symptoms on the seedlings in laboratory pathogenicity assays were tested further in greenhouse trials 5 and 6, when bay water was inoculated with Pythium species when the roots of most tobacco seedlings had extended into the bay water below the trays, approximately four weeks after seeding (Table 4.2.2).

147

Xuemei Zhang Chapter 4 148

Impacts on Seedling Roots

Tobacco seedlings inoculated with Pythium myriotylum, P. dissotocum-1, and P. coloratum consistently exhibited significantly (P<0.05) high root rot disease incidence and severity in Trials 5 and 6 (Table 4.3.17). All three species produced oospores in the infected root tissues, but the low number of oospores produced by P. coloratum was not significantly greater than the untreated control (Table 4.3.17).

Table 4.3.17. Effects of float water inoculation with individual Pythium species at water-root emergence on root rot incidence and severity and numbers of oospores in the root tissues of TN 90LC tobacco seedlings. Results are from two greenhouse trials conducted at the Virginia Tech Southern Piedmont AREC, Blackstone, VAz Spore count Root rot incidence % Root rot severity (%) Treatment (per 2mm root tissue) Trial 5 Trial 6 Trial 5 Trial 6 Trial 5 Trial 6 Uninoculated control 0 c 0 c 0 c 0 c 0 c 0 c Pythium porphyrae 0 c 0 c 0 c 0 c 0 c 0 c Pythium torulosum 0 c 0 c 0 c 0 c 0 c 0 c Pythium irregulare 0 c 25 b* 0 c 7 c 0 c 0 c Pythium catenulatum 25 bc 25 b* 12 c 8 c 0 c 0 c Pythium aristosporum 50 b* 25 b* 10 c 10 c 0 c 0 c Pythium coloratum 100 a* 100 a* 59 b* 42 b* 10 bc 4 c Pythium dissotocum-1 100 a* 100 a* 65 b* 51 b* 19 b* 13 b* Pythium myriotylum 100 a* 100 a* 99 a* 99 a* 36 a* 26 a* z Trial 5 was conducted between January 27 and March 23, 2019. Trial 4 was conducted between January 27 and December 19, 2019. y Data presented are means of four replications. Data were transformed prior to statistical analysis, and means presented in the table are back-transformed. Means within a column followed by the same letter(s) are not significantly different in Fisher’s LSD tests, α=0.05. “*” indicates means significantly different from the untreated control.

Inoculation with P. aristosporum at water root emergence caused significant root rot in both trials but did not increase root rot severity or oospore numbers in roots compared to the untreated control. Root rot was observed after water root emergence inoculation with P. catenulatum or P. irregulare in Trial 6, but not in Trial 5; oospores were never observed in root tissues after inoculation with these species at water root emergence. No root rot or Pythium spores were detected in the uninoculated control or seedlings inoculated with P. porphyrae or P.

148

Xuemei Zhang Chapter 4 149 torulosum in these greenhouse trials (Table 4.3.17). When compared with the uninoculated control, only Pythium myriotylum and P. irregulare significantly (P<0.05) reduced the vigor of tobacco seedling roots in Trial 6, and only P. irregulare significantly reduced the root length of tobacco seedlings (Table 4.3.18).

Table 4.3.18. Effects inoculating float water with individual Pythium species at water-root emergence on the vigor, length and weight of roots produced by TN 90LC tobacco seedlings. Results are from two greenhouse trials conducted at the Virginia Tech Southern Piedmont AREC, Blackstone, VAz.. Root vigor (%) Root length (cm) Root weight (g) Treatment Trial 5 Trial 6 Trial 5 Trial 6 Trial 5 Trial 6 Uninoculated control 95 ay 100 a 17.5 a 18.8 a 24.2 a 19.5 a Pythium porphyrae 97.5 a 96.3 ab 16.4 a 17.5 ab 18.7 bcd* 12.8 bc* Pythium torulosum 76.3 a 100 a 15.8 a 18.0 a 21.8 abc 15.4 ab Pythium irregulare 88.8 a 77.5 b* 15.0 a 13.8 b* 22.6 ab 15 b* Pythium catenulatum 68.8 a 96.3 ab 12.9 a 17.2 ab 18.9 abcd 13.9 bc* Pythium aristosporum 61.3 a 100 a 13.0 a 16.9 ab 16.9 cd* 13.5 bc* Pythium coloratum 75 a 85 ab 16.3 a 16.1 ab 17 cd* 10.4 c* Pythium dissotocum-1 76.3 a 92.5 ab 17.7 a 18.2 a 15.2 d* 12.6 bc* Pythium myriotylum 71.3 a 52.5 c* 14.8 a 17.0 ab 5.7 e* 5.3 d* z Trial 5 was conducted between January 27 and March 23, 2019. Trial 4 was conducted between January 27 and December 19, 2019. y Data presented are means of four replications. Data were transformed prior to statistical analysis, and means presented in the table are back-transformed. Means within a column followed by the same letter(s) are not significantly different in Fisher’s LSD tests, α=0.05. “*” indicates means significantly different from the untreated control.

The other Pythium species did not have any significant effect on seedling vigor or seedling root length in the greenhouse Trial 5 or Trial 6. Pythium myriotylum, P. dissotocum-1,

P. coloratum, P. aristosporum, and P. porphyrae significantly (P<0.05) reduced root weight of tobacco seedlings in both trials, and P. catenulatum and P. irregulare also significantly (P<0.05) reduced root weight of tobacco seedlings in Trial 6 (Table 4.3.18).

Impacts on the Aerial Parts of Tobacco Seedlings

Only Pythium myriotylum significantly reduced seedling vigor in greenhouse Trials 5 and

6, while significantly (P<0.05) increasing leaf chlorosis and the incidence of mortality in tobacco

149

Xuemei Zhang Chapter 4 150 seedlings (Table 4.3.19). The other Pythium species did not have any significant effects on seedling vigor, leaf chlorosis incidence, or morality incidence of tobacco seedlings in these greenhouse trials.

Table 4.3.19. The effects of water inoculation with individual Pythium species at water-root emergence on seedling vigor, leaf chlorosis and mortality of TN 90LC tobacco seedlings in greenhouse trials. Seedling vigor % Leaf chlorosis incidence (%) Mortality incidence (%) Treatment Trial 5 Trial 6 Trial 5 Trial 6 Trial 5 Trial 6 Uninoculated control 97.5 ay 98.8 a 0 a 0 a 4 a 4 a Pythium porphyrae 97.5 a 99.5 a 0 a 0 a 6 ab 1 a Pythium torulosum 96.3 a 100 a 0 a 0 a 4.3 a 2.3 a Pythium irregulare 98.8 a 100 a 0 a 0 a 4 a 0 a Pythium catenulatum 97.5 a 100 a 0 a 0 a 1 a 0 a Pythium aristosporum 93.3 a 100 a 0 a 0 a 2 a 2 a Pythium coloratum 100 a 97.5 a 0 a 0 a 2 a 4.1 a Pythium dissotocum-1 100 a 98.8 a 0 a 0 a 4 a 3 a Pythium myriotylum 76.3 b* 80 b* 95 b* 52 b* 13.2 b* 7 a z Trial 5 was conducted between January 27 and March 23, 2019. Trial 4 was conducted between January 27 and December 19, 2019. y Data presented are means of four replications. Data were transformed prior to statistical analysis, and means presented in the table are back-transformed. Means within a column followed by the same letter(s) are not significantly different in Fisher’s LSD tests, α=0.05. “*” indicates means significantly different from the untreated control.

4.3.7 Comparison of Disease Progresses in Greenhouse Trials

Interactions Between Pythium Inoculation and Time

The results of repeated measure ANOVA identified significant differences among the uninoculated control and Pythium inoculation treatments for every variable at every inoculation timing and every “trial” within the three inoculation timings (Table 4.3.20). Treatment effects, however, also changed frequently across the observation dates for all variables (Table 4.3.20).

150

Xuemei Zhang Chapter 4 151

Table 4.3.20. Summary of repeated measures ANOVA results of significant experimental effects over time on seedling stand and vigor, root vigor, root rot incidence and severity on water roots, and on incidence of foliar chlorosis, across greenhouse trials. Results are from six greenhouse trials conducted at the Virginia Tech Southern Piedmont AREC, Blackstone, VA..z Inoculating at seeding Inoculating at 10 DAS Inoculating at 4 WAS Effects Trial 1 Trial 2 Trial 3 Trial 4 Trial 5 Trial 6 TRTy <.0001* <.0001* <.0001* <.0001* <.0001* <.0001* Seedling BLK <.0001* <.0001* <.0001* <.0001* 0.0049* <.0001* stand WAS <.0001* <.0001* <.0001* <.0001* <.0001* 0.0272* counts TRT*WAS <.0001* <.0001* 0.0780 1.0000 0.0020* 0.6442 TRT*BLK <.0001* <.0001* <.0001* <.0001* <.0001* <.0001* TRT <.0001* <.0001* <.0001* <.0001* <.0001* 0.0003* BLK <.0001* 0.0004* <.0001* 0.0002* <.0001* 0.0001* Seedling WAS <.0001* <.0001* <.0001* <.0001* 0.0008* 0.1587 vigor (%) TRT*WAS 0.1749 <.0001* <.0001* <.0001* 0.0212* 0.0232* TRT*BLK <.0001* <.0001* <.0001* 0.0010* 0.0001* 0.0014* TRT <.0001* <.0001* <.0001* <.0001* <.0001* <.0001* BLK <.0001* 0.0019* <.0001* 0.0001* <.0001* <.0001* Root vigor WAS <.0001* 0.0068* <.0001* <.0001* 0.0909 0.0139* (%) TRT*WAS 0.1749 <.0001* 0.4384 <.0001* 0.0908 0.0179* TRT*BLK <.0001* <.0001* <.0001* 0.0007* <.0001* <.0001* TRT <.0001* <.0001* <.0001* <.0001* <.0001* <.0001* root rot BLK 0.1183 0.0507 <.0001* 0.8199 0.0139* <.0001* incidencex WAS <.0001* <.0001* <.0001* <.0001* <.0001* <.0001* (%) TRT*WAS 0.2230 0.0032* 0.1091 <.0001* 0.0244* 0.0087* TRT*BLK 0.0462* 0.0403* <.0001* 0.7904 0.0074* 0.0033* TRT <.0001* <.0001* <.0001* <.0001* <.0001* <.0001* root rot BLK 0.0015* 0.0452* <.0001* 0.3240 0.0060* 0.0039* severityx WAS <.0001* <.0001* <.0001* <.0001* <.0001* <.0001* (%) TRT*WAS 0.4993 <.0001* 0.0080* <.0001* <.0001* <.0001* TRT*BLK <.0001* 0.2347 <.0001* 0.0673 0.0011* 0.0016* TRT <.0001* <.0001* <.0001* <.0001* <.0001* 0.0009* Leaf BLK 0.0012* 0.1962 <.0001* 0.3545 0.2947 0.3959 chlorosis WAS <.0001* <.0001* <.0001* <.0001* <.0001* 0.0080* incidence (%) TRT*WAS 0.0017* <.0001* <.0001* <.0001* <.0001* <.0001* TRT*BLK <.0001* 0.0187* <.0001* 0.5559 0.2162 0.4729 “z” Data presented are probabilities of statistical significance from repeated measures ANOVA. “y” TRT = treatment; BLK = block, . WAS = weeks after seeding; TRT*WAS = treatment*weeks after seeding interaction; TRT*BLK = interaction term for treatments*blocks. “x” = symptom expressions on “water roots” only. Red indicates a significant Interaction between the treatment and time effects.

151

Xuemei Zhang Chapter 4 152

Inoculating at Seeding

Figure 4.3.4. Disease progress and seedling growth changes over time, when inoculating at seeding in Trial 1 (Top) and Trial 2 (Bottom). Both trials were conducted at the Southern Piedmont AREC near Blackstone, VA in 2019: Trial 1 was conducted in June through August 2019, and Trial 2 was conducted in October through December 2019.

152

Xuemei Zhang Chapter 4 153

Bay water was inoculated at seeding in greenhouse Trial 1 (06/04 -08/28/2019). Seeds germinated between the second and third week (10 DAS -3 WAS) after seeding, and water roots first emerged approximately three weeks after seeding. Seeds reached maximum germination approximately 2 weeks after seeding in trial 1, and then the number of seedlings in each tray started to decrease in bays inoculated with P. myriotylum, P. coloratum, P. dissotocum-1, or P. irregulare (Figure 4.3.4). Seedling stand at 1-2 WAS suggested that Pythium myriotylum, P. coloratum or P. dissotocum-1 infected seeds had lower germination compared with the uninoculated control and seeds inoculated with other Pythium species. The number of Pythium coloratum or P. dissotocum-1 inoculated seedlings continued to increase until 4 WAS but started to die-off at that time (Figure 4.3.4).

Ambient air temperature was lower (65 - 100ºF) in the second trial inoculated at seeding

(Trial 2: 10/07-12/19/2019). Seeds germinated between the third week and the sixth week (3-6

WAS) after seeding, and water roots first emerged approximately six weeks after seeding. The seedling stand graph (Figure 4.3.4) indicates fewer seedlings emerged in P. myriotylum and P. dissotocum-1 inoculated bays and that plant mortality accelerated at 7WAS.

Root rot incidence and severity on water roots decreased from 3 WAS to 6 WAS in Trial

1 but increased from 6 WAS to 9WAS (Figure 4.3.4). Ambient air temperature in the glass house decreased from 3 WAS (74 - 120ºF) to 6 WAS (75 -105ºF) and increased from 6 WAS to 9WAS

(78 -118ºF). Seedlings infected with P. myriotylum consistently exhibited high mortality percentage, leaf chlorosis incidence, and root rot incidence and severity, along with low seedling vigor and root vigor in both trials (Figures 4.3.4). The effects of P. myriotylum on seedling leaves and plant size was observed as early as 2 weeks after seeding in Trial 1, 4 weeks after seeding in Trial 2, even before the roots penetrated soil medium in the trays (Figures 4.3.4). The

153

Xuemei Zhang Chapter 4 154 root rot incidence and severity on P. myriotylum, P. coloratum, P. dissotocum, and P. dissotocum-1 inoculated seedlings increased throughout the entire seedling production season

(Figure 4.3.4).

Inoculating at Seedling Emergence

Bay water was inoculated at 10 days after seeding (DAS) in Trial 3 (06/18-09/06/2019), when most tobacco seed had germinated; seedlings had emerged within approximately one week after inoculation (DAI) (Figure 4.3.5). Bay water was also inoculated 10 DAS in Trial 4 (10/14-

12/19/2019); water roots of tobacco seedlings in that fall trial had started to emerge approximately 7 to 10 days after seeding. Tobacco seedlings inoculated with P. myriotylum, P. coloratum, and P. dissotocum-1 started to die at 4 WAS in Trial 3, when root rot incidence reached its peak (Figure 4.3.5). However, no root or above-tray symptoms were present before 4

WAI in Trial 4 (Figure 4.3.5). Seedlings infected with P. myriotylum consistently showed high mortality, leaf chlorosis and root rot incidence and severity, along with low seedling vigor and root vigor in Trial 3 (Figure 4.3.5). Pythium myriotylum, P. dissotocum-1, P. coloratum, and P. irregulare inoculated seedlings started to show increasing incidence and severity of root rot, along with incidence of leaf chlorosis, at 6WAI in Trial 4 (Figure 4.3.5). A sudden air temperature increase from (65 - 90 ºF) to (70 to 100ºF ) was noticed at that time point. Only P. myriotylum caused significant leaf chlorosis in Trial 4 (Figure 4.3.5).

154

Xuemei Zhang Chapter 4 155

Figure 4.3.5. Disease progress and seedling growth changes over time, when inoculating at 10 days after seeding in Trial 3 (Top) and Trial 4 (Bottom). Both trials were conducted at the Southern Piedmont AREC near Blackstone, VA in 2019: Trial 3 was conducted in June through September 2019, and Trial 4 was conducted in October through December 2019.

155

Xuemei Zhang Chapter 4 156

Inoculating at Water Roots Emergence

Bay water was inoculated at four weeks after seeding (WAS) in Trials 5 (conducted

01/27-03/23/2020), when water roots of most tobacco seedlings had emerged (Figure 4.3.6).

Root rot incidence and severity peaked two weeks after inoculation (WAI). Stunting and leaf symptoms started to develop, and seedlings started to die at 2 WAI, when the air temperature suddenly increased from 63 - 94 ºF to 65 - 115 ºF. Tobacco seedlings inoculated with P. myriotylum showed high mortality, leaf chlorosis and root rot incidence and severity, along with low seedling vigor and root vigor (Figure 4.3.6). However, the impact of root rot on seedling health was not as strong as when inoculations were performed at seeding or 10 days after seeding.

Root rot incidence and severity also reached their highest at 2 weeks after inoculation

(WAI) with most Pythium species in Trial 6 (01/30 - 03/24/2020), but disease severity caused by

P. myriotylum continued to increase after 2 WAI (Figure 4.3.6). Only tobacco seedlings inoculated with P. myriotylum were stunted and displayed foliar symptoms, starting at 3 WAI.

Tobacco seedlings inoculated with P. myriotylum showed high mortality, leaf chlorosis and root rot incidence and severity, along with low seedling vigor and root vigor (Figure 4.3.6). Although

P. coloratum and P. dissotocum were also associated with high root rot incidence and severity, these levels of root disease result in significantly affected seedling vigor or leaf health (Figure

4.3.5.3).

156

Xuemei Zhang Chapter 4 157

Figure 4.3.6. Disease progress and seedling growth changes over time, when inoculating at 4 weeks after seeding in Trial 5 (Top) and Trial 6 (Bottom). Both trials were conducted at the Southern Piedmont AREC near Blackstone, VA in January through March 2019.

157

Xuemei Zhang Chapter 4 158

Correlations between Root Rot Incidence and Severity and Vigor of Tobacco Seedlings and

Roots

Correlations between root rot incidence and root rot severity were significant (P<0.01), strong (r = 0.79 to r = 0.84), and positive in all greenhouse trials (Table 4.3.21 – 4.3.23).

Significant (P<0.01) negative correlations between root rot incidence and root vigor were also detected in all the greenhouse trials (Table 4.3.21 – 4.3.23). The strength of the negative correlations between root rot incidence and root vigor were moderate (r=-0.46 - -0.75) when inoculations were performed at seeding or 10 days later, but weak (r=-0.26 - -0.28) when pathogens were applied 4 WAS. Negative correlations between root rot incidence and seedling vigor were also significant (P<0.02) in all the greenhouse trials (Table 4.3.21 – 4.3.23). Negative correlations between root rot incidence and seedling vigor were stronger (r=-0.51 - -0.61) when inoculations were performed earlier, at seeding or 10 DAS, compared to those performed 4 WAS

(r=-0.14 - -0.21) in Trials 5 and 6. The negative correlations between root rot incidence and seedling vigor were also relatively strong (r=-0.58 - -0.78) when Pythium species were inoculated at seeding or at 10 DAS compared to applications 4 WAS (r=-0.24 - -0.29) in Trial 5 and 6.

Significant (P<0.01) correlations between root rot severity and root vigor were detected in all of the greenhouse trials, except in Trial 5 (conducted January to March 2020; P=0.07;

Tables 4.3.21– 4.3.23). Root rot severity and root vigor were relatively strongly (r=0.58 - 0.85) correlated in Trial 1, 2, 3 and 4, and weakly correlated (r=0.22/0.34) in Trial 5 and 6. The correlation between root rot severity and seedling vigor was also significant (P<0.01) in all of the greenhouse trials, regardless of inoculation timing (Table 4.3.21– 4.3.23). Significant (P<0.01) positive correlations between root vigor and seedling vigor were detected in all of the greenhouse trials (Table 4.3.21– 4.3.23). These correlations were stronger (r=+0.58 – +1.0) when Pythium

158

Xuemei Zhang Chapter 4 159 species were inoculated earlier, at seeding or 10 DAS or 4WAS, but relatively weaker (r=+0.58 -

/0.59) when pathogen contact was initiated at seeding.

Table 4.3.21. Pearson correlation coefficients between tobacco seedling and root vigor and root rot incidence and severity after Pythium inoculations at seeding. Vigor Root Rot Seedling vigor Root vigor Incidence Severity Trial 1 Trial 2 Trial 1 Trial 2 Trial 1 Trial 2 Trial 1 Trial 2 Seedling Vigor - - 1.00 0.62 -0.53 -0.51 -0.67 -0.67 Root Vigor 1.00 0.62 - - -0.53 -0.46 -0.67 -0.62 Root Rot Incidence -0.53 -0.51 -0.53 -0.46 - - 0.81 0.81 Root Rot Severity -0.67 -0.67 -0.67 -0.62 0.81 0.81 - - Correlation coefficient (r) values range from -1 to 1, where -1 indicates a strong negative relationship and 1 indicates a strong positive relationship. Correlation coefficient values at or close to 0 indicate weak or no linear relationships. All the relationships presented in this table were significant (P<0.05).

Table 4.3.22. Pearson correlation coefficients between the tobacco seedling and root vigor, and root rot incidence and severity after Pythium inoculations at seedling emergence. Vigor Root Rot Seedling vigor Root vigor Incidence Severity Trial 3 Trial 4 Trial 3 Trial 4 Trial 3 Trial 4 Trial 3 Trial 4 Seedling Vigor - - 0.83 1.00 -0.61 -046 -0.78 -0.58 Root Vigor 0.83 1.00 - - -0.75 -0.46 -0.85* -0.58 Root Rot Incidence -0.61 -0.46 -0.75 -0.46 - - 0.85 0.89 Root Rot Severity -0.78 -0.58 -0.85* -0.58 0.85 0.89 - - Correlation coefficient (r) values range from -1 to 1, where -1 indicates a strong negative relationship and 1 indicates a strong positive relationship. Correlation coefficient values at or close to 0 indicate weak or no linear relationships. * All the relationships presented in this table were significant (P<0.05), except the relationship between root rot severity and root vigor in Trial 5 (P>0.05

Table 4.3.23. Pearson correlation coefficients between the tobacco seedling and root vigor, and root rot incidence and severity after Pythium inoculations four weeks after seeding, when float water roots had grown from greenhouse tray cells into the nutrient solution below. Vigor Root Rot Seedling vigor Root vigor Incidence Severity Trial 5 Trial 6 Trial 5 Trial 6 Trial 5 Trial 6 Trial 5 Trial 6 Seedling Vigor - - 0.58 0.59 -0.14 -0.21 -0.24 -0.29 Root Vigor 0.58 0.59 - - -0.28 -0.25 -0.22 -0.34 Root Rot Incidence -0.14 -0.21 -0.28 -0.25 - - 0.79 0.84 Root Rot Severity -0.24 -0.29 -0.22 -0.34 0.79 0.84 - - Correlation coefficient (r) values range from -1 to 1, where -1 indicates a strong negative relationship and 1 indicates a strong positive relationship. Correlation coefficient values at or close to 0 indicate weak or no linear relationships. All the relationships presented in this table were significant (P<0.05).

159

Xuemei Zhang Chapter 4 160

Comparison of AUDPC (Area Under the Disease Progress Curve)

Root rot index data were calculated from the root rot incidence and severity data collected weekly after water roots of tobacco seedlings had emerged from the bottom of the greenhouse trays into the float water solution beneath the trays. Root rot index data were used for

AUDPC calculation, with the trapezoidal method (Sparks et al., 2008).

Analysis of the AUDPCs in Table 4.3.24 indicates that epidemics caused by P. myriotylum were always significantly (P<0.05) higher than those caused by other Pythium species and the uninoculated control, except for P. coloratum at the latest inoculation date, at 4

WAS. Areas under disease progress curves were significantly higher (P<0.05) than the uninoculated control when P. myriotylum, P. coloratum, P. dissotocum-1, P. irregulare and P. dissotocum were inoculated at seeding (Table 4.3.24). Although P. torulosum, P. aristosporum,

P. inflatum, and P. porphyrae also caused disease on the water roots of tobacco seedlings after inoculation at seeding, their AUDPCs were not significantly different from that of the uninoculated control (Table 4.3.24). Inoculations at 10 DAS (seedling emergence) with P. myriotylum, P. coloratum, and P. dissotocum-1 resulted in AUDPCs that were significantly

(P<0.05) greater than those from P. irregulare, P. torulosum, P. aristosporum, P. porphyrae, P. catenulatum, and the uninoculated control (Table 4.3.24). Inoculations at 4 WAS (water root emergence) with P. myriotylum or P. coloratum (but not P. dissotocum-1) resulted in AUDPCs that were significantly (P<0.05) greater than those from P. irregulare, P. torulosum, P. aristosporum, P. porphyrae, P. catenulatum, and the uninoculated control (Table 4.3.24).

Inoculation with P. dissotocum-1 at 4 WAS resulted in higher AUDPCs than for P. torulosum and the non-inoculated control, but not dissimilar to epidemics caused by P. irregulare, P. aristosporum, P. porphyrae, and P. catenulatum. Although P. torulosum, P. aristosporum, P.

160

Xuemei Zhang Chapter 4 161 porphyrae, and P. catenulatum also caused disease symptoms on the water roots of tobacco seedlings, their AUDPCs were not significantly different from that of the uninoculated control

(Table 4.3.24).

Table 4.3.24. The ANOVA results of disease intensity over time (the area under the disease progress curve, AUDPC), for comparisons across greenhouse trials. Inoculating at seeding Inoculating at 10 DAS Inoculating at 4 WAS Treatment Trial 1 Trial 2 Trial 3 Trial 4 Trial 5 Trial 6 Uninoculated Control 0 a 0 a 0 a 0 a 0 a 0 a Pythium catenulatum - - 40.0 a 0 a 112.5 ab 33.5 ab Pythium porphyrae 0 a 15.0 a 27.5 a 0 a 75.0 ab 12.0 ab Pythium inflatum 20.0 ab 5.0 a - - - - Pythium aristosporum 32.0 ab 9.0 a 37.5 a 5.0 a 112.5 ab 50.5 ab Pythium torulosum 59.0 ab 1.5 a 30.0 a 20.0 a 2.5 a 8.0 a Pythium dissotocum 95.0 b* 76.5 b* - - - - Pythium irregulare 107.5 bc* 47.5 b* 47.5 a 37.0 a 75.0 ab 17.5 ab Pythium dissotocum-1 109.5 bc* 70.0 b* 240.0 b* 119.5 b* 170.0 bc* 72.0 bc* Pythium coloratum 194.0 c* 150.5 c* 260.5 b* 106.5 b* 268.8 cd* 120.0 cd* Pythium myriotylum 700.0 d* 250.0 d* 565.0 c* 180.0 c* 315.0 d* 178.5 d* “*” indicates a significant difference with the uninoculated control in Fisher’s LSD tests, α=0.05, within the column. “DAS” means Days After Seeding, and “WAS” means Weeks After Seeding. Trial 1 and Trial 3 were conducted in Summer 2019. Trial 3 and Trial 4 were conducted in Mid Fall - Mid Winter 2019. Trial 5 and Trial 6 were conducted in Mid-Winter - Early Spring 2020.

4.4 Discussion

4.4.1 Intraspecific Variation within Pythium myriotylum and Pythium

dissotocum

The vegetative growth of microbes is an indicator of their biological fitness because it indicates how fast they expand on a substrate. Most Pythium species can grow saprophytically and their cultures expand quickly on artificial medium (Middleton, 1943, Ho, 2018,

Mostowfizadeh-Ghalamfarsa & Salmaninezhad, 2020, Van der Plaats-Niterink, 1981, Cooke et al., 2000, Levesque & De Cock, 2004, Ho, 2009, Robertson, 1980). However, the vegetative growth rate differs among species (Van der Plaats-Niterink, 1981). The results of vegetative

161

Xuemei Zhang Chapter 4 162 growth comparisons in this study documented little variation in this trait among isolates of

Pythium myriotylum and wide variation among Pythium dissotocum isolates. Significant variation was observed in the mycelial growth rates of Pythium dissotocum isolates on 10% V8 medium, and the virulence tests, suggesting that there was significant intraspecific variation within Pythium dissotocum. The intraspecific variation was not as wide/significant among the isolates of Pythium myriotylum in this study, but this could have been result of relatively small sample size (16) of Pythium myriotylum population in this study.

This type of intraspecific variation is not uncommon in the genus Pythium. Previous studies on vegetative growth and virulence of Pythium populations have revealed high levels of variation within other Pythium species including P. irregulare (Huzar-Novakowiski & Dorrance,

2018), P. cryptoirregulare (Huzar-Novakowiski & Dorrance, 2018), P. aphanidermatum (Al‐

Sa'di et al., 2007, McCarter & Littrell, 1970), P. infestans (Adhikari et al., 2013), P. myriotylum

(Perneel et al., 2006, McCarter & Littrell, 1970), et al. The intraspecific variation in virulence may be associated with the intraspecific variation in the number of CRN (Crinklers) effector in

Pythium species, which is involved in entering host cytoplasm and eliciting necrosis in host tissues (Adhikari et al., 2013).

4.4.2 Pathogenicity and Virulence of Pythium Species on Tobacco Seeds and

Seedlings

The results of the laboratory and greenhouse Pythium inoculation studies suggested that the 12 Pythium species collected in the 2017 tobacco greenhouse survey differed in levels of virulence on tobacco. Based on their virulence on tobacco seeds and seedlings in laboratory and greenhouse simplified float-bed systems, the 12 Pythium species can be categorized into three

162

Xuemei Zhang Chapter 4 163 groups: strong pathogens, weak pathogens, and non-pathogens. The strong pathogens include P. myriotylum, P. dissotocum-1, and P. coloratum, which were highly virulent on tobacco seeds and seedlings, consistently, in all laboratory tests and greenhouse trials. The weak pathogens include

P. aristosporum, P. torulosum, P. porphyrae, P. inflatum, P. irregulare, P. dissotocum, and P. catenulatum, which were virulent on tobacco seeds and/or seedlings but their virulence was significantly lower than that of strong pathogens’ and often fluctuated (inconsistent across experiments). The non-pathogens include P. adhaerens, P. attrantheridium, and P. pectinolyticum, which did not cause any significant symptoms on tobacco seeds or seedlings in this study. These three groups of Pythium species were often clearly separated on the disease progress curve graphs.

Strong Pathogens

The results of laboratory pathogenicity tests showed that Pythium dissotocum-1, P. coloratum, and P. myriotylum were strong pathogens on tobacco seeds, significantly reducing seed germination and rapidly killing newly germinated seedlings with only radicles emerged.

The significant differences in the seedling stand between P. myriotylum and the other three strong pathogens in laboratory seed inoculation tests suggested that the suppressive effect of P. myriotylum on tobacco seeds was weaker than that of P. dissotocum-1, P. irregulare, P. coloratum. The decrease in seedling stand from 7 DAI to 10 DAI suggested that P. myriotylum,

P. coloratum, and P. dissotocum-1 killed or weakened the seedlings rapidly after seed germination. Surviving tobacco seedlings exhibited discoloration and necrosis on radicles

(roots), hypocotyls (stems) and/or cotyledons (leaves), leading to seedling death within a week after seed germination. They were also highly virulent on young tobacco seedlings, consistently colonizing and destroying the epidermis, cortex and endodermis tissues as well as causing

163

Xuemei Zhang Chapter 4 164 significant discoloration and decay of radicles, hypocotyls, and cotyledons, leading to seedling death. Abundant sexual oospores were observed in the radicles, hypocotyls and cotyledons of tobacco seedlings infected with P. myriotylum within 10 days after inoculation. Their presence in the re-isolation cultures confirmed that these Pythium species were mostly likely the disease- causing agents.

Pythium myriotylum, P. dissotocum-1, and P. coloratum significantly reduced percent tobacco seed germination when inoculated at seeding in the greenhouse trials. Tobacco seedlings that germinated from seeds infected with these strong pathogens exhibited significantly higher root rot disease incidence and severity, and numerous oospores were found in infected root tissues. Pythium myriotylum, P. dissotocum-1, and P. coloratum strongly also affected tobacco seedling health when the inoculum was applied at seedling emergence, causing discoloration, necrosis and decaying of roots, stunting, leaf chlorosis and eventually the death of the infected tobacco seedlings. Although Pythium myriotylum, P. dissotocum-1, and P. coloratum all caused significant seedling root rot in the bays that were inoculated at water-root emergence, only P. myriotylum significantly reduced the size of root systems and seedlings plants, root weight while significantly increased the incidence of leaf chlorosis and seedling death. The results of laboratory and greenhouse pathogenicity tests and greenhouse trials (especially when inoculating at the emergence of water roots) suggested that Pythium myriotylum was the most aggressive species among the 12 Pythium species.

Weak Pathogens

Laboratory pathogenicity test results suggested that P. irregulare was highly virulent on tobacco seeds, significantly reducing seed germination and weakening the seedlings rapidly after seed germination. Surviving tobacco seedlings exhibited discoloration and necrosis on radicles

164

Xuemei Zhang Chapter 4 165

(roots), hypocotyls (stems) and/or cotyledons (leaves). However, disease incidence and severity caused by P. irregulare on 10-day-old tobacco seedlings in the laboratory tests was lower and less consistent compared to that caused by the strong pathogens. Additionally, the effects of P. irregulare infection on tobacco seeds and seedlings was significantly smaller than those caused by strong pathogens in greenhouse trials. Therefore, P. irregulare was categorized as a weak pathogen, but it was the most aggressive species in the weak pathogen group.

Laboratory pathogenicity test results suggested that P. aristosporum, P. torulosum, and P. dissotocum were weak pathogens on tobacco seeds; they delayed germination of TN 90LC tobacco seeds and caused root hair loss of germinated seedlings. Pythium aristosporum and P. torulosum were also weak pathogens on young tobacco seedling, causing root hair loss and sometimes discoloration and slight decay of radicles, without apparent hypocotyl or cotyledon symptoms. Pythium aristosporum and P. torulosum sometimes caused mild root rot symptoms with no apparent leaf or stem symptoms in the greenhouse trials across all three growth stages.

Therefore, P. aristosporum and P. torulosum were categorized as weak pathogens. Pythium dissotocum only caused root discoloration on a few seedlings in laboratory tests and it was not present on the re-isolation cultures. Therefore, it was concluded that P. dissotocum was an extremely low-virulence isolate of P. dissotocum impacting tobacco seeds more than seedlings.

Therefore, it was not included in the greenhouse trials for post-seeding inoculations.

Pythium catenulatum was not pathogenic to tobacco seeds, but when it was used to inoculate 10-day-old seedlings in lab, P. catenulatum colonized and damaged the cortex and epidermis tissues, discoloring and decaying radicles, hypocotyls and cotyledons of infected seedlings. Similar to P. aristosporum and P. torulosum, the virulence of P. catenulatum was highly inconsistent across greenhouse trials, regardless of host growth stages. Therefore, it was

165

Xuemei Zhang Chapter 4 166 concluded to be a weak pathogen on tobacco seedlings.

Although P. inflatum and P. porphyrae exhibited an inconsistent and low level of virulence in laboratory seed and/or seedling inoculation tests, these two species did not cause apparent root rot on tobacco transplants or have any significant impact on transplant health at the end of the greenhouse trials. However, the disease progress curves exhibited very low levels of root rot at some points during the seedling production season. Therefore, P. inflatum and P. porphyrae were categorized as weak pathogens with low virulence on tobacco seeds and seedlings.

Non-pathogens

Pythium adhaerens, P. attrantheridium, and P. pectinolyticum were not pathogenic to tobacco seeds, or 10-day-old tobacco seedlings in any laboratory tests because they did not colonize tobacco seeds or newly germinated seedlings (the inoculated seedlings appeared to be healthy and normal); they were also not present in the re-isolation cultures containing seedlings inoculated with these species, or seedlings germinated from seeds inoculated with these species.

Therefore, it was concluded that P. adhaerens, P. attrantheridium, and P. pectinolyticum were non-pathogens on tobacco seeds and seedlings, and thus they were not included in the greenhouse trials.

166

Xuemei Zhang Chapter 4 167

4.4.3 Pathogenic Pythium Species Occurring in Tobacco Transplant

Greenhouses

Highly virulent Pythium species

Pythium myriotylum is known to be an aggressive pathogen on many hydroponically grown crops, including tobacco seedlings, often causing root browning, root rot, stunting, leaf chlorosis, wilting and plant death (Mufunda et al., 2016, Hong et al., 2004, Pantelides et al.,

2017, Stanghellini et al., 1998, Anderson et al., 1997, Sigobodhla et al., 2010, Blancard et al.,

2012, Sutton et al., 2006). Pythium myriotylum is also capable of colonizing and/or infecting multiple grass species (Farr & Rossman). It thrives at 37 ºC and survives at temperatures higher than 40 ºC (Van der Plaats-Niterink, 1981). It has been reported as an aggressive pathogen on tobacco transplants produced in float-bed production systems in Zimbabwe (Mufunda et al.,

2016, Sigobodhla et al., 2010, Mufunda et al., 2017), North Carolina (Gutiérrez et al., 2012) and

South Carolina (Anderson et al., 1997). In the 2017 tobacco greenhouse survey (Chapter 3), P. myriotylum was found in bay water, asymptomatic tobacco seedlings, symptomatic tobacco seedlings, and weedy plants within multiple tobacco greenhouses in Virginia, Georgia,

Maryland, and Pennsylvania. It was reported there was high level of intraspecific variation within P. myriotylum in terms of its virulence on host plants (Perneel et al., 2006, McCarter &

Littrell, 1970). However, only a low level of intraspecific variation within P. myriotylum was observed in this study, based on the difference among 16 P. myriotylum isolates in ITS sequences, mycelial growth rate on 10% V8 agar medium, as well as the virulence on tobacco seeds and seedlings in laboratory tests.

Pythium dissotocum is moderately virulent species on hydroponic grown crops, causing root rot that may be accompanied with stunting, leaf chlorosis, wilting, and/or plant death

167

Xuemei Zhang Chapter 4 168

(Stanghellini & Kronland, 1986, Bates & Stanghellini, 1984, Patekoski & Zottarelli, 2009, Huo et al., 2020, Romero et al., 2012, Bates, 1983, Blancard et al., 2012, Gutiérrez et al., 2012).

Similar to P. myriotylum, P. dissotocum is also capable of colonizing grass species (Farr &

Rossman). Pythium dissotocum favors warm temperatures between 20 and 25 ºC(Van der Plaats-

Niterink, 1981). It has been found in the roots of tobacco transplants produced in float-bed production greenhouses in North Carolina (Gutiérrez et al., 2012), although the virulence of P. dissotocum was found to be low in that study. In the 2017 tobacco greenhouse survey (Chapter

3), P. dissotocum was found in bay water, asymptomatic tobacco seedlings, symptomatic tobacco seedlings, and weedy plants within multiple tobacco greenhouses in Virginia, Georgia,

Maryland, and Pennsylvania (Appendix B, Table S4.1).

Our previous study suggested that a high level of genetic variation might exist in the ITS regions of the P. dissotocum isolates collected in the 2017 tobacco greenhouse survey (Chapter

3). The virulence comparison of the 50 P. dissotocum isolates in this present study suggested intraspecific variation also exists in virulence. Additionally, the two isolates of P. dissotocum used in the laboratory and greenhouse pathogenicity tests consistently displayed significantly different levels of virulence. Those two isolates came from tobacco seedlings either asymptomatic or stunted without root rot or foliar chlorosis, from two different greenhouses.

These two isolates of P. dissotocum may have represented two drastically different populations of P. dissotocum adapted to different locations. The apparent variation in virulence within P dissotocum suggests that some isolates or biotypes may be of concern, while others may not.

Pythium coloratum causes root rot and damping-off on a wide range of plants and has also been recovered from run-off water from and growth medium in hydroponic greenhouses

(Gull et al., 2004). Pythium coloratum shares similar cardinal temperatures and morphological

168

Xuemei Zhang Chapter 4 169 characteristics with P. dissotocum, and only differs from P. dissotocum by the occasional presence of diclinous antheridia and branched antheridial stalks (Van der Plaats-Niterink, 1981).

Both P. dissotocum and P. coloratum belong to Pythium Clade B2 cluster and are so closely related that their differences are often not well-detected by ITS1/4 primers (Levesque & De

Cock, 2004, Punja & Rodriguez, 2018, Robideau et al., 2011). In the 2017 tobacco greenhouse survey (Chapter 3), P. coloratum was found in bay water, asymptomatic tobacco seedlings, and stunted tobacco seedlings within multiple tobacco greenhouses in Virginia.

Pythium species with low virulence

In this study, P. aristosporum, P. torulosum, P. inflatum, P. irregulare, P. catenulatum,

P. porphyrae, and an isolate of P. dissotocum appeared to have low virulence on tobacco seeds and/or newly germinating seedlings. They were capable of delaying tobacco seed germination and colonizing newly germinating seedlings but did not consistently cause significant discoloration or necrosis on tobacco seedling roots. Even when these weak pathogens did cause root symptoms on tobacco seedlings, the stems or leaves of the infected seedlings were not affected. These species are also pathogenic to a wide range of plant species (Farr & Rossman). It is common for some of these species to colonize the root tissues without causing any apparent symptoms or cause root dysfunction that only becomes symptomatic when the hosts are under stress (Hodges & Coleman, 1985, Feng & Dernoeden, 1999, Kerns & Tredway, 2008). In 2017 tobacco greenhouse survey (Chapter 3), P. aristosporum, P. torulosum, P. inflatum, P. irregulare, and P. catenulatum were mainly found in bay water, weedy plants, or organic mixtures found on the floor of the center walkway within a few tobacco greenhouses in Virginia, although P. catenulatum and P. porphyrae were also found on asymptomatic tobacco seedlings in two separate greenhouses, and P. porphyrae was also found in stunted and root rot tobacco

169

Xuemei Zhang Chapter 4 170 seedlings in a different greenhouse (Chapter 3).

Pythium catenulatum usually causes root rot and blight on several plant families, including the grass family and nightshades, where tobacco belongs, but there is no report on the presence of P. catenulatum on tobacco (Chapter 3). The virulence of P. catenulatum is often low to medium, sometimes colonizing hosts without causing apparent root diseases (Sánchez &

Gallego, 2001, Chellemi et al., 2000, Roudsary et al., 2010). Pythium porphyrae is pathogenic to seaweeds, and the seedlings of a variety of crops including carrots, Napa cabbage, radish, rice, cucumber, onion, and pumpkin (Klochkova et al., 2017, Kawamura et al., 2005, Dumilag, 2019,

Van der Plaats-Niterink, 1981). Pythium porphyrae caused root rot on those crop species and killed carrot, Napa cabbage, radish, and rice seedlings completely. Klochkova et al.’s (2017) study provided evidence to support their hypothesis that terrestrial run-off water could be a source of the P. porphyrae inoculum initiating red-rot disease in seaweed farms and suggested that P. porphyrae might have more hosts in addition to seaweed.

4.4.4 Factors Contributing to the Symptom Variability of Pythium Diseases

among Tobacco Greenhouses

The symptoms of Pythium diseases often vary among greenhouses. Previous researchers also documented the symptom variability of Pythium diseases in other hydroponic crop production systems, and those studies suggested the symptom variability may be dependent on the species of Pythium pathogens occurred in different greenhouses (Blancard et al., 2012), the balance between new root production and the proportion of infected roots, the environment condition, as well as the growth status of host plants (Zitnick-Anderson, 2014, Blancard et al.,

2012, Grabowsk, 2018, Hodges, 2003). We reasoned three possible factors that may contribute to

170

Xuemei Zhang Chapter 4 171 this symptom variability among tobacco greenhouses, based on our understanding of float greenhouse tobacco transplant production systems and the disease triangle (Francl, 2001). These three factors include pathogen species, host stages and environmental conditions. The results in this study provided strong evidence to support our hypotheses: pathogen (Pythium) species, host

(tobacco) growth stages, and environmental conditions are three important factors that can cause symptom variability of Pythium diseases among tobacco greenhouses. Our results also suggested the symptom variability was under the influence of the complicated interactions among these three factors.

Pathogen Species

Previous studies have revealed that different species of Pythium can be drastically different in their behaviors toward host plants and the symptoms they cause on host plants

(Gutiérrez et al., 2012, Rey et al., 1998, Asran & Abd-Elsalam, 2020, Abd-Elsalam, 2020).

Blancard et al. (2012) summarized the symptom differences caused by Pythium species differences on tomato in hydroponic production greenhouses (Chapter 2). What we observed in this study was consistent with those conclusions.

Our previous study showed that Pythium species occurring in tobacco transplant greenhouses are highly diverse (Chapter 3). The results of the laboratory and greenhouse pathogenicity tests in this present study suggested that different species exhibited significantly different levels of virulence on the same variety (cultivar) of tobacco seeds and seedlings. Such trends (virulence differences) were consistent across a series of experiments, regardless of the growth stage of tobacco host or environmental conditions. Therefore, our results provide strong evidence supporting our hypothesis that the species difference of Pythium occurring in different tobacco greenhouses is likely to be the reason why the symptoms of Pythium diseases are

171

Xuemei Zhang Chapter 4 172 variable among tobacco greenhouses.

Host Stages

The results of this study demonstrated that early inoculations tend to cause higher

Pythium disease pressure in tobacco greenhouses. Beyond that, the virulence of some of those

Pythium species was influenced by the timing of infection at different host growth stages during the tobacco seedling production season, while that of others was not. The effects of low virulence pathogens (P. inflatum and P. porphyrae) on tobacco transplants were generally consistent across the three growth stages when inoculations were performed in our tobacco greenhouse trials: any effects on tobacco transplants at the end of the production season were not apparent. The effects of inoculation with the highly virulent pathogen P. myriotylum were also consistent across the three growth stages involved in our tobacco greenhouse trials. Pythium myriotylum was the only species that consistently caused aerial symptoms (leaf chlorosis, stunting and seedling death) across all three growth stages, although P. myriotylum, P. dissotocum-1, and P. coloratum all consistently caused severe root rot when introduced at any of the growth stages in our greenhouse trials. The aerial symptoms caused by P. dissotocum-1, and

P. coloratum were different among growth stages: severe at early stages (seeding) but not at the latest stage (water-root emergence). However, the effects of the medium-virulence pathogen P. irregulare varied among growth stages at inoculation, with higher disease pressure resulting from inoculation at seeding compared to other, later, growth stages (seeding emergence or water- root emergence). Similarly, P. dissotocum was a medium-virulence pathogen on tobacco seeds but not virulent on newly germinated seedlings. Additionally, significant interactions were detected between the effects of inoculation with the various Pythium species evaluated in this research and time. Further analysis will be required in order to specifically characterize the

172

Xuemei Zhang Chapter 4 173 nature of these interactions.

Environmental Conditions

Pythium species with lower virulence (P. irregulare, P. dissotocum, P. torulosum, and P. aristosporum) showed inconsistent effects on tobacco seeds and germinated seedlings in the greenhouse trials, when inoculating at seeding. Such discrepancies may be due to the difference in air temperature and day length between these two (inoculation at seeding) trials. Trial 1 was conducted between 4 June 2019 and 29 August 2019; Trial 2 was conducted between 7 October

2019 and 19 December 2019 (Table 4.2.2). Although heating mats were used to maintain the bay water temperature around 80 ºF, the difference in air temperature and daytime length between

June-August 2019 and October-December 2019 could have affected seedling growth, and that may have influenced interactions between tobacco seedlings and the low virulence Pythium species in the greenhouse trials in this study.

The results (Table 4.3.24) of AUDPC comparison also suggested that disease pressure in the greenhouse pathogenicity trials was higher when trials were conducted in the summer than those conducted in Fall and Winter. The differences in disease pressure or level may be under the influence of environmental temperatures. The virulence of P. myriotylum is positively correlated with the temperature of bay water in float-bed hydroponic tobacco transplant production greenhouse systems (Fortnum et al., 2000). In this study, the bay water temperature was maintained at 80 ºF, and greenhouse air temperatures were maintained between 70 and 100 ºF.

Although it was not likely that the differences in disease pressure across the trials conducted in different seasons were associated with bay water temperature in this study, the differences in air temperature in different seasons may have affected the disease pressure caused by P. myriotylum in an indirect way. The growth and metabolism of tobacco seedlings are constantly under the

173

Xuemei Zhang Chapter 4 174 influence of environment temperature, including water and air temperatures in float-bed production systems, which may affect the response of tobacco seedlings to P. myriotylum.

Relationships between Below-tray (Root) Symptoms and Above-tray (Leaf/Stem)

Symptoms

The correlation analysis results showed that the vigor of tobacco seedlings was significantly and strongly correlated with the vigor of their roots. The vigor of tobacco seedlings or seedling roots were also significantly and strongly correlated with the incidence and severity of Pythium root rot. Those results suggested that Pythium root rot had a significant impact on the growth of tobacco seedling and seedling roots. The fact that such correlations were stronger when inoculations were performed at seeding or 10 DAS, and relatively weak when inoculations were delayed until 4WAS, suggested that the impact of Pythium root rot on tobacco seedlings was stronger when the inoculum was applied at seeding or seedling emergence, and relatively weak when the inoculum was applied at water root emergence, approximately the crop phenology stage when seedling roots emerged from the bottom of greenhouse tray cells into the nutrient solution below, providing resources for the rapid growth of stems and leaves necessary to produce seedlings that will survive and thrive once transplanted into production fields.

4.5 Conclusions

This study investigated the pathogenicity and virulence of 12 described Pythium species collected from a recent tobacco transplant greenhouse survey. Virulence on tobacco seeds and seedlings varied among the species, suggesting three virulence categories: strong pathogens, weak pathogens, and non-pathogens. The strong pathogens included P. myriotylum, P. dissotocum-1, and P. coloratum, which consistently suppressed tobacco seed germination and

174

Xuemei Zhang Chapter 4 175 caused severe root discoloration and decay on newly germinating tobacco seedlings, leading to stunting, leaf chlorosis, wilting and seedling death. The strong pathogens were detected in bay water, both asymptomatic and symptomatic tobacco seedlings, and/or weedy plants within multiple tobacco greenhouses in Virginia, Georgia, Maryland, and/or Pennsylvania. Weak pathogens included P. aristosporum, P. torulosum, P. inflatum, P. irregulare, P. catenulatum, P. porphyrae, and an isolate of P. dissotocum. These weak pathogens sometimes delayed seed germination and caused root discoloration and decay on infected tobacco seedlings, but the stems and leaves of tobacco seedlings infected with these weak pathogens appeared normal and healthy. The weak pathogens were mainly isolated from bay water, weedy plants, and organic mixtures on the floor of the center walkway within a few tobacco greenhouses in Virginia. Non- pathogenic Pythium species in this study included P. adhaerens, P. pectinolyticum, and P. attrantheridium. These non-pathogenic Pythium species never caused any significant symptoms on tobacco seeds or seedlings in our experiments. The non-pathogens were mainly isolated from bay water or weedy plant samples in the 2017 tobacco greenhouse survey. High levels of diversity were observed in the virulence and vegetative growth of Pythium dissotocum populations in this study. A lower level of diversity was observed in the virulence and vegetative growth of Pythium myriotylum populations. The results of this study also suggested that greenhouse environmental conditions, particularly temperature, as well as the interactions between host growth stages and Pythium infection, may influence Pythium disease severity.

However, further tests with experimental designs targeting these two factors are needed to test these hypotheses.

175

Xuemei Zhang Chapter 5 176

Chapter 5

Pythium Community Ecology: Interspecific Interaction

Abstract

Multiple species of Pythium are known to cause root rot and/or damping-off in hydroponic greenhouse production of tobacco seedlings, lettuce, tomato, and many other crops and theses Pythium species can coexist in a(n) environment or host. A recent survey of 41 tobacco transplant greenhouses revealed that the Pythium communities living in tobacco transplant production greenhouses are diverse. Twelve described Pythium species were discovered in the survey, where P. myriotylum was the second most common species (found in bay water, tobacco seedlings, and weedy plants in multiple greenhouses), as well as the most aggressive species on tobacco seeds and seedlings. During the survey, Pythium myriotylum was found to coexist with other Pythium (P. adhaerens, P. catenulatum, P. dissotocum, P. pectinolyticum, or P. porphyrae), or oomycete (Saprolegnia species or Achlya flagellata) in bay water, and a fungal species (Mortierella hyalina) in tobacco seedling samples in multiple greenhouses. Dual culture and co-inoculation assays were conducted in this study in order to investigate interactions between P. myriotylum and the other species that naturally coexist with

P. myriotylum at the same sites within tobacco greenhouses. Significant interactions between P. myriotylum and some of the coexisting species were observed in this study. Pythium catenulatum, Pythium pectinolyticum, Pythium adhaerens, and Pythium porphyrae formed clear zones around their colonies on the dual cultures. Numbers of oospores and hyphae decreased as

176

Xuemei Zhang Chapter 5 177

P. myriotylum approached the clear zones. Consistent results suggested the interaction between

P. myriotylum and P. catenulatum significantly increased the 48-hr growth rate of P. myriotylum, while the interaction between P. myriotylum and Achlya flagellata or P. dissotocum-3 significantly reduced the 48-hr growth rate of P. myriotylum. The interaction between P. myriotylum and P. porphyrae significantly reduced the virulence of P. myriotylum on tobacco seeds and seedlings, and the interaction between P. myriotylum and Achlya flagellata or P. adhaerens significantly increased the virulence of P. myriotylum on tobacco seeds and seedlings.

The outcome of this study documented the interspecific interactions occurring within these

Pythium communities and demonstrated how such interactions might impact Pythium diseases on tobacco seeds and germinated seedlings.

5.1 Introduction

Pythium species are one of the most common and problematic pathogens occurring in hydroponic crop production systems due to their preference for aquatic environmental conditions

(Pfeufer & Hinton, 2017, Gutiérrez & Melton, 2001, Gutiérrez et al., 2012, Anderson et al.,

1997, Sutton et al., 2006, Blancard et al., 2012, Stouvenakers et al., 2019). As a genus within the class Oomycetes, the so-called “water molds”, Pythium species produce motile asexual zoospores that move freely and actively in water (Thines, 2014, Beakes et al., 2012,

Stouvenakers et al., 2019). Therefore, hydroponic environments are conducive to Pythium species, facilitating the infection, dissemination, and reproduction of these microbes in various hydroponic crop production systems.

The genus Pythium consists of a large proportion of saprophytic species living in soil and aquatic environments and a small proportion of pathogenic species that are parasitic on microbes,

177

Xuemei Zhang Chapter 5 178 plants, and animals (Middleton, 1943, Ho, 2018, Mostowfizadeh-Ghalamfarsa & Salmaninezhad,

2020, Van der Plaats-Niterink, 1981, Cooke et al., 2000, Levesque & De Cock, 2004, Ho, 2009,

Robertson, 1980). Pathogenic Pythium species can also live saprophytically on dead host tissues after they kill the host (Matthews, 1931). Little is known about the roles of different Pythium species in the Pythium communities living in hydroponic crop production greenhouses, and it is not clear how interspecific interactions occurring within these Pythium communities might impact Pythium diseases in hydroponic ecosystem.

Previous research revealed that multiple Pythium species often coexist in an environment or host plants, and the virulence of these species can be significantly different (Ho, 2009,

Mostowfizadeh-Ghalamfarsa & Salmaninezhad, 2020, Lookabaugh et al., 2017, Lee & Hoy,

1992). Gutierrez et al. (2012) and Mufunda et al. (2017) found that Pythium root rot of tobacco seedlings grown in float-bed hydroponic greenhouses was often associated with multiple species of Pythium finding significant interspecific variation in virulence in North Carolina and

Zimbabwe, respectively. Pythium species can form disease complexes with fungal pathogens such as Fusarium and Rhizoctonia species, and with nematodes such as Meloidogyne incognita, or form disease complexes with other Pythium species coexisting in the same environment or crop (DeVay et al., 1982, Lumsden et al., 1976, Harvey et al., 2008, Pemberton et al., 1998,

Karthikeyan et al., 2000). When the latter happens, Pythium species can form species complexes due to gene flow between species (Blancard et al., 2012), and substantial intraspecific variation may be conserved in a single species (Robideau et al., 2011). Based on models of competition, competing species may coexist when intraspecific competition exceeds interspecific competition, which can be explained by abiotic niche differentiation (Mills & Bever, 1998).

A comprehensive research study on the composition and diversity of Pythium

178

Xuemei Zhang Chapter 5 179 communities in tobacco transplant greenhouses was conducted in 2017 (Chapter 3). Forty-one tobacco transplant production greenhouses were surveyed in Virginia and three nearby states, and 12 described Pythium species were collected from bay water samples, asymptomatic tobacco seedlings, tobacco seedlings showing typical Pythium disease symptoms, weedy plants and organic-debris-dirt mixes on a center walkway within the surveyed tobacco greenhouses. Those

12 species included P. dissotocum, P. myriotylum, P. catenulatum, P. coloratum, P. adhaerens,

P. irregulare, P. aristosporum, P. attrantheridium, P. inflatum, P. pectinolyticum, P. porphyrae and P. torulosum. Pythium myriotylum was found to be the second largest species in the survey collection (Chapter 3), and P. myriotylum was the most aggressive species on tobacco seeds and seedlings (Chapter 4). Pythium myriotylum coexisted with other Oomycete species in the nutrient solution (bay water) of eight float-bed tobacco transplant production greenhouses, including P. adhaerens, P. catenulatum, P. dissotocum, P. pectinolyticum, P. porphyrae, Saprolegnia species and Achlya flagellata. Pythium myriotylum was also found to coexist with Mortierella hyalina in tobacco seedling samples in a different greenhouse. However, how P. myriotylum may interact with the other Pythium species and oomycetes in the survey, or how would such interactions have any impacts on tobacco seedling health are unclear.

The objective of this study was to investigate the interactions between P. myriotylum and the other Pythium species that naturally coexisted with P. myriotylum in the same environment within the surveyed tobacco greenhouses by conducting in vitro and in vivo interspecific interaction assays. Of particular interest was the possible influence of such interactions on vegetative growth and spore production of P. myriotylum on V8 growth medium, as well as interaction effects on the virulence of P. myriotylum on tobacco seeds and seedlings in simplified hydroponic environments.

179

Xuemei Zhang Chapter 5 180

5.2 Materials and Methods

5.2.1 Inoculum and Tobacco Seed Preparation

All the Pythium isolates used in this study originated from the 2017 tobacco greenhouse survey (Chapter 3). The viable isolates that coexisted with P. myriotylum at the same site in the

2017 survey included one isolate of P. catenulatum, one isolate of P. pectinolyticum, one isolate of P. porphyrae, one isolate of Achlya flagellata, two isolates of P. adhaerens, and three isolates of P. dissotocum that were recovered from bay water samples, as well as one isolate of

Mortierella hyalina that was isolated from a symptomatic tobacco seedling. A Pythium myriotylum isolate (A20) that was highly virulent on tobacco seeds and seedlings in the previous pathogenicity tests (Chapter 4) was used to represent P. myriotylum in the interspecific interaction experiments.

Pythium inoculum used in this study was prepared by cutting the hyphal tips from active

10-day-old cultures of Pythium species on 10% V8 medium using a 7.5 mm diameter cork borer.

The mycelial growth and sporulation on the resulting cultures were observed with a compound microscope (Motic AE2000, Hong Kong) to confirm the purity and maturity status (sporulation) of each isolate. Pelleted tobacco TN 90LC seeds (Workman Tobacco Seed Inc., KY) used in the co-inoculation experiments were from the same seed batch.

5.2.2 in vitro Interspecific Interaction Assays

Two types of interspecific interaction assays were conducted in this study, in order to investigate the interactions between P. myriotylum and other Pythium, oomycete, or fungal species that naturally coexisted with P. myriotylum in the same environment within tobacco transplant production greenhouses in the 2017 survey. The first type of interaction assays were

180

Xuemei Zhang Chapter 5 181

“dual culture assays”, performed on artificial growth media (10% V8 agar medium) with the aim to observe mycelial interactions between Pythium myriotylum and other species, and to evaluate the effects of such interspecific interactions on the mycelial growth and reproduction of P. myriotylum on V8 growth medium.

Dual Culture Assays of Pythium myriotylum and other species on V8 Growth Medium

Dual culture assays were performed on 10% V8 agar medium at 27 ºC in order to observe interactions between Pythium myriotylum and other Pythium, oomycete, or fungal species that naturally co-occurred with P. myriotylum in the 2017 survey (Chapter 3). The experimental subjects included a highly virulent Pythium myriotylum isolate (A20), a P. catenulatum isolate, a

P. pectinolyticum isolate, a P. porphyrae isolate, an Achlya flagellata isolate, two P. adhaerens isolates, and three P. dissotocum isolates, as well as a Mortierella hyalina isolate collected in the survey.

Each isolate was transferred to four 100 mm x 15 mm plates of 10% V8 agar medium before the dual culture assays in order to determine the natural vegetative growth rates of the tested isolates. Hyphal tips were cut using a 7.5 mm diameter cork borer from original active 10- day-old cultures and agar plugs were placed on new 10% V8 agar plates. Cultures were then stored at 27 ºC. The radius of mycelial growth (excluding the radius of the agar plug) was measured in centimeters at 24 and 48 hours after culture transfer; four measurements were taken from each plate. The experiment used a RCBD with four replications, and the entire experiment was repeated once under the same experimental conditions.

181

Xuemei Zhang Chapter 5 182

Table 5.2.1. Treatments in the dual culture assays. Treatments Position 1 Position 2 Control Pythium myriotylum No isolate 1 Pythium myriotylum Pythium myriotylum 2 Pythium myriotylum Mortierella hyalina 3 Pythium myriotylum Achlya flagellata 4 Pythium myriotylum Pythium catenulatum 5 Pythium myriotylum Pythium pectinolyticum 6 Pythium myriotylum Pythium porphyrae 7 Pythium myriotylum Pythium adhaerens-1 8 Pythium myriotylum Pythium adhaerens-2 9 Pythium myriotylum Pythium dissotocum-1 10 Pythium myriotylum Pythium dissotocum-2 11 Pythium myriotylum Pythium dissotocum-3

During the dual culture assays, two positions were marked on each new 100 mm x 15 mm 10% V8 agar plate: a random straight line that passed through the center of the agar plate with two endpoints lying on the circle. Position one was at one of the endpoints, and position two was at the other endpoint. Pythium myriotylum and one isolate of another Pythium species,

Achlya flagellata, or Mortierella hyalina were transferred to position one and position two respectively (Table 5.2.1), by cutting the hyphal tips from original active 10-day-old cultures using a 7.5 mm diameter cork borer and placing an agar plug on a new 10% V8 agar plate. The cultures were then stored at 27 ºC. The radius of mycelial growth was measured in centimeters at

24 and 48 hours after culture transfer; four measurements were taken from each plate. The experiment used a RCBD with four replications, and the entire experiment was repeated once under the same experimental conditions. Mycelial interactions were observed with a Leica DME compound microscope.

182

Xuemei Zhang Chapter 5 183

5.2.3 in vivo Interspecific Interaction Assays

The second type of interaction assay was a “co-inoculation assay”, performed in sterile

Petri dishes filled with sterile distilled water (SDW), with the aim to observe the effects of the interspecific interactions between P. myriotylum and other species on tobacco seeds in a simplified hydroponic environment, and to evaluate the effects of the interspecific interactions on the virulence of P. myriotylum on tobacco seeds.

Co-inoculation of Tobacco Seeds with Pythium myriotylum and other species in Petri dishes

A series of co-inoculation experiments were also performed to observe interactions between Pythium myriotylum and other Pythium, oomycete, or fungal species that naturally co- occurred with P. myriotylum in the 2017 survey. In the co-inoculation experiments, 60 mm x 15 mm Petri dishes (Fisherbrand, Pittsburgh, PA) filled with 5 ml of SDW were used as “tiny bays”, where 20 tobacco seeds were placed in the SDW.

Figure 5.2.1. The design of the co-inoculation experiments. It includes two factors, inoculation treatment and treatment time.

183

Xuemei Zhang Chapter 5 184

The co-inoculation experiments (Figure 5.2.1) used a complete factorial design with two factors, inoculation treatment (Table 5.2.2) and inoculation timing (Table 5.2.3). Inoculum was prepared by cutting the hyphal tips from original active 10-day-old cultures using a 7.5 mm diameter cork borer. P. myriotylum inoculum was applied by placing an agar plug of inoculum in a tiny bay, and the inoculum of the other species (Neighbor Isolate, NI) was applied either by rubbing 20 seeds with 2 grams of inoculum, or by placing an agar plug inoculum in a tiny bay.

Table 5.2.2. Species combination treatments in the co-inoculation experiments. Treatment Primary Pathogen Neighbor Isolate, NI Uninoculated control N/A N/A Positive control Pythium myriotylum N/A 1 N/A Mortierella hyalina 2 N/A Achlya flagellata 3 N/A Pythium catenulatum 4 N/A Pythium pectinolyticum 5 N/A Pythium porphyrae 6 N/A Pythium adhaerens-1 7 N/A Pythium adhaerens-2 8 N/A Pythium dissotocum-1 9 N/A Pythium dissotocum-2 10 N/A Pythium dissotocum-3 11 Pythium myriotylum Mortierella hyalina 12 Pythium myriotylum Achlya flagellata 13 Pythium myriotylum Pythium catenulatum 14 Pythium myriotylum Pythium pectinolyticum 15 Pythium myriotylum Pythium porphyrae 16 Pythium myriotylum Pythium adhaerens-1 17 Pythium myriotylum Pythium adhaerens-2 18 Pythium myriotylum Pythium dissotocum-1 19 Pythium myriotylum Pythium dissotocum-2 20 Pythium myriotylum Pythium dissotocum-3

The 22 inoculation treatments included an uninoculated control, where there were only tobacco seeds and SDW sealed in Petri dishes; a positive control, where only P. myriotylum

184

Xuemei Zhang Chapter 5 185 inoculum was applied in the tiny bay; 10 treatments involving sole application of NIs Pythium species; and 10 combinations of P. myriotylum with NIs Pythium species (Table 5.2.2).

Table 5.2.3. Inoculum application time in the co-inoculation experiments. Inoculum Timing 1 Timing 2 Timing 3 Timing 4 24 hours before Neighbor Isolate seeding: At seeding At seeding At seeding (Inoculum 2) rubbing the seeds with Inoculum 2 3 days after Pythium myriotylum At seeding At seeding 5 days after seeding seeding

At inoculation timing 1, both P. myriotylum inoculum and NI inoculum were applied in

SDW at seeding (Figure 5.2.1, Table 5.2.2). At timing 2, tobacco seeds were pre-treated with NI, and P. myriotylum inoculum was applied in SDW at seeding (Figure 5.2.1, Table 5.2.2). NI inoculum was applied to SDW at seeding, at timing 3 and 4 (Figure 5.2.1, Table 5.2.2).

However, Pythium myriotylum inoculum was applied in SDW three days after seeding at timing

3, but five days after seeding at timing 4 (Figure 5.2.1, Table 5.2.2).

The experiments used a factorial RCBD with four replications (blocks), where all 22 treatments and 4 treatment times (88 Petri dishes) were randomized and laid down without stacking within blocks. The block was arranged based on the distance from the experimental units to the air-conditioning unit and windows in the growth chamber room. The co-inoculation experiments were repeated once under the same experimental conditions. Data were collected 10 days after seeding. The number of tobacco seedlings was counted and divided by the total number of seeds in each tiny bay (20) to calculate percent seed germination. A 0-5 scale was also used to evaluate the severity of root rot, where 0 indicates healthy with no apparent symptoms, 1 indicates less than 25% radicle (root) discoloration with no radicle decaying or other symptoms,

2 indicates 25-50 % radicle discoloration with less than 25% radicle decay but no other symptoms, 3 indicates more than 50 % radicle discoloration with 25 - 50% radicle decay but no 185

Xuemei Zhang Chapter 5 186 other symptoms, 4 indicates more than 50% radicle discoloration and more than 50% radicle decay, along with damping-off and chlorosis of cotyledons (leaves), and 5 indicates completely seedling death, or no seed germination. Then the root rot disease severity index (DSI) was calculated using the formula (where NRi indicates number of seedlings showing the corresponding disease level i; i ranges from 0 to 5):

(0 × N ) + (1 × N ) + (2 × N ) + (3 × N ) + (4 × N ) + (5 × N ) DSI (%) = R0 R1 R2 R3 R4 R5 × 100% 5 × Ntotal

5.2.4 Data Analysis

Mycelial growth measurements were analyzed using JMP 14 Pro with Two-way

ANOVA-Fisher’s LSD (for parametric data) or Wilcoxon each pair comparison (nonparametric data), with the significance (alpha) level set at 0.05. Data that did not meet ANOVA assumptions were log- or arcsine-transformed before analyses. Data presented that were transformed for statistical analyses are back-transformed in the reported results. Data that did not meet ANOVA assumptions after transformation were categorized as nonparametric data.

5.3 Results

5.3.1 Dual Culture Assays Mycelial Growth of Each Isolate on 10% V8 Medium

The results (Table 5.3.1) showed that when the isolates were cultured on 10% V8 medium at 27 ºC, Pythium pectinolyticum, P. adhaerens, and P. porphyrae grew as slowly as 0.1 cm/48 hours. The mycelial growth rate of P. myriotylum 48 hours post-inoculation was the highest, followed by P. dissotocum isolate 1, P. dissotocum isolate 3, and Achlya flagellata.

186

Xuemei Zhang Chapter 5 187

Table 5.3.1. Mycelial growth measurements of Pythium species, Achlya flagellata and Mortierella hyalina Isolates on 10% V8 agar medium at 27 ºC. Mycelial growth at 24 hours (cm) Mycelial growth at 48 hours (cm) Treatments Experiment 1 Experiment 2 Experiment 1 Experiment 2 Pythium pectinolyticum 0 a* 0 a 0.1 a 0.1 a Pythium adhaerens-1 0 a 0 ab 0.1 a 0.1 a Pythium porphyrae 0 a 0.1 b 0.1 a 0.2 a Pythium adhaerens-2 0.1 a 0.1 ab 0.1 a 0.1 a Pythium catenulatum 0.2 b 0.2 c 0.6 b 0.5 b Mortierella hyalina 0.3 c 0.5 d 0.9 c 1.0 c Pythium dissotocum-2 0.9 d 0.8 e 2.3 d 2.1 d Pythium myriotylum 1.3 e 1.3 fg 4.7 f 4.6 f Pythium dissotocum-1 1.4 f 1.3 g 3.6 e 3.4 e Achlya flagellata 1.5 f 1.2 f 3.6 e 3.3 e Pythium dissotocum-3 1.6 g 1.3 g 3.6 e 3.3 e * data were mean values of four replications. Data followed by the same letters were not significantly different in Fisher’s LSD tests, α=0.05.

Mycelial Growth on Dual Cultures

Co-culturing two agar plugs of P. myriotylum from the same isolate increased the mycelial growth of P. myriotylum significantly (P<0.01) within 24 hours (Table 5.3.2). When compared with culturing with P. myriotylum alone, co-culturing with P. catenulatum significantly (P<0.01) increased the mycelial growth of P. myriotylum on 10% V8 agar medium in 48 hours, in both experiments (Table 5.3.2). Co-culturing with other Pythium species, Achlya flagellata, or Mortierella hyalina significantly (P<0.01) reduced the mycelial growth of P. myriotylum on 10% V8 agar medium in 24 hours (Table 5.3.2). Co-culturing with Achlya flagellata or P. dissotocum Isolate 3 consistently caused a significant (P<0.01) reduction in the mycelial growth of P. myriotylum in 48 hours (Table 5.3.2).

187

Xuemei Zhang Chapter 5 188

Table 5.3.2. Mycelial growth measurements of Pythium myriotylum in dual culture assays. Mycelial growth at 24 hours (cm) Mycelial growth at 48 hours (cm) Treatments Experiment 1 Experiment 2 Experiment 1 Experiment 2 Pythium myriotylum 1.6 a* 1.8 a 4.8 b 4.8 ab w/ Pythium myriotylum Control: Pythium myriotylum 1.3 b 1.4 b 4.7 bcd 4.6 def alone Pythium myriotylum 1.2 c 1.2 c 4.6 def 4.6 def w/ Pythium adhaerens-2 Pythium myriotylum 1.2 c 1.1 cdef 5 a 4.8 a w/ Pythium catenulatum Pythium myriotylum 1.2 c 1.1 cd 4.8 bc 4.7 abc w/ Pythium dissotocum-1 Pythium myriotylum 1.2 c 1 g 4.5 g 4.5 fg w/ Pythium dissotocum-2 Pythium myriotylum 1.2 c 1 fg 4.7 cde 4.6cd w/ Pythium pectinolyticum Pythium myriotylum 1.2 c 1 efg 4.6 efg 4.6 cde w/ Pythium adhaerens-1 Pythium myriotylum 1.2 c 1.1 defg 4.6 efg 4.6 cde w/ Pythium porphyrae Pythium myriotylum 1.2 c 1 efg 4.4 h 4.7 bcd w/ Mortierella hyalina Pythium myriotylum 1.1 d 1 fg 4.6 fg 4.5 g w/ Achlya flagellata Pythium myriotylum 1.1 d 1.1 cde 4.5 g 4.5 fg w/ Pythium dissotocum-3

* data were mean values of four replications. Data followed by the same letters were not significantly different in Fisher’s LSD tests, α=0.05.

Mycelial Interactions and Spore Reproduction

Mycelia of P. myriotylum overlapped with the mycelia of the other isolate in a dual culture and often formed a line at the position where two isolates met, when P. myriotylum was co-cultured with P. myriotylum (Figure 5.3.1A), Mortierella hyalina (Figure 5.3.1B), Achlya flagellata (Figure 5.3.1C), or P. dissotocum (Figure 5.3.1D). When P. myriotylum was co- cultured with slow-growing Pythium species including P. catenulatum (Figure 5.3.1E), P. pectinolyticum (Figure 5.3.1F), P. adhaerens (Figure 5.3.1G), and P. porphyrae (Figure 5.3.1H),

188

Xuemei Zhang Chapter 5 189 a clear zone was formed at or near the position where two isolates met.

Figure 5.3.1. Mycelial growth patterns of Pythium myriotylum and other species on dual cultures. A. two Pythium myriotylum deriving from the same isolate. B. top: Mortierella hyalina, bottom: Pythium myriotylum. C. top: Achlya flagellata, bottom: Pythium myriotylum. D. top: Pythium dissotocum, bottom: Pythium myriotylum. E. top: Pythium catenulatum, bottom: Pythium myriotylum. F. top: Pythium pectinolyticum, bottom: Pythium myriotylum. G. top: Pythium adhaerens, bottom: Pythium myriotylum. H. top: Pythium porphyrae, bottom: Pythium myriotylum. A clear zone around the slow-growing Pythium species (E, F, G & H) was visible on the dual cultures.

Observations under a Leica DME compound microscope (100X-200X) indicated that P. myriotylum produced a large number of spores in dual cultures, but the number of spores and the density of Pythium myriotylum hyphae decreased as clear zones were approached (Figure 5.3.2).

A few hyphae were found throughout the clear zone formed around P. catenulatum, P. pectinolyticum, or P. adhaerens, but no hyphae were observed in the center of the clear zone formed around P. porphyrae (Figure 5.3.2). The mycelia of P. porphyrae congregated and formed a fence-like structure at one end of the clear zone (Figure 5.3.2A). The mycelial fence consisted of dense hyphae, forming a circle around the P. porphyrae territory and no spores were

189

Xuemei Zhang Chapter 5 190 found around it or behind it (Figure 5.3.2B). Similar vegetative growth interactions were not observed in dual cultures of P. myriotylum with Achlya flagellata, Mortierella hyalina, P. dissotocum, or P. myriotylum.

Figure 5.3.2 Approaching the clear zone around Pythium porphyrae on a dual culture from 3 cm away with a microscope (100 X). The dark dots are oospores produced by P. myriotylum. The number of spores was decreasing as approaching to the clear zone. A few P. myriotylum spores (in red circles) were visible at one end of the clear zone (A.), and a fence-like mycelial structure (where the orange arrow points) formed by P. porphyrae at the other end of the clear zone. The mycelial “fence” (B) consisted of dense hyphae.

5.3.2 Co-inoculation Experiments

The results (Table 5.3.3) of factorial ANOVA suggested that significant differences were detected among inoculation treatments (inoculum of different species), and among treatment

(inoculation) time (P<0.01). There were significant interactions between these two factors, which

190

Xuemei Zhang Chapter 5 191 had significant effects on tobacco seed germination and Pythium disease severity on the inoculated tobacco seeds or the seedlings germinated from the seeds (P<0.01).

Table 5.3.3. Effects of inoculation treatment, inoculation timing and their interactions on the germination of tobacco TN 90LC seeds and the disease severity index on the seedlings germinated from the inoculated seeds in the co-inoculation experiments. P value Disease severity index on Effects Seed germination, % germinated seedlings, % 1st assay 2nd assay 1st assay 2nd assay Inoculation treatment (ITz) <.01* <.01* <.01* <.01* Inoculation timing (TTy) <.01* <.01* <.01* <.01* IT*TT <.01* <.01* <.01* <.01* Block 0.25 0.15 0.72 0.81 P value less than 0.05 indicates a significant effect in factorial ANOVA. z : IT is short for Inoculation Time. y :TT is short for Treatment Tine.

Effects of Inoculation Timing

Percent seed germination was lowest and disease severity index highest in the co- inoculation experiments when Pythium myriotylum and Neighbor Isolates (NI) were applied at the same time in the “tiny bays” (Table 5.3.4). When compared with co-inoculating simultaneously at seeding, pretreating tobacco seeds with NI significantly (P<0.01) reduced

Pythium disease severity and had significantly higher seed germination in both assays. Compared with co-inoculating simultaneously at seeding, when NI was applied at seeding and P. myriotylum was applied three or five days after seeding, seed germination percentage was significantly higher, and the disease severity index was significantly lower (P<0.01). Applying P. myriotylum five days after seeding significantly (P<0.01) reduced Pythium disease severity and had significantly higher seed germination in both assays and, compared with applying P. myriotylum at seeding or three days after seeding. Applying P. myriotylum three days after seeding significantly (P<0.01) was associated with significantly higher seed germination

191

Xuemei Zhang Chapter 5 192 percentage in both assays and reduced Pythium disease severity, compared with applying P. myriotylum at seeding.

Table 5.3.4. Effects of inoculation timing on the germination of tobacco TN 90LC seeds and the disease severity index on the seedlings germinated from the inoculated seeds in the co- inoculation experiments. Disease severity index on Inoculation Timingz Seed germination, % germinated seedlings, % Pythium myriotylum Neighbor Isolate 1st assay 2nd assay 1st assay 2nd assay seeding seeding 37.5 ay 36.9 a 61.5 a 61.4 a seeding Pre-seeding 41.7 b 41.8 b 57.9 b 59.3 b 3 days after seeding seeding 48.6 c 51.3 c 56.5 b 56.0 c 5 days after seeding seeding 59.8 d 64.0 d 50.9 c 52.8 d z At inoculation timing 1, both Pythium myriotylum and the neighbor isolates (NI) were applied in SDW at seeding. At timing 2, seeds were pretreated with NI, and Pythium myriotylum was applied at seeding. At timing 3, NI was applied at seeding, and Pythium myriotylum was applied three days after seeding. At timing 4, NI was applied at seeding, and Pythium myriotylum was applied five days after seeding. y Data were analyzed using Two-way ANOVA followed by Fisher’s LSD analysis (α=0.05). Means were calculated based on four replications and means connected by the same letter were not significantly different.

Effects of Interspecific Interactions

Percent seed germination and disease severity indices after inoculating with Achlya flagellata, Mortierella hyalina, Pythium porphyrae, P. pectinolyticum, or P. adhaerens alone were not significantly different with that of the uninoculated control (Table 5.3.5). However, the sole inoculation with P. catenulatum or P. dissotocum isolate 2 significantly reduced seed germination and increased Pythium disease severity compared with the uninoculated control, but their effects were not as significant as that of P. myriotylum. P. dissotocum isolate 1 or 3 alone significantly reduced seed germination and increased Pythium disease severity, and their effects were more significant than those of P. myriotylum. Pythium myriotylum and P. porphyrae co- inoculation significantly reduced seed germination and increased Pythium disease severity on the seedlings germinated from the inoculated seeds. Combinations of P. myriotylum and Mortierella hyalina or P. pectinolyticum was not significantly different from P. myriotylum sole inoculation.

When compared with P. myriotylum sole inoculation, the combination of P. myriotylum and P.

192

Xuemei Zhang Chapter 5 193 adhaerens, P. dissotocum-2, P. catenulatum, or Achlya flagellata significantly (P<0.05) reduced seed germination and increased Pythium disease severity.

Table 5.3.5. Effects of inoculation treatments on the germination of tobacco TN 90LC seeds and the disease severity index on the seedlings germinated from the inoculated seeds in the co- inoculation experiments. Seed Germination (%) Disease Severity Index (%) Inoculum 1 Inoculum 2 (NI) Assay 1 Assay 2 Assay 1 Assay 2 Uninoculated control 99.7 a* 99.7 a* 0 a 0 a N/A Achlya flagellata 99.7 a 100 a 0 a 0 a N/A Mortierella hyalina 99.1 a 99.1 a 0 a 0 a N/A Pythium porphyrae 98.8 a 99.4 a 0 a 0 a N/A Pythium pectinolyticum 98.1 a 100 a* 0 a 0 a N/A Pythium adhaerens-1 97.5 a 99.7 a 0 a 0 a N/A Pythium adhaerens-2 97.2 a 100 a 0 a 0 a N/A Pythium catenulatum 63.8 b 58.8 b 36.8 b 35.3 b N/A Pythium dissotocum-2 60.3 b 50 c 38.8 b 37.5 b Pythium myriotylum Pythium porphyrae 50.6 c 57.2 b 51.8 c 49 c Pythium myriotylum Mortierella hyalina 35.6 d 36.3 d 89.5 f 93.3 fg Pythium myriotylum N/A 35.3 d 29.7 e 90.8 f 91.3 ef Pythium myriotylum Pythium pectinolyticum 31.3 d 36.9 d 84.8 e 95 gh Pythium myriotylum Pythium adhaerens-1 23.8 e 30 e 88.8 f 88.8 e Pythium myriotylum Pythium catenulatum 23.1 e 47.2 c 79.3 d 75.3 d Pythium myriotylum Pythium adhaerens-2 16.9 f 23.1 f 89.3 f 100 g N/A Pythium dissotocum-1 1.3 g 1.3 g 97.5 g 96.5 h N/A Pythium dissotocum-3 0 g 0 g 100 g 100 g Pythium myriotylum Achlya flagellata 0 g 0 g 100 g 100 g Pythium myriotylum Pythium dissotocum-1 0 g 0 g 100 g 100 g Pythium myriotylum Pythium dissotocum-2 0 g 0 g 100 g 100 g Pythium myriotylum Pythium dissotocum-3 0 g 0 g 100 g 100 g * Data were analyzed using Two-way ANOVA followed by Fisher’s LSD analysis (α=0.05). Data were transformed before prior to data analysis and back-transformed in the table results. Means were calculated based on four replications and means connected by the same letter were not significantly different.

193

Xuemei Zhang Chapter 5 194

5.4 Discussion

5.4.1 Interactions between Pythium myriotylum and other Pythium species

The results of dual culture experiments in this study suggest that Pythium myriotylum interacts with other Pythium or oomycete species that naturally occur in tobacco greenhouses.

The isolates of Pythium catenulatum, P. pectinolyticum, P. porphyrae, Achlya flagellata, P. adhaerens, P. dissotocum, and Mortierella hyalina found to be co-existing with Pythium myriotylum in the 2017 tobacco greenhouse survey (Chapter 3) exhibited high levels of diversity in vegetative growth. Pythium catenulatum, P. pectinolyticum, P. porphyrae, and P. adhaerens grew significantly slower than Achlya flagellata, Mortierella hyalina, P. dissotocum, and P. myriotylum on 10% V8 agar medium at 27 ºC. When co-cultured with P. myriotylum, these slow- growing Pythium species formed clear zones around their colonies, limiting hyphal growth and oospore production by P. myriotylum. When co-cultured with P. myriotylum, P. porphyrae formed a fence-like structure around its colony. Additionally, the mycelial growth rate of P. myriotylum on 10% V8 medium increased significantly when co-cultured with P. catenulatum,

P. dissotocum isolate 3, or Achlya flagellata. These results provided strong evidence that P. myriotylum was actively interacting with other Pythium or other oomycete species that existed in the same environment, and such interactions had a significant impact on the biological behavior of P. myriotylum.

Microbes that share the same ecological niche can collaborate interspecifically to achieve maximum fitness, in which stable networks are often established within microbial communities to exchange signaling molecules or genes (Larousse & Galiana, 2017, Kemen, 2014). Such interactions often play an important role in facilitating communal host colonization among microbial species including oomycetes (Larousse & Galiana, 2017, Kemen, 2014). It is very

194

Xuemei Zhang Chapter 5 195 common for Pythium species to interact with other Pythium species and even exchange genetic information (Robideau et al., 2011, Blancard et al., 2012, Mostowfizadeh-Ghalamfarsa &

Salmaninezhad, 2020). According to models of competition, such as Tilman’s and Lotka-

Volterra Model, the coexistence of competing species could happen when intraspecific competition exceeds interspecific competition (Mills & Bever, 1998, Gilad, 2008, Fritzell &

Mahrt, 1998). The fact that high levels of diversity was found within P. dissotocum and variation also existed in P. myriotylum suggested there might be strong competition within these Pythium species. Therefore, it is not surprising to see these species coexist with other Pythium species in the same environment, as we observed in the 2017 survey (Chapter 3).

It is known that some oomycetes such as Phytophthora produce signal molecules that act interspecifically promote the virulence of other oomycete species for nutrient completion in an ecological niche, though regulating zoospore aggregation (Kong et al., 2010). It is unclear but possible that such chemical communications and interactions also exist among Pythium species.

Currently, there is little information on the interactions within Pythium or oomycete communities in hydroponic agricultural ecosystems. Further research on this subject is needed to reveal the interactive activities between Pythium or oomycete species, especially between pathogenic and non-pathogenic Pythium species.

5.4.2 Influences of Interspecific Interactions on the Virulence of Pythium

myriotylum

The results of the co-inoculation experiments in this study suggested that interactions between Pythium myriotylum and other Pythium or oomycete species significantly impact the virulence of P. myriotylum on tobacco seeds and the germinating seedlings. Combining P.

195

Xuemei Zhang Chapter 5 196 myriotylum with P. adhaerens, P. dissotocum-2, P. catenulatum, or Achlya flagellata significantly reduced seed germination and increased Pythium disease severity on tobacco seedlings germinated from the seeds that had been inoculated in this study, compared with inoculating with P. myriotylum alone. Considering that sole inoculation with Achlya flagellata or

P. adhaerens did not significantly increase disease compared to the uninoculated control, P. adhaerens and Achlya flagellata may have interacted with P. myriotylum and increased the virulence of P. myriotylum on tobacco seeds and seedlings germinated from the inoculated seeds.

This type of interspecific virulence promotion has been observed in oomycetes before, and the promotion may be achieved through signaling molecule communication (Kong et al., 2010).

Pythium dissotocum and P. catenulatum exhibited low virulence on tobacco seeds and germinated seedlings in this study. Our previous pathogenicity studies (Chapter 4) suggested these two species are weak pathogens on tobacco seeds and seedlings, because their pathogenicity to tobacco seeds and seedlings were inconsistent and the virulence was often low.

Although combining P. myriotylum with P. dissotocum or P. catenulatum also increased the virulence of P. myriotylum in the co-inoculation assays, it is hard to conclude if they increased the virulence of P. myriotylum in this study.

Pythium porphyrae did not show pathogenicity to tobacco seeds or the seedlings germinated from the inoculated seeds in the co-inoculation experiments. The fact that P. myriotylum and P. porphyrae co-inoculation significantly increased % seed germination and reduced Pythium disease severity of germinated seedlings, suggesting the interaction between P. myriotylum and P. porphyrae reduced the virulence of P. myriotylum on tobacco seeds.

Pretreating or pre-inoculating tobacco seeds with NI significantly reduced the disease severity and increased seed germination percentage, suggesting that the interspecific interaction between

196

Xuemei Zhang Chapter 5 197

P. myriotylum and P. porphyrae may reduce the virulence of P. myriotylum, which could be achieved through interspecific competition, or chemical interference. Our previous pathogenicity studies (Chapter 4) suggested that P. porphyrae is a weak pathogen with a very low virulence on tobacco seeds and tobacco seedlings. Pythium porphyrae rarely caused slight root discoloration on tobacco seedlings during the transplant production season in tobacco greenhouses; but significant effects on the roots or aerial parts of tobacco transplants at the end of transplant production season were never observed. Therefore, P. porphyrae has the potential for development as a biological control agent to protect tobacco seedlings from P. myriotylum in float-bed tobacco transplant production systems.

Plant root exudates attract a wide range of microbes near the root surface (rhizosphere), which could promote the activities of Pythium pathogens (Hockenhull & Funck-Jensen, 1982,

Kong et al., 2010, Bassani et al., 2020, Larousse & Galiana, 2017, Kemen, 2014). The level of organic matter content in hydroponic systems is not as high as in natural soils. In addition to that, root exudates from host plants can be diluted in the float water nutrient solution. Therefore, it is presumed that hydroponic ecosystems are less supportive in terms of providing microbial substrates than soil environments (Hockenhull & Funck-Jensen, 1982, Larousse & Galiana,

2017), which would reduce the diversity in the rhizosphere of hydroponic-grown plants. The relatively uniform and simple environment in hydroponic greenhouses may help Pythium pathogens take advantages of the hosts. Therefore, introducing microbial populations that compete with Pythium pathogens for nutrients, especially those that might preferentially utilize the root exudates that help attract Pythium pathogens (Hockenhull & Funck-Jensen, 1982), could be the key to the management of Pythium diseases in hydroponic crop production systems.

197

Xuemei Zhang Chapter 5 198

5.5 Conclusions

The interaction assays in this study provided evidence suggesting significant interactions between P. myriotylum and other Pythium or oomycete species naturally coexisting with P. myriotylum within tobacco greenhouses. Pythium catenulatum, P. pectinolyticum, P. adhaerens, and P. porphyrae formed clear zones around their colonies on the dual cultures with P. myriotylum, and the number of oospores and hyphae produced by P. myriotylum decreased as it approached the clear zones. Consistent results suggested the interaction between P. myriotylum and P. catenulatum significantly increased the 48-hr growth rate of P. myriotylum, while the interaction between P. myriotylum and Achlya flagellata or P. dissotocum-3 significantly reduced the 48-hr growth rate of P. myriotylum. The interaction between P. myriotylum and

Achlya flagellata significantly increased the virulence of P. myriotylum on tobacco seeds and seedlings. The interaction between P. myriotylum and P. porphyrae resulted in reduced mycelial growth and sporulation by P. myriotylum at the interaction interface, and the formation of a specialized mycelial structure by P. porphyrae on 10% V8 agar medium. Such an interaction between P. myriotylum and P. porphyrae may have been associated with the reduction of

Pythium myriotylum virulence on tobacco seeds in simplified hydroponic environments.

This study provided substantial new information on mycelial growth interactions between

P. myriotylum and other Pythium/oomycete species that naturally coexist with P. myriotylum in tobacco transplant production greenhouses, and the impact of these interactions on tobacco seeds in simplified hydroponic environments. Further research on chemical and molecular analyses are needed to understand the mechanisms of the interspecific interactions within these Pythium species, which may eventually lead to new Pythium disease management strategies for tobacco transplant production.

198

Xuemei Zhang Chapter 6 199

Chapter 6

Assessment of Alternative Disease Control Methods for Pythium myriotylum in Tobacco Transplant Production Greenhouses

Abstract

Pythium root rot is a disease that can be caused by multiple species of Pythium in tobacco transplant production greenhouses. Aggressive species like Pythium myriotylum can pose a significant threat to tobacco seedlings. Management tools are limited, with Terramaster 4EC

(etridiazole) being the only oomyceticide registered in the United States for Pythium control in tobacco greenhouses. To identify additional Pythium control options, chemical (ethaboxam, mefenoxam and copper ethanolamine complex) and non-chemical (ultraviolet light and copper ion) water treatments were compared with etridiazole and an untreated control on TN 90LC tobacco seedlings inoculated with P. myriotylum. All the water treatments in chemical trials were applied to the float water once, immediately prior to inoculation, when seedling roots had extended into the float water. The inoculum was applied immediately before seeding in non- chemical trials. Etridiazole was applied to float water once, two weeks after seeding, as a positive control. UV light, 0.8 ppm copper ion or 1.6 ppm copper ion treatments were applied three times: 24 hours before, two weeks after, and four weeks after seeding. Results showed that ethaboxam and mefenoxam are promising alternatives to etridiazole, significantly reducing root rot incidence and severity, leaf chlorosis, stunting, and plant death. These treatments also reduced the number of oospores produced in infected root tissues, while significantly increasing root length and root weight, compared with the untreated control. Ultraviolet light and copper ion 199

Xuemei Zhang Chapter 6 200 treatments had no significant effect on tobacco seedling root length or weight compared with the untreated control, although the copper ion treatments significantly reduced root rot severity and the number of oospores produced in root tissues.

Keywords: Pythium, hydroponic greenhouse, tobacco, Pythium management

6.1 Introduction

In the United States, tobacco transplants are usually produced in float-bed greenhouse systems, in which tobacco seedlings are grown in trays filled with soilless substrate-based media

(containing sphagnum peat, vermiculite, and occasionally perlite) that float in plastic-lined bays filled with nutrient solution, the so-called bay water (Pearce et al., 2019, Reed et al., 2019). This system is conducive to oomycete pathogens because these microbes rely on water to grow, disseminate, and reproduce (Thines, 2014, Beakes et al., 2012). Pythium species are a group of oomycetes that cause root and stem rot, pre-emergent and post-emergent damping-off, and/or seedling blight in tobacco transplant production greenhouses (Pfeufer & Hinton, 2017, Gutiérrez et al., 2012, Fortnum et al., 2000, Cartwright et al., 1995, Anderson et al., 1997, Sigobodhla et al., 2006, Sigobodhla et al., 2010, Mufunda et al., 2017, Garwe et al., 2014). The management of

Pythium diseases in tobacco transplant greenhouses is challenging because management options are limited (Gutiérrez et al., 2012, Gutiérrez & Melton, 2001, Pfeufer & Hinton, 2017,

Sigobodhla et al., 2006, Pearce et al., 2019, Reed et al., 2019). Only one synthetic fungicide/oomyceticide, Terramaster 4EC (etridiazole), is currently labeled as a bay water treatment for Pythium control in tobacco greenhouses. Terramaster 4EC is usually effective on

Pythium problems in float-bed systems if applied and mixed correctly, but it can cause phytotoxicity (including stunting and seedling loss, according to the product label) on young

200

Xuemei Zhang Chapter 6 201 tobacco seedlings. Therefore, it is recommended to start the first application of Terramaster 4EC at least two weeks after seeding and to avoid an application interval that is less than two weeks

(Hansen & Hensley, 2019, Gutiérrez et al., 2012, Gutiérrez & Melton, 2001, Pfeufer & Hinton,

2017, Pearce et al., 2019, Reed et al., 2019).

A recent survey revealed twelve Pythium species (Pythium adhaerens, P. aristosporum,

P. attrantheridium, P. catenulatum, P. coloratum, P. dissotocum, P. inflatum, P. irregulare, P. myriotylum, P. pectinolyticum, P. porphyrae and P. torulosum) from the center walkway, weeds, bay water and/or tobacco seedlings in 33 out of 41 surveyed tobacco greenhouses (Chapter 3).

The results of laboratory and greenhouse pathogenicity tests (Chapter4) showed that P. myriotylum was the most aggressive species among those detected in the survey, causing pre- emergence damping-off, seedling root discoloration and root rot, stunting, wilting, leaf chlorosis and seedling death (post-emergence damping-off) of tobacco. It was found that P. myriotylum infections occurred before seedling germination can cause significant root rot and seedling losses during seedling emergence. Those results indicated applying Terramaster 4EC at two weeks after seeding in tobacco greenhouses might not be sufficient for Pythium disease management in some cases. Therefore, there is a need to search for effective treatment alternatives to Terramaster 4EC for Pythium control in tobacco transplant greenhouses.

The objective of this study was to compare the efficacies of chemical treatments including

Ridomil Gold (mefenoxam, oomyceticide), Elumin (Ethaboxam, oomyceticide) and Cutrine-plus

(Copper Ethanolamine Complex, algaecide) and non-chemical water treatments (copper ionization and ultraviolet radiation) on Pythium myriotylum control in tobacco greenhouses, and to compare the effects of alternative treatments with the effects of standard Terramaster 4EC treatments on tobacco seedling growth and Pythium disease progress in mini or small float-bed systems. The

201

Xuemei Zhang Chapter 6 202 outcome from this study could reveal promising alternatives to Terramaster 4EC for Pythium disease management in float-bed tobacco transplant greenhouses.

6.2 Materials and Methods

The pathogen Pythium myriotylum was collected from a previous survey conducted in

2017 (Chapter 3), and the original isolate used in this study (P. myriotylum 17A20) was maintained on V8 media and its virulence was verified monthly (Chapter 4). The chemical treatments Ridomil Gold (Syngenta), Elumin (Valent), Terramaster 4EC (Chemtura), and

Cutrine-plus (Applied Biochemist) used in this study were provided by manufacturers or purchased from local dealers. The copper ionization apparatus used in the small-bay trials was provided by Lauren Hailey Technologies (China Grove, NC), and the UV lamp (S8Q-PA) was purchased from VIQUA (Ontario, Canada).

6.2.1 Inoculum Preparation

Active 10-day-old cultures of P. myriotylum isolate 17A20 on 10% V8 medium were blended with sterile distilled water to prepare agar puree inoculum. The mycelial growth and sporulation on the cultures were observed with a compound microscope (Motic AE2000, Hong

Kong) to confirm the purity and maturity of 17A20. Ten plates (100 mm x 15 mm) of mature P. myriotylum cultures were blended with 1,000 ml of sterile distilled water in a blender (Waring laboratory blender, CT) to make 1,000 ml of puree-like ground inoculum. The inoculum was stirred before and during the inoculation process to ensure the even distribution of the inoculum.

202

Xuemei Zhang Chapter 6 203

6.2.2 Mini-bay Greenhouse Trials

Mini-bay oomyceticide trials were conducted in October 2017 and repeated in March

2018 and April 2019. A total of 25 2-gallon storage containers (Sterilite, Townsend, MA) were filled with 1 gallon of water to serve as miniature float-beds (“mini-bays”) in the trials (as described in Chapter 4, Figure 4.2.2). Bays were filled with municipal water and sat in the greenhouse for 3 days prior to seeding in order to allow chlorine dissipate. Brand new expanded polystyrene (EPS) trays were cut into 5x5-cell square sections and filled with growth medium

(Carolina Choice, Kinston, NC). A TN 90LC tobacco (Workman Tobacco Seed Inc, Murray,

KY) seed was placed in each cell, and one tray “section” was then floated on top of the bay water in each mini-bay. All mini-bays were fertilized three weeks after seeding with 2.5 g of fertilizer

(16-5-16).

Table 6.2.1. The treatment list in mini-bay chemical trials. Treatment Application rate Application time untreated control NA NA

Terramaster 4EC 1.00 fl oz/100 gal (0.3 ml/gal) Once, 1hr before inoculation (Etridiazole)

Ridomil Gold 2.5ml/100 gal (0.025 ml/gal) Once, 1hr before inoculation (Mefenoxam)

Elumin 0.8 fl oz/100 gal (0.24 ml/gal) Once, 1hr before inoculation (Ethaboxam)

Cutrine-plus 0.0072 ml/bay Once, 1hr before inoculation (Copper Ethanolamine Complex)

This experiment used a completely random design (CRD) with five replications. The five fungicide treatments and the untreated control were randomly assigned to 25 mini-bays (Table

6.2.1) when seedling roots had extended into the nutrient solution below the trays, approximately

203

Xuemei Zhang Chapter 6 204 four weeks after seeding. Each bay was inoculated with 100 ml of agar puree inoculum one hour later. Bays were refilled with municipal water every week to maintain a constant water volume.

Seedling leaves were trimmed as necessary each week in order to maintain a uniform height of three inches above the trays.

6.2.3 Small-bay Greenhouse Trials

The small-bay trial was conducted in October 2017 and repeated in March 2018 in order to test non-chemical water disinfection treatments: copper ion and UV treatments. The experimental design was a randomized complete block design (RCBD) with five blocks. Each experiment unit was a small bay filled with 70 gallons of water, containing five 12 x 24-cell EPS trays (Figure 6.2.1). Each bay was inoculated with 800 ml of agar puree inoculum at seeding.

Twenty-four hours after inoculation, brand new trays filled with growth medium (Carolina

Choice, Kinston, NC) and newly seeded with burley tobacco cultivar TN 90LC were floated on the inoculated bay water. Copper and UV treatments were applied 3 times: 24 hours before seeding, two weeks after seeding and 4 weeks after seeding. Terramaster was only applied once, at two weeks after seeding (Table 6.2.3.1.). All the bays were fertilized with 2.5 g of fertilizer

(16-5-16) three weeks after seeding. Bays were refilled with municipal water every week to maintain the water volume. Seedlings were trimmed every week after they reached 3 inches above the trays.

204

Xuemei Zhang Chapter 6 205

Figure 6.2.1. Five 288-cell Styrofoam trays floating in a small bay.

Table 6.2.2. Treatments in small-bay non-chemical trials. Treatment Application rate Application time untreated control NA NA Terramaster 1.00 fl oz/100 gal (0.3 ml/gal) Once, 2 weeks after seeding (Etridiazole) Copper ions 1.6 ppm Beforez, 2 weeks and 4 weeks after seeding Copper ions 0.8 ppm Beforez, 2 weeks and 4 weeks after seeding UV Circulate 5 times, 6 gal/min Beforez, 2 weeks and 4 weeks after seeding z Initial treatments were applied at 24 hours before seeding.

6.2.4 Data Collection

The efficacies of the water treatments in this study were assessed in two ways: 1) by comparing the overall effects of water treatments on Pythium disease progress and seedling growth during the greenhouse trials, and 2) by comparing seedling health and related measurements at the end of the seedling growing season (when the tobacco seedlings reach the transplanting size).

All root measurements and root rot disease examinations during these trials focused on

205

Xuemei Zhang Chapter 6 206 the water roots of tobacco seedlings, which is the under-water root system below the trays

(Figure 6.2.2). However, all root measurements and root rot disease examinations in the final assessments were based on the entire root system of tobacco seedlings. Destructive sampling only happened at the end of the greenhouse water treatment trials.

Figure 6.2.2. The entire root system (yellow) of tobacco seedlings consists of water roots (red, from the root tip to the bottom of the tray) and the part of roots contained in the tray.

Data were collected weekly after inoculation in the mini-bay trials. The number of emerged seedlings and symptomatic seedlings were counted in order to calculate disease incidence (the percentage of plants with Pythium disease symptoms in the entire sampling population in each tray). Symptomatic plants were judged to be those exhibiting leaf chlorosis, stunting, mortality, and/or root rot. Specifically, leaf chlorosis incidence described the percentage of seedlings showing leaf yellowing or bleaching in the total tobacco seedling population in a tray. Stunting incidence describes the percentage of seedlings significantly smaller than the average-size seedlings in a block. Incidence of mortality describes the

206

Xuemei Zhang Chapter 6 207 percentage of dead plants in a tray. Root rot incidence describes the percentage of seedlings showing discoloration and decay of water roots within the total tobacco seedling population in a tray. Root rot severity (the percentage of water roots showing discoloration and decaying on an individual seedling) was also assessed weekly, as well as plant height (from the stem base to the top of the plant) and root length (from the stem end to the tip of the longest feeder root).

The final assessment in the 2017 mini-bay trial was conducted 5 weeks after inoculation

(WAI), approximately 9 weeks after seeding (WAS). The final assessments in 2018 and 2019 occurred 3 weeks after inoculation (WAI), approximately 7 to 8 weeks after seeding. The assessment methods were similar to those described in Zhang et al. (Chapter 4). Five seedlings were randomly collected from each mini-bay at each of these final assessments, and the growth medium on the roots was rinsed-off with tap water in order to measure root length and fresh root weight, to assess root rot incidence and severity, and to count the number of oospores in roots.

The disease severity assessment method was adapted from previous Pythium studies (Rafin &

Tirilly, 1995, Kageyama et al., 2002, Fortnum et al., 2000). A 0-5 scale was used to indicate the severity of root rot, where 0 indicates healthy, 1 indicates 1-5% roots on a plant were affected, 2 indicates 6-25% roots were affected, 3 indicates 26-50% roots were affected, 4 indicates 51-75% were affected, and 5 indicates more than 75% of roots were affected. Then the root rot disease severity index (DSI) was calculated using the formula (where NRi indicates number of seedlings showing the corresponding disease level i; i ranges from 0 to 5):

(0 × N ) + (1 × N ) + (2 × N ) + (3 × N ) + (4 × N ) + (5 × N ) DSI (%) = R0 R1 R2 R3 R4 R5 × 100% 5 × Ntotal

Four 2-mm pieces of root tissues were randomly collected from each of the five seedlings collected from each mini-bay and were mounted on slides with staining using 0.05% aniline blue, and then observed with a compound microscope. The number of oospores in each 2 mm

207

Xuemei Zhang Chapter 6 208 root tissue was counted and recorded.

In the small-bay trial, stand count, symptomatic seedling incidence, and water root rot severity data were also collected similarly and weekly. At the final assessment, a total of 12 plants from each bay were destructively sampled in order to collect root length, fresh root weight, root rot incidence and severity, and oospore count data. In 2017, tobacco seedlings started to emerge at 3 WAI, and the data were collected at 3, 4, 5, 7, 8, and 9 WAI. In 2018, tobacco seedlings started to emerge at 4 WAI, and the data were collected at 4, 6, 8, 9, 10, and 11

WAI.

6.2.5 Data Analysis

The final assessment data were analyzed using JMP 10 pro, SAS 9.4, and R 3.6.1 with

ANOVA-Fisher’s LSD (for parametric data) or Wilcoxon each-pair comparison (nonparametric data); the significance (alpha) level was set at 0.05. All the data collected multiple times during the trials were analyzed using repeated measures ANOVA followed by Fisher’s LSD post hoc analysis, with a significance (α) level of 0.05. Areas under the disease progress curves (AUDPC) were calculated using root rot severity index data for water roots using the Agricolae package for

R (Sparks et al., 2008). Data were arcsine or log transformed before being used in statistical models to meet the analysis assumptions, and back-transformed in the reported results.

208

Xuemei Zhang Chapter 6 209

6.3 Results

6.3.1 Endpoint Comparison of Treatments at The Final Assessments in Mini-

Bay Trials

The final assessment results (Table 6.3.1 & Figure 6.3.1) showed that the positive control

Terramaster 4EC (etridiazole) significantly increased seedling root length and root weight in all three trials compared to the untreated control. Although Terramaster 4EC did not significantly reduce Pythium root rot incidence, it significantly reduced root rot severity and the number of oospores produced in seedling roots (Table 6.3.1 & Figure 6.3.1).

Ridomil Gold (mefenoxam) and Elumin (ethaboxam) were comparable with Terramaster in terms of increasing seedling root length and root weight as well as reducing root rot severity and the oospores production in roots (Table 6.3.1 & Figure 6.3.1). In addition, Ridomil Gold and

Elumin also significantly reduced root rot incidence.

Cutrine-plus (Copper Ethanolamine Complex) did not have a significant effect on root measurements or Pythium root rot in 2017 and 2019, but its treatment effect was significant in

2018 (Table 6.3.1). Variation was high within the Cutrine-plus treatment in the 2018 trial: among the five replications of this treatment, two had severe root rot disease but the other three replications were disease-free. Variation was also high within the Terramaster treatment in 2018: one replication had no disease, two had severe root rot disease, and two had slight root rot.

Cutrine-plus treated seedlings were generally similar to the untreated control at the end of the seedling growing season, exhibiting typical Pythium disease symptoms: stunting, wilting, leaf chlorosis, root discoloration, root decaying, and/or plant death (Figure 6.3.1). However, tobacco seedlings treated with Ridomil Gold and Elumin were similar to Terramaster-treated seedlings, appearing to be healthy in both above-tray (leaf and stem) and below-tray (root) parts of tobacco

209

Xuemei Zhang Chapter 6 210 seedlings (Figure 6.3.1). Moreover, a large quantity of oospores (sexual spores produced by P. myriotylum) was present in the root tissues of untreated and Cutrine-plus treated seedlings, while few were found in the root tissues of seedlings treated with the fungicides Terramaster, Ridomil

Gold and Elumin (Figure 6.3.1).

Table 6.3.1. The final effects of chemical treatments on TN 90 LC tobacco seedling roots and root rot diseases in mini-bay chemical trials. Root Root Fresh root Root rot Oospore countz rot Year Treatment length Weight severity (per 2mm root incidence (cm) (g) (%) tissue) (%) Mefenoxam 11.4 a 0.8 ab 64 b 13.6 c None (Ridomil Gold) Ethaboxam 9.9 a 0.9 a 100 a 30.4 c None (Elumin) Etridiazole 2017 7.8 a 0.6 b 88 ab 60 b <10 (Terramaster) Copper Ethanolamine complex 2.9 b 0.3 c 100 a 96.8 a Massive (Cutrine-plus) Control 3.7 b 0.1 c 100 a 99.2 a Massive Mefenoxam 16.1 a 3.4 a 0 c 0 c 0 b Ethaboxam 13.4 a 2.3 b 0 c 0 c 0 b Etridiazole 11.2 a 1.9 b 80 ab 51.5 b 48 a 2018 Copper Ethanolamine 11.1 a 2.7 ab 40 bc 28.5 bc 16 b complex Control 4.8 b 0.8 c 100 a 99 a 49 a Mefenoxam 14.9 a 4.4 a 0 b 0 c 0 c Ethaboxam 12.4 a 3.1 b 0 b 0 c 0 c Etridiazole 10.6 a 2.8 b 64 a 33.6 b 8 c 2019 Copper Ethanolamine 3.9 b 0.2 c 100 a 96 a 54 b complex Control 3.2 b 0.1 c 100 a 100 a 89 a Treatments not followed by the same letter are significantly different (α=0.05). The analysis of some data might be transformed (Arcsine/Log) before ANOVA but the data shown in the table were back-transformed. z The oospore count in 2017 was not quantified.

210

Xuemei Zhang Chapter 6 211

Figure 6.3.1. Comparison of seedling vigor (top) and spore reproduction in root tissues (bottom) at the end of a mini-bay chemical trial. The dark circles that the red arrows are pointing to are the sexual spores produced by Pythium myriotylum in root tissues. Control and Cutrine-plus: Seedling roots were dark or brown, slimy and decayed, while the upper part of the plants was stunted and bleached. Root tissues were occupied by sexual spores. Terramaster, Elumin or Ridomil Gold: Seedlings had big roots systems with no apparent root rot symptoms and the upper part of the plants was healthy. Few spores were observed in the root tissues.

211

Xuemei Zhang Chapter 6 212

6.3.2 Comparison of Treatment Effects Over Time and AUDPC in Mini-Bay

Trials

Effects of fungicide treatment on incidence and severity of root rot, root length, and incidence of plant stunting and foliar chlorosis were highly significant (P ≤ 0.0001) in the 2017 and 2019 experiments, but not significant in 2018 (Table 6.3.2). High variation within

Terramaster and Cutrine-plus treatments in 2018 may have inflated the mean square error term in the statistical analysis of that data, contributing to an inability to detect treatment effects. Effects of fungicide treatment in the 2018 experiment were only significant for plant height (P ≤

0.0331), and effects of time were only significant for the incidence of stunting, foliar chlorosis, and mortality in that trial. Fungicide treatment reduced plant mortality in 2019 (P ≤ 0.0002), but not in either 2017 or 2018. Fungicide effects on root rot incidence and severity varied over time in the 2017 trial but did not in 2018 or 2019. No fungicide treatment X time effects on root length were observed in any of the three experiments. Fungicide and time effects on plant height interacted in the 2017 test, but not in the later studies. Effects of fungicide treatment on plant stunting were consistent over time in 2017 and 2018 but interacted with time (P ≤ 0.0001) in

2019.

212

Xuemei Zhang Chapter 6 213

Table 6.3.2. The treatment and time effects on TN 90LC tobacco seedlings and root rot diseases in mini-bay chemical trials. P value

Year Effects Water roots Water roots Root Plant Stunting Leaf Mortality root rot root rot length height incidence chlorosis incidence incidence severity incidence 2017 TRT < 0.0001* < 0.0001* < 0.0001* < 0.0001* 0.0001* < 0.0001* 0.1688 Time < 0.0001* < 0.0001* 0.3842 < 0.0001* 0.4456 < 0.0001* 0.0033* TRT*Time 0.0081* < 0.0001* 0.1225 < 0.0103* 0.8464 < 0.0001* 0.9170 2018 TRT 0.1929 0.1567 0.1157 0.0331* 0.6300 0.7628 0.0887 Time 0.2957 0.9870 0.1153 < 0.0001* 0.0013* < 0.0001* 0.0043* TRT*Time 0.6891 0.7543 0.9658 0.9075 0.8717 0.7240 0.1638 2019 TRT < 0.0001* < 0.0001* < 0.0001* < 0.0001* 0.0001* < 0.0001* 0.0002* Time 0.0047* 0.0046* 0.5739 < 0.0001* < 0.0001* < 0.0001* < 0.0001* TRT*Time 0.0571 0.0896 0.7375 0.0585 0.0001* < 0.0001* 0.0023* *indicated significant differences in repeated measures ANOVA, with P values less than 0.05. The root rot disease data were collected based on the appearances of water roots.

Results of 2017 and 2019 trials showed that there were significant differences among water treatments in terms of their effects on root rot disease and seedling health (Table 6.3.2). In

2017, there were highly significant differences (P≤0.0001) among water treatments in terms of their effects on root rot incidence and severity, root length, plant height, and incidence of stunting and leaf chlorosis. The effects of treatment X time interactions were also significant on root rot incidence (P=0.0081) and severity (P<0.0001), plant height (P=0.0103), and leaf chlorosis incidence (P<0.0001). In 2019, there were significant differences among water treatments in terms of their effects on all the measurements (Table 6.3.2). The treatment X time interactions were significant on the incidence of stunting (P=0.0001), leaf chlorosis (P<0.0001) and mortality (P=0.0023), and marginally significant on root rot incidence (P=0.0571) and severity (P=0.0896), as well as plant height (P=0.0585).

Only significant treatment or treatment X time effects in repeated measures ANOVA

213

Xuemei Zhang Chapter 6 214

(Table 6.3.2.) were further analyzed with Fisher’s LSD post hoc tests to detect where the differences lay between treatments. Therefore, most of the data generated in 2018 trials were not followed by post hoc analysis. Due to the insignificant overall treatment or Treatment X Time interaction effects in 2018 mini-bay trials, the area under the disease progress curve (AUDPC) of

Pythium myriotylum was only calculated using root rot severity data collected in 2017 and 2019.

AUDPC of Pythium diseases under the influence of chemical water treatments 250

200 a a

a 150 a

100 b bc 50 bc c c c 0 2017 2019

Cutrine Plus Control Terramaster Elumin Ridomil Gold

Figure 6.3.2. AUDPC of Pythium diseases under the influence of chemical water treatments in float-bed tobacco production systems in 2017 and 2019 mini-bay greenhouse trials.

Cutrine-plus did not have any significant effects on the AUDPC of Pythium diseases on tobacco seedlings compared with the untreated control in either the 2017 or 2019 greenhouse trial (Figure 6.3.2). The positive control Terramaster, Elumin, and Ridomil Gold all significantly reduced the AUDPC of Pythium diseases on tobacco seedlings in both trials (Figure 6.3.2). The treatment effect of Elumin on the AUDPC of Pythium diseases was similar to that of Terramaster in both trials, while the treatment effect of Ridomil Gold was significantly better than that of

Terramaster in the 2017 mini-bay trial (Figure 6.3.2).

214

Xuemei Zhang Chapter 6 215

Overall Treatment Effects on Root Rot of Water Roots

Neither water treatments nor time had any significant effect on root rot disease incidence or severity of tobacco water roots in 2018, and there was no significant interaction between time and treatment (Table 6.3.2 - 6.3.4). The results of disease progress analysis were consistent with

ANOVA results: the water treatments in 2018 mini-bay trials could not be separated based on water roots root rot incidence or severity data (Figure 6.3.2 - 6.3.3).

Table 6.3.3. The treatment effect changes over time: the effects of chemical water treatments on water roots root rot incidence (%) of tobacco seedlings in mini-bay greenhouse trials. Treatment Water roots root rot incidence (%)

Overall 1WAI 2WAI 3WAI 5WAI Control 61.18 a 15.08 ab 58.47 a 52.84 a 85.82 a Cutrine-plus 53.16 a 11.92 abc 75.76 a 58.47 a 93.52 a

2017 Terramaster 20.21 b 16.65 a 4.32 b 16.65 b 52.99 b Elumin 14.21 bc 1.02 c 1.50 b 23.72 b 52.84 b Ridomil Gold 6.44 c 0.16 c 0.16 b 8.26 b 37.00 b

Elumin 49.75 78.15 14.13 59.30 - Control 34.84 30.84 17.11 59.30 - 2018 Terramaster 24.46 24.16 19.19 30.84 - Ridomil Gold 16.50 19.82 21.27 9.55 - Cutrine-plus 8.57 10.76 9.09 6.15 - Control 92.80 a 75.89 a 91.18 a 100 a - Cutrine-plus 92.72 a 89.32 a 78.13 a 100 a - 2019 Terramaster 7.83 b 0.04 b 4.04 b 34.55 b - Ridomil Gold 0 c 0 b 0 b 0 b - Elumin 0 c 0 b 0 b 0 b - Treatments not followed with the same letter are significantly different (α=0.05). The analysis of some data might be transformed before ANOVA but the data shown in the table were back-transformed. The trials were terminated 3 weeks after inoculation (WAI) in 2018 and 2019.

The repeated measures ANOVA and post hoc analysis results of 2017 and 2019 data showed that the oomyceticide water treatments (Terramaster, Ridomil Gold and Elumin) significantly reduced root rot incidence and severity in tobacco water roots, while the algaecide

215

Xuemei Zhang Chapter 6 216

Cutrine-plus did not have a significant effect on the root rot disease in water roots compared with the untreated control (Table 6.3.2 - 6.3.4). Despite the treatments, disease incidence and severity increased during the trials (Table 6.3.3 - 6.3.4, Figure 6.3.3 - 6.3.4). The treatment X time interaction was significant in 2017 and marginally significant in 2019 (Table 6.3.2), suggesting that treatment effects changed over time. The disease progress analysis (Figure 6.3.3 - 6.3.4) suggested that water treatments in the mini-bay trials separated into two groups in 2017 and

2019: Control and Cutrine-plus were similarly at high levels, while the fungicide treatments

(Elumin, Ridomil Gold, and Terramaster) clustered together at low disease levels.

Figure 6.3.3. Disease progress analysis (treatment effect changes over time) of the treatment effects of chemical water treatments on water roots root rot incidence (%) in 2017, 2018 and 2019 mini-bay chemical trials.

216

Xuemei Zhang Chapter 6 217

Table 6.3.4. The treatment effect changes over time: the effects of chemical water treatments on water roots root rot severity (%) of tobacco seedlings in mini-bay greenhouse trials. Treatment Water roots root rot severity (%)

Overall 1WAI 2WAI 3WAI 5WAI Cutrine-plus 51.88 a 28.23 a 60.83 a 56.35 a 65.02 a Control 50.46 a 30.69 a 56.35 a 53.96 ab 62.91 ab

2017 Terramaster 31.76 b 32.19 a 15.49 b 32.19 cd 49.32 ab Elumin 26.04 b 8.34 b 9.58 b 38.08 bc 53.96 ab Ridomil Gold 17.66 c 3.41 b 3.41 b 22.39 d 46.47 b

Elumin 48.11 58.54 36.90 49.71 - Control 37.57 37.40 26.03 50.34 - 2018 Terramaster 32.82 31.09 36.58 30.88 - Ridomil Gold 24.37 26.98 32.42 14.41 - Cutrine-plus 18.4 13.36 28.61 13.86 - Cutrine-plus 94.77 a 80.00 a 99.19 a 100 a - Control 92.84 a 87.75 a 97.57 a 99.19 a - 2019 Terramaster 17.09 b 0.79 b 25.91 b 26.51 b - Ridomil Gold 0 c 0 b 0 c 0 c - Elumin 0 c 0 b 0 c 0 c - Treatments not followed with the same letter are significantly different (α=0.05). The analysis of some data might be transformed before ANOVA but the data shown in the table were back-transformed. The trials were terminated 3 weeks after inoculation (WAI) in 2018 and 2019. Figure 6.3.4. Disease progress analysis (treatment effect changes over time) of the treatment effects of chemical water treatments on water roots root severity (%) in 2017, 2018 and 2019 mini-bay chemical trials.

217

Xuemei Zhang Chapter 6 218

Overall Treatment Effects on Root Length and Plant Height

There was no significant Treatment X Time interaction effect on root length in any mini- bay trial (Table 6.3.2). Neither water treatments nor time had any significant effect on the root length of tobacco seedlings in 2018. However, the treatment effects were significant in 2017 and

2019 trials (Table 6.3.2). In comparison with the untreated control, the oomyceticide treatments significantly increased root length at some time points (but not all the time) in 2017 and 2019

(Table 6.3.5). The results of the disease progress analysis of treatment effects on root length suggested that Cutrine-plus was close to the untreated control at low root length levels, while

Ridomil Gold at the highest, Terramaster at a medium level, and Elumin jumping between

Ridomil Gold and Terramaster (Figure 6.3.5).

Although the ANOVA results suggested there were differences between treatments on plant height in 2018 (Table 6.3.2), the difference did not lie between the untreated control and a water treatment, and only happened in the first week after inoculation between Cutrine- plus/Terramaster and Elumin (Table 6.3.6). The oomyceticide treatments significantly increased root length at some time points (but not all the time) in 2017 and 2019, and the overall treatment effects were significant (Table 6.3.6). Plant height steadily increased after inoculation, except in

2017, when a sudden decrease occurred in the 5th week after inoculation, due to leaf clipping earlier in that week (Table 6.3.6, Figure 6.3.6). The treatment X time interaction effect on plant height was significant in 2017 and marginally significant in 2019, but not in 2018 (Table 6.3.2).

218

Xuemei Zhang Chapter 6 219

Table 6.3.5. The treatment effect changes over time: the effects of chemical water treatments on root length (cm) of tobacco seedlings in mini-bay greenhouse trials. Treatment Root length (cm)

Overall 1WAI 2 WAI 3WAI 5WAI Ridomil Gold 11.35 a 12.90 a 11.73 a 9.47 a 11.55 a Elumin 10.04 a 9.80 a 8.63 ab 11.69 a 10.25 a 2017 Terramaster 3.91 b 2.13 b 3.07 c 6.33 ab 5.25 ab

Control 4.33 b 7.03 a 3.88 bc 3.57 b 3.51 bc Cutrine-plus 3.00 b 7.17 a 2.25 c 2.79 b 1.54 c

Cutrine-plus 13.61 12.72 13.96 14.14 - Control 12.55 12.45 13.31 11.90 - 2018 Elumin 12.34 10.83 12.90 13.30 - Terramaster 11.16 10.32 11.83 11.32 - Ridomil Gold 10.83 8.79 11.56 12.14 - Ridomil Gold 13.23 a 12.15 ab 13.38 a 14.17 a - Elumin 11.39 b 11.40 abc 10.90 ab 11.87 ab - 2019 Terramaster 11.04 b 11.29 abc 11.13 ab 10.70 bc - Cutrine-plus 8.65 c 9.30 c 8.00 c 8.64 c - Control 8.60 c 9.89 bc 7.56 c 8.36 c - Treatments not followed with the same letter are significantly different (α=0.05). The analysis of some data might be transformed before ANOVA but the data shown in the table were back-transformed. The trials were terminated 3 weeks after inoculation (WAI) in 2018 and 2019.

Figure 6.3.5. Disease progress analysis (treatment effect changes over time) of the treatment effects of chemical water treatments on root length (cm) in 2017, 2018 and 2019 mini-bay chemical trials.

219

Xuemei Zhang Chapter 6 220

Table 6.3.6. The treatment effect changes over time: the effects of chemical water treatments on plant height (cm) of tobacco seedlings in mini-bay greenhouse trials. Treatment Plant height (cm)

Overall 1WAI 2 WAI 3WAI 5WAI Ridomil Gold 5.96 a 2.28 a 4.91 a 13.11 a 8.62 ab Terramaster 4.61 b 1.61 a 3.74 b 10.96 a 6.81 b

2017 Elumin 4.41 b 1.56 a 3.27 b 11.82 a 6.29 b Cutrine-plus 3.12 c 1.78 a 2.54 bc 7.29 b 2.88 c Control 2.63 c 1.56 a 2.04 c 6.43 b 2.33 c

Cutrine-plus 6.61 a 4.66 ab 6.80 a 8.36 a - Terramaster 6.48 a 5.24 a 6.75 a 7.46 a - 2018 Control 5.76 ab 4.63 ab 5.97 a 6.68 a - Ridomil Gold 5.68 ab 4.09 b 5.83 a 7.12 a - Elumin 4.70 b 3.91 b 4.62 a 5.56 a - Ridomil Gold 12.24 a 7.25 a 16.08 a 15.74 a - Terramaster 10.50 a 6.49 a 13.62 a 13.08 a - 2019 Elumin 9.96 a 6.89 a 10.85 b 13.20 a - Cutrine-plus 2.54 b 2.48 b 2.27 c 2.90 b - Control 2.26 b 1.93 b 1.99 c 3.02 b - Treatments not followed with the same letter are significantly different (α=0.05). The analysis of some data might be transformed before ANOVA but the data shown in the table were back-transformed. The sudden reduction of plant height was associated with leaf clipping. The trials were terminated 3 weeks after inoculation (WAI) in 2018 and 2019.

Figure 6.3.6. Disease progress analysis (treatment effect changes over time) of the treatment effects of chemical water treatments on plant height in 2017, 2018 and 2019 mini-bay chemical trials.

220

Xuemei Zhang Chapter 6 221

The results of the disease progress analysis of plant height (Table 6.3.6, Figure 6.3.6) suggested that water treatments in the mini-bay trials were separated into two groups in 2017 and

2019: Control and Cutrine-plus were together at low levels of plant height, while the oomyceticide treatments (Elumin, Ridomil Gold and Terramaster) were clustered at high levels of plant height.

Overall Treatment Effects on Stunting, Leaf Chlorosis and Mortality Incidence

There was no significant treatment or treatment X time interaction effect on stunting, leaf chlorosis, and mortality incidence in the 2018 mini-bay greenhouse trial (Table 6.3.2). The treatment effect on stunting incidence was significant in the 2017 and 2019 trials, and there was a significant treatment X time interaction effect on stunting in 2019 (Table 6.3.2). Elumin and

Ridomil Gold significantly reduced stunting incidence in 2017, and all oomyceticide treatments significantly reduced stunting incidence in 2019 (Table 6.3.7). The treatment effect on stunting incidence tended to depend on time, happening at a later stage during the growing season (Table

6.3.7 and Figure 6.3.7). Effects on stunting incidence did not separate the water treatments very well at the beginning of the trials, but near the end of the trials Cutrine-plus was close to the untreated control with high incidences of stunting, while Terramaster and Elumin were at medium levels, and Ridomil Gold was at the lowest levels (Figure 6.3.7).

221

Xuemei Zhang Chapter 6 222

Table 6.3.7. The treatment effect changes over time: the effects of chemical water treatments on stunting incidence (%) of tobacco seedlings in mini-bay greenhouse trials. Treatment Stunting incidence (%)

Overall 1WAI 2 WAI 3WAI 5WAI Control 0.59 a 0.20 a 0.85 a 0.68 a 0.78 a Cutrine-plus 0.44 a 0.49 a 0.40 ab 0.20 ab 0.74 ab

2017 Terramaster 0.40 a 0.35 a 0.57 ab 0.26 ab 0.46 ab Elumin 0.13 b 0.07 a 0.06 b 0.26 ab 0.20 ab Ridomil Gold 0.08 b 0.07 a 0.12 b 0.07 b 0.08 b

Cutrine-plus 0.02 0.11 0 0.01 - Elumin 0.01 0.07 0 0 - 2018 Ridomil Gold 0.01 0.07 0 0.03 - Terramaster 0.01 0.01 0 0 - Control 0 0.03 0 0 - Control 26.18 a 0.10 0.01 100 a - Cutrine-plus 25.98 a 0.06 0.01 100 a - 2019 Elumin 5.79 b 0.26 0.24 34.55 b - Terramaster 1.73 b 0.33 0.06 9.55 b - Ridomil Gold 0.06 b 0.16 0.10 0 bc - Treatments not followed with the same letter are significantly different (α=0.05). The analysis of some data might be transformed before ANOVA but the data shown in the table were back-transformed. The trials were terminated 3 weeks after inoculation (WAI) in 2018 and 2019.

222

Xuemei Zhang Chapter 6 223

All oomyceticide treatments significantly reduced incidence of leaf chlorosis in comparison with the untreated control in both the 2017 and 2019 trials (Table 6.3.8). The treatment X time interaction effects on leaf chlorosis incidence were also significant in 2017 and

2019 (Table 6.3.8), suggesting that treatment effects changed over time. The results of the disease progress showed that water treatments were separated into two groups in 2017 and 2019 trials: the untreated control and Cutrine-plus were together at higher levels of leaf chlorosis incidence, while the oomyceticide treatments (Elumin, Ridomil Gold, and Terramaster) were clustered at lower levels (Figure 6.3.8).

None of the water treatments had a significant effect on mortality incidence among tobacco seedlings in 2017 or 2018 (Table 6.3.2 & 6.3.9). In 2019, the results showed that all three oomyceticide treatments significantly reduced mortality incidence in comparison with the untreated control (Table 6.3.9). The treatment X time interaction was significant in the 2019 trial, suggesting that the effects changed over time (Table 6.3.2). The treatment effect was not significant until the later stage of the trial (Table 6.3.9). The three oomyceticide treatments were clustered at low levels of mortality incidence, while Control and Cutrine-plus were close at much higher levels (Figure 6.3.9).

223

Xuemei Zhang Chapter 6 224

Table 6.3.8 The treatment effect changes over time: the effects of chemical water treatments on leaf chlorosis incidence (%) of tobacco seedlings in mini-bay greenhouse trials. Leaf chlorosis (%) Treatment Overall 1WAI 2WAI 3WAI 5WAI

Control 9.99 a 7.48 a 22.66 a 15.22 a 1.94 a Cutrine-plus 9.77 a 1.34 b 32.89 a 16.54 a 3.29 a

2017 Elumin 0.08 b 0.18 b 0 b 0.01 b 0.37 ab Ridomil Gold 0.07 b 0.07 b 0 b 0.03 b 0.20 b Terramaster 0.05 b 0.11 b 0.32 b 0.03 b 0 b Control 7.01 0 0 51.86 -

Elumin 6.91 0 0.97 41.41 -

2018 Ridomil Gold 3.34 0 5.12 10.09 -

Terramaster 3.27 0 0.03 25.50 -

Cutrine-plus 0.77 0 0 6.76 - Cutrine-plus 84.14 a 100 a 100 a 11.24 a - Control 76.40 a 97.59 a 99.68 a 6.67 ab - 2019 Elumin 1.15 b 0 b 6.42 b 0.43 c - Ridomil Gold 0.88 b 0 b 6.48 b 0.06 c - Terramaster 0.09 b 0 b 0 b 0.79 bc - Treatments not followed with the same letter are significantly different (α=0.05). The analysis of some data might be transformed before ANOVA but the data shown in the table were back-transformed. The trials were terminated 3 weeks after inoculation (WAI) in 2018 and 2019.

224

Xuemei Zhang Chapter 6 225

Table 6.3.9. The treatment effect changes over time: the effects of chemical water treatments on mortality incidence (%) of tobacco seedlings in mini-bay greenhouse trials. Mortality incidence (%) Treatment Overall 1WAI 2 WAI 3WAI 5WAI Control 0.06 ab 0.01 a 0.03 ab 0.06 a 0.32 a Cutrine-plus 0.34 a 0.07 a 0.04 a 0.20 a 2.04 a 2017 Terramaster 0.08 ab 0 a 0 b 0 b 0.91 a Elumin 0.05 b 0 a 0 b 0 b 0.67 a Ridomil Gold 0.03 b 0 a 0 b 0 b 0.51 a

Elumin 0.07 0 0.01 0.48 - Control 0.05 0 0.03 0.25 - 2018 Terramaster 0.01 0 0 0.06 - Cutrine-plus 0 0 0.01 0 - Ridomil Gold 0 0 0 0 - Control 0.18 a 0 0.03 a 1.22 a - Cutrine-plus 0.13 a 0 0.07 a 0.68 a - 2019 Ridomil Gold 0 b 0 0 b 0.03 b - Elumin 0 b 0 0 b 0.03 b - Terramaster 0 b 0 0 b 0 b - Treatments not followed with the same letter are significantly different (α=0.05). The analysis of some data might be transformed before ANOVA but the data shown in the table were back-transformed. The trials were terminated 3 weeks after inoculation (WAI) in 2018 and 2019.

225

Xuemei Zhang Chapter 6 226

6.3.3 Endpoint Comparison of The Effects of Non-Chemical Water

Treatments at The Final Assessments in Small-Bay Trials

The final assessment results of small-bay trials showed that Terramaster significantly increased the root weight and root length of tobacco seedlings, while reducing root rot incidence and severity compared with the untreated control, in both trials (Table 6.3.10). Terramaster also significantly reduced the number of oospores produced in tobacco seedling roots (Table 6.3.10,

Figure 6.3.10).

Table 6.3.10. The final effects of water treatments on TN 90LC tobacco seedling roots and root rot diseases in small-bay non-chemical trials.

Time Treatment Fresh root Root length Root Root rot Oospore weight (g) (cm) rot severity count per incidence (%) 2mm root (%) tissue 2017 Etridiazole 2.08 a 10.30 a 40.00 b 8.00 c Nonez (Terramaster) Copper 1.6 ppm 1.32 b 5.44 ab 83.33 a 16.33 bc None Copper 0.8 ppm 0.87 b 5.16 b 85.00 a 19.33 bc None UV 0.90 b 6.42 ab 98.33 a 31.33 ab Massive Control 0.93 b 5.53 ab 100.00 a 45.33 a Massive 2018 Etridiazole 2.46 a 6.30 a 50.06 b 12.40 d 0 c Copper 1.6 ppm 1.60 ab 4.02 bc 86.67 a 49.11 bc 2 c Copper 0.8 ppm 2.04 ab 4.49 b 88.89 a 46.56 c 3 c UV 1.58 ab 3.70 bc 100 a 70.67 ab 40 b Control 1.29 b 3.43 c 100 a 85.00 a 70 a Treatments not followed with the same letter are significantly different (α=0.05). The analysis of some data might be transformed before ANOVA but the data shown in the table were back-transformed. z The oospore count in 2017 was not quantified.

226

Xuemei Zhang Chapter 6 227

Figure 6.3.10. Comparison of tobacco seedling roots (top) and spore reproduction in root tissues (bottom) at the end of small-bay trial. The circles the red arrows pointing to are the sexual spores produced by Pythium myriotylum in root tissues. UV and control: Seedling roots were dark, slimy and decayed. Root tissues were occupied by sexual spores. Terramaster: Seedlings had big white roots systems with no apparent root rot symptoms. Few spores were found in the root tissues. Copper ion 0.8 and 1.6 ppm: Seedlings had brown or dark roots with white and short roots emerging in the center of the root systems. Few spores were found in the root tissues.

Copper ion treatments significantly reduced root rot severity in the treated bays, although they did not have much significant effect on root rot incidence and tobacco seedling root measurements (Table 6.3.10). Copper ion treatments also significantly reduced the number of oospores produced in tobacco seedling roots (Table 6.3.10, Figure 6.3.10). The UV treatment did not have any significant effects on Pythium root rot or tobacco seedling root measurements in tobacco seedlings, although it significantly reduced the number of oospores produced in tobacco

227

Xuemei Zhang Chapter 6 228 seedling roots (Table 6.3.10, Figure 6.3.10).

Generally, the tobacco seedlings in UV-treated bays were appeared similar to those in untreated control bays - roots were dark and rotten (Figure 6.3.10). The seedling roots from

Terramaster-treated bays appeared white and healthy. Although the copper-ion-treated seedlings exhibited root rot on the water roots and the root systems were small, new white roots were growing out from the medium and appeared to be white and healthy (Figure 6.3.10).

6.3.4 Comparison of Non-Chemical Treatment Effects Over Time and

AUDPC in Small-Bay Trials

The results from the 2017 small-bay trial (Table 6.3.11) showed that there were significant treatment effects on root rot incidence (P<0.0001) and severity (P<0.0001) in water roots, as well as stunting incidence (P=0.0268). The effect of the treatment X time interaction was only significant root rot incidence (P<0.0001) and severity (P<0.0001) on water roots. In

2019, the treatment and treatment X time interaction effects were significant on root rot incidence (P<0.001) and severity (P<0.001, P=0.002) on water roots, as well as for incidence of leaf chlorosis (P=0.0023, P=0.0256).

Only significant effects in repeated measures ANOVA (Table 6.3.11) were further analyzed with Fisher’s LSD post hoc tests to detect where the differences lay between treatments. The area under the disease progress curve (AUDPC) of Pythium myriotylum was calculated using water roots root rot severity data collected in both trials.

228

Xuemei Zhang Chapter 6 229

Table 6.3.11. The treatment and time effects on TN 90LC tobacco seedlings and root rot diseases in small-bay trials. P value

Year Effects Water roots Water roots Leaf Stunting Mortality Non- root rot root rot chlorosis incidence incidence germinating incidence severity incidence rate TRT <0.0001* <0.0001* 0.8140 0.0268* 0.0900 0.4584 2017 Time <0.0001* <0.0001* 0.0001* <0.0001* 0.0066* <0.0001* TRT* Time <0.0001* <0.0001* 0.9205 0.4130 0.2298 0.3594 TRT <0.0001* <0.0001* 0.0023* 0.0752 0.4060 0.2404 2018 Time <0.0001* <0.0001* 0.0004* 0.3711 <0.0001* <0.0001* TRT* Time <0.0001* 0.0002* 0.0256* 0.7682 0.3602 0.6790 *indicated significant differences in repeated measures ANOVA, with P values less than 0.05.

Effects of Non-Chemical Water Treatments on The AUDPC of Pythium myriotylum

AUDPC of Pythium diseases under the influence of Copper ion and UV treatments 300 a 250 a a a

200 a a 150 b b 100 c 50 b

0 2017 2018

Control UV Cu_0.8 Cu_1.6 Terramaster

Figure 6.3.11. AUDPC of Pythium diseases under the influence of chemical water treatments in float-bed tobacco production systems in 2017 and 2019 small-bay greenhouse trials.

The UV treatment did not have any significant effects on the AUDPC of Pythium diseases on tobacco seedlings compared with the untreated control in either the 2017 or 2018 trial. The AUDPC of Pythium diseases on tobacco seedlings was significantly reduced in

229

Xuemei Zhang Chapter 6 230

Terramaster-treated bays. Copper ion treatments significantly reduced the AUDPC of Pythium diseases on tobacco seedlings in 2018 but not in 2017 (Figure 6.3.11).

Overall Effects of Chemical Water Treatments on Pythium Root Rot of Water Roots in

Small-Bay Trials

Although significant treatment effects on Pythium root rot disease incidence and severity of tobacco water roots were detected by the ANOVA (Table 6.3.11), it was mostly due to the effects of Terramaster (Table 6.3.12 - 6.3.13). Although copper ion treatments showed significant effects on root rot disease incidence and severity at the early stage, the treatment effects changed over time and the overall treatment effect was not statistically significant in the

2017 trial (Table 6.3.11 - 6.3.13). UV treatments did not have any significant overall effect on

Pythium root rot incidence and severity of tobacco water roots in either small-bay trial.

Table 6.3.12. The treatment effect changes over time: the effects of non-chemical water treatments on water roots root rot incidence (WRRI,%) and severity (WRRS,%) of tobacco seedlings in 2017 small-bay greenhouse trial. Treatment Overall 3 WAI 4 WAI 5 WAI 7 WAI 8 WAI 9WAI Control 13.41 a 0 50.74 a 77.79 a 86.71 a 100 a 100 a UV 13.80 a 0 39.11 a 79.86 ab 84.64 a 99.42 a 100 a WRRI Copper 1.6 ppm 13.16 a 0 9.45 b 71.68 ab 83.99 a 98.14 a 94.56 a

Copper 0.8 ppm 12.28 a 0 12.75 b 67.08 ab 86.29 a 99.39 a 100 a Etridiazole 0.30 b 0 9.72 b 51.23 b 0 b 0 b 0 b Control 13.41 a 0 9.05 a 18.81 ab 11.42 b 32.26 a 26.90 ab UV 13.80 a 0 4.63 b 19.10 ab 17.74 a 30.90 ab 30.00 ab WRRS Copper 1.6 ppm 13.16 a 0 3.88 b 17.74 ab 18.40 a 26.66 b 32.71 a Copper 0.8 ppm 12.28 a 0 2.50 b 20.44 a 16.17 ab 30.90 ab 24.44 b Etridiazole 3.04 b 0 2.79 b 0.48 c 0.88 c 0 c 0 c Treatments not followed with the same letter are significantly different (α=0.05). The analysis of some data might be transformed before ANOVA but the data shown in the table were back-transformed.

230

Xuemei Zhang Chapter 6 231

Table 6.3.13. The treatment effect changes over time: the effects of non-chemical water treatments on water roots root rot incidence (WRRI,%) and severity (WRRS,%) of tobacco seedlings in 2018 small-bay greenhouse trial. Treatment Overall 4 WAI 6 WAI 8 WAI 9 WAI 10 WAI 11 WAI Control 11.3 a 0 12.03 a 81.59 a 2.56 6.44 2.56 UV 5.52 a 0 0.36 b 21.37 b 5.33 10.00 10.33 WRRI Copper 0.8 ppm 1.25 b 0 0.64 b 0.55 c 1.21 5.07 3.25 Copper 1.6 ppm 1.27 b 0 0.09 b 0.65 c 1.44 4.91 4.89 Etridiazole 0.19 b 0 0.04 b 0.01 c 0.36 0.68 0.81 Control 30.64 a 0 29.54 a 72.52 a 27.96 ab 36.14 27.69 ab UV 29.76 a 0 8.90 b 52.77 a 33.73 a 44.37 48.61 a WRRS Copper 0.8 ppm 21.47 b 0 14.56 ab 23.43 b 22.05 ab 41.92 33.15 ab Copper 1.6 ppm 21.01 b 0 6.43 b 22.05 b 19.87 ab 40.82 43.18 ab Etridiazole 10.01 c 0 4.71 b 4.97 c 18.48 b 28.15 18.48 b Treatments not followed with the same letter are significantly different (α=0.05). The analysis of some data might be transformed before ANOVA but the data shown in the table were back-transformed.

Figure 6.3.12. Disease progress analysis (treatment effect changes over time) of the treatment effects of non-chemical water treatments on water roots root rot incidence (top, %) and severity (bottom, %) in small-bay non-chemical trials.

231

Xuemei Zhang Chapter 6 232

The Terramaster and copper ion treatments had a significant overall effect on Pythium root rot disease incidence and severity of tobacco water roots in 2018. However, the effects of copper ion treatments changed over time (Table 6.3.11 & 6.3.13, Figure 6.3.12). Terramaster was associated with the lowest disease incidence and severity, which was separated from the rest of the treatments, including Copper ion treatments, UV disinfestation treatment, and Control.

Overall Effects of Non-Chemical Water Treatments on Leaf Chlorosis, Stunting, Seed

Germination and Seedling Mortality in Small-Bay Trials

There were no significant treatment effects on leaf chlorosis incidence in the 2017 small- bay trial (Table 6.3.11 & 6.3.14). Although significant differences among treatments were detected by the ANOVA in terms of the effects on stunting incidence (Table 6.3.11), that was due to the differences between UV and Terramaster or copper ion treatments (Table 6.3.14).

However, in 2018 trial, all the treatments (including UV, copper ions and Terramaster treatments) had significant effects on leaf chlorosis and stunting incidence (Table 6.3.11 &

6.3.15). Such differences mainly occurred at 8 WAI and 9 WAI (Table 6.3.15 & Figure 6.3.13).

There were no significant treatment effects on seed germination or seedling mortality incidence

(Table 6.3.11 & 6.3.16 - 6.3.17, Figure 6.3.14).

232

Xuemei Zhang Chapter 6 233

Table 6.3.14. The treatment effect changes over time: the effects of non-chemical water treatments on leaf chlorosis incidence (LC, %) and on stunting incidence (SI,%) of tobacco seedlings in 2017 small-bay greenhouse trial. Treatment Overall 3 WAI 4 WAI 5 WAI 7 WAI 8 WAI 9WAI Control 0 0 0 0 00 0.02 0.01 UV 0 0 0 0 0 0 0 LC (%) Copper 1.6 ppm 0 0 0 0 0 0.01 0

Copper 0.8 ppm 0 0 0 0 0 0.01 0 Etridiazole 0 0 0 0 0 0.02 0 Control 0 ab 0 0.05 ab 0 0 0 0 UV 0.01 a 0 0.08 a 0.01 0 0.01 0 S (%) Etridiazole 0 b 0 0.03 b 0 0 0 0 Copper 1.6 ppm 0 b 0 0.03 b 0 0 0 0 Copper 0.8 ppm 0 b 0 0.02 b 0 0 0 0 Treatments not followed with the same letter are significantly different (α=0.05). The analysis of some data might be transformed before ANOVA but the data shown in the table were back-transformed.

Table 6.3.15. The treatment effect changes over time: the effects of non-chemical water treatments on leaf chlorosis incidence (LC, %) and on stunting incidence (SI,%) of tobacco seedlings in 2018 small-bay greenhouse trial. Year Treatment Overall 4 WAI 6 WAI 8 WAI 9 WAI 10 WAI 11 WAI Control 0.25 a 0 0 1.01 a 2.46 a 0.16 0 UV 0.02 b 0 0 0.23 ab 0.03 b 0.05 0 LC (%) Copper 1.6 ppm 0.01 b 0 0 0.08 c 0 b 0.14 0

Copper 0.8 ppm 0.01 b 0 0 0.02 c 0.01 b 0.08 0 Etridiazole 0 b 0 0 0.06 c 0 b 0.02 0 Control 0.18 a 0 0.03 0.89 a 1.16 a 0.07 0.01 UV 0.02 b 0 0.08 0.01 b 0.02 b 0.03 0.01 S (%) Etridiazole 0.01 b 0 0.05 0.01 b 0.01 b 0.03 0.01 Copper 1.6 ppm 0.01 b 0 0.03 0.01 b 0.01 b 0.01 0.03 Copper 0.8 ppm 0.01 b 0 0.02 0.01 b 0.01 b 0.01 0.01 Treatments not followed with the same letter are significantly different (α=0.05). The analysis of some data might be transformed before ANOVA but the data shown in the table were back-transformed.

233

Xuemei Zhang Chapter 6 234

Figure 6.3.14. Disease progress analysis (treatment effect changes over time) of the treatment effects of non-chemical water treatments on non-germination rate (%) and mortality incidence (%) in small-bay non-chemical trials.

234

Xuemei Zhang Chapter 6 235

Table 6.3.16. The treatment effect changes over time: the effects of non-chemical water treatments on non-germination rate (NG, %) and mortality incidence (M, %) of tobacco seedlings in 2017 small-bay greenhouse trial. Treatment Overall 3 WAI 4 WAI 5 WAI 7 WAI 8 WAI 9WAI UV 0.08 0 0.37 0.24 a 0.11 0.03 0.01 Control 0.06 0 0.30 0.12 ab 0.08 0.02 0.02 NG (%) Copper 0.8 ppm 0.03 0 0.16 0.06 b 0.05 0.01 0.01

Copper 1.6 ppm 0.03 0 0.13 0.04 b 0.06 0.02 0.01 Etridiazole 0 0 0 0.12 ab 0.07 0.02 0.01 UV 0 0 0 0 0 0 0 Control 0 0 0 0 0 0 0 M (%) Copper 0.8 ppm 0 0 0 0 0 0 0 Copper 1.6 ppm 0 0 0 0 0 0 0 Etridiazole 0 0 0 0 0 0 0 Treatments not followed with the same letter are significantly different (α=0.05). The analysis of some data might be transformed before ANOVA but the data shown in the table were back-transformed.

Table 6.3.17. The treatment effect changes over time: the effects of non-chemical water treatments on non-germination rate (NG, %) and mortality incidence (M, %) of tobacco seedlings in 2018 small-bay greenhouse trial. Year Treatment Overall 4 WAI 6 WAI 8 WAI 9 WAI 10 WAI 11 WAI Control 2.21 8.20 ab 0.12 0.41 1.09 4.36 3.61 UV 1.51 15.49 a 0.82 0.09 0.16 0.74 0.78 NG (%) Terramaster 1.18 16.11 a 0.14 0.12 0.13 0.46 0.41

Copper 0.8 ppm 1.13 8.47 ab 0.12 0.07 0.14 1.35 1.75 Copper 1.6 ppm 0.69 5.28 b 0.16 0.09 0.19 0.52 0.64 Control 0.03 0 0.12 b 0.02 0.15 0 0.01 UV 0.04 0 0.82 a 0 0 0 0.03 M (%) Etridiazole 0.01 0 0.14 b 0 0 0 0.02 Copper 0.8 ppm 0.01 0 0.1 b 0 0 0 0.03 Copper 1.6 ppm 0.01 0 0.16 b 0 0 0 0.01 Treatments not followed with the same letter are significantly different (α=0.05). The analysis of some data might be transformed before ANOVA but the data shown in the table were back-transformed.

235

Xuemei Zhang Chapter 6 236

6.4 Discussion

6.4.1 The Efficacies of Chemical Treatments

The Efficacies of Alternative Chemical Treatments in Mini-bay Trials

In this study, two oomyceticides Ridomil Gold and Elumin, and an algaecide Cutrine- plus , were compared with Terramaster 4EC for controlling Pythium diseases in mini-scale float- bed systems inoculated with Pythium myriotylum in a tobacco greenhouse. In general, the results of 2017 and 2019 trials were consistent. We suspect that there might have been mistakes in treatment application or data collection, or cross contamination between plots in the 2018 trial because there was unusually high variation between replications within the Cutrine-plus and

Terramaster treatments in that experiment. The final assessment data, overall treatment effect and disease progress analysis results from the 2017 and 2019 mini-bay trials clearly separate the treatments into two groups. Group 1 consists of the oomyceticide treatments: Terramaster,

Ridomil Gold and Elumin, where were highly effective on Pythium disease control. Goup 2 consists of the untreated control and utrine-plus, which did not have any significant effects on

Pythium diseases.

The Efficacy of Ridomil Gold (Mefenoxam)

Ridomil Gold consistently reduced Pythium root rot incidence and severity in the mini- bay trials. The tobacco seedlings grown in Ridomil Gold treated bays had healthy root systems.

The treatment effect of Ridomil Gold was significantly stronger than that of Terramaster in terms of increasing root weight and reducing root rot incidence and severity. The mode of action of mefenoxam, the active ingredient of Ridomil Gold, is to inhibit the RNA synthesis of target pathogens (Davidse, 1995, FRAC, 2020). Two previous studies focused on managing Pythium root rot in tobacco transplant greenhouses with mefenoxam, and the efficacy of mefenoxam

236

Xuemei Zhang Chapter 6 237 differed in these studies. Mufunda et al. (2017) in Zimbabwe tested the mefenoxam sensitivity of multiple Pythium myriotylum isolates collected from tobacco transplant greenhouses. The results demonstrated that all of the P. myriotylum isolates were sensitive to mefenoxam. However,

Gutiérrez et al. (2012) from North Carolina found that mefenoxam did not increase the percentage of healthy tobacco seedlings, although it significantly reduced root rot incidence caused by P. myriotylum. Interestingly, etridiazole was much more effective than mefenoxam in that study, which seems to contradict the results of the present study. This difference might be explained by the genetic diversity of Pythium populations in different greenhouses (Chapter 3).

Mefenoxam is a single-site fungicide that has been widely used in greenhouse crop production, and there have been many reports on resistance in Pythium species to mefenoxam

(Moorman & Kim, 2004, Weiland et al., 2014, Aegerter et al., 2002, Lookabaugh et al., 2015).

Due to the high resistance risk, it is always recommended to rotate mefenoxam with another oomyceticide that has a different mode of action. Mefenoxam is not registered for Pythium control in tobacco transplant greenhouses; fungicide resistance could explain why mefenoxam was effective in this study and that of Mufunda et al.’s but not in Gutiérrez et al.’s study, if previous fungicide use patterns differed among the trials. Gutiérrez et al. suggested that P. myriotylum is likely to develop resistance to mefenoxam. Therefore, a baseline sensitivity analysis is required to test the response of different P. myriotylum populations to mefenoxam.

The Efficacy of Elumin (Ethaboxam)

Elumin performed comparably to Ridomil Gold, significantly increasing root length and root weight of tobacco seedlings, while significantly reducing Pythium root rot incidence and severity in the mini-bay trials. Ethaboxam, the active ingredient of Elumin, acts through affecting the microtubule assembly of target pathogens and disrupting cell mitosis (Uchida et al., 2005,

237

Xuemei Zhang Chapter 6 238

FRAC, 2020, Noel et al., 2019). It has been highly effective at protecting soybean and wheat seedlings from Pythium pre and post-emergent damping-off caused by P. aphanidermatum, P. irregulare, P. ultimum and other species (Radmer et al., 2017, Robertson et al., 2013,

McLachlan, 2016, Scott et al., 2020, White et al., 2019). Ethaboxam is helpful specifically in managing metalaxyl/mefenoxam-resistant Pythium species, and therefore, it is recommended to add ethaboxam into treatment cocktails to manage Pythium diseases(White et al., 2019, Scott,

2018, Vargas, 2018). There is no published information on the efficacy of ethaboxam in Pythium disease management in tobacco transplant greenhouse, but the results of this study indicate that ethaboxam could be potentially useful. Although the international Fungicide Resistance Action

Committee (FRAC) says ethaboxam has a low to medium resistance risk, ethaboxam resistance has been found in mutants of Pythium aphanidermatum (FRAC, 2020). Therefore, fungicide rotation will be necessary if considering adding ethaboxam in the Pythium disease management toolbox for tobacco transplant production.

The Efficacy of Cutrine-plus (Copper Ethanolamine Complex)

When compared with the untreated control, Cutrine-plus did not have any significant effects on Pythium root rot or tobacco seedling health in the 2017 mini-bay trial. The treatment effect in 2018 trial was significant. However, there was high variation within the Cutrine-plus treatment in that trial: two out of five replications had severe root rot disease, but the rest were completely disease-free. Such variation was also noticed within the Terramaster treatment in

2018. Therefore, we suspect that there might have been experimental errors in 2018 trial, and then repeated the mini-bay trial again in 2019. The results of the 2019 trial were consistent with those in 2017. Interestingly, Cutrine-plus did significantly reduce sporulation of P. myriotylum in tobacco seedling root tissues, although it did not affect root rot incidence and severity.

238

Xuemei Zhang Chapter 6 239

Cutrine-plus is an algaecide, known to be effective in killing zoospores produced by

Phytophthora in laboratory tests, due to the effect of its active ingredient, Copper Ethanolamine complex (Granke & Hausbeck, 2010). Copper compounds are thought to have a multi-site mode of action, and copper has a long history of being used to treat oomycete pathogens, including

Pythium (FRAC, 2020, Syed et al., 2020). There are several possible reasons why Cutrine-plus did not have any reliable significant effects in this study. First, in addition to zoospores and sporangia, there were mycelia and oospores in the initial inoculum that was released in the bay water. Even if Cutrine-plus was effective on zoospores, the mycelia and oospores of P. myriotylum might survive and initiate infection of tobacco seedlings. Second, the application rate of Cutrine-plus in this study was the lowest rate (0.6 gallon per acre foot) suggested on its label for low-density algae control, and the corresponding copper concentration was 0.2 ppm. The application of Cutrine-plus in this study did reduce the amount of algae significantly, but not completely. Increasing the application rate of Cutrine-plus might have shown a better result on both algae and Pythium suppression, but it’s important to note that excessive copper can injure plant roots and cause environmental contamination and safety issues (Alva et al., 2000,

Ambrosini et al., 2015, Michaud et al., 2007, Lamb et al., 2012, McBride & MartÍnez, 2000,

Michaud et al., 2008). Further tests on the treatment effects of different concentrations of

Cutrine-plus on algae, seedlings roots and root rot disease might be meaningful to tobacco growers, since algae is another problem they often encounter.

239

Xuemei Zhang Chapter 6 240

6.4.2 The Efficacies of Non-Chemical Treatments

In this study, two non-chemical water disinfestation treatments Copper ionization and UV radiation were compared with Terramaster 4EC for controlling Pythium diseases in small-scale float-bed systems inoculated with Pythium myriotylum in a tobacco greenhouse. The final treatment assessment occurred when tobacco seedlings had reached their normal transplant size.

The results of 2017 and 2018 small-bay trials were generally consistent. However,the final assessment data, overall treatment effect and disease progress analysis results separated

Terramaster from the rest of the treatments. Copper ion treatments only stood out when focusing on root rot severity and spore count data.

The Efficacy and Overall Effects of UV Radiation

Ultraviolet (UV) radiation sterilization did not reduce root rot caused by P. myriotylum or improve the root quality of treated tobacco seedlings. Tobacco seedlings from UV-treated bays had dark, slimy and decayed roots with numerous oospores in the root tissues. UV treatment significantly reduced the number of oospores produced in root tissues, but did not significantly reduce root rot severity, suggesting that UV might have interfered with the reproduction/sporulation ability of P. myriotylum, although it did not affect the infection ability.

UV Radiation is an effective water disinfestation treatment to eradicate plant pathogens occurring in greenhouses through damaging the DNA of target microorganisms, causing strand breaking, cross linking, and dimerization of adjacent pyrimidine bases, often leading to lethal mutations (Newman, 2014). UV is widely used for Pythium control in hydroponic crop production systems (Stanghellini et al., 1984, Zhang & Tu, 2000, Newman, 2014, Runia &

Boonstra, 2001, Sutton et al., 2000), but there is no published research information on the efficacy of UV water treatments on Pythium control in tobacco transplant greenhouses.

240

Xuemei Zhang Chapter 6 241

However, it was found that UV water disinfestation treatments significantly reduced the inoculum level of P. aphanidermatum in hydroponic greenhouses (Zhang & Tu, 2000,

Stanghellini et al., 1984), although UV treatments did not have any effect on root rot disease incidence or severity on hydroponically grown tomato plants in Zhang & Tu’s (2000) study. UV disinfestation was also tested in lettuce and chrysanthemums hydroponic systems and showed little suppression of root rot diseases, although it was sufficient to kill Pythium propagules

(Owen-Going et al., 2003, Johnstone). The results of the present study match what was found in

Zhang & Tu’s, Owen-Going’s and Johnstone’s study, which suggests that UV radiation did affect Pythium pathogens to some degree, but not suffiently to prevent or stop an epidemic of

Pythium diseases in hydroponic crop production systems. UV radiation is different from oomyceticide and Copper ion treatments in that it does not contact the Pythium inoculum in seedling roots or bays directly. The movement of Pythium inoculum among seedling roots in bay water is not affected before the water is circulated through the UV lamp. It was possible that a large number of Pythium propagules were dispersed to new seedling roots along the water movement during the water (nutrient solution) recirculation, and only the zoospores that did not attach to seedling roots were exposed to the UV disinfestation system. In other words, the UV lamp may have been only effective in killing free Pythium propagules, but as long as there were

Pythium propagules attached to tobacco seedling roots in float beds, UV radiation might not be able to stop Pythium buildup.

Acquisition of fungicide resistance in P. ultimum triggered by UV radiation has been reported (Bruin & Edgington, 1982). UV might have caused a mutation in P. myriotylum population that damaged reproduction or sporulation of the treated P. myriotylum. There is no control over the mutation direction caused by UV radiation, and UV radiation can trigger

241

Xuemei Zhang Chapter 6 242 fungicide resistance mutations in oomycete pathogens, including Pythium species (Chabane et al., 1993, Zhu et al., 2006).

Efficacy and Overall Effects of Copper ionization

The Copper ionization treatment was tested at two concentrations (0.8 and 1.6 ppm) in this study; neither had much significant effect on the length and weight of tobacco transplant roots, except that the 0.8 ppm copper ions treatment significantly increased root length in 2018.

Copper ionization treatments did not significantly reduce the incidence of root rot among tobacco transplants, but significantly reduced disease severity and suppressed the sporulation of

P. myriotylum in tobacco root tissues.

Copper ionization has been used for algae and oomycete disease management in greenhouses (Van Os, 2009, Wohanka, 2014). Copper ions are released during the ionization process and can actively attach to negatively charged microbial cells, destroying cell wall permeability, interfering with electron transport in respiration systems, denaturing proteins and disrupting cell metabolism (Van Os, 2009, Wohanka, 2014). Copper ionization is known to be effective for control of Phytophthora pathogens (Toppe & Thinggaard, 1998, Toppe &

Thinggaard, 2000, Wohanka, 2014, Raudales et al., 2014). Although there is little published information on the efficacy of copper ionization for Pythium control, Wohanka (2014) mentioned her unpublished data in a book: a 24-hour treatment of 4 ppm copper ions reduced the inoculum level of P. aphanidermatum by 94%. The limitation of copper ionization is the concern for environment and human safety issues, as well as potential phytotoxicity to crops. Research has shown that these concerns could be resolved if the copper ion levels are monitored and maintained within recommended levels (Zheng et al., 2004, Cachafeiro et al., 2007, Wohanka,

2014).

242

Xuemei Zhang Chapter 6 243

The results of this study suggest that Copper inoization may be useful for Pythium disease management in tobacco transplant greenhouses, especially where oomyceticide application is not an option. However, there is likely to be a trade-off between root quality and disease management. Copper ion treatments seemed to injure seedling roots, although reducing root rot severity caused by P. myriotylum. The question is, will such a phytotoxic effect impact the usability of tobacco transplants? In this study, Copper ionization did not significantly affect the upper part of tobacco seedlings; stunting, leaf chlorosis, mortality incidences were below

0.05%. However, in order to ensure the safe use of copper ionization in tobacco greenhouses, it is necessary to perform further experiments to test the effects of different copper ion concentrations on root rot severity and usability of tobacco transplants. It is also important to point out that the inoculum level of the small-bay trials was relatively low. Additional tests of copper ionization treatments at different inoculum levels are needed to accurately estimate the full performance of copper ionization in Pythium control in tobacco greenhouses.

6.4.3 The Standard Pythium Control: Terramaster (Etridiazole)

The treatment effect of Terramaster on Pythium root rot and tobacco seedlings roots was statistically significant in this study. Even with the presence of Pythium myriotylum in bays, tobacco seedlings in bays treated with Terramaster had large, white root systems and appeared to be healthy. Compared with the untreated control, Terramaster significantly increased root length and root weight of tobacco transplants, while significantly reducing root rot incidence and severity in this study. Terramaster was also likely to be associated with the reduction of oospore reproduction in tobacco seedling roots. However, it is not clear if Terramaster directly suppressed sporulation by Pythium myriotylum in tobacco root tissues; the reduction in

243

Xuemei Zhang Chapter 6 244 sporulation could have resulted from the reduction in disease severity.

Phytotoxicity can occur and injure the young tobacco seedlings when Terramaster accumulates in small areas of bays, leaving the seedlings prone to root diseases, which could explain why Terramaster did not significantly reduce root rot incidence in mini-bay trials. The inoculum level in the mini-bay trials (100 ml/gal) was relatively higher than that in the small-bay trials (800 ml/70 gal). Terramaster may have performed better in small-bay trays because the inoculum level was lower in the small-bay trials than in the mini-bay trials.

Etridiazole, the active ingredient of Terramaster, disrupts membrane integrity and function, inhibiting cell respiration and disrupting cellular proteins (Radzuhn & Lyr, 1984,

FRAC, 2020, Halos & PM, 1976, Krasnow & Hausbeck, 2017). Etridiazole may be capable of suppressing the sporangial formation of Pythium aphanidermatum, but the mechanism has not been determined (Krasnow & Hausbeck, 2017). According to the FRAC (Fungicide Resistance

Action Committee) list, the resistance risk of etridiazole is low to medium. Although there is no report on resistance to etridiazole in Pythium, etridiazole resistance has been found in laboratory mutants of another oomycete species, Phytophthora drechsleri (Zhu et al., 2006). Over twenty years ago, Gutiérrez et al. (2012) found that etridiazole completely inhibited root rot incidence and significantly increased the percentage of usable (healthy) tobacco seedlings. Terramaster is generally effective for Pythium disease management in tobacco transplant greenhouses.

However, Pythium pathogens in commercial tobacco greenhouses could evolve to be tolerant or resistant to etridiazole. This hypothesis can be tested if a large number of Pythium isolates are collected from tobacco greenhouses and a baseline sensitivity analysis is performed. Considering the potential resistance risk and phytotoxicity of Terramaster, alternative oomyceticides should be identified that could be rotated with etridiazole for Pythium disease management in float-bed

244

Xuemei Zhang Chapter 6 245 tobacco transplant production systems.

6.4.4 Influence of Water Treatments on Pythium myriotylum Sporulation

Terramaster, Ridomil Gold and Elumin had strong suppressive effects on sporulation of

Pythium myriotylum in tobacco root tissues in the mini-bay trials. copper ionization treatments also significantly suppressed the sporulation of P. myriotylum in tobacco root tissues. Cultrine- plus and UV treatments significantly reduced sporulation of P. myriotylum in tobacco seedling root tissues but did not affect root rot incidence and severity.

Determining whether or not the reduction in P. myriotylum sporulation in root tissues was due to the direct effect of water treatments or to reduced disease severity is difficult. For

Terramaster, Ridomil Gold, Elumin and copper ionization treatments, reduced sporulation was accompanied by lower root rot severity. However, both cutrine-plus and UV significantly reduced sporulation without significantly affecting root rot incidence or severity. It may be possible that cutrine-plus and UV interfered with sporulation of P. myritylum. Those results from this study suggest that the number of oospores produced in P. myritylum-infected roots might not be a good indicator of disease severity.

6.5 Conclusions

Results of this study suggest Ridomil Gold (mefenoxam) and Elumin (ethaboxam) effectively protected tobacco seedlings from P. myriotylum in float tobacco transplant production systems. The treatment effects of these two oomyceticides were similar to Terramaster

(etridiazole) and even better than Terramaster in some aspects. Therefore, Ridomil Gold and

Elumin can be considered as alternative treatments that could be combined or rotated with

245

Xuemei Zhang Chapter 6 246

Terramaster for Pythium disease management in tobacco transplant greenhouses. A baseline sensitivity analysis should be conducted to test the response of different populations of P. myriotylum and other Pythium pathogens from tobacco transplant production greenhouses to etridiazole, in order to estimate the longevity of Terramaster in tobacco greenhouses. Similar baseline sensitivity analyses should also be conducted for mefenoxam and ethaboxam if they are being considered as additions to the Pythium management toolbox for tobacco transplant greenhouses. In addition, in order to elongate the longevity of these oomyceticides in Pythium disease management, the response of Pythium pathogens to the combination programs of etridiazole, mefenoxam and ethaboxam should also be thoroughly evaluated.

The results of this study also suggest that copper ionization may be effective on Pythium diseases in tobacco transplant greenhouses, which could serve as an additional option for tobacco growers, especially organic growers. However, further experiments are needed to test the effects of different copper ion concentrations on root rot severity and usability of tobacco transplants,

These additional experiments should include different inoculum levels.

Cutrine-plus and UV radiation were not effective on Pythium diseases of tobacco seedlings in this study. However, the concentration of Cutrine-plus used in this study was very low. Future tests with a higher application concentration might suggest a greater potential for Cutrine-plus in

Pythium disease management. UV radiation might be able to reduce Pythium inoculum levels in circulated bay water, but it was not able to stop Pythium from building up in seedling roots and suppress root rot diseases.

246

Xuemei Zhang Chapter 7 247

Chapter 7

Summaries and Future Directions

This project consists of four sub-projects aimed to investigate the diversities and ecological relationships within Pythium communities occurring in tobacco transplant greenhouses, as well as to explore new Pythium disease management methods for tobacco transplant production.

Chapter 3 presented the first sub-project, a tobacco transplant greenhouse survey that was conducted in 2017. In this study, 424 samples were collected from one to seven locations within

41 greenhouses mainly in Virginia. The results showed approximately 80% of the surveyed greenhouses harbored Pythium in at least one of four locations within the greenhouse, which included the center walkway, weeds, bay water, and tobacco seedlings. A total of 360 Pythium isolates belonging to 12 described Pythium species, and an undescribed Pythium species were collected in this survey. Those 12 Pythium species included three (P. myriotylum, and P. dissotocum, P. irregulare) that were reported in previous tobacco seedling root rot studies and 9 additional species (P. adhaerens, P. aristosporum, P. attrantheridium, P. catenulatum, P. coloratum, P. inflatum, P. pectinolyticum, P. porphyrae and P. torulosum). Among them, P. dissotocum was the most common species, followed by P. myriotylum. The composition of the

Pythium communities was diverse among the surveyed greenhouses, and this diversity appeared to be dependent on the sampling location, sample type and sampling time. Phylogenetic analysis results indicated intraspecific variation may exist in the P. dissotocum populations collected in this survey. It was also observed that P. myriotylum was the second most widespread species and found to co-exist with multiple other Pythium or oomycete species in the same environment within greenhouses in this survey. This study provided substantial evidence showing the

247

Xuemei Zhang Chapter 7 248 diversity of Pythium communities occurring in tobacco transplant greenhouses across locations.

However, it was not clear how these different Pythium species interact with tobacco seedlings

(the hosts), or each other (interspecific interactions).

Chapter 4 presented a follow-up study on the roles of the 12 Pythium species collected in the 2017 survey. Laboratory and greenhouse trials were conducted to test the pathogenicity of each collected Pythium species to tobacco seeds and seedlings in Petri dishes and simulated float-bed tobacco transplant production systems. The results suggested the 12 Pythium species fell into three groups. Strong pathogens: including P. coloratum, P. dissotocum and P. myriotylum, that consistently suppressed seed germination and caused root rot, stunting, foliar chlorosis and death of tobacco seedlings. Pythium aristosporum, P. torulosum, P. inflatum, P. irregulare, P. catenulatum, and an isolate of P. dissotocum tended to cause root symptoms without affecting the upper part of tobacco seedlings. Therefore, they were categorized as weak pathogens. The third group contained non-pathogens, including P. adhaerens, P. attrantheridium, P. inflatum and P. pectinolyticum, which exhibited no apparent effects on tobacco seeds or seedlings. Pythium myriotylum was the most aggressive species in this study.

The consequences of infection by strong pathogens were relatively consistent across three different host growth stages (at seeding, seedling emergence, and water roots emergence).

However, the damage from infection by weak pathogens decreased as the tobacco plant developed from seeds to seedlings with water roots. The outcome of this study provided additional evidence to show the diversity of Pythium communities in tobacco greenhouses and revealed their relationships with their tobacco seedling hosts. It interested the author that two isolates of P. dissotocum exhibited significantly different virulence on tobacco seeds and seedlings in laboratory and greenhouse trials, and that Pythium myriotylum and its naturally co-

248

Xuemei Zhang Chapter 7 249 occurring species exhibited significantly different levels of virulence on tobacco seeds and seedlings. The author developed two hypotheses: 1 - significant intraspecific variation may exist within Pythium species, and 2 - Pythium myriotylum interacts significantly with the naturally co- occurring species collected in the 2017 survey.

Therefore, a third study (Chapter 5) was designed to explore the intraspecific variation within the two largest Pythium “clans” in the 2017 survey, as well as to investigate the relationship between Pythium myriotylum and other species that co-existed with it in the same environment within tobacco transplant greenhouses. Vegetative growth rate and virulence were highly variable within P. dissotocum populations but less variable within the P. myriotylum populations collected in the 2017 survey. In-vitro interspecific interaction assays suggested there were significant interactions between P. myriotylum and P. catenulatum, P. adhaerens, P. porphyrae, and Achlya flagellata. When Pythium myriotylum was co-cultured with Pythium catenulatum, Pythium pectinolyticum, Pythium adhaerens, and Pythium porphyrae, a clear zone was formed at or near the position where two isolates met. The most interesting observation was that Pythium porphyrae congregated and formed a fence-like structure at one end of the clear zone. In-vivo interspecific interaction assays suggested Pythium adhaerens, Pythium dissotocum,

Pythium catenulatum, and Achlya flagellata may have interacted with Pythium myriotylum in hydroponic environments and increased the virulence of Pythium myriotylum on tobacco seeds, while the interaction between Pythium myriotylum and Pythium porphyrae reduced the virulence of Pythium myriotylum on tobacco seeds. The results from this study provided strong evidence to support the author’s hypotheses generated in Chapter 4.

Chapter 6 presented greenhouse trials where chemical (ethaboxam, mefenoxam and copper ethanolamine complex) and non-chemical water treatments (ultra-violet light and copper

249

Xuemei Zhang Chapter 7 250 ionization) were applied in Pythium myriotylum-inoculated bays. The results showed promising potential from using ethaboxam, mefenoxam, and copper ionization as alternatives to etridiazole for Pythium disease management in tobacco transplant production.

In summary, this dissertation presented a chain of investigations that improve our understanding of the diversity and ecological relationships within Pythium communities living in tobacco transplant production systems. The outcome of this project provides new information on diversity and ecological relationships within Pythium communities in the target ecosystem, as well as new information on expanding available management methods for Pythium diseases in tobacco transplant production greenhouses.

250

Xuemei Zhang References 251

References

Abd-Elsalam KA, Amal-Asran, 2020. Host Plants and Specificity of the Genus Pythium. In: Rai M, Abd-

Elsalam, Kamel A. , Ingle, Avinash P., ed. Pythium: Diagnosis, Diseases and Management. CRC Press,

162-75. (Incidence, Host-range and Disease; vol.)

Abdelzaher HMA, Moustafa SMN, Al-Sheikh H, 2020. The Genus Pythium in Three Different

Continents. In. Pythium. CRC Press, 15-29.

Adhikari BN, Hamilton JP, Zerillo MM, Tisserat N, Lévesque CA, Buell CR, 2013. Comparative genomics reveals insight into virulence strategies of plant pathogenic oomycetes. PloS one 8, e75072.

Aegerter B, Greathead A, Pierce L, Davis R, 2002. Mefenoxam-resistant isolates of Pythium irregulare in an ornamental greenhouse in California. Plant Disease 86, 692-.

Al-Sheikh H, 2010. Two pathogenic species of Pythium: P. aphanidermatum and P. diclinum from a wheat field. Saudi Journal of Biological Sciences 17, 347-52.

Al‐Sa'di AM, Drenth A, Deadman M, De Cock AWaM, Aitken E, 2007. Molecular characterization and pathogenicity of Pythium species associated with damping‐off in greenhouse cucumber (Cucumis sativus) in Oman. Plant Pathology 56, 140-9.

Al‐Sa’di A, Drenth A, Deadman M, Al‐Said F, Khan I, Aitken E, 2008. Potential sources of Pythium inoculum into greenhouse soils with no previous history of cultivation. Journal of Phytopathology 156,

502-5.

Alcala AVC, Paulitz TC, Schroeder KL, Porter LD, Derie ML, Du Toit LJ, 2016. Pythium species associated with damping-off of pea in certified organic fields in the Columbia Basin of central

Washington. Plant Disease 100, 916-25.

Alejandro Rojas J, Jacobs JL, Napieralski S, et al., 2017. Oomycete species associated with soybean seedlings in North America—Part I: Identification and pathogenicity characterization. Phytopathology

107, 280-92.

251

Xuemei Zhang References 252

Allain-Boulé N, Lévesque C, Martinez C, Bélanger R, Tweddell R, 2004a. Identification of Pythium species associated with cavity-spot lesions on carrots in eastern Quebec. Canadian Journal of Plant

Pathology 26, 365-70.

Allain-Boulé N, Tweddell R, Mazzola M, Bélanger R, Lévesque CA, 2004b. Pythium attrantheridium sp. nov.: taxonomy and comparison with related species. Mycological research 108, 795-805.

Alva A, Huang B, Paramasivam S, 2000. Soil pH affects copper fractionation and phytotoxicity. Soil

Science Society of America Journal 64, 955-62.

Ambrosini VG, Rosa DJ, Prado JPC, et al., 2015. Reduction of copper phytotoxicity by liming: a study of the root anatomy of young vines (Vitis labrusca L.). Plant Physiology and Biochemistry 96, 270-80.

Anderson M, Fortnum B, Martin S, 1997. First report of Pythium myriotylum in a tobacco seedling float system in South Carolina. Plant Disease 81, 227-.

Anusuya S, Sathiyabama M, 2015. Foliar application of β-D-glucan nanoparticles to control rhizome rot disease of turmeric. International journal of biological macromolecules 72, 1205-12.

Asano T, Senda M, Suga H, Kageyama K, 2010. Development of multiplex PCR to detect five Pythium species related to turfgrass diseases. Journal of Phytopathology 158, 609-15.

Asran A, Abd-Elsalam KA, 2020. Top Three Plant Pathogenic Pythium Species. In: Mahendra Rai Kaa-

E, Avinash P. Ingle, ed. Pythium: Diagnosis, Diseases and Management. CRC press, 77-91.

Augspurger CK, Wilkinson HT, 2007. Host specificity of pathogenic Pythium species: implications for tree species diversity. Biotropica 39, 702-8.

Avery Jr GS, 1933. Structure and germination of tobacco seed and the developmental anatomy of the seedling plant. American Journal of Botany, 309-27.

Bassani I, Larousse M, Tran QD, Attard A, Galiana E, 2020. Phytophthora zoospores: from perception of environmental signals to inoculum formation on the host-root surface. Computational and Structural

Biotechnology Journal.

Bates M, Stanghellini M, 1984. Root rot of hydroponically grown spinach caused by Pythium aphanidermatum and Pythium dissotocum. Plant Disease 68, 989-91.

252

Xuemei Zhang References 253

Bates ML, 1983. Diseases of hydroponically grown spinach saused by Pythium aphanidermatum and

Pythium dissotocum. Master Thesis, the Univeristy of Arizona.

Beakes GW, Glockling SL, Sekimoto S, 2012. The evolutionary phylogeny of the oomycete “fungi”.

Protoplasma 249, 3-19.

Benhamou N, Rey P, Picard K, Tirilly Y, 1999. Ultrastructural and cytochemical aspects of the interaction between the mycoparasite Pythium oligandrum and soilborne plant pathogens. Phytopathology

89, 506-17.

Benjamin C, 2019. Scientists transform tobacco into factory for high-value proteins. In. I Illinois IGB.

Illinois Carl R. Woese Institute for Genomic Biology.

Berendsen RL, Pieterse CM, Bakker PA, 2012. The rhizosphere microbiome and plant health. Trends in plant science 17, 478-86.

Billings E, 1875. Tobacco: its history, varieties, culture, manufacture and commerce, with an account of its various modes of use, from its first discovery until now. American Publishing Company.

Blancard D, Laterrot H, Marchoux G, Fletcher J, Candresse T, Mcgee D, 2012. Principal characteristics of pathogenic agents and methods of control. Tomato Diseases, 413-650.

Breen TH, 2001. Tobacco culture: the mentality of the great tidewater planters on the eve of revolution.

Princeton University Press.

Broders K, Lipps P, Paul P, Dorrance A, 2007. Characterization of Pythium spp. associated with corn and soybean seed and seedling disease in Ohio. Plant Disease 91, 727-35.

Bruin G, Edgington L, 1982. Induction of Fungal Resistance to Metalaxyl by Ultraviolet Irradiation.

Phytopathology 72, 476-80.

Bu Y, Tang B, Geng S, Li Q, Zhou R, 2008. Technology development and procedure of tobacco seedling production in sand floating system. Chinese Tobacco Science 1.

Cachafeiro SP, Naveira IM, García IG, 2007. Is copper–silver ionisation safe and effective in controlling legionella? Journal of Hospital Infection 67, 209-16.

Cao Y, Li Y, Li J, et al., 2016. Rapid and quantitative detection of Pythium inflatum by real-time

253

Xuemei Zhang References 254 fluorescence loop-mediated isothermal amplification assay. European Journal of Plant Pathology 144,

83-95.

Carrasco G, Márquez O, Urrestarazu M, Salas M. Transplants grown hydroponically are an alternative for soil. Proceedings of the International Symposium on Managing Greenhouse Crops in Saline Environment

609, 2003, 407-10.

Cartwright DK, Spurr Jr H, Shew H, 1995. Commercial potting medium as the source of Pythium causing a disease on tobacco transplants. Plant Disease 79.

Cavale S, 2020. BAT says potential COVID-19 vaccine using tobacco leaves ready for human trials. In.

Reuters Health News. Reuters.com: Reuters.

Chabane K, Leroux P, Bompeix G, 1993. Selection and characterization of Phytophthora parasitica mutants with ultraviolet‐induced resistance to dimethomorph or metalaxyl. Pesticide Science 39, 325-9.

Chatterton S, Sutton J, Boland G, 2004. Timing Pseudomonas chlororaphis applications to control

Pythium aphanidermatum, Pythium dissotocum, and root rot in hydroponic peppers. Biological control

30, 360-73.

Chellemi D, Mitchell D, Kannwischer-Mitchell M, Rayside P, Rosskopf E, 2000. Pythium spp. associated with bell pepper production in Florida. Plant Disease 84, 1271-4.

Chérif M, Menzies J, Ehret D, Bogdanoff C, Belanger R, 1994. Yield of cucumber infected with Pythium aphanidermatum when grown with soluble silicon. HortScience 29, 896-7.

Chunlei Y, Yongxiong H, Aifei CG, Zhengbin L, Xinghe Y, 1997. Study on the technique of tobacco seedling production with the direct-seeded float system. Acta Tabacaria Sinica 2.

Coffua LS, Veterano ST, Clipman SJ, Mena-Ali JI, Blair JE, 2016. Characterization of Pythium spp. associated with asymptomatic soybean in southeastern Pennsylvania. Plant Disease 100, 1870-9.

Cooke D, Drenth A, Duncan J, Wagels G, Brasier C, 2000. A molecular phylogeny of Phytophthora and related oomycetes. Fungal genetics and biology 30, 17-32.

Cornell University, 2019. Transformed tobacco fields could cuts costs for medical proteins. In.

ScienceDaily. ScienceDaily.

254

Xuemei Zhang References 255

D'arcy WG, 1986. Solanaceae, Biology and systematics. Columbia University Press.

Daley B, 2020. ‘Pharming’ for a vaccine: the answer to coronavirus may be in tobacco plants. In.

Theconservation.com.

Davidse L, 1995. Phenylamide fungicides: biochemical action and resistance. Modern selective fungicides, 347-54.

De Cock A, Lodhi A, Rintoul T, et al., 2015. Phytopythium: molecular phylogeny and systematics.

Persoonia: Molecular Phylogeny and Evolution of Fungi 34, 25.

Devaki N, Shankara Bhat S, Bhat S, Manjunatha K, 1992. Antagonistic activities of Trichoderma harzianum against Pythium aphanidermatum and Pythium myriotylum on tobacco. Journal of

Phytopathology 136, 82-7.

Devay J, Garber R, Matheron D, 1982. Role of Pythium species in the seedling disease complex of cotton in California. Plant Disease 66, 151-4.

Dewan M, Sivasithamparam K, 1988. Pythium spp in roots of wheat and rye-grass in western Australia and their effect on root rot caused by Gaeumannomyces graminis var. tritici. Soil Biology and

Biochemistry 20, 801-8.

Dumilag RV, 2019. Detection of Pythium porphyrae infecting Philippine Pyropia acanthophora based on morphology and nuclear rRNA internal transcribed spacer sequences. Journal of general plant pathology

85, 72-8.

Eggertson QA, 2012. Resolving the Pythium ultimum species complex: Carleton University.

Elshahawy I, Abouelnasr HM, Lashin SM, Darwesh OM, 2018. First report of Pythium aphanidermatum infecting tomato in Egypt and its control using biogenic silver nanoparticles. Journal of Plant Protection

Research 58.

Erickson L, Yu WJ, Brandle J, Rymerson R, 2013. Molecular farming of plants and animals for human and veterinary medicine. Springer Science & Business Media.

Fao CS, 2003. Issues in the Global Tobacco Economy–Selected Case Studies. In. Food and Agriculture

Organization.

255

Xuemei Zhang References 256

Farr DF, Rossman AY. In. Fungal Databases, U.S. National Fungus Collections, ARS, USDA. Retrieved

October 5, 2020, from https://nt.ars-grin.gov/fungaldatabases/.

Farr DF, Rossman, A.Y. , 2020. Fungal Databases, U.S. National Fungus Collections, ARS, USDA.

Retrieved August 19, 2020, from https://nt.ars-grin.gov/fungaldatabases/. In.

Feng Y, Dernoeden PH, 1999. Pythium species associated with root dysfunction of creeping bentgrass in

Maryland. Plant Disease 83, 516-20.

Ferrell AK, 2013. Burley: Kentucky Tobacco in a New Century. University Press of Kentucky.

Finch‐Savage WE, Leubner‐Metzger G, 2006. Seed dormancy and the control of germination. New phytologist 171, 501-23.

Fortnum B, Rideout J, Martin S, Gooden D, 2000. Nutrient solution temperature affects Pythium root rot of tobacco in greenhouse float systems. Plant Disease 84, 289-94.

Frac FRaC 2020. FRAC Code List ©*2020: Fungal control agents sorted by cross resistance pattern and mode of actionOn-line [URL] Year/Electronic Resource Number|.

Francl LJ, 2001. The disease triangle: a plant pathological paradigm revisited. The Plant Health

Instructor 10.

Frantz JM, Mitchell CA, Frick J, 1999a. A solid-matrix, liquid hybrid hydroponic system for establishing small-seeded crop Species. HortTechnology 9, 668-71.

Frantz JM, Welbaum GE, Shen Z, Morse R, 1999b. Comparison of cabbage seedling growth in four transplant production systems.

Fritzell E, Mahrt M 1998. Competition II - Interspecific CompetitionOn-line [URL] Year/Electronic

Resource Number|.

Gams W, 1977. A key to the species of Mortierella. Persoonia 9, 381-91.

Garwe D, Chirova T, Muzhinji N, Sengudzwa T, 2014. Molecular Characterization of Pythium (Py)

Species Affecting Tobacco in the Float Tray Seedling Production System. International journal of

Research Studies in Biosciences (IJRSB) 2, 14-20.

Garzón CD, Yánez JM, Moorman GW, 2007. Pythium cryptoirregulare, a new species within the P.

256

Xuemei Zhang References 257 irregulare complex. Mycologia 99, 291-301.

Gilad O, 2008. Competition and Competition Models. In: Sven Erik Jørgensen, Fath BD, eds.

Encyclopedia of Ecology. Academic Press, 707-12.

Goldberg NP, 1990. Aerial transmission and strategies for control of Pythium on hydroponically grown cucumbers.

Gómez FJR, Navarro-Cerrillo RM, Pérez-De-Luque A, Oβwald W, Vannini A, Morales-Rodríguez C,

2019. Assessment of functional and structural changes of soil fungal and oomycete communities in holm oak declined dehesas through metabarcoding analysis. Scientific reports 9, 1-16.

Grabowsk M, 2018. Damping off is a disease of seedlings In.: University of Minnesota Extension

Grand View Research I, 2020. Hydroponics Market Worth $16.0 Billion by 2025 - Exclusive Report by

MarketsandMarkets™. In. Cision PR Newswire. https://www.prnewswire.com/news- releases/hydroponics-market-size-worth-5-68-billion-by-2025--cagr-22-52-grand-view-research-inc-

300987260.html.

Granke L, Hausbeck M, 2010. Effects of temperature, concentration, age, and algaecides on Phytophthora capsici zoospore infectivity. Plant Disease 94, 54-60.

Griffin R, 2020. Covid Shot Derived From Tobacco-Like Plant Tested in Humans. In.: Bloomberg.

Grise VN, Griffin, Karen F., 1988. The US tobacco industry. US Department of Agriculture, Economic

Research Service.

Gull C, 2006. Study of Pythium root diseases of hydroponically grown crops, with emphasis on lettuce:

University of Pretoria.

Gull C, Labuschagne N, Botha W, 2004. Pythium species associated with wilt and root rot of hydroponically grown crops in South Africa. African Plant Protection 10, 109-16.

Gutiérrez W, Melton T, Mila A, 2012. Pythium root rot of flue-cured tobacco seedlings produced in greenhouses: Factors Associated with its Occurrence and Chemical Control. Plant health progress 13, 7.

Gutiérrez WA, Melton TA 2001. Pythium root rot in tobacco greenhouses North Carolina State University

Plant Pathology Extension TB08 - Tobacco Disease Note No. 8

257

Xuemei Zhang References 258 www.ces.ncsu.edu/depts/pp/notes/Tobacco/tdin008/Tb08Pythium.html.

Hall BG, 2013. Building phylogenetic trees from molecular data with MEGA. Molecular biology and evolution 30, 1229-35.

Halos P, Pm H, 1976. Mechanism of tolerance of Pythium species to ethazol.

Hansen Z and Hensley D 2019. Tobacco Disease Management. The Univeristy of Tennessee Extension

Publications W 815 https://extension.tennessee.edu/publications/Documents/W815.pdf

Harvey P, Warren R, Wakelin S, 2008. The Pythium–Fusarium root disease complex–an emerging constraint to irrigated maize in southern New South Wales. Australian Journal of Experimental

Agriculture 48, 367-74.

Hendrix F, Campbell W, 1973. Pythiums as plant pathogens. Annual review of Phytopathology 11, 77-98.

Hendrix J, Floyd F, Campbell WA, 1970. Distribution of Phytophthora and Pythium species in soils in the continental United States. Canadian Journal of Botany 48, 377-84.

Herrero M-L, Brurberg MB, Ojeda DI, Roleda MY, 2020. Occurrence and pathogenicity of Pythium

(Oomycota) on Ulva species (Chlorophyta) at different salinities. Algae 35, 79-89.

Herrero M, Hermansen A, Elen O, 2003. Occurrence of Pythium spp. and Phytophthora spp. in

Norwegian greenhouses and their pathogenicity on cucumber seedlings. Journal of Phytopathology 151,

36-41.

Hirschfelder AB, 2010. Tobacco. Greenwood.

Ho H-H, 2009. The genus Pythium in Taiwan, China (1)—a synoptic review. Frontiers of Biology in

China 4, 15-28.

Ho HH, 2018. The taxonomy and biology of Phytophthora and Pythium. J Bacteriol Mycol: Open Access

6, 00174.

Hockenhull J, Funck-Jensen D, 1982. Is damping-off, caused by Pythium, less of a problem in hydroponics than in traditional growing systems?

Hodges CF, Coleman L, 1985. Pythium-induced root dysfunction of secondary roots of Agrostis palustris.

Plant Disease 69, 336-40.

258

Xuemei Zhang References 259

Hodges L, 2003. G03-1522 Damping off of seedlings and transplants. Historical Materials from

University of Nebraska-Lincoln Extension, 1731.

Hong S-Y, Kim J-W, Kang Y-K, Yang Y-M, Kang H-S, 2004. Potato basal stem rot caused by Pythium myriotylum in hydroponic cultural system. Research in Plant Disease 10, 13-6.

Huo C, Cao J, Wu K, Chen Y, Zhao Z, 2020. First report of Pythium dissotocum causing root rot on hydroponically grown spinach in China. Plant Disease.

Hussein HZ, Abdul-Karim EK, Mutar SS, 2017. Possibility of using nanoparticles (ZnNPs, MgONPs) in keeping cucurbit fruit from infection by Pythium aphanidermatum. Int J Sci Res 6, 837-9.

Huzar-Novakowiski J, Dorrance A, 2018. Genetic diversity and population structure of Pythium irregulare from soybean and corn production fields in Ohio. Plant Disease 102, 1989-2000.

Ichitani T, Kinoshita T, 1990. Materials for Pythium flora of Japan (III) Pythium aristosporum from rhizosphere soil of zoysia green. Bull. Univ. Osaka Pref., Ser. B 42, 1-8.

Ishiguro Y, Asano T, Otsubo K, Suga H, Kageyama K, 2013. Simultaneous detection by multiplex PCR of the high-temperature-growing Pythium species: P. aphanidermatum, P. helicoides and P. myriotylum.

Journal of general plant pathology 79, 350-8.

Ivors KL, Moorman GW, 2014. Oomycete plant pathogens in irrigation water. Biology, Detection, and

Management of Plant Pathogens in Irrigation Water. C. Hong, G. Moorman, W. Wohanka, and C.

Büttner, eds. American Phytopathological Society, St. Paul, MN, 57-64.

Jenkins Jr S, Averre C, 1983. Root diseases of vegetables in hydroponic culture systems in North

Carolina greenhouses. Plant Disease 67, 968-70.

Jeyasubramanian K, Thoppey UUG, Hikku GS, Selvakumar N, Subramania A, Krishnamoorthy K, 2016.

Enhancement in growth rate and productivity of spinach grown in hydroponics with iron oxide nanoparticles. RSC advances 6, 15451-9.

Jiye Q, Haiping Z, 2004. Seeding production with float system of flue-cured tobacco. Journal of Lishui

Teachers College 2.

Johnson CS, Reed TD, 1994. Tobacco. Encyclopedia of Agricultural Science. Academic Press, Inc. 4,

259

Xuemei Zhang References 260

323-36.

Johnson JM, Ludwig A, Furch AC, et al., 2019. The beneficial root-colonizing fungus Mortierella hyalina promotes the aerial growth of Arabidopsis and activates calcium-dependent responses that restrict

Alternaria brassicae–induced disease development in roots. Molecular Plant-Microbe Interactions 32,

351-63.

Johnstone M, 2001. Canopy and leaf gas exchange accompanying Pythium root rot of lettuce and chrysanthemum. 126 p.: Thesis.

Jones J, 2020. Resources For Teachers: The History Of Growing, Harvesting, Manufacturing and

Consuming Tobacco in Text And Photographs. Jeffrey Frank Jones.

Jung T, Scanu B, Bakonyi J, et al., 2017. Nothophytophthora gen. nov., a new sister genus of

Phytophthora from natural and semi-natural ecosystems. Persoonia: Molecular Phylogeny and Evolution of Fungi 39, 143.

Kageyama K, Aoyagi T, Sunouchi R, Fukui H, 2002. Root rot of miniature roses caused by Pythium helicoides. Journal of general plant pathology 68, 15-20.

Kamoun S, 2009. Plant Pathogens: Oomycetes (water mold). In: Schaechter M, ed. Encyclopedia of

Microbiology (Third Edition). Oxford: Academic Press, 689-95.

Kanatas P, 2020. Float system and crucial points of the method for seedling production and crop cultivation with or without organic fertilization.

Karthikeyan G, Sabitha D, Sivakumar C, 2000. Biological and chemical control of Pythium aphanidermatum-Meloidogyne incognita disease complex in chilli and brinjal. Madras Agricultural

Journal 87, 105-8.

Kawamura Y, Yokoo K, Tojo M, Hishiike M, 2005. Distribution of Pythium porphyrae, the causal agent of red rot disease of Porphyrae spp., in the Ariake Sea, Japan. Plant Disease 89, 1041-7.

Kemen E, 2014. Microbe–microbe interactions determine oomycete and fungal host colonization. Current opinion in plant biology 20, 75-81.

Kerns J, Tredway L, 2008. Pathogenicity of Pythium species associated with Pythium root dysfunction of

260

Xuemei Zhang References 261 creeping bentgrass and their impact on root growth and survival. Plant Disease 92, 862-9.

Khan A, Sutton J, Grodzinski B, 2003. Effects of Pseudomonas chlororaphis on Pythium aphanidermatum and root rot in peppers grown in small-scale hydroponic troughs. Biocontrol Science and Technology 13, 615-30.

Kishore K, 2014. Monograph of tobacco (Nicotiana tabacum). Indian Journal of Drugs 2, 5-23.

Klochkova TA, Jung S, Kim GH, 2017. Host range and salinity tolerance of Pythium porphyrae may indicate its terrestrial origin. Journal of Applied Phycology 29, 371-9.

Knapp S, Chase MW, Clarkson JJ, 2004. Nomenclatural changes and a new sectional classification in

Nicotiana (Solanaceae). Taxon 53, 73-82.

Komarnytsky S, Borisjuk NV, Borisjuk LG, Alam MZ, Raskin I, 2000. Production of recombinant proteins in tobacco guttation fluid. Plant Physiology 124, 927-34.

Kong P, Tyler BM, Richardson PA, Lee BW, Zhou ZS, Hong C, 2010. Zoospore interspecific signaling promotes plant infection by Phytophthora. BMC microbiology 10, 1-9.

Krasnow CS, Hausbeck MK, 2017. Influence of pH and etridiazole on Pythium species. HortTechnology

27, 367-74.

Kucharek T, Mitchell D, 2000. Diseases of agronomic and vegetable crops caused by Pythium. Plant pathology fact sheet PP-53. University of Florida, Gainesville, FL.

Kumar A, Reeja S, Bhai RS, Shiva K, 2008. Distribution of Pythium myriotylum Drechsler causing soft rot of ginger. Journal of Spices and Aromatic Crops 17, 05-10.

Kusakari S, Tanaka Y. Root rot caused by Pythium spp. in tomato in hydroponics. Proceedings of the

Proceedings of the Kansai Plant Protection Society, 1987, 31-4.

Labuchagne N, Gull C, Wehner F, Botha W, 2002. Report of root rot caused by Pythium F-group on hydroponically grown celery in South Africa. Plant Disease 86, 441-.

Labuschagne N, Gull C, Wehner F, Botha W, 2002. Pythium spp. infecting hydroponically grown lettuce in South Africa. Plant Disease 86, 1175-.

Labuschagne N, Gull C, Wehner F, Botha W, 2003. Root rot and stunting of hydroponically grown

261

Xuemei Zhang References 262 endive, fennel, and sorrel caused by Pythium F-group in South Africa. Plant Disease 87, 875-.

Lamb DT, Naidu R, Ming H, Megharaj M, 2012. Copper phytotoxicity in native and agronomical plant species. Ecotoxicology and environmental safety 85, 23-9.

Larousse M, Galiana E, 2017. Microbial partnerships of pathogenic oomycetes. PLoS pathogens 13, e1006028.

Larsen JE, 1982. Growers problems with hydroponics. Journal of Plant Nutrition 5, 1077-81.

Larsson M, 1994. Prevalence and pathogenicity of spinach root pathogens of the genus Pythium in

Sweden. Plant Pathology 43, 261-8.

Lee E-K, Lee Y-H, Yoo J-D, Long PG, 1975. Studies on Pythium spp. in Korea-(I) Preliminary taxonomic and physiological studies. Korean Journal of Mycology 3, 7-12.

Lee Y, Hoy J, 1992. Interactions among Pythium species affecting root rot of sugarcane. Plant Disease

76, 735-9.

Lévesque CA, 2011. Fifty years of oomycetes—from consolidation to evolutionary and genomic exploration. Fungal Diversity 50, 35.

Levesque CA, De Cock AW, 2004. Molecular phylogeny and taxonomy of the genus Pythium.

Mycological research 108, 1363-83.

Lin Y, Huang S, 1993. Occurrence of Pythium root rot of hydroponic vegetables. Plant Protection

Bulletin (Taipei) 35, 51-61.

Liptay A, Tu J, 2003. Hydroponic chrysanthemum production: cultural and pathological issues.

Communications in agricultural and applied biological sciences 68, 613-8.

Liu W, Sutton J, Grodzinski B, Kloepper J, Reddy M, 2007. Biological control of Pythium root rot of chrysanthemum in small-scale hydroponic units. Phytoparasitica 35, 159.

Lock CGW, 1886. Tobacco: Growing, Curing, & Manufacturing: A Handbook for Planters in All Parts of the World. E. & FN Spon.

Lodhi AM, Shahzad S, Ghaffar A, 2004. Re-description of Pythium adhaerens Sparrow. Pakistan Journal of Botany 36, 453-6.

262

Xuemei Zhang References 263

Lookabaugh E, Ivors K, Shew B, 2015. Mefenoxam sensitivity, aggressiveness, and identification of

Pythium species causing root rot on floriculture crops in North Carolina. Plant Disease 99, 1550-8.

Lookabaugh E, Shew B, Cowger C, 2017. Three Pythium species isolated from severely stunted wheat during an outbreak in North Carolina. Plant health progress 18, 169-73.

Lumsden R, Ayers W, Adams P, et al., 1976. Ecology and epidemiology of Pythium species in field soil.

Phytopathology 66, 1203-9.

Ma Y, He X, Zhang P, et al., 2017. Xylem and phloem based transport of CeO2 nanoparticles in hydroponic cucumber plants. Environmental Science & Technology 51, 5215-21.

Maciejowska Z, 1962. Studies on soil microflora and biological control of damping-off of apple.

Maciosek MV, Lafrance AB, St. Claire AW, Keller PA, Xu Z, Schillo BA, 2020. The 20-year impact of tobacco price and tobacco control expenditure increases in Minnesota, 1998-2017. PloS one 15, e0230364.

Mahdizadeh V, Safaie N, Khelghatibana F, 2015. Evaluation of antifungal activity of silver nanoparticles against some phytopathogenic fungi and Trichoderma harzianum. Journal of Crop Protection 4, 291-300.

Mahendra Rai, Kamel Ahmed Abd-Elsalam, Ingle AP, 2020. Pythium: Diagnosis, Diseases and

Management. CRC Press.

Mathews C, Ogola JB, Botha W, Magongwa M, Gaur P, 2016. First report of root rot caused by Pythium spp. on chickpea in South Africa. Acta Agriculturae Scandinavica, Section B—Soil & Plant Science 66,

379-80.

Matthews VD, 1931. Studies on the genus Pythium. Chapel Hill : The University of North Carolina press,

1931

Mcbride MB, Martínez CE, 2000. Copper phytotoxicity in a contaminated soil: remediation tests with adsorptive materials. Environmental Science & Technology 34, 4386-91.

Mccarter S, Littrell R, 1968. Pathogenicity of Pythium myriotylum to several grass and vegetable crops.

Plant Disease Reporter 52, 179-83.

Mccarter S, Littrell R, 1970. Comparative pathogenicity of Pythium aphanidermatum and Pythium

263

Xuemei Zhang References 264 myriotylum to twelve plant species and intraspecific variation in virulence. Phytopathology 60, 264-8.

Mccarthy CG, Fitzpatrick DA, 2017. Phylogenomic reconstruction of the oomycete phylogeny derived from 37 genomes. Msphere 2.

Mckellar ME, Nelson EB, 2003. Compost-induced suppression of Pythium damping-off is mediated by fatty-acid-metabolizing seed-colonizing microbial communities. Applied and Environmental

Microbiology 69, 452-60.

Mclachlan KS, 2016. Evaluation of Pythium root rot and damping off resistance in the ancestral lines of

North American soybean cultivars and chemical control of the active ingredient ethaboxam in seed treatments.

Mclean K, Lawrence G, 2001. First report of Pythium root rot on grain sorghum in Mississippi. Plant

Disease 85, 922-.

Mcleod A, Botha WJ, Meitz JC, Spies CF, Tewoldemedhin YT, Mostert L, 2009. Morphological and phylogenetic analyses of Pythium species in South Africa. Mycological research 113, 933-51.

Meents AK, Furch AC, Almeida-Trapp M, et al., 2019. Beneficial and pathogenic Arabidopsis root- interacting fungi differently affect auxin levels and responsive genes during early infection. Frontiers in

Microbiology 10, 380.

Michaud AM, Bravin M, Galleguillos M, Hinsinger P, 2007. Copper uptake and phytotoxicity as assessed in situ for durum wheat (Triticum turgidum durum L.) cultivated in Cu-contaminated, former vineyard soils. Plant and soil 298, 99-111.

Michaud AM, Chappellaz C, Hinsinger P, 2008. Copper phytotoxicity affects root elongation and iron nutrition in durum wheat (Triticum turgidum durum L.). Plant and soil 310, 151-65.

Middleton JT, 1943. The taxonomy, host range and geographic distribution of the genus Pythium.

Memoirs of the Torrey Botanical Club 20, 1-171.

Mills KE, Bever JD, 1998. Maintenance of diversity within plant communities: soil pathogens as agents of negative feedback. Ecology 79, 1595-601.

Miyake N, Nagai H, Kageyama K, 2014. Wilt and root rot of poinsettia caused by three high-temperature-

264

Xuemei Zhang References 265 tolerant Pythium species in ebb-and-flow irrigation systems. Journal of general plant pathology 80, 479-

89.

Molina A, Hervás‐Stubbs S, Daniell H, Mingo‐Castel AM, Veramendi J, 2004. High‐yield expression of a viral peptide animal vaccine in transgenic tobacco chloroplasts. Plant biotechnology journal 2, 141-53.

Moorman G, Kim S, 2004. Species of Pythium from greenhouses in Pennsylvania exhibit resistance to propamocarb and mefenoxam. Plant Disease 88, 630-2.

Moorman GW, May S. Pythium Identification: DNA SequencingOn-line [URL] Year/Electronic

Resource Number|.

Mostowfizadeh-Ghalamfarsa R, Salmaninezhad F, 2020. Taxonomic Challenges in the Genus Pythium.

Pythium: Diagnosis, Diseases and Management, 1944.

Mufunda F, Muzhinji N, Sigobodhla T, Marunda M, Chinheya CC, Dimbi S, 2017. Characterization of

Pythium spp. associated with root rot of tobacco seedlings produced using the float tray system in

Zimbabwe. Journal of Phytopathology 165, 737-45.

Mufunda F, N. M, Sigobodhla T, Kashangura C. Pythium myriotylum, the dominant Pythium species associated with root rot of tobacco seedlings produced using the float tray system in Zimbabwe.

Proceedings of the CORESTA Congress, 2016. Berlin: Agronomy/Phytopathology Groups, AP 08.

Mulder D, 1969. The pathogenicity of several Pythium species to rootlets of apple seedlings. Netherlands journal of plant pathology 75, 178-81.

Mycobank, 2020. Pythium In. [MB#20465]. http://www.mycobank.org/Biolomics.aspx?Table=Mycobank&Rec=39637&Fields=All.

Nelson EB, Craft CM, 1991. Identification and comparative pathogenicity of Pythium spp. from roots and crowns of turfgrasses exhibiting symptoms of root rot. Phytopathology 81, 1529-36.

Newman L, Duffus AL, Lee C, 2016. Using the free program MEGA to build phylogenetic trees from molecular data. The American Biology Teacher 78, 608-12.

Newman SE, 2014. Ultraviolet light and photocatalytic processes for irrigation water treatment. Biology,

Detection and Management of Plant Pathogens in Irrigation Water. American Phytopathological Society,

265

Xuemei Zhang References 266

St Paul, MN, USA, 197-208.

Niedziela CE, Mullins CD, Reed TD, Swallow WH, Eberly E, 2005. Comparison of four production systems for dutch iris in a tobacco transplant greenhouse. HortTechnology 15, 173-6.

Noel ZA, Sang H, Roth MG, Chilvers MI, 2019. Convergent Evolution of C239S Mutation in Pythium spp. β-Tubulin Coincides with Inherent Insensitivity to Ethaboxam and Implications for Other

Peronosporalean Oomycetes. Phytopathology 109, 2087-95.

Nzungize JR, Lyumugabe F, Busogoro J-P, Baudoin J-P, 2012. Pythium root rot of common bean: biology and control methods. A review. BASE.

Ongena M, Daayf F, Jacques P, et al., 1999. Protection of cucumber against Pythium root rot by fluorescent pseudomonads: predominant role of induced resistance over siderophores and antibiosis. Plant

Pathology 48, 66-76.

Owen-Going N, Sutton J, Grodzinski B, 2003. Relationships of Pythium isolates and sweet pepper plants in single-plant hydroponic units. Canadian Journal of Plant Pathology 25, 155-67.

Palmucci H, Wolcan S, 2011. Status of the Pythiaceae (Kingdom Stramenopila) in Argentina. I. The

Genus Pythium. Revista de la Sociedad Argentina de Botánica 46.

Pantelides IS, Tsolakidou M-D, Chrysargyris A, Tzortzakis N, 2017. First report of root rot of hydroponically grown peppermint (Mentha× piperita) caused by a Pythium myriotylum in Cyprus. Plant

Disease 101, 1682-.

Papenfus H, Billenkamp N, 2019. A scale for coding growth stages in tobacco crops. In. Growth Stages and Identification Keys for Tobacco Task Force. CORESTA, Cooperation Centre for Scientific Research

Relative to Tobacco, 1-17.

Patekoski KDS, Zottarelli CLaP, 2009. Pathogenicity in vitro of Pythium aphanidermatum and Pythium dissotocum in varieties of lettuce (Lactuca sativa L.). Hoehnea 36, 161-72.

Paul B, 2001. A new species of Pythium with filamentous sporangia having pectinolytic activities, isolated in the Burgundy region of France. FEMS microbiology letters 199, 55-9.

Paulitz T, 1997. Biological control of root pathogens in soilless and hydroponic systems. HortScience 32,

266

Xuemei Zhang References 267

193-6.

Pearce B, Andy Bailey, Lowell Bush, J.D. Green EA, 2019. 2019-2020 Burley and Dark Tobacco

Production Guide. University of Kentucky, University of Tennessee, Virginia Tech and NC State

University.

Pego CM, Hill RF, Solomon GW, Chisholm RM, Ivey SE, 1995. Tobacco, culture, and health among

American Indians: A historical review. American Indian Culture and Research Journal 19, 143-64.

Peitsch NVISC, 2020. The Tobacco Plant Genome. Springer, Cham.

Pemberton I, Smith G, Philley G, Rouquette Jr F, Yuen G, 1998. First Report of Pythium ultimum, P. irregulare, Rhizoctonia solani AG4, and Fusarium proliferatum from Arrowleaf Clover (Trifolium vesiculosum): a disease complex. Plant Disease 82, 128-.

Perneel M, Tambong JT, Adiobo A, et al., 2006. Intraspecific variability of Pythium myriotylum isolated from cocoyam and other host crops. Mycological research 110, 583-93.

Pfeufer E, Hinton C 2017. Pythium Damping-off & Root Rot in Tobacco Float Systems. Plant Pathology

Fact Sheet On-line [URL] Year/Electronic Resource Number|.

Punja ZK, Rodriguez G, 2018. Fusarium and Pythium species infecting roots of hydroponically grown marijuana (Cannabis sativa L.) plants. Canadian Journal of Plant Pathology 40, 498-513.

Radmer L, Anderson G, Malvick D, Kurle J, Rendahl A, Mallik A, 2017. Pythium, Phytophthora, and

Phytopythium spp. associated with soybean in Minnesota, their relative aggressiveness on soybean and corn, and their sensitivity to seed treatment fungicides. Plant Disease 101, 62-72.

Radzuhn B, Lyr H, 1984. On the mode of action of the fungicide etridiazole. Pesticide Biochemistry and

Physiology 22, 14-23.

Rafin C, Tirilly Y, 1995. Characteristics and pathogenicity of Pythium spp. associated with root rot of tomatoes in soilless culture in Brittany, France. Plant Pathology 44, 779-85.

Raftoyannis Y, Dick MW, 2006. Zoospore encystment and pathogenicity of Phytophthora and Pythium species on plant roots. Microbiological research 161, 1-8.

Rai M, Abd-Elsalam KA, Ingle AP, Paralikar P, Ingle P, 2020. The Genus Pythium: An Overview. In.

267

Xuemei Zhang References 268

Pythium. CRC Press, 3-14.

Rai M, Ingle AP, Paralikar P, Anasane N, Gade R, Ingle P, 2018. Effective management of soft rot of ginger caused by Pythium spp. and Fusarium spp.: emerging role of nanotechnology. Applied microbiology and biotechnology 102, 6827-39.

Raudales RE, Parke JL, Guy CL, Fisher PR, 2014. Control of waterborne microbes in irrigation: A review. Agricultural Water Management 143, 9-28.

Raviv M, Lieth JH, Raviv M, 2008. Significance of soilless culture in agriculture. Soilless culture theory and practice, 1-11.

Reed TD, 2009. Float greenhouse tobacco transplant guide. In Virginia Cooperative Extension (436-051).

Reed TD, Johnson CS, Wilkinson CA, Barts S, 2019. 2019 Flue-cured tobacco production guide.

Rey P, Benhamou N, Tirilly Y, 1998. Ultrastructural and cytochemical investigation of asymptomatic infection by Pythium spp. Phytopathology 88, 234-44.

Rey P, Leucart S, Desilets H, Bélanger R, Larue J, Tirilly Y, 2001. Production of indole-3-acetic acid and tryptophol by Pythium ultimum and Pythium group F: possible role in pathogenesis. European Journal of

Plant Pathology 107, 895-904.

Riganakos KA, Karabagias IK, Gertzou I, Stahl M, 2017. Comparison of UV-C and thermal treatments for the preservation of carrot juice. Innovative Food Science & Emerging Technologies 42, 165-72.

Ristroph KD, Astete CE, Bodoki E, Sabliov CM, 2017. Zein nanoparticles uptake by hydroponically grown soybean plants. Environmental Science & Technology 51, 14065-71.

Robertson AE, Matthiesen R, Ahmad A, 2013. Nine species of Pythium associated with corn seeding blight in southeastern Iowa.

Robertson G, 1980. The genus Pythium in New Zealand. New Zealand journal of botany 18, 73-102.

Robideau GP, De Cock AW, Coffey MD, et al., 2011. DNA barcoding of oomycetes with cytochrome c oxidase subunit I and internal transcribed spacer. Molecular ecology resources 11, 1002-11.

Rodriguez G, Punja Z, 2007. Root infection of wasabi (Wasabia japonica) by Pythium species. Canadian

Journal of Plant Pathology 29, 79-83.

268

Xuemei Zhang References 269

Romero G, De Jensen CE, Palmateer A, 2012. First report of Pythium dissotocum affecting cilantro in hydroponic systems in Puerto Rico. Plant health progress 13, 32.

Rossi L, Sharifan H, Zhang W, Schwab AP, Ma X, 2018. Mutual effects and in planta accumulation of co-existing cerium oxide nanoparticles and cadmium in hydroponically grown soybean (Glycine max (L.)

Merr.). Environmental Science: Nano 5, 150-7.

Roudsary M, Okhovat S, Mirabolfathi M, Kafi M, 2010. First record of Pythium catenulatum and

Pythium okanoganense on turfgrasses in Iran. Plant Protection Journal 2, 325-8.

Ruhuai C, Furong W, Xiaoling W, et al., 1996. Study on the genetic resistance of maize to Pythium inflatum Matthews. Yi Chuan= Hereditas 18, 4-6.

Rujirawat T, Patumcharoenpol P, Kittichotirat W, Krajaejun T, 2019. Oomycete Gene Table: an online database for comparative genomic analyses of the oomycete microorganisms. Database 2019.

Runia W, Boonstra S, 2001. Disinfection of Pythium-infested recirculation water by UV-oxidation technology. Mededelingen (Rijksuniversiteit te Gent. Fakulteit van de Landbouwkundige en Toegepaste

Biologische Wetenschappen) 66, 73-82.

Sánchez J, Gallego E, 2001. Pythium spp. present in irrigation water in the Poniente region of Almeria

(south-eastern Spain). Mycopathologia 150, 29-38.

Schroeder KL, Martin FN, De Cock AW, et al., 2013. Molecular detection and quantification of Pythium species: evolving taxonomy, new tools, and challenges. Plant Disease 97, 4-20.

Scott K, Eyre M, Mcduffee D, Dorrance AE, 2020. The Efficacy of ethaboxam as a soybean seed treatment toward Phytophthora, Phytopythium, and Pythium in Ohio. Plant Disease 104, 1421-32.

Scott KL, 2018. Studies in the Management of Pythium Seed and Root Rot of Soybean: Efficacy of

Fungicide Seed Treatments, Screening Germplasm for Resistance, and Comparison of Quantitative

Disease Resistance Loci to Three Species of Pythium and Phytophthora sojae: The Ohio State University.

Seebold KW, Pearce RC, Bailey WA, et al., 2013. 2013-2014 Kentucky & Tennessee Tobacco production guide.

Senda M, Kageyama K, Suga H, Lévesque CA, 2009. Two new species of Pythium, P. senticosum and P.

269

Xuemei Zhang References 270 takayamanum, isolated from cool-temperate forest soil in Japan. Mycologia 101, 439-48.

Shang H, Chen J, Handelsman J, Goodman RM, 1999. Behavior of Pythium torulosum zoospores during their interaction with tobacco roots and Bacillus cereus. Current Microbiology 38, 199-204.

Shew HD, Lucas GB, 1991. Compendium of tobacco diseases. American Phytopathological Society.

Sierro N, Battey JN, Ouadi S, et al., 2014. The tobacco genome sequence and its comparison with those of tomato and potato. Nature communications 5, 1-9.

Sigobodhla T, Dimbi S, Masuka A, 2010. First report of Pythium myriotylum causing root and stem rot on tobacco in Zimbabwe. Plant Disease 94, 1067-.

Sigobodhla TE, Dimbi S. Survival of floatbed Pythium-infected tobacco seedlings in the field and their yield potential, 2014: CORESTA Congress, Quebec, 2014, Agronomy/Phytopathology Groups, AP 12.

Sigobodhla TE, Dimbi S, Masuka AJ, 2006. Algae and Pythium root rot control in float bed production system in Zimbabwe. In.: CORESTA Congress, Paris, 2006, AP 08.

Simko I, Piepho H-P, 2012. The area under the disease progress stairs: calculation, advantage, and application. Phytopathology 102, 381-9.

Smith W, Peedin G, Yelverton F, Campbell C, 1993. Producing tobacco transplants in greenhouses.

Greenhouse systems. Bull. North Carolina State University, College of Agriculture & Life Sciences.

Song Y-C, Pei E-Q, Dan Y-S, Wang T-Y, 2012. Identification and evaluation of resistance to stalk rot

(Pythium inflatum Matthews) in important inbred lines of maize. Journal of Plant Genetic Resources 13,

798-802.

Sopher C, 2012. High temperature predisposition of sweet pepper to Pythium root rot and its remediation by Pseudomonas chlororaphis.

Sparks, A.H., P.D. Esker, M. Bates, W. Dall' Acqua, Z. Guo, V. Segovia, S.D. Silwal, S. Tolos, and K.A.

Garrett, 2008. Ecology and Epidemiology in R: Disease Progress over Time. The Plant Health Instructor.

DOI:10.1094/PHI-A-2008-0129-02.Sparrow FK, 1931. Two new species of Pythium parasitic in green algae. Annals of botany 45, 257-77.

Sparrow FK, 1943. Aquatic Phycomycetes exclusive of the Saprolegniaeeae and Pythium. Aquatic

270

Xuemei Zhang References 271

Phycomycetes exclusive of the Saprolegniaeeae and Pythium.

Stanghellini M, Kim D, Rakocy J, Gloger K, Klinton H, 1998. First report of root rot of hydroponically grown lettuce caused by Pythium myriotylum in a commercial production facility. Plant Disease 82, 831-.

Stanghellini M, Kronland W, 1986. Yield loss in hydroponically grown lettuce attributed to subclinical infection of feeder rootlets by Pythium dissotocum. Plant Disease 70, 1053-6.

Stanghellini M, Russell J, 1971. Damping-off of tomato seedlings in commercial hydroponic culture.

Progr Agr Ariz.

Stanghellini M, Stowell L, Bates M, 1984. Control of root rot of spinach caused by Pythium aphanidermatum in a recirculating hydroponic system by ultraviolet irradiation. Plant Disease 68, 1075-

Steinberg RA, 1950. Growth on synthetic nutrient solutions of some fungi pathogenic to tobacco.

American Journal of Botany, 711-4.

Stouvenakers G, Dapprich P, Massart S, Jijakli MH, 2019. Plant pathogens and control strategies in aquaponics. Aquaponics Food Production Systems, 353.

Sutton J, Yu H, Grodzinski B, Johnstone M, 2000. Relationships of ultraviolet radiation dose and inactivation of pathogen propagules in water and hydroponic nutrient solutions. Canadian Journal of

Plant Pathology 22, 300-9.

Sutton JC, Sopher CR, Owen-Going TN, et al., 2006. Etiology and epidemiology of Pythium root rot in hydroponic crops: current knowledge and perspectives. Summa phytopathologica 32, 307-21.

Syed RN, Lodhi A, Shahzad S, 2020. Management of Pythium Diseases. In: Rai M, Abd-Elsalam KA,

Ingle AP, eds. Pythium: Diagnosis, Diseases and Management. CRC Press.

Taylor R, Salas B, Secor G, Rivera V, Gudmestad N, 2002. Sensitivity of North American isolates of

Phytophthora erythroseptica and Pythium ultimum to mefenoxam (metalaxyl). Plant Disease 86, 797-

802.

Thiessen LD, Ellington GH, Macialek JA, Johnson CS, Reed DT, 2020. Sanitation of float trays for the management of Pythium Species in tobacco float systems. Plant health progress 21, 21-5.

271

Xuemei Zhang References 272

Thines M, 2014. Phylogeny and evolution of plant pathogenic oomycetes—a global overview. European

Journal of Plant Pathology 138, 431-47.

Tojo M, Van West P, Hoshino T, et al., 2012. Pythium polare, a new heterothallic oomycete causing brown discolouration of Sanionia uncinata in the Arctic and Antarctic. Fungal biology 116, 756-68.

Toppe B, Thinggaard K, 1998. Prevention of Phytophthora root rot in Gerbera by increasing copper ion concentration in the nutrient solution. European Journal of Plant Pathology 104, 359-66.

Toppe B, Thinggaard K, 2000. Influence of copper ion concentration and electrical conductivity of the nutrient solution on Phytophthora cinnamomi in ivy grown in ebb‐and‐flow systems. Journal of

Phytopathology 148, 579-85.

Tremblay R, Wang D, Jevnikar AM, Ma S, 2010. Tobacco, a highly efficient green bioreactor for production of therapeutic proteins. Biotechnology Advances 28, 214-21.

Tsao PH, Guy SO, 1977. Inhibition of Mortierella and Pythium in a Phytophthora-isolation medium containing hymexazol. Phytopathology 67, 796-801.

Uchida M, Roberson RW, Chun SJ, Kim DS, 2005. In vivo effects of the fungicide ethaboxam on microtubule integrity in Phytophthora infestans. Pest Management Science: formerly Pesticide Science

61, 787-92.

Usda-Ers USDOaERS, 2018. U.S. and state-level farm income and wealth statistics. In. https://www.ers.usda.gov/data-products/farm-income-and-wealth-statistics/data-files-us-and-state-level- farm-income-and-wealth-statistics/.

Utkhede R, Levesque C, Dinh D, 2000. Pythium aphanidermatum root rot in hydroponically grown lettuce and the effect of chemical and biological agents on its control. Canadian Journal of Plant

Pathology 22, 138-44.

Vaartaja O, 1968. Pythium and Mortierella in soils of Ontario forest nurseries. Canadian Journal of

Microbiology 14, 265-9.

Van Der Plaats-Niterink AJ, 1981. Monograph of the genus Pythium. Centraalbureau voor

Schimmelcultures Baarn.

272

Xuemei Zhang References 273

Van Os E. Disease management in soilless culture systems. Proceedings of the VII International

Symposium on Chemical and Non-Chemical Soil and Substrate Disinfestation 883, 2009, 385-93.

Vargas A, 2018. Management of seedling diseases caused by Oomycetes, Phytophthora spp.,

Phytopythium spp. and Pythium spp. using seed treatment in Ohio: The Ohio State University.

Villa NO, Kageyama K, Asano T, Suga H, 2006. Phylogenetic relationships of Pythium and Phytophthora species based on ITS rDNA, cytochrome oxidase II and β-tubulin gene sequences. Mycologia 98, 410-22.

Wang X, Sun W, Zhang S, Sharifan H, Ma X, 2018. Elucidating the effects of cerium oxide nanoparticles and zinc oxide nanoparticles on arsenic uptake and speciation in rice (Oryza sativa) in a hydroponic system. Environmental Science & Technology 52, 10040-7.

Weiland JE, 2011. Influence of isolation method on recovery of Pythium species from forest nursery soils in Oregon and Washington. Plant Disease 95, 547-53.

Weiland JE, Santamaria L, Grünwald NJ, 2014. Sensitivity of Pythium irregulare, P. sylvaticum, and P. ultimum from forest nurseries to mefenoxam and fosetyl-Al, and control of Pythium damping-off. Plant

Disease 98, 937-42.

White DJ, Chen W, Schroeder KL, 2019. Assessing the contribution of ethaboxam in seed treatment cocktails for the management of metalaxyl-resistant Pythium ultimum var. ultimum in Pacific Northwest spring wheat production. Crop Protection 115, 7-12.

Who-Ritc WHORFITC, 2008. WHO report on the global tobacco epidemic, 2008: the MPOWER package. World Health Organization.

Wohanka W, 2014. Copper and silver ionization for irrigation water treatment. Biology, Detection, and

Management of Plant Pathogens in Irrigation Water. CX Hong, GW Moorman, W. Wohanka, and C.

Büttner, eds. American Phytopathological Society, St. Paul, MN 19, 52-62.

Wood LE, 1998. The economic impact of tobacco production in Appalachia. Appalachian Regional

Commission Washington, DC.

Wu W, Ogawa F, Ochiai M, Yamada K, Fukui H, 2020. Common Strategies to Control Pythium Disease.

Reviews in Agricultural Science 8, 58-69.

273

Xuemei Zhang References 274

Zabrieski Z, Morrell E, Hortin J, et al., 2015. Pesticidal activity of metal oxide nanoparticles on plant pathogenic isolates of Pythium. Ecotoxicology 24, 1305-14.

Zhang W, Tu J, 2000. Effect of ultraviolet disinfection of hydroponic solutions on Pythium root rot and non-target bacteria. European Journal of Plant Pathology 106, 415-21.

Zheng Y, Wang L, Dixon MA, 2004. Response to copper toxicity for three ornamental crops in solution culture. HortScience 39, 1116-20.

Zhu YF, Pan H, Zhang H, Jiang H, Yuan S, Yan Q, 2006. Induction and characteristics of mutants of

Phytophthora drechsleri resistant to etridiazole. Chines Journal of Pesticide Science 8, 323-6.

Zitnick-Anderson K, Markell, Samuel., Nelson, Berlin, 2014. Pythium damping-off of soybean. Plant

Disease Management NDSU Extension. NDSU Extension, pp1737.

274

Xuemei Zhang Appendix A 275

Appendix A

Chapter 3 Supplementary Materials

Table S3.1. The sampling structure within the greenhouses with single visits in the 2017 tobacco transplant greenhouse survey. Sample sites within the greenhouses Survey Tobacco seedlings Growth Bay The number Bay root rot Reused medium identities of root * surface Weeds center water asymptomatic stunting & trays in tray greenhouses rot ** *** walkway stunting cells X 16 X 21 X 14 X X 26 X X X X X X 3 X 7, 19. 23, 24, 27, 28, 33 X X 6 X X 5 X X X 4 X X 22, 25 X X 15 X X X 13 X X 10, 12, 20 X X X 29, 34 X X X 1, 2 X X X 17, 36 X X X X 8 X X X X 32, 35 X X X X 11, 18 X X X X 31 X X X X X X 30 X X X X X 9 “X” indicates samples were taken from that sampling site and the corresponding category. * there were dry root tissues embedded in the used trays ** Organic residue (dirt and tobacco leaf debris mix) samples were collected from bay surface *** Growth medium samples were collected from tray cells with un-germinated seeds

275

Xuemei Zhang Appendix A 276

Table S3.2. The sampling structure within the greenhouses with multiple visits in the 2017 tobacco transplant greenhouse survey. Sample sites within the greenhouses Survey Tobacco seedlings Growth Bay The number Bay root rot Reused medium identities for root * surface Weeds center water asymptomatic stunting & trays in tray greenhouses rot ** *** walkway stunting cells X 37- 1st visit X X X 37- 2nd visit

X X 38- 1st visit X X 38- 2nd visit

X X X X 39- 1st visit X X 39- 2nd visit X X X X 39- 3rd visit X X X 39- 4th visit

X X 40- 1st visit X X 40- 2nd visit

X X 41- 1st visit X X X X 41- 2nd visit X X X X X 41- 3rd visit “X” indicates samples were taken from that environment and the corresponding category. * there were dry root tissues embedded in the used trays ** Organic residue (dirt and tobacco leaf debris mix) samples were collected from bay surface *** Growth medium samples were collected from tray cells with un-germinated seeds

276

Xuemei Zhang Appendix B 277

Appendix B

Chapter 4 Supplementary Materials

Table S 4.1. Presence of Pathogenic Pythium spp. at different locations within tobacco greenhouses in 2017 survey. Number of Pythium-positive Greenhouses Pythium species Bay water Tobacco seedlings Weeds Walkway P. inflatum 1 P. porphyrae 2 2 P. torulosum 1 P. aristosporum 1 P. catenulatum 2 1 P. irregulare 1 2 1 P. coloratum 7 3 P. dissotocum 23 13 3 P. myriotylum 10 11 1

277

Xuemei Zhang Appendix C 278

Appendix C

Chapter 6 Supplementary Materials

Overall Treatment Effects on Pythium Diseases in Small-bay Trials

The overall treatment effects were evaluated by analyzing Pythium disease symptom- related data including the root rot incidence and severity on water roots of tobacco seedlings, stunting incidence, leaf chlorosis incidence and mortality incidence. Additionally, root length and plant height were measured in mini-bay chemical trials, and germination percentage was recorded in small-bay non-chemical trials. Results from the 2018 mini-bay trial will not be discussed in the following sections, since we suspect that there were errors in this trial and those results might lead to confusion.

Overall Treatment Effects on Root Rot Incidence and Severity on Water Roots

Terramaster, Ridomil Gold and Elumin significantly reduced the root rot incidence and severity on tobacco water roots in this study. The treatment effects of those oomyceticides changed over time in 2017 but not in the 2019 trial. Based on the disease progress data of the untreated control in the 2017 trial, disease progressed gradually in 2017, but rapidly in 2019. The

2017 trial was initiated in October while the 2019 trial was initiated in April. The differences between the 2017 and 2019 trials might be explained by differences in environmental conditions

(such as air temperature and daytime length) during the growing season.

Cutrine-plus was not significantly different from the untreated control in terms of the effect on root rot. Water treatments in the mini-bay trials were divided into two groups: the untreated control and Cutrine-plus associating with high disease incidence and severity, while

278

Xuemei Zhang Appendix C 279 the oomyceticide treatments (Elumin, Ridomil Gold and Terramaster) were associated with low disease incidence and severity. Those results also suggested Elumin and Ridomil Gold were similar to Terramaster, and Cutrine-plus was similar to the untreated control in terms of the effect on root rot of tobacco seedlings in this study.

The data collection schedules were different for 2017 and 2018 small-bay trials due to delayed seed germination in 2018. In 2017, tobacco seedlings started to emerge at 3 WAI, and the data were collected at 3 , 4, 5, 7, 8 and 9 WAI. In 2018, tobacco seedlings started to emerge at 4 WAI, and the data were collected at 4, 6, 8, 9, 10 and 11 WAI. The cause of the germination delay was a slower wicking by the growth medium in 2018 resulting from the use of old growth medium. In summary, the overall treatment effects of UV and copper ion treatments on root rot were not significant, but the overall treatment effect of Terramster was significant. Copper ionization treatments seemed to work at the early stage of disease progress, but effects became insignificant as the disease progressed. Results suggested that UV and Copper ionization treatments were not as effective as Terramaster in reducing root rot caused by P. myriotylum.

Overall Treatment Effects on Stunting and Leaf Chlorosis

Terramaster, Ridomil Gold and Elumin significantly reduced the incidence of stunting and leaf chlorosis on tobacco water roots in this study, except that Terramaster did not significantly reduce stunting incidence in 2017. The effects of those treatments changed over time during the trials; and the effects on stunting tended to be more significant later in the season. This is reasonable because the needs for water and nutrient intake increase as seedlings grow. Seedling roots might be damaged at early stages but still provide sufficient water and nutrients for seedling growth. However, at later stages, the disease has progressed, and roots do

279

Xuemei Zhang Appendix C 280 not function properly, and thus the diseased seedlings cannot take up enough water and nutrients from remaining roots, and it is more likely to see stunting of the infected tobacco seedlings.

Cutrine-plus was not significantly different from the untreated control in terms of the effect on stunting and leaf chlorosis. The oomyceticide treatments and Cutrine-plus were separated at two ends of the disease progress analysis results, with Cutrine-plus close to the untreated control, while Elumin and Ridomil Gold were similar to Terramaster in effectively reducing stunting and leaf chlorosis.

In small-bay trials, stunting and leaf chlorosis symptoms were not severe, probably due to relatively low inoculum level and disease pressure. In 2017, the incidence of stunting and leaf chlorosis of untreated tobacco seedlings was less than 0.1% and the treatment effects of

Terramaster, copper ions and UV were not significant. In fact, the incidence of stunting and leaf chlorosis of untreated tobacco seedlings was higher in 2018, and Terramaster, copper ions and

UV significantly reduced the incidence of stunting and leaf chlorosis on tobacco seedlings.

However, the effects were not significant in disease management aspects, due to low percentage incidence. Water treatments were not separated clearly by these two measurements on the disease progress analysis graphs. Therefore, the treatment effects of copper ion and UV on stunting and leaf chlorosis incidence are inconclusive in this study.

Overall Effects of Oomyceticides on Root Length, Plant Height and Seedling Death

Compared with the untreated control, Terramaster, Ridomil Gold and Elumin significantly increased root length and weight of tobacco seedlings in this study, except that the overall effect of Terramaster was not significant in 2017. Cutrine-plus was not significantly different from the untreated control. The clear separation of oomyceticide treatments and

280

Xuemei Zhang Appendix C 281

Cutrine-plus on the disease progress analysis graphs also suggested that the oomyceticide increased root length and weight of tobacco seedlings while Cutrine-plus was not.

Significant overall treatment effects on seedling death were only detected in the 2019 trial, where the oomyceticide treatments reduced the mortality rate from 0.18% to 0. Such a small reduction may not be significant in tobacco transplant production. However, Cutrine-plus-treated and untreated tobacco seedlings were extremely small and weak. Although they were not completely dead, they were not usable in transplanting.

Overall Effects of Copper Ionization and UV Radiation on Seed Germination and Seedling

Death

The overall treatment effects of Copper ionization and UV radiation on seed germination and seedling death were not significant. Nongermination and mortality incidence was very low

(less than 2.5% and 1%, respectively), suggesting that disease pressure was low in these trials, most likely due to the low inoculum level. Therefore, the overall treatment effects of Copper ionization and UV radiation on seed germination and seedling death of tobacco seedlings were inconclusive.

281