DOCSLIB.ORG

Nonmetabolic Functions of Metabolic Enzymes in Cancer Development Sean Lu and Yugang Wang*

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Nonmetabolic Functions of Metabolic Enzymes in Cancer Development Sean Lu and Yugang Wang* Lu and Wang Cancer Commun (2018) 38:63 https://doi.org/10.1186/s40880-018-0336-6 Cancer Communications REVIEW Open Access Nonmetabolic functions of metabolic enzymes in cancer development Sean Lu and Yugang Wang* Abstract Metabolism is a fundamental biological process composed of a series of reactions catalyzed by metabolic enzymes. Emerging evidence demonstrates that the aberrant signaling in cancer cells induces nonmetabolic functions of meta- bolic enzymes in many instrumental cellular activities, which involve metabolic enzyme-mediated protein post-trans- lational modifcations, such as phosphorylation, acetylation, and succinylation. In the most well-researched literatures, metabolic enzymes phosphorylate proteins rather than their metabolites as substrates. Some metabolic enzymes have altered subcellular localization, which allows their metabolic products to directly participate in nonmetabolic activities. This review discusses how these fndings have deepened our understanding on enzymes originally classi- fed as metabolic enzymes, by highlighting the nonmetabolic functions of several metabolic enzymes responsible for the development of cancer, and evaluates the potential for targeting these functions in cancer treatment. Keywords: Metabolic enzymes, Function, Protein kinase, Metabolite products, Phosphorylation, Acetylation, Succinylation, Mitochondria Introduction reactions in which they were originally characterized to Metabolism, regulated by metabolic enzymes, supports work on. For instance, several metabolic enzymes use cell growth and proliferation by providing energy for cel- proteins as substrates and function as protein kinases lular activities and synthesizing the molecular building to phosphorylate these protein substrates, thereby regu- blocks for production of amino acids, nucleotides, and lating diverse functions [1]. Second, metabolic enzymes lipids. Metabolic enzymes are responsible for specifc that translocate from their original subcellular compart- chemical reactions on metabolites, which takes place ments to diferent organelles, where their metabolite under strict regulation at specifc subcellular locations products are directly used for protein modifcations or in the metabolic cascades. Metabolic enzymes, such as acting as instrumental regulators for other proteins. For carboxylases, dehydrogenases, lipoxygenases, oxidore- instance, mitochondrial α-ketoglutarate dehydrogenase ductases, kinases, lyses, and transferases carry out a wide (α-KGDH) that translocates to the nucleus and produces range of catalytic activities and are responsible for a vari- succinyl-coenzyme A (CoA), which is used by the histone ety of cellular functions necessary for cellular homeosta- acetyltransferase, lysine acetyltransferase 2A (KAT2A), to sis and survival. succinylate histone H3 [2, 3]. In addition, mitochondrial Recent literatures have determined that some meta- fumarase, when translocated to the nucleus, produces bolic enzymes possess nonmetabolic activities that are fumarate that inhibits lysine demethylase 2B (KDM2B) critical in the development of cancer. Tese nonmetabolic histone demethylase activity and enhances the methyla- activities can be divided into two categories. First, meta- tion of histone H3 and the repair of damaged DNA [4]. bolic enzymes that use non-metabolites as substrates to Tis review summarizes the recent fndings regarding catalyze reactions that are distinct from the metabolic these nonmetabolic functions of metabolic enzymes and highlights the implication of these functions in cancer development. *Correspondence: [email protected] Brain Tumor Center and Department of Neuro‑Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX 77030, USA © The Author(s) 2018. This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creat​iveco​mmons​.org/licen​ses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creat​iveco​mmons​.org/ publi​cdoma​in/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Lu and Wang Cancer Commun (2018) 38:63 Page 2 of 7 Metabolic enzymes function as protein kinases of the cytokinesis process, and proliferation of tumor Protein kinases are critical regulators of intracellular cells [16]. In addition, it has been found that in hepato- signal transduction pathways that mediate various cel- cellular carcinoma (HCC), PKM2 phosphorylates the lular processes in both unicellular and multicellular sterol regulatory element-binding proteins (SREBPs) at organisms. Tey can directly transfer the γ-phosphate Tr59, activates lipid biosynthesis, and promotes the pro- from adenosine triphosphate (ATP) to specifc tyros- liferation of the cancer cells [17]. Apart from its functions ine (Tyr), serine (Ser), threonine (Tr), and histidine in regulating gene expression and cell cycle progression, (His) residues on substrate proteins, thereby altering PKM2 has been demonstrated to phosphorylate serine/ the functions of these substrates. More than 500 protein threonine kinase 1 (AKT1) at Ser202/203 to release it kinases have been identifed in humans, constituting of from the regulatory-associated protein of mTOR (rap- about 1.7% of all human genes [5]. Recent studies have tor), which subsequently promotes hormonal and nutri- demonstrated that several metabolic enzymes, such as ent signaling-independent activation of the mammalian pyruvate kinase M2 (PKM2), phosphoglycerate kinase 1 target of rapamycin complex 1 (mTORC1), to provide (PGK1), ketohexokinase-A (KHK-A), hexokinases (HK), survival and proliferation advantages over normal cell nucleoside diphosphate kinase (NDPK or NDK), and upon stimulus by the epidermal growth factor receptor 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4 (EGFR)-dependent activation of nuclear factor kappa (PFKFB4), have unexpected protein kinase activities and enhancer binding protein (NF-κB) [6, 18]. play signifcant roles in nonmetabolic cellular functions. In response to oxidative stress, PKM2 promotes cell Tese new studies expand the family of protein kinases survival by translocating into the mitochondria, phos- and provide new insights into the integrated regulation of phorylating the apoptosis regulator Bcl2 at Tr69 to sta- cell metabolism and other cellular processes. bilize Bcl2, which blocks its association with Cul3-based E3 ligase to prevent the degradation of Bcl2 and pro- PKM2 motes the resistance of tumor cells against apoptosis [19]. Pyruvate kinase (PK) catalyzes the fnal rate-limiting step Further, as PKM2 can also phosphorylate the synapto- of glycolysis and converts phosphoenolpyruvate (PEP) to some-associated protein 23 (SNAP23) at Ser95, resulting pyruvate by transferring a phosphate group from PEP to in the formation of the soluble N-ethylmaleimide sensi- adenosine diphosphate (ADP), producing ATP. It has four tive factor attachment protein receptors (SNARE) com- isoforms: PKL, PKR, PKM1, and PKM2. PKM2 is highly plex, this demonstrates that PKM2 has contribution in expressed in cancer cells [6]. Besides, although PKM1 has the remodeling of the tumor microenvironments by pro- a higher glycolytic activity than PKM2, only the protein moting tumor cell exosome secretions, which are neces- kinase activity of PKM2 has been described till present. sary for the docking of tumor cells to plasma membranes PKM2 is involved in the regulation of gene expression, [20]. A recent report has shown that in pancreatic ductal mitosis, apoptosis, and other critical cellular activities adenocarcinoma, PKM2 could phosphorylate the ser- that promote aerobic glycolysis and tumor growth [7–9]. ine/threonine protein kinase PAK2 at Ser20, Ser141, and PKM2’s protein kinase activity was initially identifed Ser 192/197 to recruit heat shock protein 90 for increas- from the phosphorylation of histone H3 at Tr11 and ing the stability of the PAK2 protein, thereby promoting that of signal transducer and activator of transcription invasion and metastasis of the pancreatic cancerous cells 3 (STAT3) at Tyr705. In the nucleus, PKM2-mediated [21]. Further, PKM2 was observed to promote genomic histone H3 phosphorylation promotes β-catenin- and instability, an important hallmark of cancer develop- c-Myc-mediated gene expression, which enhances aero- ment and progression due to increased interruption of bic glycolysis and promotes the proliferation of tumor DNA repair, in breast cancer cells breast cancer since cells [10–14]. During mitosis, PKM2 binds to the spindle it was demonstrated that nuclear PKM2 could interact checkpoint protein Bub3 and phosphorylate it at Tyr207 with and directly phosphorylate histone H2AX at Ser139 to enable the interaction of the Bub3–Bub1 complex with under DNA damaged conditions to induce chromosomal kinetochores, which is essential for the mitotic/spindle- aberrations and promote cancer cell proliferation [22]. assembly checkpoint, accurate chromosome segregation, Furthermore, phosphoproteomic studies in yeast and and tumorigenesis [15]. PKM2 also phosphorylates myo- mammalian cells have revealed that hundreds of addi- sin light chain 2 (MLC2) at Tyr118, primes the binding tional proteins, including many protein kinases such as of Rho-associated protein kinase 2 (ROCK2) to
Load more

Recommended publications
  • METACYC ID Description A0AR23 GO:0004842 (Ubiquitin-Protein Ligase
    Electronic Supplementary Material (ESI) for Integrative Biology This journal is © The Royal Society of Chemistry 2012 Heat Stress Responsive Zostera marina Genes, Southern Population (α=0.
    [Show full text]
  • • Glycolysis • Gluconeogenesis • Glycogen Synthesis
    Carbohydrate Metabolism! Wichit Suthammarak – Department of Biochemistry, Faculty of Medicine Siriraj Hospital – Aug 1st and 4th, 2014! • Glycolysis • Gluconeogenesis • Glycogen synthesis • Glycogenolysis • Pentose phosphate pathway • Metabolism of other hexoses Carbohydrate Digestion! Digestive enzymes! Polysaccharides/complex carbohydrates Salivary glands Amylase Pancreas Oligosaccharides/dextrins Dextrinase Membrane-bound Microvilli Brush border Maltose Sucrose Lactose Maltase Sucrase Lactase ‘Disaccharidase’ 2 glucose 1 glucose 1 glucose 1 fructose 1 galactose Lactose Intolerance! Cause & Pathophysiology! Normal lactose digestion Lactose intolerance Lactose Lactose Lactose Glucose Small Intestine Lactase lactase X Galactose Bacteria 1 glucose Large Fermentation 1 galactose Intestine gases, organic acid, Normal stools osmotically Lactase deficiency! active molecules • Primary lactase deficiency: อาการ! genetic defect, การสราง lactase ลด ลงเมออายมากขน, พบมากทสด! ปวดทอง, ถายเหลว, คลนไสอาเจยนภาย • Secondary lactase deficiency: หลงจากรบประทานอาหารทม lactose acquired/transient เชน small bowel เปนปรมาณมาก เชนนม! injury, gastroenteritis, inflammatory bowel disease! Absorption of Hexoses! Site: duodenum! Intestinal lumen Enterocytes Membrane Transporter! Blood SGLT1: sodium-glucose transporter Na+" Na+" •! Presents at the apical membrane ! of enterocytes! SGLT1 Glucose" Glucose" •! Co-transports Na+ and glucose/! Galactose" Galactose" galactose! GLUT2 Fructose" Fructose" GLUT5 GLUT5 •! Transports fructose from the ! intestinal lumen into enterocytes!
    [Show full text]
  • Phosphatidylinositol-3-Kinase in Tomato (Solanum Lycopersicum. L) Fruit and Its Role in Ethylene Signal Transduction and Senescence
    Phosphatidylinositol-3-Kinase in Tomato (Solanum lycopersicum. L) Fruit and Its Role in Ethylene Signal Transduction and Senescence by Mohd Sabri Pak Dek A Thesis presented to The University of Guelph In partial fulfilment of requirements for the degree of Doctor of Philosophy in Plant Agriculture Guelph, Ontario, Canada © Mohd Sabri Pak Dek,June, 2015 ABSTRACT PHOSPHATIDYLINOSITOL-3-KINASE IN TOMATO (SOLANUM LYCOPERSICUM. L) FRUIT AND ITS ROLE IN ETHYLENE SIGNAL TRANSDUCTION AND SENESCENCE Mohd Sabri Pak Dek Co-Advisors: University of Guelph, 2015 Professor G. Paliyath Professor J. Subramanian The ripening process is initiated by ethylene through a signal transduction cascade leads to the expression of ripening-related genes and catabolism of membrane, cell wall, and storage components. One of the minor components in membrane phospholipids is phosphatidylinositol (PI). Phosphatidylinositol-3-kinase (PIK) is an enzyme that phosphorylates PI at the 3-OH position of inositol head group to produce phosphatidylinositol 3-phosphate (PI3P). Phosphorylation of PI may be an early event in the ethylene signal transduction pathway that generates negatively charged domains on the plasma membrane. PI3P domains may potentially serve as a docking site for phospholipase D (PLD) after ethylene stimulation. It is hypothesized that ethylene stimulation may activate PI3K resulting in enhanced level of phosphorylated phosphatidylinositol. However, the properties and function of PI3K is not well understood in plants. In the present study, the effect of PI3K inhibition during tomato fruit ripening was evaluated. This study demonstrated that PI3K activity is required for normal ripening process of the fruit. Inhibition of PI3K activity using wortmannin significantly reduced tomato ripening process.
    [Show full text]
  • Structure-Function Analysis of the Catalytic Domain of the Histidine Kinase Chea
    Loyola University Chicago Loyola eCommons Dissertations Theses and Dissertations 1997 Structure-Function Analysis of the Catalytic Domain of the Histidine Kinase Chea Dolph David Ellefson Loyola University Chicago Follow this and additional works at: https://ecommons.luc.edu/luc_diss Part of the Microbiology Commons Recommended Citation Ellefson, Dolph David, "Structure-Function Analysis of the Catalytic Domain of the Histidine Kinase Chea" (1997). Dissertations. 3425. https://ecommons.luc.edu/luc_diss/3425 This Dissertation is brought to you for free and open access by the Theses and Dissertations at Loyola eCommons. It has been accepted for inclusion in Dissertations by an authorized administrator of Loyola eCommons. For more information, please contact [email protected]. This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 3.0 License. Copyright © 1997 Dolph David Ellefson LOYOLA UNIVERSITY MEDICAL CENTER LIBRARY LOYOLA UNIVERSITY OF CHICAGO STRUCTURE-FUNCTION ANALYSIS OF THE CATALYTIC DOMAIN OF THE HISTIDINE KINASE CHEA A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL IN CANDIDACY FOR THE DEGREE OF DOCTOR OF PHILOSOPHY DEPARTMENT OF MICROBIOLOGY AND IMMUNOLOGY BY DOLPH DAVID ELLEFSON CHICAGO, ILLINOIS MAY, 1997 Copyright by Dolph David Ellefson, 1997 All Rights Reserved ii ACKNOWLEDGEMENTS I would like to thank my director, Dr. Alan J. Wolfe, for his support, advice, and encouragment during the many years in his laboratory. In his laboratory, I was given a rare opportunity to explore a new arena of science and interact with a field of gifted researchers who I would not known otherwise. I would also like to thank the members of my committee, Ors.
    [Show full text]
  • A Thesis Entitled Phor, Phop and Mshc
    A Thesis entitled PhoR, PhoP and MshC: Three essential proteins of Mycobacterium tuberculosis by Erica Loney Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Master of Science Degree in Chemistry __________________________________ Dr. Donald R. Ronning, Committee Chair __________________________________ Dr. John J. Bellizzi, Committee Member __________________________________ Dr. Ronald Viola, Committee Member __________________________________ Dr. Patricia R. Komuniecki, Dean College of Graduate Studies The University of Toledo May 2014 Copyright 2014, Erica Loney This document is copyrighted material. Under copyright law, no parts of this document may be produced without the expressed permission of the author. An Abstract of PhoR, PhoP and MshC: Three essential proteins of Mycobacterium tuberculosis by Erica Loney Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Master of Science Degree in Chemistry The University of Toledo May 2014 The tuberculosis (TB) pandemic is responsible for 1.6 million deaths annually, most of which occur in developing nations. TB is treatable, though patient non- compliance, co-infection with HIV, and the long, 6-9 month treatment regimen have resulted in the emergence of drug-resistant TB. For these reasons, the development of novel anti-tuberculin drugs is essential. Three proteins – PhoR, PhoP, and MshC – of Mycobacterium tuberculosis (M.tb), the causative agent of TB, are the focus of this thesis. The PhoPR two-component system is a phosphorelay system responsible for the virulence of M.tb. The histidine kinase PhoR responds to a yet-unknown environmental stimulus and autophosphorylates a conserved histidine. The phosphate is transferred to an aspartate of the response regulator PhoP, which then forms a head-to-head homodimer and initiates the transcription of 114 virulence genes.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Expression, Purification and Characterisation of Full-Length
    B doi:10.1016/S0022-2836(02)00424-2 available online at http://www.idealibrary.com on w J. Mol. Biol. (2002) 320, 201–213 Expression, Purification and Characterisation of Full-length Histidine Protein Kinase RegB from Rhodobacter sphaeroides Christopher A. Potter1, Alison Ward1, Cedric Laguri2 Michael P. Williamson2, Peter J.F. Henderson1 and Mary K. Phillips-Jones1* 1Division of Microbiology The global redox switch between aerobic and anaerobic growth in School of Biochemistry and Rhodobacter sphaeroides is controlled by the RegA/RegB two-component Molecular Biology, University system, in which RegB is the integral membrane histidine protein kinase, of Leeds, Leeds LS2 9JT, UK and RegA is the cytosolic response regulator. Despite the global regulatory importance of this system and its many homologues, there have been no 2Department of Molecular reported examples to date of heterologous expression of full-length RegB Biology and Biotechnology or any histidine protein kinases. Here, we report the amplified expression University of Sheffield of full-length functional His-tagged RegB in Escherichia coli, its purifi- Sheffield S10 2TN, UK cation, and characterisation of its properties. Both the membrane-bound and purified solubilised RegB protein demonstrate autophosphorylation activity, and the purified protein autophosphorylates at the same rate under both aerobic and anaerobic conditions confirming that an additional regulator is required to control/inhibit autophosphorylation. The intact protein has similar activity to previously characterised soluble forms, but is dephosphorylated more rapidly than the soluble form (half- life ca 30 minutes) demonstrating that the transmembrane segment present in the full-length RegB may be an important regulator of RegB activity.
    [Show full text]
  • Oncorequisite Role of an Aldehyde Dehydrogenase in the Pathogenesis of T-Cell Acute Lymphoblastic Leukemia
    Acute Lymphoblastic Leukemia SUPPLEMENTARY APPENDIX Oncorequisite role of an aldehyde dehydrogenase in the pathogenesis of T-cell acute lymphoblastic leukemia Chujing Zhang, 1 Stella Amanda, 1 Cheng Wang, 2 Tze King Tan, 1 Muhammad Zulfaqar Ali, 1 Wei Zhong Leong, 1 Ley Moy Ng, 1 Shojiro Kitajima, 3 Zhenhua Li, 4 Allen Eng Juh Yeoh, 1,4 Shi Hao Tan 1 and Takaomi Sanda 1,5 1Cancer Science Institute of Singapore, National University of Singapore, Singapore; 2Department of Anatomy, National University of Singapore, Singapore; 3Institute for Advanced Biosciences, Keio University, Tsuruoka, Japan; 4VIVA-NUS CenTRAL, Department of Pedi - atrics, National University of Singapore, Singapore and 5Department of Medicine, Yong Loo Lin School of Medicine, National University of Singapore, Singapore. ©2021 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol. 2019.245639 Received: December 18, 2019. Accepted: May 14, 2020. Pre-published: May 15, 2020. Correspondence: TAKAOMI SANDA - [email protected] Zhang et al Roles of ALDH in T-ALL Supplementary Information Supplementary Materials and Methods Cell culture and reagents All human leukemia cell lines were cultured in RPMI-1640 medium (BioWest) supplemented with 10% FBS (BioWest). 293T cells were maintained in DMEM medium (BioWest) supplemented with 10% FBS and penicillin/streptomycin (Life Technologies). All-trans retinaldehyde was purchased from Sigma-Aldrich. Glucose free and Glutamine free RPMI- 1640 media were purchased from ThermoFisher. Patient derived xenograft (PDX) sample T-ALL patient-derived PDX sample (DFCI15) was kindly provided by Alejandro Gutierrez (Boston Children’s Hospital, Boston). Mouse studies were conducted according to the recommendations from the Institutional Animal Care and Use Committee (IACUC) and all protocols were approved by the Committee at the National University of Singapore (NUS).
    [Show full text]
  • Yeast As a Tool to Understand the Significance of Human Disease
    G C A T T A C G G C A T genes Review Yeast as a Tool to Understand the Significance of Human Disease-Associated Gene Variants Tiziana Cervelli and Alvaro Galli * Yeast Genetics and Genomics Group, Laboratory of Functional Genetics and Genomics, Institute of Clinical Physiology CNR, Via Moruzzi 1, 56125 Pisa, Italy; [email protected] * Correspondence: [email protected] Abstract: At present, the great challenge in human genetics is to provide significance to the growing amount of human disease-associated gene variants identified by next generation DNA sequencing technologies. Increasing evidences suggest that model organisms are of pivotal importance to addressing this issue. Due to its genetic tractability, the yeast Saccharomyces cerevisiae represents a valuable model organism for understanding human genetic variability. In the present review, we show how S. cerevisiae has been used to study variants of genes involved in different diseases and in different pathways, highlighting the versatility of this model organism. Keywords: yeast; Saccharomyces cerevisiae; functional assays; Mendelian disease; cancer; human gene variants 1. Introduction The advent of next generation DNA sequences technologies allows us to identify Citation: Cervelli, T.; Galli, A. Yeast individual genetic variants, and this revolutionized the strategy for discovering the cause as a Tool to Understand the of several genetic and multifactorial diseases. The association between genetic variants Significance of Human and disease risk can potentially overturn our understanding of common disease. The Disease-Associated Gene Variants. discovery of pathways and processes that are causally involved in a disease, so far not Genes 2021, 12, 1303. https:// linked, may open the way towards the development of targeted therapies and prevention doi.org/10.3390/genes12091303 strategies.
    [Show full text]
  • Structures, Functions, and Mechanisms of Filament Forming Enzymes: a Renaissance of Enzyme Filamentation
    Structures, Functions, and Mechanisms of Filament Forming Enzymes: A Renaissance of Enzyme Filamentation A Review By Chad K. Park & Nancy C. Horton Department of Molecular and Cellular Biology University of Arizona Tucson, AZ 85721 N. C. Horton ([email protected], ORCID: 0000-0003-2710-8284) C. K. Park ([email protected], ORCID: 0000-0003-1089-9091) Keywords: Enzyme, Regulation, DNA binding, Nuclease, Run-On Oligomerization, self-association 1 Abstract Filament formation by non-cytoskeletal enzymes has been known for decades, yet only relatively recently has its wide-spread role in enzyme regulation and biology come to be appreciated. This comprehensive review summarizes what is known for each enzyme confirmed to form filamentous structures in vitro, and for the many that are known only to form large self-assemblies within cells. For some enzymes, studies describing both the in vitro filamentous structures and cellular self-assembly formation are also known and described. Special attention is paid to the detailed structures of each type of enzyme filament, as well as the roles the structures play in enzyme regulation and in biology. Where it is known or hypothesized, the advantages conferred by enzyme filamentation are reviewed. Finally, the similarities, differences, and comparison to the SgrAI system are also highlighted. 2 Contents INTRODUCTION…………………………………………………………..4 STRUCTURALLY CHARACTERIZED ENZYME FILAMENTS…….5 Acetyl CoA Carboxylase (ACC)……………………………………………………………………5 Phosphofructokinase (PFK)……………………………………………………………………….6
    [Show full text]
  • Emerging Roles of P53 Family Members in Glucose Metabolism
    International Journal of Molecular Sciences Review Emerging Roles of p53 Family Members in Glucose Metabolism Yoko Itahana and Koji Itahana * Cancer and Stem Cell Biology Program, Duke-NUS Medical School, 8 College Road, Singapore 169857, Singapore; [email protected] * Correspondence: [email protected]; Tel.: +65-6516-2554; Fax: +65-6221-2402 Received: 19 January 2018; Accepted: 22 February 2018; Published: 8 March 2018 Abstract: Glucose is the key source for most organisms to provide energy, as well as the key source for metabolites to generate building blocks in cells. The deregulation of glucose homeostasis occurs in various diseases, including the enhanced aerobic glycolysis that is observed in cancers, and insulin resistance in diabetes. Although p53 is thought to suppress tumorigenesis primarily by inducing cell cycle arrest, apoptosis, and senescence in response to stress, the non-canonical functions of p53 in cellular energy homeostasis and metabolism are also emerging as critical factors for tumor suppression. Increasing evidence suggests that p53 plays a significant role in regulating glucose homeostasis. Furthermore, the p53 family members p63 and p73, as well as gain-of-function p53 mutants, are also involved in glucose metabolism. Indeed, how this protein family regulates cellular energy levels is complicated and difficult to disentangle. This review discusses the roles of the p53 family in multiple metabolic processes, such as glycolysis, gluconeogenesis, aerobic respiration, and autophagy. We also discuss how the dysregulation of the p53 family in these processes leads to diseases such as cancer and diabetes. Elucidating the complexities of the p53 family members in glucose homeostasis will improve our understanding of these diseases.
    [Show full text]
  • 6-Phosphofructo-2-Kinase/Fructose-2
    Published OnlineFirst August 7, 2019; DOI: 10.1158/1078-0432.CCR-18-3448 Translational Cancer Mechanisms and Therapy Clinical Cancer Research 6-Phosphofructo-2-Kinase/Fructose-2,6- Biphosphatase-2 Regulates TP53-Dependent Paclitaxel Sensitivity in Ovarian and Breast Cancers Hailing Yang1, Zhang Shu1,2,Yongying Jiang3, Weiqun Mao1, Lan Pang1, Abena Redwood4, Sabrina L. Jeter-Jones4, Nicholas B. Jennings5, Argentina Ornelas6, Jinhua Zhou1, Cristian Rodriguez-Aguayo1,7, Geoffrey Bartholomeusz1, LaKesla R. Iles1, Niki M. Zacharias8, Steven W. Millward6, Gabriel Lopez-Berestein1,7, Xiao-Feng Le1, Ahmed A. Ahmed9,10, Helen Piwnica-Worms4, Anil K. Sood5,7, Robert C. Bast1, and Zhen Lu1 Abstract Purpose: Paclitaxel is an integral component of primary Results: Knockdown of PFKFB2 inhibited clonogenic therapy for breast and epithelial ovarian cancers, but less than growth and enhanced paclitaxel sensitivity in ovarian and half of these cancers respond to the drug. Enhancing the breast cancer cell lines with wild-type TP53 (wtTP53). response to primary therapy with paclitaxel could improve Silencing PFKFB2 significantly inhibited tumor growth and outcomes for women with both diseases. enhanced paclitaxel sensitivity in four xenografts derived Experimental Design: Twelve kinases that regulate from two ovarian and two breast cancer cell lines, and metabolism were depleted in multiple ovarian and breast prolonged survival in a triple-negative breast cancer PDX. cancer cell lines to determine whether they regulate sensi- Transfection of siPFKFB2 increased the glycolysis rate, but tivity to paclitaxel in Sulforhodamine B assays. The effects decreased the flow of intermediates through the pentose– of 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase phosphate pathway in cancer cells with wtTP53,decreasing 2(PFKFB2) depletion on cell metabolomics, extracellular NADPH.
    [Show full text]