DOCSLIB.ORG

Ydrate an Aid to Nutrition in the Future

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Ydrate an Aid to Nutrition in the Future CarboYthetic ydrate An Aid to Nutrition in the Future Prepared Under Stanford University Ames Research Center Summer Faculty Program in Engineering Systems Design NASA Ccntract NGR-05020-409 School of Engineering, Stanford University 1972 The Stanford-Ames NASA/ASEE Summer Faculty Systems Design Workshop FINAL REPORT SYNTHETIC CARBOHkBRATE AN AID TO NUTRITION IN THE FUTURE January 1973 Gerald A. Berman Kate H. Murashige editors PARTICIPANTS Rodney W. Ballard L. Daniel hletz Assaciate Professor, .4ssistant Professor, Microbiology Department General Engineering California State Lniversity University of Illinois San Jose, California Urbana, Illinois Gerald A. Berman Peter $1. Moretti Associate Professor, Assistant Professor, E lec t rica1 Eng inee ring Mec han ica 1/Aerospace Eng rg . University of Detroit Oklahoma State Lniversity Detroit, Michigan Stillwater, Oklahoma James P. Chandler Kate H. Murashige Assistant Professor, Chairman, Physical Science Div. School of Law College of San Mate0 University of Maryland San Mateo, California Baltimore, Maryland Peter J. Reilly Nicholas Dinos Assistant Professor, Professor, Chemical Engrg . Chemical Engineering Ohio University University of Nebraska Athens, Ohio Lincoln, Nebraska William A. Drewry Errol D. Rodda Associate Professor, Associate Professor, Civil Engineering Agricultural Engineering The University of Temessee Un iversity of I11 inois Know i lle, Tennessee Urbana, Illinois William G. Gensler Dewey D.Y. Ryu Associate Professor, Associate Professor, Electrical Engineering Chemical Engineering University of Arizona Massachusetts Institute of Tech. Tucson, Arizona Cambridge, Massachusetts Leo J. Hirth Shirley Stoner Associate Professor, Assistant Prof ., Economics Chemic a 1 Engi nee r ing California State university Auburn University San Jose, California Auburn, Alabama Keith R. Wellman Marshall M. Lih Associate Professor, Associate Professor, Chemistry Department Chemical Engineering University of Miami The Catholic Univ. of America Coral Gables, Florida Washington, D. C. George Wilkins Kurt M. Marshek Assistant Professor, Assistant Professor, Chemical Engineering Mechanical Engineering University of Detroit University of Connecticut Detroit, Michigan Storrs, Connecticut i CO-DIRECTORS Wofessor James L. Adam Dr. John Billingham Director, Design Division Chief, Biotechnology Stant ord Universi ty Ames Research Center ASSOCIATE DIRECTORS Channing Robertson Jacob Shapira Assistant Professor, Research Scientist Chemical Engineering Ames Research Center Stanford University ii ABSTRACT This report discusses the synthetic production of carbohydrate on a large scale. First of all, the world food situation is studied in some detail. Next, three possible nonagricultural methods of making starch are presented in detail and discussed. The simplest of these, the hydrolysis of cellulose wastes to glucose followed by polymeriza- tion to starch, appears a reasonable and economic supplement to agri- culture at the present time. The conversion of fossil fuels to starch was found to be not com- petitive with agriculture at the present time, but tractable enough to allow a reasonable plant design to be made. This design may serve as a basis for future analysis, should needs, costs, or technology change. It may also serve as a model for the design of similar but more compli- cated multienzyme, large scale processes, such as mock photosynthesis. A reconstruction of the photosynthetic prmess using isolated en- zyme systems proved technically much more diff icblt than either of the other two processes. Particular diff iculties relate to the replacement of expensiv,? energy carrying compounds, separation of similar materials, and processing of large reactant volumes. Problem areas have been pin- pointed, and technological progress necessary to permit such a system to become practical has been described. This process is of special interest because of its potential use to recycle metabolic waste (1202) on prolonged space flights. Next, the possible use of synthetically produced carbohydrate materi- al is discussed in some detail. Finally, an analysis of the implementation of the cellulose process in a representative area and its impact on the social, economic, and political factors of the area is made. iii CONTENTS Chapter .Page 1 . INTRODUCTION AND SUMMARY .........., ...... 1 1.1 General ....................... 1 1.2 Cellulose Process .................. 3 1.3 Fossil Fuel Process ................. 7 1.4 CO Fixation Process 10 2 ................ 1.5 Cost Data Comparison ................ 13 2 . THE WORU) FOOD SITUATION ................. 15 2.1 Introduction .................... 15 2.2 World Population Growth Trends : Past. Present. and Future .............. 15 2.3 Present and Projected World Food Needs and Supplies ................. 21 2.4 Nutritional Requirements .............. 32 2.5 Alternative Methods of Meeting Food Needs ...... 46 2.6 Synthetic Foods ................... 51 2.7 Summary ....................... 59 3 ESSENTIAIS OF THE PRODUCTION OF SYNTHETIC CARBOHYDRATES ...................... 63 3.1 Introduction .................... 63 3.2 Cellulose Conversion to Glucose ........... 64 3.3 Fossil Fuel Pathway ................. 65 3.4 Carbon Dioxide Fixation Process ........... 67 3.5 Glucose to Starch .................. 68 4 . CHEMISTRY OF GLUCOSE AND STARCH PRODUCTION ........ 71 4.1 Chemistry of Cellulose Process-Cellulose to Glucose ..................... 71 4.2 Fossil Fuel Process.. Glycidaldehyde to Clucose ....................... 76 4.3 C02 Fixation Process.. C02 to Glucose ........ 84 4.4 Comparison of Three Processes to Glucose ...... 92 4.5 Starch Synthesis from Glucose ............ 94 4.6 Adenosine Triphosphate (ATP) Regeneration ...... 98 4.7 Rejected Pathways ..................107 V PRECEDING PAGE BLANK NOT FILMED CONTENTS (Cont) Chapter .Page 5 . PROCESS AhL' PIANT DESIGN ................. 119 5.1 Cellulose to Glucose ................ 119 5.2 Fossil Fuel ..................... 136 5.3 Carbon Dioxide Fixation Process ........... 162 5.4 Glucose to Starch .................. 169 6 . FOODTECHNOJAXY ..................... 185 6.1 Introduction .................... 185 6.2 Factory Products: Current and Potential Utilization ................ 185 6.3 Augmentation .................... 187 7 . SPECITIC APPLICATIONS..INDIA. AS AN EXAMPLE ....... 197 7.1 Introduction .................... 197 7.2 Demand for Food ................... 197 7.3 Agricultural Production of Food ........... 198 7.4 Synthetic Carbohydrates ............... 207 Append ices 4.1 CHARACTERISTICS OF ENZYMES: GLYCIDAIDEHYDE + GLUCOSE . 213 4.2 IMPORTANCE OF SEQUENCE IN COUPLED REACTIONS ....... 221 4.3 ENZYME KINETICS FOR THE CARBON DIOXIDE FIXATION PROCESS . 225 4.4 CRITERIA FOR SELECTION OF GLUCOSE 4 STARCH PATHWAY .... 239 4.5 CHARACTERISTICS OF ENZYMES.. GLUCOSE +STARCH ....... 243 4.6 GENERAL METHODS OF ENZYME PREPARATION AND IMMOBILIZATION AND SPECIFIC EXAMPLES OF SEPARATION AND PURIFICATION ... 249 5.1 REACTOR DESIGN ...................... 255 5.2 SETTLERDESIGN .. * . 0 . 0 . 295 VI I UUSTRATIONS Figure Prsge 1.1 Simplified flow diagram.. cellulose to starch ....... 4 1.2 Chemical pathway.-c ellulose to starch ........... 5 1.3 SiL-plified flow diagram.. glycidaldehyde to starch ..... 8 1.4 Chemical pathway ..................... 9 1.5 Chemical reactions.< O2 to starch ............. 11 1.6 Simplified flow diagram.-C O2 to starch .......... 12 2.1 Long-range trend of world population growth ........ 15 2.2 Six estimates of world population. 1965-2000 ....... 16 2.3 The "Modified Irish Curvet1 ................ 18 2.4 The "Population Crash Curve" ............... 19 2.5 Possibility No . 3: "Gradual Approach to Zero Population Growth" .................... 20 2.6 Estimated values of food supplies per capita by world regions. prewar to 1958-60 ............ 22 2.7 Dramatic changes in yields per acre made possible by the new seeds ................. 23 2.8 Average dietary needs ................... 39 2.9 History of wheat and potato ................ 47 2.10 History of corn and sorghum yield in the United States ....................... 48 2.11 Labor content: man hours per 100 bushels in U.S. corn and wheat production ................. 49 2.12 World fertilizer consumption ............... 50 4.1 Reactions of the "cellulase cmplex'' ........... 72 4.2 Cellulose degradation process ............... 73 4.3 Effect of NaOH pretreatment 01) the percentage of dry matter digestion in vitro with rumen microorganisms . 74 vi1 ILLUSTRATIONS (Cont ) Figure Page 4.4 Flow diagram.. glycidaldehyde + glucose .......... 77 4.5 Chemical reactions.. glycidaldehyde +glucose ....... 78 4.6 Reductive pentose phosphate cycle and associated reactions ......................... 85 4.7 Possible routes.. glucose + starch ............. 95 4.8 Configuration for glucose --$ starch ............ 95 4.9 Alternative to the selected route to starch ........ 98 4.10 ATP regeneration.* yanate process ............. 99 4.11 Mass balance for ATP regeneration ............. 100 4.12 Once-through urea process ................. 103 4.13 Total recycle urea process ................ 105 4.14 ATP regeneration.. laboratory scheme ............ 104 4.15 Cyanate process.. schematic flwsheat ........... 105 4.16 Heat inactivation of carbamyl phosphokinase from S . faecalis at 5OoC ................. 107 4.17 The f omaldehyde-transketolase process for glucose synthesis ..................... 109 4.18 Glycerol kinase pathway .................. 111 4.19 Mannitol pathway ..................... 111
Load more

Recommended publications
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Yeast As a Tool to Understand the Significance of Human Disease
    G C A T T A C G G C A T genes Review Yeast as a Tool to Understand the Significance of Human Disease-Associated Gene Variants Tiziana Cervelli and Alvaro Galli * Yeast Genetics and Genomics Group, Laboratory of Functional Genetics and Genomics, Institute of Clinical Physiology CNR, Via Moruzzi 1, 56125 Pisa, Italy; [email protected] * Correspondence: [email protected] Abstract: At present, the great challenge in human genetics is to provide significance to the growing amount of human disease-associated gene variants identified by next generation DNA sequencing technologies. Increasing evidences suggest that model organisms are of pivotal importance to addressing this issue. Due to its genetic tractability, the yeast Saccharomyces cerevisiae represents a valuable model organism for understanding human genetic variability. In the present review, we show how S. cerevisiae has been used to study variants of genes involved in different diseases and in different pathways, highlighting the versatility of this model organism. Keywords: yeast; Saccharomyces cerevisiae; functional assays; Mendelian disease; cancer; human gene variants 1. Introduction The advent of next generation DNA sequences technologies allows us to identify Citation: Cervelli, T.; Galli, A. Yeast individual genetic variants, and this revolutionized the strategy for discovering the cause as a Tool to Understand the of several genetic and multifactorial diseases. The association between genetic variants Significance of Human and disease risk can potentially overturn our understanding of common disease. The Disease-Associated Gene Variants. discovery of pathways and processes that are causally involved in a disease, so far not Genes 2021, 12, 1303. https:// linked, may open the way towards the development of targeted therapies and prevention doi.org/10.3390/genes12091303 strategies.
    [Show full text]
  • 2 Points Chem 465 Biochemistry II Test 1 Spring 2017 Multiple Choice
    Name: 2 points Chem 465 Biochemistry II Test 1 Spring 2017 Multiple choice (4 points apiece): 1. Which of the following statements about the oxidative decarboxylation of pyruvate in aerobic conditions in animal cells is correct? A) One of the products of the reactions of the pyruvate dehydrogenase complex is a thioester of acetate. B) The methyl (-CH3) group is eliminated as CO2. C) The process occurs in the cytosolic compartment of the cell. D) The pyruvate dehydrogenase complex uses all of the following as cofactors: NAD+, lipoic acid, pyridoxal phosphate (PLP), and FAD. E) The reaction is so important to energy production that pyruvate dehydrogenase operates at full speed under all conditions. 2. In comparison with the resting state, actively contracting human muscle tissue has a: A) higher concentration of ATP. B) higher rate of lactate formation. C) lower consumption of glucose. D) lower rate of consumption of oxygen E) lower ratio of NADH to NAD+. 3.The metabolic function of the pentose phosphate pathway is: A) act as a source of ADP biosynthesis. B) generate NADPH and pentoses for the biosynthesis of fatty acids and nucleic acids. C) participate in oxidation-reduction reactions during the formation of H2O. D) provide intermediates for the citric acid cycle. E) synthesize phosphorus pentoxide. 4. Gluconeogenesis must use "bypass reactions" to circumvent three reactions in the glycolytic pathway that are highly exergonic and essentially irreversible. Reactions carried out by which three of the enzymes listed must be bypassed in the gluconeogenic pathway? 1) Hexokinase 2) Phosphoglycerate kinase 3) Phosphofructokinase-1 4) Pyruvate kinase 5) Triosephosphate isomerase A) 1, 2, 3 B) 1, 2, 4 C) 1, 4, 5 D) 1, 3, 4 E) 2, 3, 4 5.
    [Show full text]
  • Physiological and Proteomic Responses of Diploid and Tetraploid Black Locust (Robinia Pseudoacacia L.) Subjected to Salt Stress
    Int. J. Mol. Sci. 2013, 14, 20299-20325; doi:10.3390/ijms141020299 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Physiological and Proteomic Responses of Diploid and Tetraploid Black Locust (Robinia pseudoacacia L.) Subjected to Salt Stress Zhiming Wang 1,†, Mingyue Wang 1,†, Likun Liu2 and Fanjuan Meng 1,* 1 College of Life Science, Northeast Forestry University, Harbin 150040, China; E-Mails: [email protected] (Z.W.); [email protected] (M.W.) 2 Department of Medical Biotechnology, College of Biomedical Science, Kangwon National University, Chuncheon, Gangwon-do 200-701, Korea; E-Mail: [email protected] † These authors contributed equally to this work. * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +86-451-8219-2170; Fax: +86-451-8643-3905. Received: 17 June 2013; in revised form: 31 August 2013 / Accepted: 9 September 2013 / Published: 14 October 2013 Abstract: Tetraploid black locust (Robinia pseudoacacia L.) is adaptable to salt stress. Here, we compared morphological, physiological, ultrastructural, and proteomic traits of leaves in tetraploid black locust and its diploid relatives under salt stress. The results showed that diploid (2×) plants suffered from greater negative effects than those of tetraploid (4×) plants. After salt treatment, plant growth was inhibited, photosynthesis was reduced, reactive oxygen species, malondialdehyde content, and relative electrolyte leakage increased, and defense-related enzyme activities decreased in 2× compared to those in 4×. In addition, salt stress resulted in distorted chloroplasts, swollen thylakoid membranes, accumulation of plastoglobules, and increased starch grains in 2× compared to those in 4×.
    [Show full text]
  • Downregulation of Phosphoglycerate Kinase 1 by Shrna Sensitizes U251 Xenografts to Radiotherapy
    ONCOLOGY REPORTS 32: 1513-1520, 2014 Downregulation of phosphoglycerate kinase 1 by shRNA sensitizes U251 xenografts to radiotherapy YI-JUN CHENG1, HAO DING1, HUA-QING DU2, Hua YAN1, JIN-BING ZHAO1, WEN-BIN ZHANG1, YUAN-JIE ZOU1, HONG-YI LIU1 and HONG XIAO2 1Department of Neurosurgery and 2Neuro-Psychiatric Institute, Nanjing Brain Hospital Affiliated to Nanjing Medical University, Nanjing, Jiangsu, P.R. China Received April 6, 2014; Accepted July 9, 2014 DOI: 10.3892/or.2014.3353 Abstract. Phosphoglycerate kinase 1 (PGK1) has been demon- radiotherapy is one of the standard treatments for glioma. Yet, strated to be involved in radioresistance. The present study was the prognosis remains dismal due to the ability of gliomas to designed to investigate the effect of PGK1 on the radioresis- infiltrate diffusely into the normal brain parenchyma, a direct tance in vivo. U251 glioma cells were transfected with the short consequence of the transformation into genetic higher-grade hairpin RNA (shRNA)-PGK1 and pcDNA3.1-PGK1 using gliomas and recurrence (4-6). As known, radioresistance is Lipofectamine 2000. The radiosensitivity of U251 xenografts a common phenomenon in gliomas and, to date there are no was observed by tumor growth curve following radiotherapy. valid biomarkers for evaluating radiosensitivity. Quantitative PCR, western blot analysis and immunohisto- In fact, radiotherapy which relies on the generation of chemistry were performed to evaluate PGK1 expression in the oxygen super-radicals, often fails to kill tumor cells, due to xenografts from the different tumor models. The expression inadequate oxygen stress within the tumor cell mass (7,8). of PGK1 was maximally inhibited in response to shRNA4 at However, in tumor microenvironments where oxygen is scarce 24 h after the transfection in vitro.
    [Show full text]
  • De Novo Transcriptome Analysis of Chlorella Sorokiniana: Efect of Glucose Assimilation, and Moderate Light Intensity Siti Nor Ani Azaman1,2, Darren C
    www.nature.com/scientificreports OPEN De novo transcriptome analysis of Chlorella sorokiniana: efect of glucose assimilation, and moderate light intensity Siti Nor Ani Azaman1,2, Darren C. J. Wong3, Sheau Wei Tan4, Fatimah M. Yusof5,6, Norio Nagao2,7 & Swee Keong Yeap8* Chlorella can produce an unusually wide range of metabolites under various nutrient availability, carbon source, and light availability. Glucose, an essential molecule for the growth of microorganisms, also contributes signifcantly to the metabolism of various metabolic compounds produced by Chlorella. In addition, manipulation of light intensity also induces the formation of secondary metabolites such as pigments, and carotenoids in Chlorella. This study will focus on the efect of glucose addition, and moderate light on the regulation of carotenoid, lipid, starch, and other key metabolic pathways in Chlorella sorokiniana. To gain knowledge about this, we performed transcriptome profling on C. sorokiniana strain NIES-2168 in response to moderate light stress supplemented with glucose under mixotrophic conditions. A total of 60,982,352 raw paired-end (PE) reads 100 bp in length was obtained from both normal, and mixotrophic samples of C. sorokiniana. After pre-processing, 93.63% high-quality PE reads were obtained, and 18,310 predicted full-length transcripts were assembled. Diferential gene expression showed that a total of 937, and 1124 genes were upregulated, and downregulated in mixotrophic samples, respectively. Transcriptome analysis revealed that the mixotrophic condition caused upregulation of genes involved in carotenoids production (specifcally lutein biosynthesis), fatty acid biosynthesis, TAG accumulation, and the majority of the carbon fxation pathways. Conversely, starch biosynthesis, sucrose biosynthesis, and isoprenoid biosynthesis were downregulated.
    [Show full text]
  • Name: Chem 465 Biochemistry II Test 1 Spring 2019 Multiple Choice (4 Points Apiece): 1. in an Anaerobic Muscle Preparation, Lact
    Name: Chem 465 Biochemistry II Test 1 Spring 2019 Multiple choice (4 points apiece): 1. In an anaerobic muscle preparation, lactate formed from glucose labeled in C-3 and C-4 would be labeled in: A) all three carbon atoms. B) only the carbon atom carrying the OH. C) only the carboxyl carbon atom. D) only the methyl carbon atom. E) the methyl and carboxyl carbon atoms. 2. In an anaerobic muscle preparation, lactate formed from glucose labeled in C-2 would be labeled in: A) all three carbon atoms. B) only the carbon atom carrying the OH. C) only the carboxyl carbon atom. D) only the methyl carbon atom. E) the methyl and carboxyl carbon atoms. 3. All of the following enzymes involved in the flow of carbon from glucose to lactate (glycolysis) are also involved in the reversal of this flow (gluconeogenesis) except: A) 3-phosphoglycerate kinase. B) aldolase. C) enolase. D) phosphofructokinase-1. E) phosphoglucoisomerase. 4. Cellular isozymes of pyruvate kinase are allosterically inhibited by: A) high concentrations of AMP. B) high concentrations of ATP. C) high concentrations of citrate. D) low concentrations of acetyl-CoA. E) low concentrations of ATP. 5. Which of the following is not true of the reaction catalyzed by the pyruvate dehydrogenase complex? A) Biotin participates in the decarboxylation. B) Both NAD+ and a flavin nucleotide act as electron carriers. C) The reaction occurs in the mitochondrial matrix. D) The substrate is held by the lipoyl-lysine "swinging arm." E) Two different cofactors containing -SH groups participate. 6. (20 points) This page is blank because I want you to fill it in with the glycolytic pathway from glucose to pyruvate showing the structure of all intermediates.
    [Show full text]
  • O O2 Enzymes Available from Sigma Enzymes Available from Sigma
    COO 2.7.1.15 Ribokinase OXIDOREDUCTASES CONH2 COO 2.7.1.16 Ribulokinase 1.1.1.1 Alcohol dehydrogenase BLOOD GROUP + O O + O O 1.1.1.3 Homoserine dehydrogenase HYALURONIC ACID DERMATAN ALGINATES O-ANTIGENS STARCH GLYCOGEN CH COO N COO 2.7.1.17 Xylulokinase P GLYCOPROTEINS SUBSTANCES 2 OH N + COO 1.1.1.8 Glycerol-3-phosphate dehydrogenase Ribose -O - P - O - P - O- Adenosine(P) Ribose - O - P - O - P - O -Adenosine NICOTINATE 2.7.1.19 Phosphoribulokinase GANGLIOSIDES PEPTIDO- CH OH CH OH N 1 + COO 1.1.1.9 D-Xylulose reductase 2 2 NH .2.1 2.7.1.24 Dephospho-CoA kinase O CHITIN CHONDROITIN PECTIN INULIN CELLULOSE O O NH O O O O Ribose- P 2.4 N N RP 1.1.1.10 l-Xylulose reductase MUCINS GLYCAN 6.3.5.1 2.7.7.18 2.7.1.25 Adenylylsulfate kinase CH2OH HO Indoleacetate Indoxyl + 1.1.1.14 l-Iditol dehydrogenase L O O O Desamino-NAD Nicotinate- Quinolinate- A 2.7.1.28 Triokinase O O 1.1.1.132 HO (Auxin) NAD(P) 6.3.1.5 2.4.2.19 1.1.1.19 Glucuronate reductase CHOH - 2.4.1.68 CH3 OH OH OH nucleotide 2.7.1.30 Glycerol kinase Y - COO nucleotide 2.7.1.31 Glycerate kinase 1.1.1.21 Aldehyde reductase AcNH CHOH COO 6.3.2.7-10 2.4.1.69 O 1.2.3.7 2.4.2.19 R OPPT OH OH + 1.1.1.22 UDPglucose dehydrogenase 2.4.99.7 HO O OPPU HO 2.7.1.32 Choline kinase S CH2OH 6.3.2.13 OH OPPU CH HO CH2CH(NH3)COO HO CH CH NH HO CH2CH2NHCOCH3 CH O CH CH NHCOCH COO 1.1.1.23 Histidinol dehydrogenase OPC 2.4.1.17 3 2.4.1.29 CH CHO 2 2 2 3 2 2 3 O 2.7.1.33 Pantothenate kinase CH3CH NHAC OH OH OH LACTOSE 2 COO 1.1.1.25 Shikimate dehydrogenase A HO HO OPPG CH OH 2.7.1.34 Pantetheine kinase UDP- TDP-Rhamnose 2 NH NH NH NH N M 2.7.1.36 Mevalonate kinase 1.1.1.27 Lactate dehydrogenase HO COO- GDP- 2.4.1.21 O NH NH 4.1.1.28 2.3.1.5 2.1.1.4 1.1.1.29 Glycerate dehydrogenase C UDP-N-Ac-Muramate Iduronate OH 2.4.1.1 2.4.1.11 HO 5-Hydroxy- 5-Hydroxytryptamine N-Acetyl-serotonin N-Acetyl-5-O-methyl-serotonin Quinolinate 2.7.1.39 Homoserine kinase Mannuronate CH3 etc.
    [Show full text]
  • Phase II of Glycolysis
    BCH 4054 Fall 2000 Chapter 19 Lecture Notes Slide 1 Chapter 19 Glycolysis Slide 2 aka = “also known as” Overview of Glycolysis aka The Embden-Meyerhoff Pathway • First pathway discovered • Common to almost all living cells • Occurs in cytoplasm of Eukaryotes • Overall reaction: + Glucose + 2 NAD + 2 ADP + 2 Pi ¯ 2 Pyruvate + 2 NADH + 2 ATP Slide 3 Glycolysis Overview, con’t. • Ten reactions overall • Same in all cells, but relative rates and regulation varies among species and even between tissues (i.e. liver and muscle). • Intermediates all bound to phosphate • Membrane impermeable • Important in energy conversion to ATP • Occurs in two stages (or phases) Chapter 19, page 1 Slide 4 Phases of Glycolysis • Phase 1 – Preparatory Phase • Glucose converted to equilibrium mixture of triose phosphates • Investment of 2 ATP’s required • Phase 2 – Energy Yielding Phase • Triose phosphates converted to pyruvate • An oxidation step occurs • Yield of 4 ATP’s, two for each triose phosphate Slide 5 Reactions of Glycolysis (Summary) • Overall Pathway (Figure 19.1) • List of Enzymes (Table 19.1a) • Energetics of Reactions (Table 19.1b) • Intermediate structures, first phase • (Figure 19.2) Slide 6 Phosphorylation of Glucose • Energetics: “Driven” by ATP hydrolysis DGo’ kJ/mol glucose + Pi ¾ glucose-6-P + H2O 13.9 ATP + H2O ¾ ADP + P i -30.5 glucose +ATP ¾ glucose-6-P +ADP -16.7 • At Q of cell, DG can be much larger, -33.9 for erythrocytes, for example (Table 19.1b). The reaction is removed from equilibrium. • (Review discussion of phosphate transfer energetics, Table 3.3, pp.67-69) • Remember induced fit mechanism, Figure 15.1.
    [Show full text]
  • Gluconeogenesis Is Essential for Trypanosome Development in The
    Gluconeogenesis is essential for trypanosome development in the tsetse fly vector Marion Wargnies, Eloise Bertiaux, Edern Cahoreau, Nicole Ziebart, Aline Crouzols, Pauline Morand, Marc Biran, Stefan Allmann, Jane Hubert, Oriana Villafraz, et al. To cite this version: Marion Wargnies, Eloise Bertiaux, Edern Cahoreau, Nicole Ziebart, Aline Crouzols, et al.. Gluco- neogenesis is essential for trypanosome development in the tsetse fly vector. PLoS Pathogens, Public Library of Science, 2018, 14 (12), pp.e1007502. 10.1371/journal.ppat.1007502. pasteur-01963538 HAL Id: pasteur-01963538 https://hal-pasteur.archives-ouvertes.fr/pasteur-01963538 Submitted on 21 Dec 2018 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Distributed under a Creative Commons Attribution| 4.0 International License RESEARCH ARTICLE Gluconeogenesis is essential for trypanosome development in the tsetse fly vector 1,2 3 4 5 Marion Wargnies , Eloïse Bertiaux , Edern CahoreauID , Nicole Ziebart , 3 2 2 1,5 4 Aline Crouzols , Pauline MorandID , Marc BiranID , Stefan Allmann , Jane Hubert
    [Show full text]
  • Nonmetabolic Functions of Metabolic Enzymes in Cancer Development Sean Lu and Yugang Wang*
    Lu and Wang Cancer Commun (2018) 38:63 https://doi.org/10.1186/s40880-018-0336-6 Cancer Communications REVIEW Open Access Nonmetabolic functions of metabolic enzymes in cancer development Sean Lu and Yugang Wang* Abstract Metabolism is a fundamental biological process composed of a series of reactions catalyzed by metabolic enzymes. Emerging evidence demonstrates that the aberrant signaling in cancer cells induces nonmetabolic functions of meta- bolic enzymes in many instrumental cellular activities, which involve metabolic enzyme-mediated protein post-trans- lational modifcations, such as phosphorylation, acetylation, and succinylation. In the most well-researched literatures, metabolic enzymes phosphorylate proteins rather than their metabolites as substrates. Some metabolic enzymes have altered subcellular localization, which allows their metabolic products to directly participate in nonmetabolic activities. This review discusses how these fndings have deepened our understanding on enzymes originally classi- fed as metabolic enzymes, by highlighting the nonmetabolic functions of several metabolic enzymes responsible for the development of cancer, and evaluates the potential for targeting these functions in cancer treatment. Keywords: Metabolic enzymes, Function, Protein kinase, Metabolite products, Phosphorylation, Acetylation, Succinylation, Mitochondria Introduction reactions in which they were originally characterized to Metabolism, regulated by metabolic enzymes, supports work on. For instance, several metabolic enzymes use cell
    [Show full text]
  • 1787 Genome-Wide Identification and Characterization of Eukaryotic Protein Kinases Kanhu Charan Das1, Parismita Kalita1, Timir
    [Frontiers in Bioscience, Landmark, 25, 1787-1827, June 1, 2020] Genome-wide identification and characterization of eukaryotic protein kinases Kanhu Charan Das1, Parismita Kalita1, Timir Tripathi1 1Molecular and Structural Biophysics Laboratory, Department of Biochemistry, North-Eastern Hill University, Shillong 793022, India TABLE OF CONTENTS 1. Abstract 2. Introduction 3. Methods 3.1. F. gigantica gene sequence retrieval 3.2. Generation of hidden markov models (HMMs) 3.3. Classification and domain analysis of FgePKs 4. Results 4.1. Identification of kinase-like proteins in F. gigantica genome 4.2. Classification and domain analysis of FgePKs 4.2.1. Ser/Thr kinase group 4.2.1.1. cAMP-dependent protein kinase (AGC) group 4.2.1.1.1. Protein kinase C (PKC) 4.2.1.1.2. Protein kinase A (PKA) 4.2.1.2. Calmodulin kinase (CaMK) group 4.2.1.3. Cyclin-dependent kinase and other close relatives (CMGC) group 4.2.1.3.1. Cyclin dependent kinases (CDK) 4.2.1.3.2. Mitogen activated protein kinases (MAPK) 4.2.1.3.3. Glycogen synthase 3 kinases (GSK3) 4.2.1.3.4. Dual-specificity Tyr regulated kinases (DYRK) 4.2.1.4. Sterile Ser/Thr kinase (STE) group 4.2.1.5. Casein kinase 1 (CK1) group 4.2.2. Tyr kinase group 4.3.3. Hybrid group 4.3.3.1. Tyr kinase-like (TKL) group 4.3.3.2. Others 5. Discussion 6. Acknowledgments 7. References 1. ABSTRACT The tropical liver fluke, Fasciola gigantica is kinases (ePKs) are regulators of cellular a food-borne parasite responsible for the phosphorylation.
    [Show full text]