DOCSLIB.ORG

ZR-2020-214 Supplementary Material.Pdf

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
ZR-2020-214 Supplementary Material.Pdf Supplementary material Supplementary Figure S1 Maximum-likelihood tree of 57 taxa of Leptonetidae Each genus is indicated by black bar. BS<70 not shown, taxa followed by asterisk indicate type species of corresponding genus. BS: Bootstrap support. Supplementary Table S1 List of voucher information and GenBank accession Nos. Voucher Taxa Locality Coordinates 18S 28S 16S COI H3 Leptonetela Sanxing Cave, Guizhou, 27.05 W32 MT968689 MT968579 MT988002 MT995824 pentakis China N/106.30E Yunshui Cave, Beijing, 39.67 W57 jineta.folliformis MT968702 MT968580 MT968630 MT988003 MT995825 China N/115..81E 39.71 W58 Jingneta setulifera Beipo Cave, Beijing, China MT968691 MT968581 MT968631 MT988004 MT995826 N/115..63E 39.71 W59 Jingneta wangae Zhizhu Cave, Beijing, China MT968692 MT968582 MT968632 MT988005 MT995827 N/115..74E Shenxian Cave, Beijing, 39.86 W60 Jingneta cornea MT968693 MT968583 MT988006 MT995828 China N/115..68E 39.48 W61 Jingneta exilocula Bianfu Cave, Beijing, China MT988007 N/115..54E Falcileptoneta 29.10N/119. W85 Shuanglong, Zhejing, China MT968694 MT988008 MT995829 anocellata 60E Falcileptoneta 28.9N/118.8 W86 Taizhen, Zhejing, China MT968695 MT968633 MT988009 MT995830 taizhensis E Leptonetela. 29.75N/118. W87 Shiyan Cave, Anhui, China MT968696 MT968634 MT988010 MT995831 hangzhouensis 39E Taizhen, Zhejing, China 28.9N/110.8 W89 Falcileptoneta sp2 MT968697 MT968584 MT988011 (with eyes) E Falcileptoneta 29.07N/119. W90 Lingqi Cave, Zhejing, China MT968698 MT968585 MT988012 MT995832 lingqiensis 2E Shuanglong Cave, Zhejiang, W91 Longileptoneta sp5 W91 sp MT968699 MT988013 MT995833 China Leptonetela 33.35N/111. W92 Tianxin Cave, Henan, China MT968700 MT988014 tianxinensis 88E W93 Jingneta sp2 Maxian Cave, Beijing, China MT968701 MT988015 MT995834 39.69 W94 Jingneta cornea Xipo Cave, Beijing, China MT968703 MT988016 N/115..67E Jingneta caoxianensis Caoxian Cave, Beijing, 34.44 W97 MT968704 MT968586 MT968635 MT988017 MT995835 sp. nov China N/114.03E Rhyssoleptoneta 32.44 W98 Zhangshijian, Hehei, China MT968705 MT968636 MT988018 MT995836 latitarsa N/114..03E Jingneta Jingdongdarong Cave, 40.21 W122 MT968637 MT968532 MT968587 MT987953 MT995791 jingdongensis sp. nov Beijing, China N/117.25E 38.24 W123 Leptonetela kanellisi Koitiki Cave, Attika, Greece MT968638 MT968533 MT968588 MT995792 N/26.01E Dao Tao Natural Park, 21.47N/105. W124 Leptonetela pungitia MT968639 MT987954 Vietnam 64E Cataleptoneta Damlatas cave, Antalya, 36.53N/31.9 W125 MT968640 MT987955 MT995793 aesculapii Turkey 8E Leptonetela Carpinus-fagus forest, 42.33N/42.0 W130 MT968641 MT987956 caucasica greorgia 3E Cave Kontrabasa, lovetch 43. 17N/ W132 Proleptoneta sp MT995794 District, Bulgaria 24.06E Longileptoneta Yeren Cave, Jiangxi, China 25.65N/115. W160 MT968642 MT968534 MT987957 MT995795 yerenensis sp. nov 20E Lianhua Cave, Jiangxi, 25.47N/114. W161 Leptonetela lianhua MT968643 MT968535 MT987958 China 08E Leptonetela 26.60N/114. W162 Shiyan Cave, Jiangxi, China MT968644 MT968536 MT987959 flabellaris 20E Longileptoneta Huangshan Cave, Jiangxi, 26.48N/115. W163 MT968645 MT968537 MT968589 MT987960 MT995796 huangshanensis sp. China 91E nov Taiping Cace, Jiangxi, China 25.48N/115. W164 Longileptoneta sp1 MT968646 MT968538 MT968590 MT987961 MT995797 91E Longileptoneta Zhuxian Cave, Jiangxi, 29.21'N/117. W165 MT968647 MT968539 MT968591 MT987962 MT995798 zhuxianensis sp. nov China 30E; Taiping Yan, Jiangxi, China 26.40N/115. W166 Longileptoneta sp2 MT968648 MT968540 MT968592 MT987963 MT995799 77E Longileptoneta Lianhua Cave, Jiangxi, 29.48N/117. W167 MT968649 MT968541 MT968593 MT987964 MT995800 gutanensis sp. nov China 61E Longileptoneta Hanxu Cave, Jiangxi, China 29.48N/117. W168 MT968650 MT968542 MT968594 MT987965 gutanensis sp. nov 61E Longileptoneta Huangyuan Cave, Jiangxi, 29.03'N/117. W169 MT968651 MT968543 MT968595 MT987966 zhuxianensis sp. nov China 37E; 35.33N/24.9 W172 Barusia sp1 Doxa spileon, Crete, Greece MT968597 MT995801 8E Anshi Cave, Jiangxi, China 26.52N/115. W171 Longileptoneta sp3 MT968652 MT968596 MT987967 10E Katafygi Cave, Peloponnese, 35.80N/22. w173 Barusia sp2 MT968544 MT968598 Greece 28E Kaiadas Cave, Peloponnese, 35.08N/22.3 W174 Barusia sp3 MT968653 MT968599 MT987968 MT995802 Greece 3E 32.69 km west of Chania, 35.40N/23.6 W176 Barusia sp4 MT968600 Crete, Greece 8E Spilaio Lera Cave, Crete, 35.58N/24.1 w177 Barusia sp5 MT968545 MT968601 Greece 0E Leptonetela 38.15N/23.6 W178 Pan Cave, Athens, Greece MT968654 MT968546 MT987969 paragamiani 7E Ahyrospilios Cave, Crete, 35.58N/24.1 W179 Barusia sp6 MT968655 MT968547 MT987970 Greece 3E Spilaio Panagias 35.59N/24.1 W180 Barusia sp7 MT968602 MT987971 Arkoudiotisas, Cave, Crete, 4E Greece 35.32N/24.2 W181 Barusia sp8 Kournas Cave, Crete, Greece MT968603 MT995803 8E Leptonetela Agiogala Cave, Chios Island, 38.56N/25.8 W182 MT968657 MT968549 MT987972 chiosensis Greece 6E 38.50N/23.9 W183 Leptonetela penevi Skoteini Cave, Thiva, Greece MT968658 MT968550 MT987973 8E Leptonetela 37.99N/23.8 W184 Leondari, Athens, Greece MT968659 MT987974 arvanitidisi 3E Maroneia Cave, Komotini, 40.93N/25.5 W185 Leptonetela thracia MT968660 MT968604 MT987975 Greece 0E W186 Leptonetidae gen Taiwan W186 MT968605 Longileptoneta Shenxian Cave, Anhui, 30.38N/118. W188 MT968661 shenxianensis sp. nov China 23E Grotte de Liqué, W189 Leptoneta convexa L. convexa MT968662 MT968551 middle-pyrénées, France: Xianduhe Cave, Chongqing, 28.51N/106. W198 Leptonetela tianxingensis MT968663 MT968552 China 69E Yin Cave, Henan, 40.76 W202 Jingneta sp1 MT968664 MT968553 MT987976 MT995804 China N/113.70E 32.88 W203 Rhyssoleptoneta sp Baxian Cave, Henan, China MT968665 MT968554 MT968606 MT987977 MT995805 N/111.5E 32.67N/113. W204 Leptonetidae gen Tianxian, Henan, China MT968555 70E 32.80N/111. W205 Leptonetidae gen Wuming, Henan, China MT968556 MT968607 56E Falcileptoneta 35.75N/139. W214 Otake cave, Tokyo, Janpan MT968666 MT968557 MT968608 MT987978 MT995806 musculina 15E Falcileptoneta Narusawa Bat Cave, 35.47N/138. W216 MT968667 MT968558 MT968609 MT987979 musculina Yumanashi, Janpan 67E 25.08N/107. W222 Leptonetela encun Encun Cave, Guangxi, China MT968668 MT968559 59E Fengcheng City, Shenyang, 40.38N/124. W254 Falcileptoneta sp2 MT968690 MT968560 MT987980 China 08E Jiande City, Zhejiang, China 29.47N/119. W256 Longileptoneta sp4 MT968669 MT968561 MT987981 27E Falcileptoneta Mt. Chiak , Socho-myeon, 37.40N/128. W257 MT968670 MT968562 MT968610 MT987982 MT995807 chiakensis Gangweon-do Korea 05E Falcileptoneta Mt. Odae, Gangwon-do, 37.79N/128. W258 MT968671 MT968563 MT968611 MT987983 MT995808 odaesanensis Korea, 57E Longileptoneta Weolak, Mt, Hansu-myeon, 36.86N/128. W259 MT968672 MT968612 MT987984 MT995809 weolakensis Jecheon-si, 10E Chungcheongbuk-do, Korea Falcileptoneta. Hansan-myeon,Gyeongnam- 34.80N/128. W260 MT968673 MT968564 MT968613 MT987985 MT995810 hansanensis do, 48E Korea Falcileptoneta Mt. Unmun, 35.65N/129. W261 MT968674 MT968565 MT968614 MT987986 MT995811 unmunensis Gyeongsangbuk-do,Korea 03E Falcileptoneta Mt. Unmun, 35.65N/129. W262 MT968675 MT968615 MT987987 MT995812 unmunensis Gyeongsangbuk-do,Korea 03E Mt Kkachisan, Bangeum-ri, 35.70N/128. W263 Masirana. flabelli MT968676 MT968566 MT968616 MT987988 Gyeongsangbuk-do, Korea 95E Falcileptoneta Maehwasan-ro, 35.76N/128. W264 MT968677 MT968567 MT968617 MT987989 maewhaensis Gyeongsangnam-do, Korea, 12E Sinpa-ri, Suryun-myeon, Longileptoneta. 35.82N/128. W265 Seongju-gun, MT968678 MT968568 MT968618 MT987990 MT995813 gayaensis 18E Gyeonsangbuk-do, Korea Longileptoneta Mt. Choijeong, Daegu, 35.78N/128. W266 MT968679 MT968569 MT968619 MT987991 MT995814 gachangensis Korea 60E Falcileptoneta Mt Juwang, Gyeongbuk-do, 36.40N/129. W268 MT968680 MT968570 MT968620 MT987992 MT995815 juwangensis Korea 16E Falcileptoneta Mt Juwang, Gyeongbuk-do, 36.40N/129. W269 MT968681 MT968571 MT968621 MT987993 MT995816 juwangensis Korea 16E Masirana Gye-ri, Gyeongbuk-do, 36.76N/129. W270 MT968682 MT968572 MT968622 MT987994 ihwaeolensis Korea 18E Falcileptoneta Dang-ri, Gyeongbuk-do, 36.78N/129. W271 MT968683 MT968573 MT968623 MT987995 MT995817 ihwaeolensis Korea 06E Masirana Mt Taebaek, Hyeol-dong, 37.04N/128. W272 MT968684 MT968574 MT968624 MT987996 MT995818 bonghwaensis Taebaek-si, Gangwon-do, 99E Korea Falcileptoneta Samga-ri, 36.50N/127. W273 MT968685 MT968575 MT968625 MT987997 MT995819 boeunensis Chungbuk-do,Korea 86E Longileptoneta Sango-ri, Hwabuk-myeon, 36.51N/127. W274 MT968626 MT987998 MT995820 songniensis Sangju-si, Chungbuk-do, 92E Korea Leptoneta Janghyeon-ri, Gyeonggi-do, 37.73 N/ W275 MT968686 MT968576 MT968627 MT987999 MT995821 kwangreungensis Korea 127.17 E Falcileptoneta Mt Baegunsan, 38.07N/127. W276 MT968687 MT968577 MT968628 MT988000 MT995822 baegunsanensis Gyeonggi-do, Korea, 40E Falcileptoneta Jinjung-ri, Mt Yebong, 37.56N/127. W277 MT968688 MT968578 MT968629 MT988001 MT995823 yebongsanensis Gyeonggi-do, Korea, 29E Genbank Falcileptoneta JN816654.1 JN816868.1 JN816437.1 JN817068.1 coreana Falcileptoneta JN816656.1 JN816870.1 JN816439.1 JN817069.1 hwanseonensis KY016333. KY016945. KY015757. KY017601. KY018130. Hickmania 1 1 1 1 1 Leptoneta JN816655.1 N816869.1 JN816438.1 hogyegulensis KY016498. KY017140. KY015922. KY017764. Leptoneta infuscata 1 1 1 1 Leptoneta JN816657.1 JN816440.1 waheulgulensis Supplementary Table S2 Primers used for amplification and sequencing in this study Gene Primer Sequence 5'-3' References COI LCO1490-ONO GGTCAACAAATCATCATAAAGATATTGG Folmer et al., 1994 HCO2568 GCTACA ACA TAA TAA GTA TCATG Hedin et al., 2001 28S 28Sa GACCCGTCTTGAAACACGGA Rix et al., 2008
Load more

Recommended publications
  • Research Article ISSN 2336-9744 (Online) | ISSN 2337-0173 (Print) the Journal Is Available on Line At
    Research Article ISSN 2336-9744 (online) | ISSN 2337-0173 (print) The journal is available on line at www.biotaxa.org/em New faunistic data on the cave-dwelling spiders in the Balkan Peninsula (Araneae) MARIA V. NAUMOVA1, STOYAN P. LAZAROV2, BOYAN P. PETROV2, CHRISTO D. DELTSHEV2 1Institute of Biodiversity and Ecosystem Research, Bulgarian Academy of Sciences, 1, Tsar Osvoboditel Blvd., 1000 Sofia, Bulgaria, E-mail: [email protected] 2National Museum of Natural History, Bulgarian Academy of Sciences, 1, Tsar Osvoboditel Blvd., 1000 Sofia, Bulgaria, E-mail: [email protected], [email protected], [email protected] Corresponding author: Christo Deltshev Received 15 October 2016 │ Accepted 7 November 2016 │ Published online 9 November 2016. Abstract The contribution summarizes previously unpublished data and adds records of newly collected cave-dwelling spiders from the Balkan Peninsula. New data on the distribution of 91 species from 16 families, found in 157 (27 newly established) underground sites (caves and artificial galleries) are reported due to 337 original records. Twelve species are new to the spider fauna of the caves of the Balkan Peninsula. The species Histopona palaeolithica (Brignoli, 1971) and Hoplopholcus longipes (Spassky, 1934) are reported for the first time for the territory of Balkan Peninsula, Centromerus cavernarum (L. Koch, 1872), Diplocephalus foraminifer (O.P.-Cambridge, 1875) and Lepthyphantes notabilis Kulczyński, 1887 are new for the fauna of Bosnia and Herzegovina, Cataleptoneta detriticola Deltshev & Li, 2013 is new for the fauna of Greece, Asthenargus bracianus Miller, 1938 and Centromerus europaeus (Simon, 1911) are new for the fauna of Montenegro and Syedra gracilis (Menge, 1869) is new for the fauna of Turkey.
    [Show full text]
  • Arachnologische Arachnology
    Arachnologische Gesellschaft E u Arachnology 2015 o 24.-28.8.2015 Brno, p Czech Republic e www.european-arachnology.org a n Arachnologische Mitteilungen Arachnology Letters Heft / Volume 51 Karlsruhe, April 2016 ISSN 1018-4171 (Druck), 2199-7233 (Online) www.AraGes.de/aramit Arachnologische Mitteilungen veröffentlichen Arbeiten zur Faunistik, Ökologie und Taxonomie von Spinnentieren (außer Acari). Publi- ziert werden Artikel in Deutsch oder Englisch nach Begutachtung, online und gedruckt. Mitgliedschaft in der Arachnologischen Gesellschaft beinhaltet den Bezug der Hefte. Autoren zahlen keine Druckgebühren. Inhalte werden unter der freien internationalen Lizenz Creative Commons 4.0 veröffentlicht. Arachnology Logo: P. Jäger, K. Rehbinder Letters Publiziert von / Published by is a peer-reviewed, open-access, online and print, rapidly produced journal focusing on faunistics, ecology Arachnologische and taxonomy of Arachnida (excl. Acari). German and English manuscripts are equally welcome. Members Gesellschaft e.V. of Arachnologische Gesellschaft receive the printed issues. There are no page charges. URL: http://www.AraGes.de Arachnology Letters is licensed under a Creative Commons Attribution 4.0 International License. Autorenhinweise / Author guidelines www.AraGes.de/aramit/ Schriftleitung / Editors Theo Blick, Senckenberg Research Institute, Senckenberganlage 25, D-60325 Frankfurt/M. and Callistus, Gemeinschaft für Zoologische & Ökologische Untersuchungen, D-95503 Hummeltal; E-Mail: [email protected], [email protected] Sascha
    [Show full text]
  • Annotated Checklist of the Spiders of Turkey
    _____________Mun. Ent. Zool. Vol. 12, No. 2, June 2017__________ 433 ANNOTATED CHECKLIST OF THE SPIDERS OF TURKEY Hakan Demir* and Osman Seyyar* * Niğde University, Faculty of Science and Arts, Department of Biology, TR–51100 Niğde, TURKEY. E-mails: [email protected]; [email protected] [Demir, H. & Seyyar, O. 2017. Annotated checklist of the spiders of Turkey. Munis Entomology & Zoology, 12 (2): 433-469] ABSTRACT: The list provides an annotated checklist of all the spiders from Turkey. A total of 1117 spider species and two subspecies belonging to 52 families have been reported. The list is dominated by members of the families Gnaphosidae (145 species), Salticidae (143 species) and Linyphiidae (128 species) respectively. KEY WORDS: Araneae, Checklist, Turkey, Fauna To date, Turkish researches have been published three checklist of spiders in the country. The first checklist was compiled by Karol (1967) and contains 302 spider species. The second checklist was prepared by Bayram (2002). He revised Karol’s (1967) checklist and reported 520 species from Turkey. Latest checklist of Turkish spiders was published by Topçu et al. (2005) and contains 613 spider records. A lot of work have been done in the last decade about Turkish spiders. So, the checklist of Turkish spiders need to be updated. We updated all checklist and prepare a new checklist using all published the available literatures. This list contains 1117 species of spider species and subspecies belonging to 52 families from Turkey (Table 1). This checklist is compile from literature dealing with the Turkish spider fauna. The aim of this study is to determine an update list of spider in Turkey.
    [Show full text]
  • Spiders (Arachnida: Aranei) of Azerbaijan. 1. New Family and Genus Records
    Arthropoda Selecta 12 (1): 2946 © ARTHROPODA SELECTA, 2003 Spiders (Arachnida: Aranei) of Azerbaijan. 1. New family and genus records Ïàóêè (Arachnida: Aranei) Àçåðáàéäæàíà. 1. Íîâûå äëÿ ðåãèîíà ñåìåéñòâà è ðîäà Yuri M. Marusik1 & Elchin F. Guseinov2 Þ.Ì. Ìàðóñèê1, Ý.Ô. Ãóñåéíîâ2 ¹ Institute for Biological Problems of the North, Portovaya Str. 18, Magadan 685000 Russia. email: [email protected] 1 Èíñòèòóò áèîëîãè÷åñêèõ ïðîáëåì Ñåâåðà, ÄÂÎ ÐÀÍ, óë. Ïîðòîâàÿ 18, Ìàãàäàí 685000 Ðîññèÿ. ² Institute of Zoology, block 504, passage 1128, Baku 370073 Azerbaijan. email: [email protected] 2 Èíñòèòóò çîîëîãèè ÀÍ Àçåðáàéäæàíà, êâàðòàë 504, ïðîåçä 1128, Áàêó 370073 Àçåðáàéäæàí. KEY WORDS: Aranei, spiders, Caucasus, Azerbaijan, new records, new species. ÊËÞ×ÅÂÛÅ ÑËÎÂÀ: Aranei, ïàóêè, Êàâêàç, Àçåðáàéäæàí, íîâûå íàõîäêè, íîâûå âèäû. ABSTRACT. Twenty genera and seven families Ñîâåòñêîãî Ñîþçà. Äâà ðîäà Mysmena è Tuberta (Desidae, Leptonetidae, Mysmenidae, Nesticidae, Pal- âïåðâûå çàðåãèñòðèðîâàíû íà òåððèòîðèè Àçèè. pimanidae, Prodidomidae and Theridiosomatidae) new Îïèñàíî òðè âèäà íîâûõ äëÿ íàóêè: Lycosoides to Azerbaijan are reported. 16 genera and 4 families are lehtineni sp.n. ($), Paracedicus feti sp.n. (#$) è Try- new to Caucasus. Five genera are new to the former getus jacksoni sp.n. ($), êðîìå òîãî, ïðèâåäåíû èëëþ- Soviet Union (Lycosoides, Mysmena, Orchestina, Tryge- ñòðèðîâàííûå îïèñàíèÿ åùå ïÿòè âèäîâ: Leptonetella tus and Tuberta) and two genera (Mysmena and Tuber- caucasica Dunin, 1990 ? ($), Howaia mogera (Yagi- ta) are new to Asia as a whole. Three species are numa, 1972) (#$), Nesticella nepalensis (Hubert, 1973) described as new to science: Lycosoides lehtineni sp.n. (# èç ñåâåðíîé Èíäèè), Orchestina sp. ($) è Palpima- ($), Paracedicus feti sp.n. (#$) and Trygetus jacksoni nus sogdianus Charitonov, 1946 ? (#$).
    [Show full text]
  • 2013 Kirill the Book.P65
    ZOOLOGICAL MUSEUM OF MOSCOW STATE UNIVERSITY K.G. Mikhailov The spiders (Arachnida: Aranei) of Russia and adjacent countries: a non-annotated checklist Arthropoda Selecta. Supplement No. 3. KMK Scientific Press Ltd. Moscow v 2013 Mikhailov K.G.1 The spiders (Arachnida: Aranei) of Russia and adjacent countries: a non- annotated checklist. Arthropoda Selecta. Supplement No.3. Moscow: KMK Scientific Press Ltd. 262 p. 1 Zoological Museum MGU, Bolshaya Nikitskaya Str. 6, Moscow 125009 Russia. E-mail: [email protected] A checklist of 3,340 spider species belonging to 629 genera and 50 families is provided for Russia and the other post-Soviet republics, namely, Armenia, Azerbaijan, Byelorussia (Belarus), Estonia, Georgia, Kazakhstan, Latvia, Lithuania, Moldavia (Moldova), Kirghizia (Kyrgyzstan), Tajikistan, Turkmenia (Turkmenistan), Ukraine, and Uzbekistan, based on comprehensive literature data covering more than 2,600 sources published between 1770 and June 2013. Calculations of the number of spider species in the post-Soviet republics and different physiographical areas are provided in the introductory part. Each species included in the checklist is supplied with an attribution both to physiographical area(s) and republic(s). The necessary synonymies and valid subspecies are also enlisted, same as nomina dubia and nomina nuda. An alphabetic index of all genera and species names is provided as well. Destined for zoologists, mainly arachnologists and entomologists, as well as for local biologists and naturalists. 1 map, 3 tables, 199 references. Key words: Aranei, spiders, checklist, Russia, Armenia, Azerbaijan, Byelorussia, Belarus, Estonia, Georgia, Kazakhstan, Latvia, Lithuania, Moldavia, Moldova, Kirghizia, Kyrgyzstan, Tajikistan, Turkmenia, Turkmenistan, Ukraine, Uzbekistan, physiographical areas. Ìèõàéëîâ Ê.Ã.1 Ïàóêè (Arachnida: Aranei) Ðîññèè è ïðèëåæàùèõ ñòðàí: íåàííîòè- ðîâàííûé ðååñòð.
    [Show full text]
  • Cave Survey Yields a New Spider Family Record for Israel
    © Arachnologische Gesellschaft e.V. Frankfurt/Main; http://arages.de/ Arachnologische Mitteilungen / Arachnology Letters 51: 39-42 Karlsruhe, April 2016 Cave survey yields a new spider family record for Israel Efrat Gavish-Regev, Shlomi Aharon, Igor Armiach & Yael Lubin doi: 10.5431/aramit5105 Abstract. Leptonetidae and Phyxelididae were discovered as part of the first thorough cave survey of arthropods in Israel, and are re- ported here for the first time from caves in Israel. Both families were found in relatively temperate and humid caves at the western part of Israel and in intermediate elevation, at the cave entrance and the twilight zone. Leptonetidae were recorded for the first time in Israel. Keywords: Araneae, Cataleptoneta, Leptonetidae, Levant, Phyxelida, Phyxelididae, troglophiles Cave dwelling species can be classified into three groups, ac- of Cyprus and the mainland area including Israel, Jordan, cording to their affinity to life in caves: troglobites are obli- Lebanon, Palestine and Syria. The Levant mainland is, as a gatory cave species, and therefore usually have morphological unit, unusually heterogeneous topographically, climatically adaptations such as reduction or complete loss of vision and and biologically. It includes four main topographic elements, pigmentation as well as elongation of the appendages; troglo- each element continues from the north to the south: the philes (which can be divided into eutroglophile and subtrog- coastal plain, the western mountain ridge, the rift valley and lophile, see Sket 2008) are species that have a strong affinity the eastern mountain ridge. The topographic and climatic to caves but can also live outside caves, and therefore lack the- heterogeneity can be explained by geological processes and se morphological adaptations.
    [Show full text]
  • Arachnida, Araneae)
    ZooKeys 1000: 1–17 (2020) A peer-reviewed open-access journal doi: 10.3897/zookeys.1000.57660 RESEARCH ARTICLE https://zookeys.pensoft.net Launched to accelerate biodiversity research Redescription of types of three species of Leptonetidae Simon, 1890 from China (Arachnida, Araneae) Jinxin Liu1*, Zongguang Huang1*, Xiang Xu1,2, Haiqiang Yin1,2 1 College of Life Science, Hunan Normal University, Changsha 410081, Hunan, China 2 The National & Lo- cal Joint Engineering Laboratory of Animal Peptide Drug Development (Hunan Normal University), National Development and Reform Commission, Changsha, Hunan 410081, China Corresponding author: Xiang Xu ([email protected]) Academic editor: D. Dimitrov | Received 16 August 2020 | Accepted 5 November 2020 | Published 3 December 2020 http://zoobank.org/7225F846-0B52-4F4C-BE78-DF14E43D6E25 Citation: Liu J, Huang Z, Xu X, Yin H (2020) Redescription of types of three species of Leptonetidae Simon, 1890 from China (Arachnida, Araneae). ZooKeys 1000: 1–17. https://doi.org/10.3897/zookeys.1000.57660 Abstract Three species of the genusLeptoneta Simon, 1872 deposited at Hunan Normal University, Changsha, China, are examined and redescribed. Two species are transferred from Leptoneta Simon, 1872 to Lep- tonetela Kratochvíl, 1978, and the following new combinations are proposed: Leptonetela trispinosa (Yin, Wang & Wang, 1984), comb. nov. (♀♂), and Leptonetela unispinosa (Yin, Wang & Wang, 1984), comb. nov. (♂). The generic placement ofLeptoneta monodactyla Yin, Wang & Wang, 1984 is maintained. De- tailed descriptions, illustrations, and a distribution map for all three species are provided. Keywords Leptoneta, Leptonetela, new combination, taxonomy Introduction Leptonetids are small in size, usually less than 3 mm, with the body color entirely pale or yellowish (sometimes color varying between pale and yellowish) (Lin and Li 2010; Le Peru 2011).
    [Show full text]
  • Three New Species of the Genus Leptonetela from Greece (Araneae, Leptonetidae)
    A peer-reviewed open-access journal ZooKeys 569: 23–35Three (2016) new species of the genusLeptonetela from Greece (Araneae, Leptonetidae) 23 doi: 10.3897/zookeys.569.6921 RESEARCH ARTICLE http://zookeys.pensoft.net Launched to accelerate biodiversity research Three new species of the genus Leptonetela from Greece (Araneae, Leptonetidae) Yi Wu1, Chunxia Wang2, Guo Zheng1, Shuqiang Li2 1 College of Life Science, Shenyang Normal University, Shenyang 110034, China 2 Institute of Zoology, Chi- nese Academy of Sciences, Beijing 100101, China Corresponding authors: Guo Zheng ([email protected]); Shuqiang Li ([email protected]) Academic editor: Y. Marusik | Received 21 October 2015 | Accepted 28 January 2016 | Published 24 February 2016 http://zoobank.org/9EFB75EF-B126-441A-93DD-9FB14765F125 Citation: Wu Y, Wang C, Zheng G, Li S (2016) Three new species of the genus Leptonetela from Greece (Araneae, Leptonetidae). ZooKeys 569: 23–35. doi: 10.3897/zookeys.569.6921 Abstract Three new species of the spider genus Leptonetela collected from caves in Greece are described: L. arvan- itidisi sp. n. (male & female), L. paragamiani sp. n. (male & female) and L. penevi sp. n. (male & female). Detailed illustrations of the new species are provided. DNA barcodes were obtained for future use. Keywords Haplogynae, taxonomy, DNA-barcoding, Balkan Peninsula, spider Introduction The leptonetids are minute (1.0–3.0 mm) spiders that can be easily distinguished from other families by a distinctive 6-eyed pattern, with the posterior median eyes situated behind the posterior lateral eyes; however, in some cave species, the eyes are reduced to vestiges or may be completely absent (Gertsch 1974).
    [Show full text]
  • Phylogenomics and Biogeography of Leptonetid Spiders (Araneae : Leptonetidae)
    CSIRO PUBLISHING Invertebrate Systematics, 2021, 35, 332–349 https://doi.org/10.1071/IS20065 Phylogenomics and biogeography of leptonetid spiders (Araneae : Leptonetidae) Joel Ledford A,G, Shahan Derkarabetian B, Carles Ribera C, James Starrett D, Jason E. Bond D, Charles Griswold E and Marshal HedinF ADepartment of Plant Biology, University of California—Davis, Davis, CA 95616-5270, USA. BDepartment of Organismic and Evolutionary Biology, Museum of Comparative Zoology, Harvard University, Cambridge, MA 02138, USA. CDepartament de Biologia Evolutiva, Ecologia i Ciències Ambientals, Universitat de Barcelona, Barcelona, Spain. DDepartment of Entomology and Nematology, University of California—Davis, Davis, CA 95616-5270, USA. EDepartment of Entomology, California Academy of Sciences, San Francisco, CA 94118, USA. FDepartment of Biology, San Diego State University, San Diego, CA 92182-4614, USA. GCorresponding author. Email: [email protected] Abstract. Leptonetidae are rarely encountered spiders, usually associated with caves and mesic habitats, and are disjunctly distributed across the Holarctic. Data from ultraconserved elements (UCEs) were used in concatenated and coalescent-based analyses to estimate the phylogenetic history of the family. Our taxon sample included close outgroups, and 90% of described leptonetid genera, with denser sampling in North America and Mediterranean Europe. Two data matrices were assembled and analysed; the first ‘relaxed’ matrix includes the maximum number of loci and the second ‘strict’ matrix is limited to the same set of core orthologs but with flanking introns mostly removed. A molecular dating analysis incorporating fossil and geological calibration points was used to estimate divergence times, and dispersal–extinction–cladogenesis analysis (DEC) was used to infer ancestral distributions. Analysis of both data matrices using maximum likelihood and coalescent-based methods supports the monophyly of Archoleptonetinae and Leptonetinae.
    [Show full text]
  • A Synthesis on Cave-Dwelling Spiders in Europe 2 3 Stefano Mammola1, Pedro Cardoso2, Carles Ribera3, Martina Pavlek3,4,5, Marco Isaia1,*
    1 A synthesis on cave-dwelling spiders in Europe 2 3 Stefano Mammola1, Pedro Cardoso2, Carles Ribera3, Martina Pavlek3,4,5, Marco Isaia1,* 4 5 Authors for correspondence: 6 * [email protected]; phone 0116704544 7 1. Department of Life Sciences and Systems Biology, University of Torino, Turin, Italy 8 2. Finnish Museum of Natural History, University of Helsinki, Helsinki, Finland 9 3. Biodiversity Research Institute and Department of Animal Biology, University of 10 Barcelona, Barcelona, Spain 11 4. Ruđer Bošković Institute, Zagreb, Croatia 12 5. Croatian Biospeleological Society, Zagreb, Croatia 13 14 15 Running title: European cave spiders checklist 16 17 18 19 20 21 22 23 24 25 26 27 1 28 29 Abstract 30 We provide the first overview on spiders living in subterranean habitats in Europe, 31 including the first European subterranean spider checklist. In Europe there are 486 spider 32 species known to dwell in caves and other subterranean habitats, distributed across 22 33 families. Despite a few species being able to colonize caves across the whole continent, 34 approximately 90% of the species show a restricted distribution, occurring exclusively in 35 one or two countries. From a biogeographic perspective, Southern Europe emerges as the 36 main hot spot of subterranean spider diversity, showing the highest richness of endemic 37 species. Compared to other temperate regions of the world, some families appear to be 38 well represented and other poorly represented (or lacking) in European subterranean 39 habitats. Overall, it appears that the taxonomical knowledge on subterranean spiders in 40 Europe is sufficient, but not evenly distributed.
    [Show full text]
  • Araneae, Leptonetidae), with Descriptions of 46 New Species
    ZOOLOGICAL RESEARCH Integrative taxonomy of Leptonetela spiders (Araneae, Leptonetidae), with descriptions of 46 new species Chun-Xia Wang1,2, Xin Xu3, Shu-Qiang Li1,4,* 1Institute of Zoology, Chinese Academy of Sciences, Beijing 100101, China 2Southeast Asia Biodiversity Research Institute, Chinese Academy of Sciences, Yezin Nay Pyi Taw 05282, Myanmar 3College of Life Sciences, Hunan Normal University, Changsha Hunan 410006, China 4University of Chinese Academy of Sciences, Beijing 100049, China ABSTRACT palmata is a preoccupied name. Extreme environments, such as subterranean habitats, Keywords: DNA barcoding; Phylogeny; Phenotype; are suspected to be responsible for morphologically Species delineation inseparable cryptic or sibling species and can bias biodiversity assessment. A DNA barcode is a short, INTRODUCTION1 standardized DNA sequence used for taxonomic purposes and has the potential to lessen the challenges Subterranean ecosystems, such as caves and cracks, are presented by a biotic inventory. Here, we investigate evident mainly in karst areas, which represent nearly 4% of the the diversity of the genus Leptonetela Kratochvíl, rocky outcrops of the world. These environments are marked by 1978 that is endemic to karst systems in Eurasia permanent darkness, a lack of diurnal and annual rhythms, and using DNA barcoding. We analyzed six hundred and extremely scarce food sources (Culver & White, 2005; Howarth, twenty four specimens using one mitochondrial gene 1983; Poulson & White, 1969). Many studies show that despite fragment (COI). The results show that DNA barcoding stressful and unfavorable conditions, the subsurface habitat is an efficient and rapid species identification method harbors diverse animal communities (mainly invertebrates) in this genus. It indicated the existence of 90 species, (Amara-Zettler et al., 2002; Flot et al., 2010; López-García et al., a result consistent with previous taxonomic hypotheses 2001; Mathieu et al., 1997; Niemiller et al., 2012: Sket, 1999).
    [Show full text]
  • Commented Checklist of the Spider Species (Araneae) in the Caucasus Ecoregion
    Caucasian Spiders Database Version 1.4.3 (20 October 2015) Commented Checklist of the Spider Species (Araneae) in the Caucasus Ecoregion Stefan Otto* GutsMuthsstr. 42, 04177 Leipzig, Germany. Email: s.otto [email protected] Contents Introduction2 Methods 3 Commented Checklist3 List of doubtful and erroneous Species Records 56 Acknowledgements 59 References 59 Additional References 80 Index 81 Appendix 95 Abstract: The commented checklist is based on 275 publications with occurrence data on spiders in the Caucasus Ecoregion (13321 records of 1107 species. The number of records as well as its abundance status is given for each species. The list of doubtful and erroneous species records contains another 57 species, which are either invalid species or their species records in the Caucasus Ecoregion are based on doubtful records, misidentifications or related reasons. A record density map for the Caucasus Ecoregion is provided. http://caucasus-spiders.info/checklist/ 1 Caucasian Spiders Database Introduction Introduction The Caucasus Ecoregion (hencefourth termed 'CE') is one of the global biodiversity hotspots. Despite having been studied for nearly 150 years, the species numbers of invertebrate taxa in this ecoregion (and almost all other ecoregions as well) remain obscure due to lack of diversity databases, unresolved taxonomic/systematic questions and insufficient research efforts, e.g. local and regional faunistic studies. Since the first species censuses for the countries of the former USSR (Mikhailov 1997- 2000) and a summary on the spider fauna of the Caucasus (Marusik et al. 2006), the species number of the spiders in the CE has risen to well above one thousand species. In recent years regularly updated information on the occurence status, taxonomy and determination of spider species in the CE has become easily available through internet ressource, e.
    [Show full text]