Phosphatidylinositol-3-Kinase in Tomato (Solanum lycopersicum. L) Fruit and Its Role in Ethylene Signal Transduction and Senescence
by
Mohd Sabri Pak Dek
A Thesis presented to The University of Guelph
In partial fulfilment of requirements for the degree of Doctor of Philosophy in Plant Agriculture
Guelph, Ontario, Canada
© Mohd Sabri Pak Dek,June, 2015
ABSTRACT
PHOSPHATIDYLINOSITOL-3-KINASE IN TOMATO (SOLANUM LYCOPERSICUM. L) FRUIT AND ITS ROLE IN ETHYLENE SIGNAL TRANSDUCTION AND SENESCENCE
Mohd Sabri Pak Dek Co-Advisors: University of Guelph, 2015 Professor G. Paliyath Professor J. Subramanian
The ripening process is initiated by ethylene through a signal transduction cascade leads to the expression of ripening-related genes and catabolism of membrane, cell wall, and storage components. One of the minor components in membrane phospholipids is phosphatidylinositol (PI). Phosphatidylinositol-3-kinase (PIK) is an enzyme that phosphorylates PI at the 3-OH position of inositol head group to produce phosphatidylinositol 3-phosphate (PI3P). Phosphorylation of PI may be an early event in the ethylene signal transduction pathway that generates negatively charged domains on the plasma membrane. PI3P domains may potentially serve as a docking site for phospholipase D (PLD) after ethylene stimulation. It is hypothesized that ethylene stimulation may activate PI3K resulting in enhanced level of phosphorylated phosphatidylinositol. However, the properties and function of PI3K is not well understood in plants. In the present study, the effect of PI3K inhibition during tomato fruit ripening was evaluated. This study demonstrated that PI3K activity is required for normal ripening process of the fruit. Inhibition of PI3K activity using wortmannin significantly reduced tomato ripening process. The inhibitory effect of wortmannin was similar in magnitude to that obtained with 1-methylcyclopropene (1-MCP), an ethylene receptor blocker. This observation was further supported by genetic modification of PI3K gene expression in tobacco via stable transformation. PI3K overexpression (OX), and downregulation of
PI3K with short hairpin antisense (sh) constructs, affected ethylene biosynthesis in flowers. PI3K OX resulted in increased levels of ethylene production and accelerated flower senescence. Meanwhile, down regulation of PI3K inhibited ethylene biosynthesis and prolonged the flower shelf life. Subcellular localization by GFP fluorescence in transgenic plants showed that PI3K was preferentially localized at the plasma membrane, nucleolus and inner part of stomata, based on the tissue. Further characterization of PI3K
C2 domain revealed that this protein could bind to all phosphoinositides including PI, and its own phosphorylated products. This suggests that PI3K C2 domain enables the translocation of PI3K from cytosol to plasma membrane, and potentially other endomembranes. In conclusion, PI3K activity is required for fruit ripening, potentially acting via membrane phospholipid catabolism in conjunction with PLD, and releasing the downstream signal transduction process from suppression by CTR.
Key words:
C2 domain. ethylene, phosphatidylinositol 3-kinase, ripening, senescence, signal transduction, tomato
iv
In the name of God and Beloved Prophet Peace and Blessings be Upon Him…
v
ACKNOWLEDGEMENTS
First and foremost, all gratitude goes to the God, who has given me the chance and capability to complete this research.
I would like to express my deepest gratitude to my advisor and my co-advisor,
Professor Gopinadhan Paliyath and Professor Jayasankar Subramanian and for giving me an opportunity to work in their laboratory, their guidance, suggestions, and patience throughout the research. My sincere thank goes to Dr. Sherif Sherif, Dr. Priya
Padmanabhan, and Dinesh Kumar Selvaraj for valuable discussions and providing suggestions during my research. I also extend my gratitude to Professor. Marica Bakovic and Dr. Jim Todd for participating in my PhD advisory committee. Their valuable suggestions and constructive criticisms made my research become smoother and more productive.
To my beloved lab mates, Ramany Paliyath, Valsala Kallidumbil, Dr. Krishnaraj
Tiwari, Dr. Ajila Chandran Matheyambath, Renu Chandrasekaran, Dr. Azizah Misran, and
Dr. Julieta Correa-Betanzo, thanks for all the moments and support that we have shared in the lab as a family. My thanks to all professors in Plant Agriculture Department, in particular, Dr Praveen Saxena, Dr. Katerina Jordan, Dr. Gale Bozzo, Dr. Barry Shelp and
Dr. Manish Raizada for allowing me to work in their labs, and for the valuable help from their staff and students.
My thanks go to my sponsor, Government of Malaysia and Universiti Putra
Malaysia for awarding a scholarship and approving my study leave. My thanks go to others sponsors including Manton Memorial Scholarship and June and Keith Leaver
Scholarship from the OAC, University of Guelph.
Last but not least, to all my family and friends, in particular, my lovely wife Adilah and daughter, Aisyah, my dad and mom, all brothers and sisters, thanks for your love and support. Finally, thanks to everyone who helped me to make this research, a success. vi
TABLE OF CONTENTS
ABSTRACT ii ACKNOWLEDGMENTS v TABLE OF CONTENTS vi LIST OF TABLES xi LIST OF FIGURES xii LIST OF ABBREVIATIONS xviii
PAGE INTRODUCTION xxi
Research Hypothesis xxvii
Research Objectives xxvii
CHAPTER I
LITERATURE REVIEW 1
1.1 Ripening and senescence in fruits 1
1.2 Signal transduction during ripening 3
1.3 Inhibition of ethylene-regulated gene expression during fruit ripening 8
1.4 The function and roles of biomembrane in ripening and senescence 12
1.5 Phosphatidylinositol metabolism in senescence 16
1.6 Mammalian phosphatidylinositol 3-kinase (PI3K) 24
1.7 Phosphatidylinositol 3-kinases (PI3K) in plant growth and development 26
1.8 Structural characterization of plant phosphatidylinositol 3-kinase 29
1.9 Inhibition of phosphatidylinositol 3 kinase by wortmannin 32
CHAPTER II 34 EFFECT OF PHOSPATIDYLINOSITOL 3-KINASE INHIBITION DURING 34 SOLANUM LYCOPERSICUM (TOMATO) RIPENING
2.1 Introduction 34
2.2 Materials and Methods 39 vii
2.2.1 Fruit materials and treatments 39
2.2.2 Measurement of ethylene and respiration rate 40
2.2.3 Firmness 41
2.2.4 Tomato colour index 41
2.2.5 Lycopene 41
2.2.6 Weight loss 42
2.2.7 Real time-polymerase chain analysis 42
2.2.8 Statistical analysis 45
2.3 Results 45
2.3.1 Phosphatidylinositol related gene expression during 45
tomato fruit ripening
2.3.2 Physiological changes in tomatoes during storage 47
2.3.3 Colour index 47
2.3.4 Firmness 50
2.3.5 Ethylene production 50
2.3.6 Respiration 53
2.3.7 Lycopene content 53
2.3.8 Weight loss 56
2.3.9 Quantitative analysis of gene expression by Real-time PCR 56
2.3.10 Expression analysis of genes involved in ethylene biosynthesis 56
2.3.11 Expression analysis of genes involved in ethylene 61
signal transduction
2.3.9.3 Expression analysis of genes involved in 64
carotenoid biosynthesis
2.3.9.4 Expression analysis of genes involved in PI metabolism 67
2.4 Discussion 70 viii
2.4.1 Comparison of physiological changes on tomatoes in 70
response to wortmannin, hexanal and 1-MCP treatments
2.4.2 Genes involved in ethylene biosynthesis and signaling 73
2.4.3 Differences in the expression of genes involved in 74
phospholipid metabolism
2.4.4 Proposed mechanism of inhibition of PI3K mediated 75
inhibition/suppression of ripening and senescence
2.5 Conclusions 77
CHAPTER III 78 MODULATION OF Sl-PHOSPHATIDYLINOSITOL 3-KINASE (Sl-PI3K) 78 ENHANCES ETHYLENE BIOSYNTHESIS AND SENESCENCE IN NICOTIANA TABACUM
3.1 Introduction 78
3.2 Materials and Methods 81
3.2.1 Total RNA extraction and cDNA synthesis 81
3.2.2 Construction of the PI3K overexpression vector 81
and short-hairpin antisense plasmids
3.2.3 Agrobacterium tumefaciens-mediated transformation 83
3.2.4 Triple-response assay 83
3.2.5 Ethylene measurement 84
3.2.6 Extraction and genomic DNA 84
3.2.7 Gene expression analyses 84
3.2.8 Subcellular localization of PI3K 84
3.2.9 Statistical Analyses 85
3.3 Results 85
3.3.1 Cloning of Solanum lycopersicum PI3K cDNA 85 ix
3.3.2 Subcellular localization of PI3K in tobacco seedlings 88
3.3.3 PI3K expression and developmental characteristics of 92
tobacco flowers
3.3.4 Developmental and senescence characteristics of flowers 94
3.3.5 Ethylene production from tobacco flowers 97
3.3.6 Ethylene-related gene expression analysis 99
3.3.7 Triple response in tobacco seedlings 101
3.4 Discussion 101
3.4.1 PI3 Kinases in plants 101
3.4.2 Cloning and characterization of Solanum lycopersicum PI3K 104
3.4.3 PI3K in ethylene signal transduction 105
3.4.4 Subcellular localization of PI3K 108
3.5 Conclusions 112
CHAPTER IV 113 CHARACTERIZATION OF SOLANUM LYCOPERSICUM (TOMATO) 113 PHOSPHATIDYLINOSITOL 3-KINASE C2 DOMAIN
4.1 Introduction 113
4.2 Materials and Methods 118
4.2.1 Total RNA extraction and cDNA synthesis 118
4.2.2 Construction of PI3K C2 domain plasmid 118
4.2.3 Expression and purification of the PI3K C2-His domain 119
4.2.4 PI3K C2 domain binding measurement with phospholipid 120
strip and array
4.2.5 Effect of calcium and pH on PI3K C2 domain conformation 121
changes
x
4.2.6 Transient expression of Sl-PI3K:GFP 122
4.2.7 Conformational analysis of PI3K C2 domain 123
4.2.8 Statistical Analyses 123
4.3 Results 123
4.3.1 Cloning and expression of Sl-PI3K C2 domain 123
4.3.2 Phospholipid binding properties 125
4.3.3 Effect of calcium and pH on lipid binding affinity of the 127
PI3K-C2 domain
4.3.4 Effect of calcium and pH on the Sl-PI3K C2 domain conformation 131
4.3.5 Subcellular localization of Sl-PI3K 131
4.3.6 Structural analysis of Sl-PI3K C2 domain 134
4.4 Discussion 140
4.5 Conclusion 153
CHAPTER V 155
GENERAL CONCLUSION AND FUTURE RECOMMENDATIONS 155
REFERENCES 158
APPENDIX 210
xi
L IST OF TABLES
Table 2.1. List of primers for real time PCR amplification 43
Table 3.1. List of primers for cloning and real time PCR amplification 82
xii
LIST OF FIGURES
Figure 1.1. The schematic pathway for ethylene biosynthesis in plants. 4
Figure 1.2. The schematic pathways for phosphatidylinositiol metabolism in 19 mammalian and plant systems.
Figure 1.3. A phylogenetic tree of phosphatidylinositol 3-kinase (PI3K) C2 28 domains of angiospermous species.
Figure 1.4. The amino acid sequence alignment for C2 domain of plant 30 phosphatidylinositiol 3-kinase (PI3K).
Figure 2.1. Gene expression analyses of several genes involved in PI 46 metabolism in cherry tomato fruit (cultivar Sweeties) at different maturity stages.
Figure 2.2. Colour changes in tomato fruits subjected to various treatments 48 and analyzed on day 1, 3, 6 and 10.
Figure 2.3. Colour index (CI) of control, wortmannin (0.5 μM), hexanal (1%) 49 and 1-MCP (10 ppm) treated tomatoes during storage at room temperature.
Figure β.4. Firmness (g/mm) of control, wortmannin (0.5 μM), hexanal (1%) and 51
1-MCP (10 ppm) treated tomatoes during storage at room temperature.
Figure β.5. Ethylene production of control, wortmannin (0.5 μM), hexanal (1%) 52 xiii and 1-MCP (10 ppm) treated tomatoes during storage at room temperature.
Figure 2.6. Carbon dioxide production by control, wortmannin (0.5 μM), 54 hexanal (1%) and 1-MCP (10 ppm) treated tomatoes during storage.
Figure β.7. Lycopene content of control, wortmannin (0.5 μM), hexanal (1%) 55 and 1-MCP (10 ppm) treated tomatoes during storage at room temperature.
Figure β.8. Weight loss in control, wortmannin (0.5 μM), hexanal (1%) and 58
1-MCP (10 ppm) treated tomatoes during storage at room temperature.
Figure β.9. Effect of wortmannin treatment (0.5 μM) on gene expression 59 analyses for ethylene-related biosynthesis enzymes.
Figure 2.10. Effect of hexanal (1%) and 1-MCP (10 ppm) treatments on 60 gene expression of ethylene related biosynthesis enzymes as compared with control.
Figure β.11. Effect of wortmannin treatment (0.5 μM) on gene expression 62 for ethylene signal transduction-related genes.
Figure 2.12. Effect of hexanal (1%) and 1-MCP (10 ppm) treatments on 63 gene expression of ethylene signal transduction genes.
Figure 2.13. Effect of wortmannin (0.5 μM) treatment on the gene expression of 65 genes involved in pigment development during storage as compared with control. xiv
Figure 2.14. Effect of hexanal (1%) and 1-MCP (10 ppm) treatments on gene 66 expression for enzymes involved in pigment development during storage.
Figure 2.15. Effect of wortmannin treatment (0.5 μM) on gene expression 68 analysis of phosphatidylinositol-related biosynthetic enzymes and plasma membrane lipid degrading enzymes in tomato during storage.
Figure 2.16. Effect of hexanal (1%) and 1-MCP (10 ppm) treatments on gene 69 expression analyses for phosphatidylinositol-related biosynthetic enzymes and plasma membrane lipid degrading enzymes during storage.
Figure 3.1. (A) Protein sequence alignment between S. lycopersicum PI3K and 86
Nicotiana tabacum PI3K using ClustalW2. (B) Domain analysis of PI metabolism related enzymes.
Figure 3.2. Molecular characterization of transgenic tobacco plants. 89
Figure 3.3. Subcellular localization of phosphatidylinositol 3-kinase 90
(PI3K-GFP) in Nicotiana tabacum seedlings.
Figure 3.4. Changes in flower development of different transgenic lines. 93
Figure 3.5. Changes on the fruit and pollen characteristics of different 95 transgenic lines.
Figure 3.6A. Corolla petal of flowers of Nicotiana tabacum (WT) at different 96 xv developmental stages on the plant.
Figure 3.6B. Changes in Nicotiana tabacum flowers physiology stage 5 after 96 detaching from the plant.
Figure 3.7. Temporal changes in ethylene production by Nicotiana tabacum 98 flowers from WT and different transgenic lines.
Figure 3.8. Gene expression analyses of Nicotiana tabacum (Nt) flowers 100 from different tobacco lines during 0 hour and 48 hours.
Figure 3.9.Triple response phenotype of Nicotiana tabacum seedlings 102 at different condition.
Figure 3.10. A proposed model for the interaction between phosphatidylinositol 110
3-kinase (PI3K) and ethylene biosynthesis.
Figure 4.1. Structural analysis for plant/yeast phosphatidylinositol 3-kinase (PI3K) 115 as compared with mammalian PI3K.
Figure 4.2. SDS-Page and Western Blot of chimeric phosphatidylinositol 3-kinase 124
C2 domain protein.
Figure 4.3A. Binding affinity of phosphatidylinositol 3-kinase C2 domain to 126 various immobilized membrane lipids on PIP Strips (100 pmol).
xvi
Figure 4.3B. Binding affinity of phosphatidylinositol 3-kinase C2 domain to 128 various immobilized phosphoinositides at different concentration of on PIP
Arrays (100 to 1.16 pmol).
Figure 4.4A. Calcium induced binding characteristics of phosphatidylinositol 129
3-kinase (PI3K) C2 domain with phosphatidylinositol (PI).
Figure 4.4B. pH induced binding characteristics of phosphatidylinositol 130
3-kinase (PI3K) C2 domain with phosphatidylinositol (PI).
Figure 4.5A. Calcium induced conformational changes of phosphatidylinositol 132
3-kinase (PI3K) C2 domain as measured from tryptophan fluorescence.
Figure 4.5B. pH induced conformational changes of phosphatidylinositol 133
3-kinase (PI3K) C2 domain as measured from tryptophan fluorescence.
Figure 4.6. Localization of Sl-PI3K-C2 in onion epidermis. 135
Figure 4.7A. Predicted topology of Solanum lycopersicum phosphatidylinositol 136
3-kinase (Sl-PI3K) C2 domains.
Figure 4.7B. Amino acid sequence alignment of phosphatidylinositol 137
3-kinase (PI3K) C2 domains from several plant species using ClustalW.
Figure 4.8. Comparison Solanum lycopersicum phosphatidylinositol 3-kinase 139
(Sl-PI3K) C2 domain with established protein. xvii
Figure 4.9. Domain characteristic of Solanum lycopersicum phosphatidylinositol 141
3-kinase (Sl-PI3K) C2 domain.
Figure 4.10. Predicted three dimension (3D) structure of full sequence of 142
Solanum lycopersicum phosphatidylinositol 3-kinase (Sl-PI3K).
Figure 4.11. Schematic diagram of PI3K function in signal transduction. 154
xviii
ABBREVIATION
1-MCP = 1-Methylcyclopropene
3D = Three dimension
ABA = Abscisic acid
ABA = Abscisic acid
ACC= 1-Aminocyclopropane-1-carboxylicacid
ACO = 1-Aminocyclopropane-1-carboxylate oxidase
ACS = 1-Aminocyclopropane-1-carboxylate synthase
AdoMet = S-Adenosylmethionine
AVG = Aminoethoxyvinylglycine
CBR = Calcium binding region
CRTISO = Carotenoid isomerase
CTR1 = Constitutive triple response 1
CV = Column volume cv = Cultivar
DG = Diacylglycerol
DGK = Diacylglycerol kinase
DXS =1-Deoxy-D-xylulose-5-phosphate synthase
EFR = Ethylene response factor
EIN = Ethylene Insensitive
ER = Endoplasmic reticulum
ETR = Ethylene Receptor Homolog
FRA = Fragile fiber
GGPS = Geranylgeranyl pyrophosphate synthase xix
HEAT = Huntingtin, elongation factor 3, the PR65/A subunit of protein phosphatase 2A and the lipid kinase Tor
IC50 = Concentration for fifty percent Inhibition
IP3= Inositol-1,4,5-trisphosphate
MADFTF = MADS-box transcription factor
Met = Methionine
MG = Mature green mg/mL = Milligram / mililiter
NR = Never ripe
OR = Orange
OX = Overexpression
PA = Phosphatidic acid
PC = Phosphatidylcholine
PE = Phosphatidylethanolamine
PH = Pleckstrin homolog
PI = Phosphatidylinositol
PI2,4,5P3= Phosphatidylinositol 1,4,5-trisphosphate
PI3K = Phosphatidylinositol 3-kinase
PI3P = Phosphatidylinositol 3-monophosphate
PI4,5P2= Phosphatidylinositol 4,5-bisphosphate
PI4K = Phoshatidylinositol 4-kinase
PI4P = Phosphatidylinositol 4-monophosphate
PI4P5K = Phosphatidylinositol 4-phosphate 5-kinase
PIKs = PIKinases
PIP = Phosphatidylinositol phosphate
PIP2= Phosphatidylinositol bisphosphate xx
PLA = Phospholipase A
PLC = Phospholipase C
PLD = Phospholipase D
PP2A = Protein phosphatase-2A
PS = Phosphatidylserine
PSY = Phytoene synthase
PTEN = Phosphatase and tensin homolog
PX = Phox homology qRT-PCR = Quantitative real time-polymerase chain reaction
RBD = Ras binding domain
SAC = Suppressor of actin
SAM = S-Adenosyl methionine
SDS-PAGE = Sodium dodecyl sulfate-polyacrylamide gel electrophoresis sh = Short hairpin antisense
STS = Silver thiosulfate
TCI =Tomato colour index
TO =Turning orange
Vps = Vacuolar protein sorting
xxi
INTRODUCTION
Fruits and vegetables have gained significant attention among consumers, especially after several epidemiological surveys have demonstrated that increased intake of fruits and vegetables has an inverse correlation with the risk of getting several diseases
(Dauchet et al., 2006; He et al., 2007). Data analysis from human epidemiologic and animal studies concluded that the consumption of vegetables and fruits reduced the risk of developing cancers affecting several organs such as stomach, esophagus, lung, pancreas, and colon. Increased fruit and vegetable consumption has also been found to reduce the risk of developing other chronic degenerative diseases including cardiovascular diseases, diabetes, stroke, obesity, and neurodegenerative diseases
(Steinmetz and Potter, 1996). Health-protective effects of fruits and vegetables are mainly due to their phytochemical nutrients that are usually denoted as bioactive compounds with functional properties. Secondary plant products such as flavonoids, vitamins (Arisz et al., 2009), dietary fiber, carotenoids and sulfur showed various protective effects mainly as antioxidant, anti-inflammatory, and anti-cancer agents (Kris-Etherton et al., 2002).
The increase in awareness on the importance of fruit and vegetable intake has become a determining feature in the consumer behavior. Individual total fresh fruit intake increased annually, from 33.6 kg per person in 2001 to 39.3 kg per person in 2009. Fruits including apple, blueberry, strawberry, avocado, cranberry and cherry which are locally grown, or imported from other countries, always have a high market demand (Statistics
Canada, 2003). However, Canada still has to imports fruits such as grapes, strawberries, citrus fruit and banana in order to cater market demand. In 2009, the imbalance between the market value of exported and imported fruits resulted in a trade deficit of nearly $5.8 billion (Statistics Canada, 2003). xxii
Therefore, several strategies have been identified in order to maximize the production of fruit yield. The first strategy is to maintain the quality of fruits produced in
Canada by planting new cultivars with consumer demand, integrated pesticide management, ideal planting system, optimal nutrient or fertilizer to enable longer shelf life as well as identification of optimum harvesting time for higher quality fruit (Reganold et al., β001; Kader, β005; Kitinoja et al., β011). Another strategy is by maintaining the fruit’s quality during storage through appropriate technologies. Storage under low temperature, or/and CA storage facilities (Gorny et al., 1999) can prolong shelf life of fruits (Kader et al., 1989). Other technologies such the use of 1-methylcyclopropene (1-MCP), phospholipase D inhibition technology using hexanal, etc. have been successfully used to enhance shelf life of fruits by modulating the levels of gene expression and enzyme activities that are responsible for fruit deterioration (Serek et al., 1995; Sisler and Serek,
1997; Sharma et al., 2010; Tiwari and Paliyath, 2011a).
Ripening is a natural process occurs in the fruit and indicates the initiation of cell senescence. It causes physiological and biochemical changes in the fruit. Softening of fruits, loss of chlorophyll, accumulation of carotenoids, development of flavour and aroma etc., are important changes that denote the development of quality characteristics in tomato. However, ripening also makes the fruit susceptible to pathogen invasion resulting in shorter shelf life (Giovannoni, 2004).
Biochemical changes during ripening involve ethylene and respiratory bursts, especially for climacteric fruits (Giovannoni, 2004). Ethylene is biosynthesized from the amino acid; S-adenosyl-L-methionine via 1-aminocyclopropane-1-carboxylic acid (ACC) catalyzed by ACC synthase (ACS) and ACC-oxidase (ACO). Ethylene is perceived by several ethylene receptors such as ETR1, ERS1, EIN4, ETR2 and ERS2 (Hua et al.,
1989). A signal transduction sequence involving several proteins and enzymes enables the downstream signal transduction causing physiological changes that occur during fruit xxiii ripening. Some of these intermediaries are thought to include several MAP-kinases, a key member of these has been denoted as the Constitutive Triple Response 1 (CTR1).
Ethylene signal transduction involves negative regulation. In the absence of ethylene, the receptors continuously suppress downstream signal transduction through CTR1, preventing gene expression. Once the receptors are activated by ethylene, CTR1 becomes inactivated and the downstream suppression of signal transduction is broken.
Activation of a downstream membrane bound protein denoted as EIN2 and several transcription factors further leads to the increase in gene expression and associated physiological and biochemical changes of fruit (Alonso et al., 1999; Ma et al., 2005;
Testerink and Munnik, 2005).
Deterioration of membrane structure and function is a key event initiated after ethylene stimulation, and results in the loss of enzyme function critical to ion compartmentalization such as Ca2+ATPase and H+ATPase (Paliyath and Thompson,
1987). With advancing senescence, membrane compartmentalization is lost and this results in the ultimate senescence of the fruit. Enzymes that mediate the degradation of membrane lipids through a catabolic cascade include phospholipase D (PLD), phosphatidate phosphatase, lipolytic acyl hydrolase and lipoxygenase, which act in tandem, generating a variety of products leading to the destabilization of membrane
(Paliyath and Thompson, 1987). A transition from a predominantly fluid phase to a gel phase, decrease in membrane lipid fluidity, increase in phase transition temperature, increase in sterol content etc. are physical changes associated with senescence (Paliyath and Droillard, 1992).
Despite the availability of detailed information on membrane lipid degradation, the precise link between ethylene receptor activation and initiation of membrane lipid degradation has remained unknown. Cloning several genes encoding PLD enabled the understanding of PLD function in several biological processes. Such studies indicate that xxiv
PLD action is involved in plant responses to biotic and abiotic stresses such as drought, cold, freezing, salt tolerance, pathogen infection etc. PLD activity was also shown to be involved in root hair patterning and programmed cell death, a form of senescence (Wang,
2005). Primary and secondary structure analysis of the PLDs provided further clues into the mode of action of PLDs. The PLD family consists of many heterogeneous enzymes with distinct biochemical, regulatory, and structural properties. The A. thaliana PLD gene family contains 12 genes, which is more complex than in others such as yeast and mammals, where only one and two genes respectively, were identified (Wang, 2002). In general, PLDs can be divided into two subfamilies based on their protein domain, those possessing a C2 domain (C2-PLD) and those having phox homology-pleckstrin homology
(PX-PH PLD). PLDs are cytosolic enzymes, and their membrane translocation occurs in response to an external stimulus (eg. Hormone, stress) that normally results in the elevation of cytosolic calcium from below micromolar levels to above micromolar levels.
An N-terminal C2 domain is present in ten out of twelve Arabidopsis PLDs. The rest include PLDs with PX-PH domains that are involved in phosphoinositide-interaction, as occur in Arabidopsis PLDs and mammalian PLDs (Eliaset al., 2002; Qin and Wang,
2002).
In contrast to Arabidopsis PLDs, PLDs in fruits showed several features that are quite distinct, both in terms of structure and function. Arabidopsis PLDs are classified into several isoforms, predominantly α, , and δ, based on their calcium stimulation, and cofactor requirements. The predominant α form was stimulated at millimolar levels of calcium in Arabidopsis. In fruits, a PLD α1, and αβ were identified and were stimulated at physiologically activated micromolar levels of calcium, and the latter stimulated at millimolar levels of calcium. Thus, it has become apparent that an elevation of cytosolic calcium to micromolar levels could enable the membrane translocation of some PLDs where it can initiate phospholipid degradation. Though tomato PLD C2 could bind calcium xxv at micromolar levels, and its binding to phosphoinositides was enhanced by calcium, it could bind to phosphatidic acid vesicles even in the absence of calcium with very high affinity (Tiwari and Paliyath, 2011b). Phosphatidic acid is a product of PLD action, and the question arose as to how PLD could bind to the membrane and generate PA. This observation also suggested that as the PA domains in the membrane increases, more and more PLD will bind to the membrane, perhaps initiating an autocatalytic cascade of membrane degradation. Thus, it appeared that generation of negatively charged domains in the membrane (such as that induced by PA) could be the driving force behind the initiation of PLD binding to the membrane. This may happen by increasing the phosphoinositide content in the membrane. Most of the acidic phospholipids in plasma membrane are synthesized via phosphatidylinositol (PI) metabolism.
PI is a negatively charged phospholipid and constitute around 15-20 % of total phospholipids (Drobak, 1993). Therefore, synthesis of PI and its phosphate derivatives such as phosphatidylinositol phosphate (PIP), phosphatidylinositol bisphosphate (PIP2) and phosphatidylinositol trisphosphate (PIP3) by kinases can lead to the formation of negatively charged domains in the membrane (Sasaki et al., 2009). The synthesis of these phospholipids in inner leaflet of the plasma membrane could create negatively charged docking sites that may serve as anchoring sites for PLD and phospholipase C
(PLC) during signal transduction due to high affinity of C2 domain and plextrin homology domain to these phospholipids (Payrastre et al., 2001; Tiwari and Paliyath, 2011b).
Phosphatidylinositol-3-kinase (PI3K) is an enzyme that is involved in the phosphorylation of PI in plasma membrane. PI3K uses PI as a substrate to synthesize phosphatidylinositol 3-phosphate (PI3P) which can be subsequently phosphorylated by specific kinase enzymes into phosphatidylinositol -3,4-diphosphate (PI3,4P2), phosphatidylinositol -3,4,5-triphosphate (PI3,4,5P3) and phosphatidylinositol -4,5- diphosphate (PI4,5P2). Hydrolysis of PI4,5P2 by PLC activity as occur in mammalian xxvi
systems generates diacylglycerol (DG) and inositol triphosphate (IP3), which can lead to icreased phosphatidic acid (PA) synthesis by DG Kinase and elevated level of calcium
2+ 2+ ion (Ca ) in cytosol, by the activation of Ca channels on ER by IP3, respectively
(Payrastre et al., 2001). Catabolism of phosphoinositides by PLD directly results in the formation of PA. Besides PIK activity, earlier study have hypothesized that the ethylene receptor stimulation may be mediated through phosphorylation of phosphatidylinositol and this may serve as anchoring site for PLD alpha 1 (Pinhero et al., 2003). Therefore, ethylene stimulation of PI catabolism which changes the composition of membrane phospholipids appeared to be a significant avenue worthy further investigation. The synthesis of negatively charged phospholipids may initiate the binding of lipolytic enzymes such as PLD and PLC to the plasma membrane and this can be considered an early event in fruit ripening.
Recently, interesting information has provided evidence that links ethylene receptor activation and release of the CTR1 inhibition through PA, a known signaling molecule (Testerink and Munnik, 2011). PA has been identified as a new class of lipid mediators in cellular signaling, including phosphorylation and dephosphorylation of proteins and lipids (Wang, 2005). PA that accumulated within minutes in response to biotic or abiotic stresses and showed its potential function as mediators of stress in response to environmental cues, and this could accelerate cell senescence (Testerink and Munnik, 2006). In controlled environments without ethylene, accumulation of PA in
Arabidopsis suspension cells showed downstream effects similar to those usually observed after ethylene exposure (Testerink et al., 2008). The results suggested that PA may deactivate CTR1, thus relieving the suppression on downstream components such as EIN2 and activation of gene expression. This suggests that PA generated during early stages of ethylene action may involve the sequence-“ethylene binding to receptor, activation of PI3K and generation of negatively charged domains, binding of PLD to these xxvii domains, generation of PA, inactivation of CTR, and activation of downstream gene expression”. In this study we have analyzed the role of PI3K in these processes through various approaches.
1.1 Research hypotheses.
It is proposed that ethylene stimulation activates PIKinases (PIKs), resulting in enhanced levels of phosphorylated phosphatidylinositols. The changes in phosphatidylinositol metabolism may be considered as an early event of fruit ripening since it can provide negatively charged docking domains for PLD and initiating plasma membrane degradation. It is hypothesized that modulation of PI3K function in plants may affect their pattern of senescence. Therefore, upregulation of PI3K function should enhance the senescence and its downregulation should delay the senescence. The C2 domain of
PI3K is anticipated to have structural features that would enable its binding to PI.
1.2 The objectives of the study were:
To address the above hypothesis, I plan to study the characteristics of PI3K in tomato fruits. PI3K and its C2 domain will be cloned separately in bacterial system. The upregulation or downregulation of PI3K will be achieved by transformation of tobacco plants for overexpression and antisense suppression of PI3K, and monitoring the senescence pattern of flowers. Structural and functional characteristics of Sl-PI3K C2 domain will be conducted by expression the protein in E.coli and determining various properties. In vivo activity of PI3K will be inhibited by wortmannin, a specific inhibitor of
PI3K, and following the ripening characteristics of tomato fruits.
xxviii
1. To characterize of phosphatidylinositol metabolism in tomato fruit at various developmental stages. The effect of PI3K inhibitor such as wortmannin on tomato fruit ripening will substantiate the role of PI3K in ethylene signal transduction pathway.
2. To study the effect of genetic modification of PI3K using overexpression (OX) and short hairpin antisense (sh) suppression in regulating ethylene biosynthesis and senescence.
3. To characterize the C2 domain of PI3K and its physicochemical properties. The full sequence of PI3K C2 domain was cloned and purified. The binding property with numerous potential target phospholipids was analyzed.
CHAPTER I
LITERATURE REVIEW
1.1 Ripening and senescence in fruits
Ripening is a natural stage of fruit development. It is a complex process with a series of quantitative and qualitative changes in compositional characteristics of the fruit. It can be considered as a transition process from physiological maturity to natural senescence through the ripening process. Ripening occurs to facilitate the dispersal of seeds by preparing the seed-bearing organs to be dispersed by various methods.
Tomato fruit ripening involves a series of biochemical and physiological transformations which include change in skin colour, softening of the fruit, development of aroma, sugar, organic acids, pigments, and degradation of chlorophyll
(Davies, 1966). Prominent physiological changes of tomato ripening include an increase in respiration rate and ethylene production (Cano et al., 2003).
Physiologically mature fruits usually have a variety of molecular ingredientssuch as carbohydrates, proteins, lipids and organic acids as storage material. After detachment from the plant, the fruit continues to live without support from the plant for water and nutrients. Therefore, fruit will utilize the storage complexes in order to remain metabolically active.
The ripening process also changes the function of the tissue metabolism in order to attract other organisms which later will assist in seed release and dispersal process (Adams-Phillips et al., 2004a). Ripening is a final stage of fruit development before senescence (Watada et al. 1984).
Based on their ripening characteristics, fruits can be divided into two groups, either as climacteric or as non-climacteric. For climacteric fruit, ripening is accompanied by a peak in respiration and a concomitant burst of ethylene production
1 towards the final stage of ripening. By contrast, for non-climacteric fruit, the respiration process increases gradually with time, and ethylene production remains at low levels without a burst (Alexander and Grierson, 2002).
Usually climacteric fruit produces relatively high amounts of ethylene as compared with non-climacteric fruits. However, the internal ethylene biosynthesis process varies among the fruit. An increase in ethylene concentration triggers biochemical and physiological transformations during fruit ripening. For climacteric fruit, an initial biosynthesis of ethylene generally induces more ethylene production via an ‘autocatalytic’ process (Alexander and Grierson, 2002)
During ripening, ethylene accelerates several biochemical changes in the fruit including conversion of starch to sugars, accumulation of acidic amino acids which lead to changes in pH, lipid degradation to develop aroma and volatiles, degradation of chlorophyll in parallel with pigment synthesis that changes the skin colour, and degradation of cell wall that causes tissue softening (Gray et al., 1994). On the contrary, exposing non-climacteric fruits to ethylene only transiently increases the rate of respiration and the ripening process. In fruits, respiration rate can be used as an indicator for fruit ripening (Lelièvre et al., 1997). Respiration is a chemical reaction that involves multiple enzymes in the fruit (Kader and Mitchell, 1989).
One of the differences between animal and plant cell is the presence of a cell wall, a macromolecular entity biosynthesized from multiple polysaccharides, generally categorized into pectin and cellulose. During fruit ripening, most of the pectin is converted from a water-insoluble form to a water soluble form by enzymatic reactions involving enzymes such as pectin methylesterase and polygalacturonase (Prasanna et al., 2007). As a result, the fruit attains a soft texture. Other enzymes such as alpha and beta amylases catabolise starch during fruit ripening into shorter water soluble molecules such as fructose, glucose and sucrose (Medlicott and Thompson, 1985).
This gives a sweet taste to the ripened fruit and in some cases leads to fruit softening as in banana.
2 1.2 Signal transduction during ripening
In the last decade, ethylene biosynthesis and its mode of action has been a main focus of study in plants, including the its role of ethylene in fruit ripening. Ethylene biosynthesis, its biochemical and molecular regulation, and roles in developmental processes are well studied (Yang and Hoffman, 1984). Ethylene biosynthesis is initiated from the amino acid methionine (Met) which is converted to S- adenosylmethionine (SAM) by SAM synthase. SAM is converted to 1- aminocyclopropane-1-carboxylic acid (ACC) by ACC synthase (ACS). ACC is converted to ethylene by ACC oxidase (ACO) in the presence of oxygen as shown in
Figure 1.1.
During senescence, the expression levels of several senescence-related genes are known to be modulated by ethylene (Lawton et al., 1990). ACS activity is the control point for ethylene biosynthesis in climacteric fruits. Interestingly, there are two types of ACS gene expression in climacteric fruits that control ethylene biosynthesis. System I occurs at low levels throughout the plant growth and System II is expressed much higher during ripening process. Ethylene biosynthesis that occurs at a low and a basal level during fruit development prior to ripening is known as
System I.
Ethylene production from System I is involved in normal plant growth and development. Examples of ACS homologs for System I are Le-ACS1A and Le-ACS6.
System I allows ethylene biosynthesis to occur, but with auto-inhibition properties.
Therefore, ethylene will be produced at basal levels for both climacteric and non- climacteric fruits (Barry and Giovannoni, 2007).
Meanwhile System II is a process where the ACS gene expression rapidly increases during ripening and involves autocatalytic stimulation to produce more ethylene. Fruit and flower petals usually display System II ethylene biosynthesis after the initiation of senescence and this usually begins in localized areas of the organ,
3
Figure 1.1. The schematic pathway for ethylene biosynthesis in plants. Ethylene biosynthesis is controlled by the activity of (1-aminocyclopropane-1-carboxylic acid)
ACC synthase (ACS) and ACC oxidase (ACO). Amino acid methionine is converted into S-adenosylmethionine (AdoMet) by Adomet synthetase in the presence of adenosine triphosphate (ATP). SAM is a substrate for ACS to produce ACC. ACO oxidizes ACC into ethylene in the presence of oxygen. Adapted from Arc et al. (2013).
4 which is probably the most mature, before spreading to the whole organ (Alexander and Grierson, 2002). ACS genes such as Le-ACS1A, Le-ACS2 and Le-ACS4 are among the ACS homologs that are involved in System II (Barry and Giovannoni,
2007). When climacteric tomato fruit reaches the ripening stage, ethylene production shifts from System I to System II resulting System II allows significantly higher ethylene production via autocatalytic regulation and accelerates the ripening process
(Barry et al., 2000).
Studies involving genetic regulation provide more information on the roles and regulation of ACS and ACO in ethylene biosynthesis. Expression of bacterial ACC deaminase which reduces the accumulation of ACC in tomato delayed the ripening process (Barry and Giovannoni 2007). Ripening and senescence patterns show that ethylene operates as a modulator to synchronize multiple processes including colour development, fruit softening, accumulation of sugars and organic acids, and the production of volatiles and aroma components (Johnston et al., 2009).
Ripening also requires the activation of ethylene perception. There are several types of ethylene receptors identified in plants. Examples of ethylene receptor proteins include Ethylene Receptor (ETR), Ethylene Response Sensor (ERS) and
Ethylene Insensitive (EIN) (Chang et al., 1993; Wang et al., 2002; Liu et al., 2010a).
Some of these receptor proteins exist as isoforms. ETR1 functions during early ethylene signal transduction in plants and involves in a phosphorylation process similar to prokaryotic two-component system (Chang et al., 1993). The etr1-1 mutant of Arabidopsis thaliana was insensitive towards ethylene (Chang et al., 1993). ERS1 is another protein receptor involved in regulating ethylene responses in an ETR1- dependent manner (Liu et al., 2010a). EIN4 and ERS2 are closely related to ETR2.
Both ein4 and ers2 mutants are ethylene insensitive and double mutants show similar ethylene response with other ethylene receptor proteins (Hua et al., 1998). The entire ethylene receptor proteins are involved in perception upstream of the CTR1 function.
5 Ethylene receptors can be divided into two subfamilies according to amino acid sequence alignment. Both subfamilies have an N-terminal transmembrane ethylene-binding domain and C-terminal histidine kinase domain. However, certain subfamily 2 has an extra N-terminal transmembrane domain (Bleecker et al., 1988).
Currently in Arabidopsis, there are five ethylene receptors identified, that showsimilar structural and functional organization. The subfamily 1 ethylene receptors include
ETR1 and ERS1. ETR1 has only histidine kinase activity. Meanwhile ERS1 has both histidine kinase activity and serine-threonine kinase activity.
Meanwhile the subfamily 2 of ethylene receptors include ETR2, ERS2 and
EIN4. All subfamily 2 ethylene receptors have only serine-threonine kinase activity
(Binder, 2008). CTR1 is a protein that that has mitogen-activated protein kinase kinase (MAPKK) activity in the plant system. CTR1 has a stronger physical interaction with all subfamily I receptors including ETR1 and ERS1 as compared with subfamily
II, suggests that subfamily I receptor proteins may play a major role during ethylene perception (Clark et al., 1998; Cancel and Larsen, 2002). CTR1 suppresses downstream signal transduction by direct phosphorylation of intermediary proteins such as EIN2 (Gao et al., 2003). In the absence of ethylene, CTR1 exists in an active form bound to the ethylene receptor, and naturally suppresses ethylene downstream responses. The suppression inhibits ethylene-stimulated gene expression. Upon the binding of ethylene to its receptors, conformational changes in the receptors facilitate the dissociation of CTR1 deactivating the CTR and releasing the downstream pathway from suppression. Deactivated CTR1 is unable to suppress downstream activity of EIN2. The active EIN2 protein stimulates ethylene related gene expression.
Current information of the subcellular localization suggests that all ethylene receptors are localized on the ER (Chen et al. 2002; Grefen et al. 2008; Dong et al., 2008).
However, ERS has been observed to be localized on the plasma membrane as well
(Ma et al., 2006a).
6 CTR1 is a single-component system of Ser/Thr kinase family of proteins that interact with members of two-component system of His kinase-like ethylene family receptors. A study using yeast two-hybrid interaction assay showed that the tomato receptors LeETR1, LeETR2 and Never-Ripe (NR) interact with multiple CTR proteins including LeCTR1, LeCTR3 and LeCTR4 via direct protein-protein interaction (Zhong et al., 2008). Upon removal of suppression downstream of CTR, transcription factors such as EIN 3 and Ethylene Response Factor 1 (ERF1) gets activated and migrate to the nucleus. ERF1 binding to GCC boxes of the promoter region for ethylene related genes activates transcription processes (Cheng et al., 2013). In Arabidopsis, the N- terminal of serine/threonine protein kinase (CTR1) binds directly to the C-terminal of
ETR1 and ERS1 on the endoplasmic reticulum (ER) membrane (Clark et al., 1998;
Gao et al., 2003). Mutation of the N-terminal of CTR1 such as in At-CTR1 disrupts the protein’s interaction with ethylene receptors and changes the localization of CTR1 from the ER to the membrane extract (Gao et al., 2003).
A study on Arabidopsis protein fraction showed that ETR1 is mostly localized at the ER and the binding of ethylene to ETR1 does not change the receptor localization at the ER (Chen et al., 2002; Bisson et al., 2009). Similarly, membrane topology shows the presence of three transmembrane domains at N-terminal of
CmERS1 and the subcellular localization of CmERS1:GFP occurs on the ER membrane and plasma membrane (Ma et al., 2006a). In tomato, LeCTR1, LeCTR3 and LeCTR4 are localized at the ER (Zhong et al., 2008). The EIN2 in Arabidopsis that controls ethylene signaling is also localized at the ER (Bisson et al., 2009). In the absence of ethylene, active CTR1 can bind to ETR1 and ERS1, subsequently downregulating ethylene biosynthesis (Ju et al., 2012). The crystal structure of CTR1 shows that an active CTR1 protein domain forms a dimer and shows activation interface with ethylene receptor clusters (Mayerhofer et al., 2011). The active CTR1 phosphorylates the C-terminal domain of EIN2. The phosphorylated EIN2 is unable to enter the nucleus and becomes a target for 26S proteasomal F-box degradation
7 proteins ETP1/2. Therefore, the degraded EIN2 is unable to trigger ethylene responses in plants (Qiao et al., 2012). Meanwhile upon binding with ethylene to its receptors such as ETR1 and ERS1, CTR1 is inactivated. The presence of ethylene controls the autophosphorylation of ETR1 (Voet-van-Vormizeele and Groth, 2008).
The inactive CTR1 is incapable of phosphorylating EIN2. Non-phosphorylated EIN2 no longer becomes a target for 26S proteasomal F-box degradation proteins ETP1/2.
The non-hosphorylated C-terminal of EIN2 is capable of migrating from ER to the nuclear membrane, allowing ethylene signal to be amplified through activation of ethylene related transcription factors (Bisson et al., 2009; Qiao et al., 2012).
Inside the nucleus, Ethylene Insensitive 3 (EIN3) and EIN3-LIKE1 (EIL1) mediate the activation of gene expression enhancing ethylene biosynthesis. EIN3
Binding F-Box protein 1 (EBF1) and EBF2 are able to regulate EIN3/EIL for downstream ethylene activation. In the absence of ethylene, EBF1 and EBF2 form a complex with Cullin 1-based ubiquitin-protein ligases (E3) and degrade EIN3 and EIL1 via proteasomal degradation (Binder et al., 2008). Activation of ethylene signal transduction downregulates EBF1 and EBF2 accumulation, thus reducing the chance for EIN3/EIL degradation by proteasomal activity (Binder et al., 2007). The accumulation of stable EIN3 and EIL1 in the nucleus activates ethylene related downstream transcription of genes (Ju et al., 2012).
1.3 Inhibition of ethylene-regulated gene expression during fruit ripening
Ethylene is a key initiator and modulator of several physiological processes including fruit ripening, flower senescence, abscission, as well as growth and development
(Reid, 1995). In addition, the function of ethylene has been extended to other processes such as stress, defense responses and interacts with other plant growth regulators that include jasmonic acid and salicylic acid (Morgan and Drew, 1997; Bari and Jones, 2009). Stress conditions such as wounding, mechanical stress, drought
8 and chilling affect the activity of SAM, ACS and ACO (Morgan and Drew, 1997). The interaction of ethylene with other plant growth regulators is believed to be required for plant immunity via synergistic responses with jasmonic acid and salicylic acid (Leon-
Reyes et al., 2009). The interaction between ethylene and jasmonic acid signaling pathways is mainly via transcriptional activation of protein such as Ethylene Response
Factor1 (ERF1) (Lorenzo et al., 2003).
The roles of ethylene during fruit ripening have been reported in many studies
(Burg and Burg, 1965). Tomato is the most common model system used for to the study of ethylene regulation in the ripening process of climacteric fruits (Alexander and Grierson, 2002). Ethylene functions to coordinate gene expression for ripening- related processes, including a rapid increase in ethylene biosynthesis via an autocatalytic process, respiration, colour changes, texture, aroma and flavour development. The levels of enzymes such as LeACS2, LeACS4 and LeACO are enhanced during tomato fruit ripening. ACO gene expression usually peaks earlier than ACS gene expression during climacteric peak. Application of ethylene inhibitors or downregulation of ACS and ACO activity demonstrates that ethylene biosynthesis plays a key role in regulating fruit maturation and ripening (Oetiker and Yang, 1995).
As compared with Arabidopsis, at least six unique ethylene receptors have been discovered together with their histidine kinase activity in tomato fruit (Alexander and Grierson, 2002). LeETR4 which is not present in Arabidopsis is an important ethylene receptor for System II ethylene biosynthesis. During tomato ripening, ethylene regulates gene expression of ripening enzymes, such as those involved in fruit softening, aroma and volatile production (Alexander and Grierson, 2002).
The flower is another organ that is sensitive to ethylene. In flowers, ethylene accelerates senescence and reduces vase life by premature abscission of flower and bud, wilting and flower discoloration (Reid and Wu, 1992; Mayers et al. 1997).
Carnation has been the most common model to study the effect of ethylene on flower shelf life. Carnation is sensitive to ethylene and exposure of flowers to ethylene at 1
9 µl/L causes the flowers to wilt within 24 hours (Camprubi and Nichols, 1978). The senescence of carnation flowers is associated with increases of internal ethylene biosynthesis and polyribosomal activity that changes the type of protein synthesis.
Therefore, inhibition of ethylene from binding to its receptor prolongs carnation vase life (Reid and Wu, 1992).
The climacteric like increase in ethylene biosynthesis in carnation flowers is similar to that observed in tomato fruit. The flower buds and young flowers produce very low ethylene. Just as in climacteric fruit, the flower petal releases ethylene via an autocatalytic cascade during senescence (Woodson and Lawton, 1988; Savin et al.,
1995). The autocatalytic ethylene production occurs in parallel with increases in ACS and ACO activities (Woodson et al., 1992). Similarly, the gene expression for ACS and ACO in carnation petals follows the trend in ethylene production (Savin et al.,
1995).
A compound that is intensively used for preventing ethylene action is 1- methylcyclopropene (1-MCP). 1-MCP is a gaseous molecule and could act as a competitive inhibitor for ethylene at the binding site of the ethylene receptor, essentially blocking the site (Sisler and Serek, 1997). The affinity of 1-MCP to the binding site is much stronger than that of ethylene, and the binding becomes almost irreversible. It has been reported that 1-MCP inhibits ethylene-induced cut flower wilting by interfering with ethylene action and by delaying ethylene biosynthesis
(Serek et al., 1995). Once 1-MCP is bound to the receptor, the receptor continues to inhibit downstream signaling and gene expression that are required for fruit ripening.
Thus, 1-MCP treatment essentially shuts off ethylene mediated processes.1-MCP treatment is an effective way of preserving the quality of treated produce, sometimes to a great extent, so that the treated produce does not advance in the ripening process resulting in a produce having partially advanced organoleptic qualities. 1-
MCP has been reported to be effective in climacteric and non-climacteric fruits such as apple (Sisler and Serek, 1997; Fan et al., 2000), peach (Kluge and Jacomino,
10 2002), avocado (Jeong et al., 2002) etc. Fruits in which firmness is desirable, such as apple and pear, 1-MCP is very effective, and have been the preferred experimental system to analyze the physiological and biochemical changes during ripening and post harvest storage (Watkins, 2006). 1-MCP spray delays preharvest fruit drop of
‘Golden Delicious’ apples mainly by blocking the ethylene biosynthesis (Yuan and
Carbaugh, 2007). Similarly, 1-MCP spray effectively reduces ethylene biosynthesis effectively, and subsequently decreases the rate of citrus leaf senescence and fruit drop (Pozo et al., 2004). The ability of 1-MCP to reduce fruit drop during fruit development is by diffusing into abscission zone and binding to the ethylene receptor.
Strong binding of 1-MCP to ethylene receptor at the abscission zone delays senescence and retains the fruit on the fruit tree (Yuan and Carbaugh, 2007).
However, it is very difficult to control ripening in soft fruits with 1-MCP. If the concentration used is in supra optimal range, the fruit does not ripen properly (Tiwari and Paliyath, 2011a). Exposure of fully ripened sweet cherry fruits resulted in a marginal increase in firmness, and a significant increase in antioxidant enzyme activity
(Sharma et al, 2010). Currently, 1-MCP has been commercialized with the name
EthylBloc® and SmartFresh™ for flowers and fruit and vegetables, respectively
(Blankenship and Dole, 2003; Watkins, 2006).
More recently, hexanal, an inhibitor of phospholipase D has been observed to be an effective inhibitor of ethylene signal transduction (Paliyath et al., 2003;
Jakubowicz et al. 2010). Earlier studies have shown that hexanal is a strong PLD inhibitor (Paliyath et al., 1999). PLD is a membrane degrading enzyme and initiates phospholipid degradation during fruit ripening and flower senescence (Paliyath et la.,
1987; Paliyath and Droillard, 1992). The ability of hexanal to bind to a hydrophobic site of PLD such as at the HKD motif that is essential for catalytic action is believed to be the mode of action of hexanal (Paliyath et al., 2008). The HKD motif is highly conserved in plant PLD gene family, with at least two HKD motifs (Liu et al., 2010b).
Inhibition of PLD prolongs the shelf life of tomato (Tiwari and Paliyath, 2011a).
11 Preharvest hexanal application enhances quality and shelf life of sweet cherry
(Sharma et al., 2010) and greenhouse tomatoes (Cheema et al., 2014). In addition, hexanal has anti-fungal property that delays postharvest decay of strawberry (Yuan et al., 2009), highbush blueberry fruit (Song et al., 2010), tomato (Utto et al., 2008) and pear (Spotts et al., β007). Hexanal vapor at 900 μδ/δ completely controls Botrytis cinerea on peach fruit and reduces Monilinia fructicola on raspberry within 24 hour
(Song et al., 2007).
1.4 The function and role of biomembrane in ripening and senescence
At the cellular level, the degradation of phospholipids accelerates ethylene biosynthesis and senescence (Beutelmann and Kende, 1977; Paliyath et al., 1987).
The plasma membrane bilayer is made from two layer of phospholipids with both the hydrophobic acyl chains facing each other and both hydrophilic tails facing the aqueous apoplastic and cytosolic environment (Ashrafuzzaman and Tuszynski, 2013;
Nicolson, 2014). Phospholipid degradation occurs by several processes including hydrolysis by phospholipase D and to a lesser extent by phospholipase A (PLA), phospholipase C (PLC) (Paliyath et al., 1987; Wang, 1999; Rhee, 2001).
The plasma membrane also plays a role in intracellular metabolic processes.
One of the important functions of the plasma membrane is to mediate the interactions between the internal parts of the cell with external environment. For instance the plasma membrane is a mediator for bringing substances inside the cell in order to maintain the cell metabolism. At the same time, the plasma membrane also functions to evacuate the waste products from the metabolic process that is harmful for the cell
(DePierre and Karnovsky, 1973). The mechanisms of transport at the plasma membrane occur using active or passivetransport. The plasma membrane also facilitates endocytotic and exocytotic processes of the cell by passive transport
(Besterman and Low, 1983). Active ATP-dependent transport of Ca2+ and H+ is critical
12 for the regulation of cytosolic concentrations of these ions at an optimal level. Several receptor proteins are also present at the plasma membrane for communication purposes that are controlled by active transport. These include receptors for hormones transport, ion channels for calcium ion entry into cytosol and defence against pathogen attack (Kuno and Gardner, 1987; Monaghan and Zipfel, 2012).
The lipid bilayer is permeable to water, oxygen and carbon dioxide. In contrast, the lipid bilayer is impermeable to cations and anions, hydrophilic molecules such as sugar and macromolecules such as protein and RNA (Benz and Bauer, 1988; Deamer and Dworkin, 2005). Therefore, the ion channel and pumps function as carriers to maintain ionic gradients across the plasma membrane (Hedrich and Schroeder,
1989). As a result, the ionic composition of the cytosol usually differs from that of the apoplastic or vacuolar fluid. Electrochemical gradients of protons across plasma membranes give the energy for transport protein function. The gradient is created by plasma membrane H+-ATPases activity in the presence of ATP. The plant H+-ATPase protein sequence is more closely related to fungal and protozoan H+-ATPases as compared with bacterial K+/-ATPases or to animal (Na+/K+)-ATPases, (H+/K+)-
ATPases, and Ca2+-ATPases. At least three isoforms of H+-ATPase gene have been identified in plant genome (Pardo and Serrano, 1989).
The information on the three-dimensional (3-D) structure of plant plasma membrane H+-ATPase gives a better understanding on how this protein functions in creating an electrochemical gradient (Palmgren, 2001). Plant plasma membrane H+-
ATPase also controls other processes including plant growth and development, nutrient transport, and stomatal movement (Pardo and Serrano, 1989). Another plasma membrane ATPase is Ca2+-ATPase (PMCA) that functions to maintain cytosolic calcium ion concentration of the cell at less than 0.2 με under normal non- excited conditions (Garcia and Strehler, 1999).
Structurally, the plasma membrane exists as a semi fluid bilayer comprising liquid crystalline and gel phase lipids (Singer and Nicloson, 1972). Recent information
13 on the fluid-mosaic model suggests the presence of other fluctuating membrane structural features such as lipid rafts and protein complexes which suggest that the function of plasma membrane is much broader than a simple barrier (Nicolson, 2014).
The phospholipids can be categorized according to head group and fatty acid (FA) chains that bond to glycerol backbone. For phospholipids, the head group consists of phosphate molecules between glycerol and free head group. The two FA chains that are linked to the glycerol backbone via ester bonds are non polar with different length of hydrocarbon, usually from 14 to 24 carbons long. Having both polar and nonpolar region makes phospholipids amphiphilic molecules that easily aggregate to bilayers in aqueous environments (Bohdanowicz and Grinstein, 2013). Classification of phospholipids species depend on the nature of their head-group and the length and saturation of FA chains. The head group can be polar molecules such as choline, ethanolamine, serine and inositol. The type of phospholipids head group dictates the viscosity, curvature and electrostatic charge of the phospholipids bilayer (Fahy et al.
2013; Bohdanowicz and Grinstein, 2013).
Phospholipid head groups also become ligands for protein to be incorporated into plasma membrane bilayer. For example, glycosylphosphatidylinositol (GPI) anchored protein binds to phosphatidylinositol head group while its FA chains are embedded in the lipid bilayer (Kato et al., 2012). The plasma membrane has less phosphoinositides compared with other phospholipids such as phosphatidylcholine
(PC), phosphatidylserine (PS), or phosphatidylethanolamine (PE) (Kato et al., 2012).
Similarly, the phospholipid composition from purified mitochondria from germinated castor bean endosperms shows the presence of PC, PE and PI at a molar percent of
46.3, 29.5 and 9.4, respectively (Ohmori and Yamada, 1974).
Phosphoinositides, derivatives of PI, are not abundant in the membrane compared with other phospholipids such as PC and PE. However, phosphoinositides can function in numerous cellular processes including the determination of cell polarity, membrane trafficking, cytoskeletal arrangements, ion channel and transporter
14 function, and signal transduction (Wang et al., 2002a; Thole and Nielsen, 2008;
Chang-Ileto et al., 2012). The ability of phosphoinositides to be spatially and temporally translocated to different organelles offers a broader role in signaling process (Chang-Ileto et al., 2012). At the plasma membrane, phosphoinositides interact with other proteins by electrostatic interaction (McLaughlin and Murray, 2005).
The cytosol exposed head group of phosphoinositides is also a target of other enzymes as a substrate or docking site. For example, phosphatidylinositol 4,5- diphosphate (PI4,5P2) is a substrate for PLC to generate diacylglycerol (DAG) and inositol 1,4,5 triphosphate (IP3) head group. PLD hydrolyzes a variety of phospholipids including PC, PE, PI, PIP and PIP2 generating phosphatidic acid (PA) (Paliyath and
Thompson, 1987; Paliyath et al, 1987; Paliyath et al, 1995). Both DAG and PA is a plant secondary messenger since these molecules could trigger activation or deactivation of other proteins during cell signaling (Hokin, 1985; Munnik, 2001). DAG could be converted to PA by the action of DG Kinase, providing an alternate biosynthetic route for PA (Testerink and Munnik, 2011).
Phospholipase D is the key enzyme involved in membrane deterioration process during fruit ripening, senescence, and stress. Through a catabolic cascade involving enzymes such as PLD, phosphatidate phosphatase, lipolytic acyl hydrolase and lipoxygenase, phospholipids are catabolyzed to neutral lipids that cause gel phase formation destabilization of the membrane. Application of plasma membrane phospholipase D inhibitors reduces the rate of senescence. For instance, hexanal is an inexpensive PLD inhibitor that prolongs the shelf life and qualities of several commodities including tomato (Tiwari and Paliyath, 2011a), sweet cherry (Sharma et al., 2010) and pear (Spotts et al., 2007).
15 1.5 Phosphatidylinositol metabolism in senescence
Phosphatidylinositol (PI) is a relatively minor phospholipid in plant membranes. Based on the inositol structure, and the number and position of the phosphate moieties, there are nine possible stereoisomers that can be formed. At present, only seven PI streoisomers have been reported in mammalian system and few in plant systems
(Drobak, 1993). These PIs with different numbers of phosphate molecules on the inositol head group are collectively known as phosphoinositides.
Phospholipid content in mammalian cells such as for phosphatidylserine, phosphatidic acid and PI are approximately 8.5%, 1.5% and 1.0% respectively, based on the total lipid content (Stephen et al., 1991; Lemmon, 2008). Mammalian phosphoinositides have more stereoisomers than plant phosphoinositides, due to fewer plant enzymes involved in PI metabolism. For instance, mammalian systems have three classes of phosphatidylinositiol 3-kinases (PI3K) with multiple isomers for each class. Meanwhile, plants only have class III PI3K with only one gene coding for the enzyme (Welters et al., 1994). Currently, the presence of PI3,4P2 and PI3,4,5P3 is not clear in plants, suggesting that these phosphoinositides are not being synthesized directly from a kinase reaction, but are probably synthesized by a phosphatase reaction from inositols with a larger number of phosphates on the inositol group
(Drobak, 1993). Similarly, PI5P, PI3,4P2 and PI3,4,5P3 have also not been detected in
Saccharomyces cerevisiae (Sc) suggesting there is a similarity in PI metabolism between yeast and plants (Lemmon, 2008). Subcellular localization studies have shown that PI3P localizes on the late endosomes and tonoplast (Vermeer et al.,
2006). Similarly, PI4P localizes on the plasma membrane and Golgi/endosomal compartments (Vermeer et al., 2009). Likewise PI4,5P2 localizes mostly on the plasma membrane instead of endomembrane compartment (van Leeuwen et al.,
2007).
16 The importance of phosphoinositide metabolism has been reported in mammalian systems (Hokin and Hokin, 1964). Inositol is required for normal cell growth processes such as for cellular perception, signal transduction and in response to extracellular signals (Drobak, 1993). PI4,5P2 is a source for three secondary messengers including PA, DAG and free inositol head group. PI4,5P2 is involved in activation of ion channels and enzymes, become a protein ligand during the formation of vesicles for endocytosis and exocytosis (McLaughlin and Murray, 2005). The ability to be a ligand for enzymes expands its function in recruiting the enzyme localization from cytosol to the plasma membrane or membrane containing organelles such as the
ER. Studies show that several phosphoinositides are ligands for enzymes having specific protein domains. For instance, PI3P binds to C2 domain (C2), phox-homology
(PX) domain, plextrin homology (PH) domain, and All Fab1, YOTB, Vac1, EEA1’
(FYVE) (Lomasney et al., 1996; Ellson et al., 2001; Kanai et al., 2001). In addition, PH domain is able to bind to PI3,4P2, PI4,5P2 as PI3,4,5P3 making PI metabolism a more diverse signaling process. PI3P and PI4P metabolite flux also controls intracellular trafficking and localization during cellulose biosynthesis in Arabidopsis thaliana
(Fujimoto et al., 2015).
The biosynthesis of PI is catalyzed by phosphatidylinositol synthase (PIS). In plant system such as Arabidopsis, PIS has two isoforms. Meanwhile, human system has six isoforms of PIS (Michell, 2008). In vitro studies show that both At-PIS1 and At-
PIS2 have similar enzymatic activity (Lofke et al., 2008; Xue et al., 2000). The PIS structure consists of transmembrane domains (Lofke et al., 2008). Subcellular localization shows that AtPIS is localized on the ER and Golgi body (Lofke et al.,
2008). PIS1 overexpression increases the DAG and PE content. Meanwhile PIS2 overexpression increases PI, PI4P and PI4,5P2 in the plant. PIS2 overexpression results in increased unsaturated fatty acid content in PI (Lofke et al., 2008). However, both PIS1 and PIS2 overexpression inhibit plant growth suggesting that a balanced PI flux is required for normal growth (Lofke et al., 2008).
17 PI is synthesized on the ER from CDP-DAG and myo-inositol by PIS activity
(Agranoff et al., 1958). Thenewly synthesized PI forms a vesicle complex possibly with several PI lipid transfer protein (PIPTs) (Cockcroft and Carvou, 2007; Kim et al.,
2011). Then the PIPTs cargo is distributed to other organelles such as the plasma membrane and the Golgi. Interestingly, mammalian PIPTs have a conserved nonpolar amino acid sequence that creates a hydrophobic region at the C-terminal which functions to protect PI from aqueous environments. In addition, this hydrophobic region also functions as a ‘lid’ for the PIPTs cargo and releases PI on the targeted organelles such as the plasma membrane and Golgi body (Cockcroft and Carvou,
2007). Phosphorylation of the inositiol head group in PI by kinase enzymes produces
PI monophosphate. Subsequent phosphorylation of PI monophosphate produces PI triphosphate. Therefore, the first phosphorylation of PI can be considered as an initial step of PI metabolism to produce PI diphosphate and PI triphosphate (Balla, 2013).
PI is phosphorylated by phosphatidylinositol kinases (PIKs) to PI monophosphate according to the type of kinases as illustrated in Figure 1.2. Currently there are only two PIKs that have been reported in plant system. PI3K phosphorylates
PI at the 3-hydroxyl position and currently there is only one copy of the gene identified that encodes for PI3K in a plant genome (Welters et al., 1994). Plant PI3K has similar function with ScVps34. Overexpression of ScVps34 increases PI3K activity in the cell (Schu et al., 1993). Domain structure comparison shows that plant
PI3K has similar domain structure with class III mammalian PI3K. Class III mammalian PI3K is involved in phosphorylation of only PI as a substrate. Similarly, both plant PI3K and ScVps34 possibly phosphorylates
PI instead of PI monophosphates or PI bisphosphates (Heilmann and
Heilmann, 2015). In contrast to plant PI3K that is encoded by only a single gene in the plant genome, plant PI4K is encoded by several genes and has more isoforms. For instance, Arabidopsis PI4K has four isoforms, AtPI4Kα1, AtPI4Kαβ, AtPI4K 1 and
AtPI4K β. All AtPI4K isoforms have a catalytic domain at the C-teminal end.
18
Figure 1.2. The schematic pathways for phosphatidylinositiol metabolism in mammalian and plant systems. The question mark (?) shows the presence of enzymes only in mammalian system. The possible routes from phosphatidylinositiol into phosphatidyinositol 4,5-diphosphate (PI45P2) in plant system are less complicated as compared with mammalian due to an absence of phosphatidylinositiol
5-phosphate (PI5P). Phosphatase and tensin homolog (PTEN). Adapted from
Payrastre et al. (2001).
19 However, AtPI4Kα1 and AtPI4Kαβ have a Plextrin homology-domain (PH- domain) for binding with its own product of the reaction, PI4P suggesting that these isoforms are involved in PI autocatalytic phosphorylation by PI4K (Stevenson et al.,
1998).
Meanwhile both AtPI4K 1 and AtPI4K β isoforms do not contain PH-domain, but only contain plant PI4K charged region-domain (PPC domain), and a helical domain at the N-terminal end. Cloning and characterization of AtPI4K showed that the enzyme could phosphorylate the phosphatidylinositol head group exclusively at the D4 position (Xue et al., 1999). However, the level of AtPI4K gene expression is constant in all tissues and is not affected by abiotic factors such as light and salts, suggesting that this enzyme is only being expressed at a basal level (Xue et al.,
1999).
The third PI monophosphate is PI5P. The PI5P has been reported using 32P- labelling with an estimated concentration of 3-8% of the PI pool in Chlamydomonas and around 18% of the PI pool in Vicia faba seedlings and suspension-cultured tomato cells (Meijer et al., 2001). The level of PI5P rapidly increased in
Chlamydomonas cells in response to hyperosmotic stress, suggesting that PI5P plays a key role in signaling, and become a substrate for PI3,5P2 biosynthesis (Meijer et al.,
2001). However, genomic data from plant genomes areunable to identify the potential candidate gene for plant PI5K (Heilmann and Heilmann, 2015). Besides, PLC activity does not contribute to the PI5P biosynthesis (Meijer et al., 2001). Therefore, the biosynthesis mechanism for plant PI5P is still unclear. There is a possibility that a combination of reactions from other kinases or phosphatases during PI metabolism may generate PI5P in the plant system (Heilmann and Heilmann, 2015).
PI monophosphate including PI3P and PI4P can be converted into PI diphosphate and PI triphosphate by different kinase enzymes. PI3P and PI4P can be phosphorylated by phosphatidylinositol 3-phosphate 5-kinase (PI3P5K) and phosphatidylinositol 4-phosphate 5-kinase (PI4P5K) into PI3,5P2 and PI4,5P2,
20 respectively. According to genome analysis, there are four isoforms of PI3P5K in
Arabidopsis that could phosphorylate PI3P into PI3,5P2 (Mueller-Roeber and Pical,
2002). PI3,5P2 is involved in several processes including the response to abscisic acid (ABA)-induced stomatal closure by regulating the vacuolar acidification and convolution (Bak et al., 2013). Mutation of At-PI3P5K leads to plants with slower stomatal closure rates in response to ABA treatment as compared with the wild type
(Bak et al., 2013).. This observation supports a previous study where inhibition of PI3K activity inhibited stomatal movement in response to ABA (Jung et al., 2002). These suggest that inhibition of PI monophosphate and PI diphosphate synthesis impairs calcium ion signaling in the plant cell and is involved in stomatal movement (Jung et al., 2002).
In mammalian systems, PI4P is a substrate for class I and II PI3Ks to produce
PI3,4P2 (Rameh et al., 1997; Zhang et al., 1997). However in plant systems, PI4P is only a substrate for phosphatidylinositol 4-phosphate 5-kinase (PI4P5K) to produce
PI4,5P2. Arabidopsis PI4P5Ks have eleven isoforms with two different subfamilies
(Mueller-Roeber and Pical, 2002). Subfamily A consists of isoforms PIP5K10 and
PIP5K11 and has similar domain structure with mammalian PI4P5K. Meanwhile subfamily B consists of a wide range of isoforms from PIP5K1 to PIP5K9 and has extra “εembrane Occupation and Recognition Nexus” repeat (εORN) domain and variable linker (Lin) domain at N-terminal end as compared with subfamily A. The amino acid sequence for subfamily A enzymes is shorter than subfamily B enzymes
(Mueller-Roeber and Pical, 2002).
Subcellular localization of subfamily A members such as PI4P5K10 and
PI4P5K11 as well as subfamily B members such as PI4P5K4 and PI4P5K5, showed that these enzymes are localized on the apical plasma membrane microdomain of
Arabidopsis pollen tubes (Ischebeck, et al., 2008; Ischebeck et al., 2011). In addition, a study on PI4P5K3 showed that this enzyme was localized on the periphery of the
21 apical region of root hair cells, suggesting that this enzyme is associated with plasma membrane and vesicles formation (Stenzel et al., 2008).
Overexpression of PI4P5K4 or PI4P5K5 triggers multiple tip branching and increases pectin deposition at apical plasma membrane and causes plasma membrane invagination (Ischebeck, et al., 2008). Similarly, overexpression of
PI4P5K10 or PI4P5K11 causes swelling on the tobacco pollen tube tip, mainly due to the ability of these enzymes to control the actin arrangement (Ischebeck et al., 2011).
PI4P5K4 and PI4P5K5 are also involved in pollen germination and pollen tube elongation (Ischebeck, et al., 2008). Transient expression of PI4P5K3 increases
PI4,5P2 on the plasma membrane of the growing pollen tubes (Stenzel et al., 2008).
Disturbing PI4,5P2 flux by type B PI4P 5-kinases causes imbalance in membrane trafficking and apical pectin deposition on the pollen tubes (Ischebeck, et al., 2008).
During PI metabolism sequence, the synthesized PI monophosphate can be phosphorylated into PI diphosphate and PI triphosphate by PIKs. For instance, in mammalian systems, the phosphorylation of PI4,5P2 by class I PI3K produces
PI3,4,5P3 (Auger et al., 1989). In vitro study showed that PIP5Ks can phosphorylate
PI3,4P2 to PI3,4,5P3 (Zhang et al. 1997). However, there is less information regarding
PIKs that can utilize PI diphosphate as a substrate.
Apart from PIKs, PI metabolism is also controlled by phosphatase enzyme.
Phosphatase is a phosphate removing enzyme. Therefore, PI-phosphatase is having an opposite catalytic direction as compared with PIKs. The ability of phosphatase to remove the phosphate molecules from phosphoinositides makes the PI metabolism more complex. However, there is difference in opinion on the sequence in which inositol head groups are phosphorylated and dephosphorylated. Genomic information suggests that plant phosphatases has similar function with mammalian PTEN
(Mueller-Roeber and Pical, 2002; Pribat et al., 2012). All three AtPTEN isoforms have a different genome structure. The introns for AtPTEN2a and AtPTEN2b are more as compared with AtPTEN1 (Pribat et al., 2012). Interestingly, the AtPTEN2a protein only
22 displays a strong binding activity towards PA, suggesting the more diverse function of phosphatase in PI metabolism and signal transduction (Pribat et al., 2012).
Another enzyme that has been found to possess phosphatase activity is the enzyme containining suppressor of actin (SAC) domain. Currently Arabidpsis has nine genes encoding SAC domain. For instance, AtSAC1 gene is expressed at all tissues predominantly in vascular tissues and fibre of the stems. Subcellular localization study shows that AtSAC1 is localized on the Golgi body (Zhong et al., 2005). Mutation at the
C-terminal of AtSAC1 changes its subcellular localization from the Golgi body to cytoplasm and abolishes its phosphatase activity and actin organization function
(Zhong et al., 2005). Similarly, AtSAC5 functions in plant growth by controlling tonoplast development, vacuolar function and turgor-driven cell expansion in
Arabidopsis thaliana (Nováková et al., 2014). Fragile Fiber3 (FRA3) containing protein domain also has phosphatase activity. FRA3 is encoded as type II inositol polyphosphate 5-phosphatases (type II 5PTase) and plays an essential role in synthesis of the secondary wall and actin organization (Zhong et la., 2004).
AtPTEN2a shows a consistent phosphatase activity when able to dephosphorylate the 3' phosphate molecules from PI3P, PI3,4P2 and PI3,5P2 as analyzed in vitro (Pribat et al., 2012). Similarly, in vitro study shows that AtSAC1 demonstrates phosphatase activity toward PI3,5P2 (Zhong et al., 2005). In vitro study also proved that At-Fragile Fiber3 (AtFRA3) is able to use PI4,5P2, PI3,4,5P3, and IP3 as substrate with the highest substrate affinity toward PI4,5P2 (Zhong et la., 2004).
Briefly, the overall level and concentration of the phosphoinositides are regulated by the activity of PI-kinases and PI-phosphatases as shown in Figure 1.2.
Interestingly, the phosphoinositides from PI metabolism such as PI4,5P2 is a substrate for phospholipase C (PLC). DAG is a product from PLC hydrolysis and could activate other enzyme activities such as protein kinase C (PKC) and DAG kinase (DGK).
Meanwhile, another product from hydrolysis PI4,5P2 is IP3. IP3 is a water soluble compound that easily can migrate from plasma membrane to cytosol. The binding of
23 IP3 at vacuole promotes calcium releases into cytoplasm and causes a rise in calcium ion concentration (Berridge, 1987). However, this pathway may be localized to stomatal cells, as IP3 concentration required for calcium release has been observed to be very high in carnation microsomal membranes (Paliyath et al., 1995). The increase in calcium in the cytosol can stimulate several calcium dependent enzymes such as
PLD, calmodulin dependent enzymes, phosphatidate phosphatise etc. activating membrane deterioration and enhancing senescence (Paliyath and Thompson, 1987;
Paliyath and Droillard, 1992; Munnik et al., 1995; Tiwari and Paliyath, 2011a).
1.6 Mammalian phosphatidylinositol 3-kinase (PI3K)
PI monophosphate is a D-myo-inositol-1-phosphate that is linked to diacylglycerol via phosphate molecules (Vanhaesebroeck et al., 2001). Since PI only has five free hydroxyl groups on the inositol head group the first PI kinase that phosphorylates inositol canadd phosphate moieties at any five different points. Currently there is no information for PI 2-phosphate (PI2P) and PI 6-phosphate (PI6P), or their kinases.
Only the PI3P, PI4P and PI5P have been reported in both plant and mammalian system. The amount of PI is 10–20 times higher than PI monophosphate
(Vanhaesebroeck et al., 2001). PI4P acquires up to 90–96% from total PI monophosphate and the remaining is a mix of PI3P and PI5P. Similarly, PI4,5P2 consists more than 99% of the major PI diphosphate and the remaining is a mixture of
PI3,4P2 and PI3,5P2 (Stephens et al., 1999; Rameh et al., 1997; Vanhaesebroeck et al., 2001).
PI3K is a kinase enzyme that phosphorylates the 3-hydroxyl group of the inositol head group jn the presence of ATP. In mammalian system, PI3K has three classes according to substrate specificity and structure (Vanhaesebroeck et al., 2001).
All classes of mammalian PI3K have a PIK catalytic domain, helical and C2 domain.
However, the C2 domain for class III is located at the N-terminal as compared with
24 class I kinases which possess C2 domain at C-terminal (Vanhaesebroeck et al.,
2001). In mammalian system, PI3K involves in multiple process including signalling, neutrophil activation, B and T cell antigen receptor signalling, vesicular trafficking, regulation of the actin cytoskeleton, cell division, imunity, diabetes and cancer development (Stephens et al., 1991; Toker and Cantley, 1997; Siddhanta et al., 1998;
Katso et al., 2001; Okkenhaug et al., 2002).
Class I PI3Ks are heterodimer proteins that have a total size of approximately
110-kilodalton. They are also known as p110 and can phosphorylate PI, PI4P and
PI4,5P2 for adding phosphate at 3-position with a higher preference for PI4,5P2 as a substrate. These enzymes are important for cell development and proliferation
(Fruman et al., 1999). Class I PI3Ks could bind to Ras protein (Vanhaesebroeck et al.,
2001). Studies show that, in mammalian systems, class I PI3Ks are involved in downstream activation of tyrosine kinase receptors and G proteins coupled receptors, thus making the function of these enzymes as crucial control points for tumor development (Fruman et atl., 1999; Martini et al., 2014). This makes class I PI3K activity is a right marker for developing anticancer drugs (Martini et al., 2014).
Class II PI3Ks have larger size than class I PI3Ks, with molecular masses in the range of approximately 170 kilodaltons. Unlike class I PI3K, class II PI3K has C2 domain at the C-terminal (Vanhaesebroeck et al., 2001). Phospholipid binding property of class II PI3K is calcium ion-independent (MacDougall et al., 1995; Arcaro et al., 1998). This property is contradictory to the classical function of C2 domain which requires calcium ion for binding with phospholipids (Garcia et al., 2000). The difference is due to the absence of negatively charged domain at the class II PI3K C2 domain that is necessary for calcium ion synchronization in calcium ion-dependent C2 domains (MacDougall et al., 1995). Protein structure analysis showed the presence of
Ras binding domain at the N-terminal of class II PI3Ks, just as in class I PI3K structure (Arcaro et al., 1998). Mammalian class II PI3Ks can be subdivided into three classes such as PI3KC2, PIγKCβ and PIγKCβ . The PIγKCβ and PIγKCβ are
25 ubiquitous as compared with PIγKCβ which is only found in the liver (Arcaro et al.
1998). Subcellular localization of class II PI3Ks suggest that these enzymes are associated with biosynthesis of the membrane fraction of the cells, including the plasma membrane and membrane vesicles during their formation (Arcaro et al. 1998;
Domin et al. 1997; Gaidarov et al., 2001; De εatteis and D’Angelo, 2007).
In contrast to other PI3K, class III PI3K uses only PI as a substrate to produce
PI3P in the cells. Domain structure analysis shows that class III PI3K has C2 domain at N-terminal followed by helical domain and catalytic domain at the C-terminal. Only a single catalytic subunit has been identified in all class III PI3K eukaryotic that is associated with Ser/Thr protein kinase complexes (Vanhaesebroeck et al. 2001).
Subcellular localization suggests that class III PI3K functions to recruit specific effector proteins that bind to FYVE and PX domains. These enzymes involve in vesicle formation including endocytosis process, phospholipids cargo and protein sorting on the plasma membrane (Raiborg et al., 2013).
Since the distinct function of class III PI3K is in vacuolar formation, these proteins are generally known as vacuolar protein sorting (Vps). Vps34 is the common example of class III PI3K and is involved in generating of PI3P for membrane trafficking processes (Backer, 2008). Class III PI3K is also required for cell autophagy and in response to the nutritional changes in the cell (Backer, 2008). Vps34 is also involved in intracellular processes such as nutrient sensing in the mTOR pathway
(Nobukuni et al., 2005) and mitogen-activated protein kinase signaling (Byfield et al.,
2005).
1.7 Phosphatidylinositol 3-kinases (PI3K) in plant growth and development
In plant systems, PI content is relatively low as compared with animals. Genetic analysis of the plant genome shows that there is only one family of PI3K present in the plant genome that is similar to ScVps34 (Welters et al., 1994). Plant PI3K has
26 similar protein domain structure with class III PI3K in mammalian system that is involved in vesicle trafficking (Boss and Im, 2012). Since plant PI3K occurs only as a single copy as compared with mammalian system which has three classes, this makes the function of plant PI3K more diverse than simply vesicle trafficking. The
PI3K sequence is well conserved in the plant genome as illustrated in Figure 1.3.
In plants, PI3K is suggested to phosphorylate PI into PI3P. PI3P plays a role in membrane biogenesis and vacuolar trafficking from Golgi-derived vesicle (Vermeer et al., 2006), vesicle trafficking from the trans-Golgi network to the lumen of the central vacuole (Kin et al., 2001b), and nuclear transcription process (Bunney et al., 2000).
PI3K is required for normal growth and development (Welters et al., 1994), normal stomatal movements in response to ABA (Jung et al., 2002), root hair elongation (Lee et al., 2008), cytoskeleton arrangement (Dove et al., 1994) and possibly to form a complex with actin (Kim et al., 2011a; Aparicio-Fabre et al., 2006;
Tejos et al., 2014). PI3P also functions to reallocate nutrient flux during symbiosis when PI3K activity induces nodule organogenesis (Hong and Verma, 1994). Similarly within the yeast system, plant PI3P is the main component for the autophagy process
(Vieira et al., 2001; Obara et al., 2008). PI metabolism in plant is different from that of mammalian system. Plant PI3P can be phosphorylated by phosphatidylinositol 3- phosphate 5-kinases (PI3P5K) to produce PI3,5P2 (Mueller-Roeber and Pical, 2002).
Plant PI3,5P2 is one of the potential plant secondary messenger in plant system, and its biosynthesis increases in response to osmotic stress (Meijer et al.,
1999). Loss-of-function and mutation of PI3P5K impair the endomembrane homeostasis suggesting that PI3,5P2 flux is essential for vacuole acidification, endocytosis and root growth (Hirano et al.,2011). The current data suggests that PI3P and PI3,5P2 are associated with autophagy process and vacuole formation, respectively (Boss and Im, 2012).
27
Figure 1.3. A phylogenetic tree of phosphatidylinositol 3-kinase (PI3K) C2 domains of angiospermous species. The phylogenetic tree shows several subgroups of the ancestral C2 domain, the most ancient being that of Morus notabilis, which belongs to moraceae, and ancient family among angiosperms. The closest subgroup to Morus appears to be consisting of Theobroma, having more evolved species such as Ricinus and Jatropha, which are characterized by oil bearing seeds. A group comprising
Phaseolus, Glycine max and and Medicago (fabaceae) appears to be a more recent evolution. Similarly, subgroups with clustering of members of cruciferae (eg.
Arabidopsis), and solanaceae (eg. Solanum), are highly related. C2 domains of
Solanum sp., are very close and evolved from the C2 domain of Nicotiana. C2 domains of graminaceous members (eg. Triticum), are more recently evolved.
Evolution of angiosperms with the presence of PI3K with C2 domains in their genome, suggests its importance in metabolic regulation.
28 1.8 Structure characterization of plant phosphatidylinositol 3-kinase
The information on the structural features of plant PI3K is few as compared with mammalian PI3K. Therefore, the 3D structural aspects gleaned from x-ray crystallography data from mammalian PI3K can be adopted to predict the structural and potential functional featuresof plant PI3K. Briefly, plant PI3K has similar domain structure only with class III PI3K. However, most of the structural studies of mammalian PI3Ks are reported for class I and class II PI3Ks since increased activity of these enzymes have been identified to be critical in cancer development. The 3-D structure of class I PI3K, p110 reveals that the enzyme has a Ras binding domain
(RBD), C2 domain, helical domain and catalytic domain (Walker et al. 1999). Similarly with plant PI3K, the domain structure analysis shows that the N-terminal of the protein has a C2 domain, a helical domain and a catalytic domain at the C-terminal. Plant
PI3K C2 domain is well conserved in the protein sequence as shown in Figure 1.4.
The 3-D structure of that class I PI3K C2 domain shows the presence of three potential calcium binding region (CBR) loops. The presence of CBR on C2 domain is in alignment with classical role of C2 domainin facilitating phospholipid and membrane binding (Nalefski and Falke, 1996). The CBR such as CBRγ of p110 and p110 is rich in basic amino acid residues, suggesting potential binding region of these enzymes with phospholipids that possess a negatively charged phosphate group/s facilitating electrostatic interaction (Vanhaesebroeck et al. 2001). Mutation of the basic amino acid residues at the CBR3 loop of PTEN impairs its phospholipid binding property and tumor suppressor function (Lee et al. 1999). C2 domain also facilitates the binding other proteins by protein-protein interactions (Shiratsuchi et al. 1998; Liu et al. 2000; Remans et al., 2014; Rodriguez et al., 2014).
The helical domain in PI3K acts as a protein backbone for the enzyme. This domain will be surrounded by other domains, suggesting the potential roles of helical domain as a structural spine for other domains. Mammalian systems have helical
29
30 Figure 1.4. The amino acid sequence alignment for C2 domain of plant phosphatidylinositiol 3-kinase (PI3K). The basic amino acid such as lysine (K), arginine (R) and histidine (H) are well and non polar amino acids (red) are well conserved in all plant PI3K C2 domain.
31 domain between C2 domain and catalytic domain. The structure analysis of the helical domain shows the presence of five pairs of antiparallel helices of amino acid residues and the pattern is similar with the Huntingtin elongation factor 3 (HEAT) motifs. HEAT motif is a regulatory subunit for protein phosphatase-2A (PP2A) (Groves et al. 1999).
The catalytic domain of class I p110 has two lobes. The small N-terminal lobe contains the nucleotide-binding loop. The bigger C-terminal lobe contributes to ATP binding and consists of the activation and catalytic loops (Vanhaesebroeck et al.
2001). X-ray crystallographic structure of the catalytic subunit of class I PI3K has been characterized. The domain can be activated by heterotrimeric G-protein beta gamma subunits and Ras protein (Walker et al., 1999). The catalytic domain and domain are surrounding the helical domain. This structure arrangement allows the C2 domain and catalytic domain to interact with phospholipid membranes (Walker et al.,
1999).
The nucleotide binding site of the PI3K has a lysine-rich region within the ATP binding pocket. This domain interacts with the phosphate from ATP during phosphorylation (Vanhaesebroeck et al. 2001). Similarly with other kinase enzymes, this domain is critical for PI3K activity (Gibbs and Zoller, 1991; Robinson et al. 1996).
Lysine is one among the positively charged amino acid residues that is important for
PI3K phosphorylation property. For instance, Lys802 has been identified as a critical amino acid for PI3K activity. The inhibition of PI3K using wortmannin changes these amino acid residues binding property (Wymann et al. 1996).
1.9 Inhibition of phosphatidylinositol 3 kinase by wortmannin
Wortmannin is a product from fungus such as Penicillium funiculosum. Wortmannin has been found to be a potent and specific inhibitor for PI3K. In mammalian system,
Wortmannin directly binds to class I PI3K 110-kDa protein instead of 85-kDa protein and effectively inhibit PI3K activity without inhibiting PI4K (Yano et al., 1993).
32 Similarly, the ability of wortmannin to inhibit PI3K activity blocks insulin secretion with an IC50 less than 10 nM and completely inhibits insulin secretion at 100 nM (Okada et al., 1994). Another report showed that IC50 for wortmannin in inhibiting PI3K was between 2 to 4 nM and wortmannin effectively inhibited the formation of PI3P in intact cells (Powis et al, 1994).
Interestingly, wortmannin also inhibits other enzymes in mammalian system.
Wortmannin inhibited PLD activation in response to N-formyl-Met-Leu-Phe (fMPL) but not after PLD was activated by the addition of calcium calcium ionophore A23187
(Reinhold et al., 1990). Wortmannin was also found to be a potent inhibitor of smooth muscle myosin light chain kinase (MLCK) enzymes (Nakanishi et al., 1992).
Kinetic study showed that wortmannin inhibition ofPI3K was a noncompetitive and irreversible and as well as time and concentration dependent (Powis et al, 1994).
Similarly, another study showed that wortmannin irreversibly bound to a region near the catalytic site of the MLCK, and changed the conformation of PI3K (Nakanishi et al., 1992; Walker et al, 1999). Wortmannin also inhibited the phosphorylation process of MLCK, suggesting another potential inhibition mechanism (Nakanishi et al., 1992).
Another study showed that wortmannin also inhibited mammalian polo-like kinase, an enzyme that is involved in cell division with an IC50 of 24 nM (Liu et al., 2005). During wortmannin inhibition of PLD activity, it irreversibly inhibited the oxidative burst without inhibiting other components in signal transduction such as NADPH oxidase (Reinhold et al., 1990).
Similarly, wortmannin inhibited MLCK activity without inhibiting the activities of other enzymes including cAMP-dependent protein kinase, cGMP-dependent protein kinase and calmodulin-dependent protein kinase II (Nakanishi et al., 1992). Only small inhibition effect on protein kinase C activity has been reported from wortmannin at this concentration (Nakanishi et al., 1992). In addition, another study showed that wortmannin is not an inhibitor for protein kinase C and protein tyrosine kinase (Powis et al, 1994).
33 CHAPTER II
REGULATION OF PHOSPATIDYLINOSITOL 3-KINASE ON TOMATO (SOLANUM
LYCOPERSICUM) FRUIT RIPENING
2.1 Introduction
Fruit ripening is a complex process that involves an array of irreversible physiological, biochemical and organoleptic changes that lead to changes in color, texture, flavor, aroma and nutritional qualities. Fleshy fruits are classified into climacteric and non- climacteric based on the differences in respiratory pattern and ethylene production.
Tomato, a climacteric fruit is characterized by a rise in respiration and burst in ethylene synthesis associated with ripening. Ethylene plays vital and crucial roles by regulating ripening of climacteric fruits. There are two systems of ethylene production in plants, system1 and system 2. System 1 is autoinhibitory and is responsible for producing basal ethylene levels during normal vegetative growth and development, while system 2 is autocatalytic and functional during fruit ripening (Alexander and
Grierson, 2002). Ethylene biosynthesis is a highly regulated process and starting with the conversion of amino acid methionine into S-adenosylmethionine (SAM) by the enzyme SAM synthetase via the Yang cycle (Baur and Yang, 1972). Then, SAM is converted to 1-aminocyclopropane-1-carboxylic acid (ACC) by ACC synthase.
Subsequently, ACC is oxidized by ACC oxidase (ACO) to ethylene.
Formation of ACC is considered as the rate limiting step for ripening- associated ethylene biosynthesis, since the transcription of the ACS is highly regulated and responsive to many external stimuli. Nine ACS genes have been characterized in tomato. The second enzyme in the ethylene biosynthesis sequence is
ACC oxidase (ACO). These two genes (ACS and ACO) are regulated by a number of factors and are differentially expressed in various tissues at different developmental
34 stages and in response to various stimuli such as ripening and stress (Alexander and
Grierson, 2002). During tomato ripening, differential expression of four ACS
(LeACS1A, LeACS2, LeACS4 and LeACS6) and three ACO (LeACO1, LeACO3 and
LeACO4) genes have been reported (Cara and Giovannoni, 2008). Higher expression of LeACS6 is involved in system-1 ethylene biosynthesis in green fruit, while
LeACS1A and LeACS3 are expressed constitutively at a low rate. Induction of
LeACS1A and LeACS4 occurs at the transition of ripening resulting in enhanced climacteric ethylene production. This will lead to induction of LeACS2 expression and autocatalytic system-2 ethylene biosynthesis (Barry and Giovannoni, 2007). In tomato, five ACO (LeACO1-5) have been identified and studied during fruit ripening.
Differential expression of three ACO (LeACO1, LeACO3, and LeACO4) genes have been described in tomato fruit. Expression of LeACO1 and LeACO4 in immature green stages have been studied and it has been shown that their accumulation increase at the onset of climacteric ethylene burst and ripening (Barry et al., 1996;
Nakatsuka et al., 1998).
At the onset of system 2 ethylene biosynthesis, a cascade of events signaling changes in activation of metabolism are triggered in climacteric fruits resulting in the progression of ripening. It has been demonstrated that ethylene regulates ripening in climacteric fruits by inducing changes in gene expression. This is achieved through different steps that involve the perception of ethylene, the transduction of the signal through regulators, and followed by altered gene expression. Perception of ethylene occurs through binding of ethylene to receptors at the endoplasmic reticulum, and possibly plasma membrane. Ethylene receptors (ETRs) are responsible for perception of ethylene and seven members of ETRs (ETR1-7) belonging to 2 subfamilies have been reported in tomato (Klee and Tieman, 2002). Receptors actively suppress the ethylene response in the absence of ethylene, and binding of ethylene to these receptors result in the removal of suppression. Tomato ethylene receptors show differential expression patterns throughout development and in response to
35 environmental stimuli (Klee and Tieman, 2002). It has been shown that LeETR1 and
LeETR2 are expressed constantly in all tissues throughout development, while
LeETR4-6 is abundantly expressed in reproductive tissues such as flowers and fruits.
An increase in LeETR4 and LeETR-5 expression have been noticed in ripening fruits
(Wilkinson et al., 1995; Lashbrook et al., 1998; Tieman et al., 2000). Ethylene signal transduction starts with the binding of ethylene to ethylene receptorsCTR1 (an
MAPKKK), lying downstream of these receptors has been shown to physically interact directly with the receptors at the endoplasmic reticulum (ER) (Gao et al. 2003). The binding of CTR1 to the ethylene receptors maintains the repression of ethylene responses in the absence of ethylene. The binding of ethylene to its receptor leads to the dissociation of CTR1 from the receptor making it inactive, resulting in the induction of ethylene responses (Zhong et al., 2007). CTR1 is a natural repressor (negative regulation) of ethylene signal transduction pathway (Ma et al., 2006b). Deactivation of
CTR1 activates downstream receptors and transcription factors, resulting in enhanced gene expression. Four CTRs (LeCTR1-4) have been identified in tomato (Leclercq et al., 2002; Adams-Phillips et al., 2004b). CTR1 encodes for a putative Raf 1 MAP- kinase kinase kinase (MAPKKK or MAP3K). Ethylene signal is transduced to messengers such as ethylene insensitive3 (EIN3) and EIL (ethylene insensitive like) through CTR1.
Several compounds are able to inhibit ethylene biosynthesis through different mechanisms including inhibition of ethylene receptor. 1-Methylcyclopropene (1-MCP) is a gaseous compound that binds to ethylene receptor and competitively inhibit ethylene binding. Other compounds such as aminoethoxyvinylglycine (AVG) and silver thiosulfate (STS) are also able to reduce ethylene biosynthesis and extend the shelf life of fruit acting through different mechanisms (Mordy et al., 1987; Anna et al.,
2002). Currently, 1-MCP is widely used to prolong the shelf life of horticultural produces (Ron et al., 1995; Fan et al., 2000).
36 Degradation of cellular components leading to the loss of cellular compartmentalization and tissue structure has been considered to occur during senescence (Paliyath and Thompson, 1990; Paliyath and Droillard, 1992). Thus, loss of membrane integrity has been proposed as a key event in plant senescence.
Phospholipase D initiates the first reaction producing phosphatidic acid in this process through hydrolysis of structural lipids such as phosphatidylinositol and phosphatidylcholine into PA and the respective head group (Pinhero et al., 2003).
Phosphatidic acid is then converted to diacylglycerol and subsequently to free fatty acids. PA has been reported to inhibit CTR1 in plant system (Testerink et al., 2007).
Therefore, the formation of more PA accelerates ethylene biosynthesis. If the activity of PLD could be inhibited, then the other enzymes in the lipid catabolic pathway are unable to act on the intermediates which translate to enhanced membrane stability and increased longevity of produce (Paliyath and Droillard, 1992; Tiwari and Paliyath
2011a). Studies have demonstrated that PLD activity may be selectively inhibited by primary alcohols such as hexanal and several technologies utilizing hexanal to prolong the shelf life of produce are currently under investigation (Paliyath et al.,
2008).
Phospholipids are important components of cell membranes. Besides playing a structural role, phospholipid components are also emerging as important signaling molecules in multiple processes in plants (Testerink and Munnik, 2011). Phospholipid metabolic pathway plays crucial role in plant growth and development (Walters et al.,
1994). Phosphoinositides are phosphatidylinositol (PI) with different number of phosphate on inositol head group. Currently, seven different phosphoinositides have been reported in plant excluding PI3,4,5P3 (Mueller-Roeber and Pical, 2002). Many observations support that PI metabolism is involved in cellular signaling particularly with the identification of several PI-related enzymes such as PI-PLC that could hydrolyze PI4,5P2 into DAG (Bae et al., 1998). PI metabolism is also involved in the activation of PLD (Pappan et al., 1997) and protein kinase C (Oh et al., 1998). PI-
37 metabolism isalso involved in various processes including response to hyperosmotic condition (Dove et al., 1997), stomatal closure (Blatt et al., 1990, Gilroy et al., 1990), cytoskeleton arrangement (Drobak and Watkins, 1994) and pollen tube growth (Kost et al., 1999). Phosphatidylinositol-3-kinase (PI3K) phosphorylates PI at 3-hydroxy position and produces a phosphoinositide with a phosphate molecule at the 3- position of the inositol head group. In mammalian system, multiple isoforms of PI3K have been identified including class I, II and III according to protein domain structure and substrate specificity (Vanhaesebroeck and Waterfield, 1999). Interestingly, only one isoform of PI3K has been identified in plant genome, known as Vps34 (Welters et al., 1994). AtVps34 has homology with ScVps34, a gene that is required for normal vacuolar protein sorting and vacuole segregation in yeast (Herman and Emr, 1990).
Further studies on Vps34p found that this protein could phosphorylate PI similar to
PI3K and regulate intracellular protein trafficking (Schu et al., 1993). Down-regulation of the AtVPS34 gene expression in Arabidopsis thaliana inhibited plant growth and development (Welters et al., 1994). In plant system, PI3K are also involved in several processes including vesicle formation (Matsuoka et al., 1995), trans-Golgi network to the lumen of the central vacuole (Kim et al., 2001a), regulation of chloroplast movement (Bovet et al., 2001), and regulation of transcription process (Bunney et al.,
2000). Similarly, 3-phosphorylated inositol could function as secondary messenger in cellular system (Vanhaesebroeck et al., 2001).
Recently, several PI3K inhibitors have been reported including wortmannin and LY294002 (Arcaro and Wymann, 1993; Walker et al., 2000). Wortmannin is a more potent PI3K inhibitor with IC50 at 5 nM as compared with LY294002 which has
IC50 at 1 με (Vanhaesebroeck et al., 2001). Wortmannin inhibition is mainly due to competitive inhibition of ATP binding to PI3K and subsequently changingPI3K conformation (Walker et al, 2000). The binding of wortmannin to positively charged amino acid residues such as lysine and arginine at protein catalytic domain occurs via covalent binding (Wymann et al., 1996).
38 PI3K may be involved in the early steps of PI metabolism, since PI3K activity can provide phosphoinositide which function as docking sites and substrates for plasma membrane degradation enzymes including PLC and PLD (Boss and Im,
2012). Interestingly, PLC and PLD proteins have a domain that can bind to phosphoinositides in particular PI4,5P2 (Rebecchi et al., 1992; Lomasney et al., 1999;
Pappan et al., 1997; Tiwari and Paliyath, 2011b). Therefore, the objective of the present study was to evaluate the effect of wortmannin-induced PI3K inhibition on tomato fruit ripening. The inhibition efficiency was compared with PLD inhibitor, hexanal and ethylene receptor binding inhibitor, 1-methylcyclopropene (1-MCP). The ripening parameters such as ethylene production, respiration rate, texture, weight loss and formation of pigments were evaluated. The expression of various ripening related genes was also was measured using real time PCR.
2.2 Materials and Methods
2.2.1 Fruit materials and treatments
Seeds of Solanum lycopersicum cv Sweetie (OSC Seeds, Waterloo, ON) were germinated and the seedlings were grown in a greenhouse at the University of
Guelph. Fruit were collected from plants at various stages of ripeness (mature green, turning orange, orange and red) to study gene expression in some of the early experiments. After harvest, peel and flesh of fruit were dissected out removing any seeds, frozen immediately in liquid nitrogen and stored at -80°C until further use for
RNA isolation. For treatments with various inhibitors, fruit from Solanum lycopersicum cv. De Ruiter at mature green stage were purchased locally (Elmira, Ontario) to maintain uniformity of growth stage and quality. Fruits were sorted and randomly separated into four groups for performing different treatments (wortmannin, hexanal,
1-MCP and control). Wortmannin (0.5 με) and hexanal (0.01 mε) treatment of
39 tomatoes were carried out by vacuum infiltration (600 mm Hg) for 1 minute and fruit subjected to vacuum infiltration for 1 minute served as the control. After treatments, fruit were air dried overnight in the dark and then stored at room temperature for sampling at various intervals. Treatment with 1-MCP (as vapour, 10 ppm) was carried out according to Tassoni et al (2006). Briefly, 20 mg of SmartFreshTM (0.14 % of active ingredient w/w) was dissolved in 1 mL water to provide a final gas concentration of 10 μδ/δ in a 1 δ air tight container with 80g fruit, and then stored overnight in the dark at room temperature. After 18 h of exposure, fruit were withdrawn from the container and stored at room temperature for further studies.
Three biological replicates were maintained for each treatment. Samples were collected at 1, 3, 6 and 10 day of storage for analysis of various ripening related quality parameters such as colour, fruit firmness, ethylene content, respiration rate, lycopene content and weight loss. Fruit pericarp tissues were frozen in liquid nitrogen and stored at -80 °C for gene expression analysis.
2.2.2 Measurement of ethylene and respiration rate
Tomatoes from various treatments were weighed and placed in 500 mL glass containers. Containers were sealed for an hour and the amount of ethylene and carbon dixode in the head-space was measured. For ethylene measurement, 1 mL of head-space gas sample was injected into a Varian CP-3380 gas chromatograph
(Varian Inc., Mississauga, ON) equipped with a 0.5 mL sample loop. The sample was separated with a 15 m x 0.32 mm Restek Rt-SPLOTTM capillary column
(Chromatographic Specialties Inc., Brockville, ON) and ethylene was detected with a flame ionization detector. Ethylene was quantified by commercial ethylene standards
(BOC Gases, Mississauga, ON) and normalized for fruit mass. For carbon dioxide detection, 3 mL of head-space gas sample was injected into an ADC infrared gas
40 analyzer (Nortech Control Equipment Inc., Etobicoke, ON) and quantified using a commercial standard (BOC Gases, Mississauga, ON).
2.2.3 Firmness
Fruit pericarp firmness was measured by a FirmTech 2 Fruit Firmness Tester
(BioWorks, KS, USA). The values were expressed as gram/mm (g/mm). Firmness was measured twice from 10 fruits of each replicate.
2.2.4 Tomato colour index
Color parameters such as brightness (L), green or red (a) and saturation, blue or yellow (b) were measured by a Minolta Colorimeter (Minolta CR-300 Chroma Meter,
Minolta, Ramsey, N.J.) calibrated with a white standard tile (L = 97.1, a+ = 0.29, and b+ = 1.82). Readings were recorded from both sides of the tomato from 10 fruits per replicate. The colour changes in tomato fruit was expressed as tomato colour index
(TCI) according to Richardson and Hobson (1987) as follows:
TCI =2000a/L (a2 + b2)1/2 Equation 1.1
2.2.5 Lycopene
Lycopene estimation was carried out according to the method of Fish et al (2002).
Tomato pericarp tissue (10 g) was homogenized in 10 mδ of water using Brinkmann™
Polytron™ Homogenizer fitted with PTA 10 probe (Kinematica, δuzen, Switzerland) and the slurry was incubated on ice in the dark. Then, 20 mL of hexane: acetone: ethanol (10:5:5 v/v) was added to the slurry and mixed thoroughly for 30 min on an orbital shaker at 180 rpm. Three mL of distilled water was added and then incubated
41 on ice for 30 min for phase separation. The absorbance of the top hexane layer was measured at 503 nm for lycopene estimation.
2.2.6 Weight loss
Weight loss for each replicate was determined by measuring the initial weight of fruit after treatment and the final weight on day 1, 3, 6 and 10.
2.2.7 Real time-polymerase chain analysis
RNA was extracted from each replicate of tomato fruit flesh using CTAB method and the concentration was determined by NanoDropTM (Thermoscientific, Wilmington, DE,
USA). The quality and integrity of RNA was confirmed by separation on agarose gel,
1.2% w/v (Sambrook et al., 1989). RNA was treated with RNase free DNAse (Thermo
Scientific) according to the manufacturer’s protocol. First strand cDNA was synthesized from 4 µg of total RNA with oligo(dT) primer using High Capacity cDNA
Reverse transcription kit (Life Technologies Inc. Burlington, ON, Canada) according to the manufacturer’s protocol.
The cDNA was diluted 10-fold before performing real time gene expression analysis. Real time- polymerase chain analysis was performed in a StepOneTM Plus
Real Time PCR System 2.3 (Applied Biosystems, Foster City, CA) by using SYBR
Green chemistry as a fluorescence signal. Primer pairs were designed specifically for qPCR based on various tomato mRNA sequences in the NCBI databases using primer 3 as listed in Table 2.1. Expression data were normalized using the actin or
TIP4 gene (Expósito-Rodríguez et al., 2008). The RT-reaction was carried out in β0 μl reaction volume by adding 10 μl of βX Perfecta Sybr Green FAST mix ROX (Quanta
Biosciences, Gaithersburg, εD), 5 μl template, 0.8 μl of forward primer, 0.8 μl reverse primer (β00 nε final concentration) and 4.β μl of water. The thermal cycling profile
42 Table 2.1. List of primers for real time PCR amplification.
Gene cDNA Forward and Reverse Primers
Phosphatidylinositol 3-kinase (PI3K) FP: CTCTGGCCCCTGGTATGTT
RP: AAATGTCAACCGCAATGGA
Phosphatidylinositol 4-kinase (PI4K) FP: TACAACAATTGCCGCACTG
RP: GACACGTGGATGACCCTTG
Phosphatidylinositol 4-phosphate 5- FP: TGGATGGTGAAGGGACTTATAC kinase (PI4P 5K) RP: CGACGCCATTCTCCTTCATA
Phosphatidylinositol phosphatase (PIP) FP: GACCCTCGGTTTCTTTGGA
RP: CCTTGGACAACTGGAAGCA
Phospholipase C (PLC) FP: ATCCTTCACGGAGGGACAC
RP: ACTCAGACGCCACAAATGC
Phospholipase D (PLD) FP: AGTGGGAAGCCGTGTAAGG
RP: CCCCACACCACCATGATAA
1-Aminocyclopropane-1-carboxylate FP: GATGACGAGACGATGAGGATTG synthase 1 (ACS1) RP: TTCCTCCTGCTGCATTGTT
1-Aminocyclopropane-1-carboxylate FP: TTGGCTGATCCTGGCGATGC synthase 2 (ACS2) RP:GCTCTCACAGTGAATTGGAATAAG
TTG
1-Aminocyclopropane-1-carboxylate FP: ACAAACAGACGGGACACGAA oxidase 1 (ACO1) RP: CTCTTTGGCTTGAAACTTGA
S-Adenosyl methionine synthestase FP: CAAACCAGTCATCCCAGAGA
(SAM1) RP: CACCATGAGGTCCACCAATAA
Ethylene receptor homolog 1 (ETR1) FP: TTGCCTGCTGACGACTTGC
RP: GCACCGAACTGCACAAGAACC
Ethylene receptor homolog 1 (ETR4) FP:TTGTAATGGCAGTCTCTTTTTCTCT
AC
43 RP:CACTTCATCACTTCCCTTTTTTCAA
C
Constitutive triple response 1 (CTR1) FP: GCTAATGGCAGTTGGTAACTGAAC
RP: CACTACACCAGCTCCGGC
MADS-box transcription FP: AACATCATGGCATTGTGGTG factor (MADFTF) RP: ATTCAAAGCATCCATCCAGG
Carotenoid isomerase (CRTISO) FP: GCGAAGAAAGAGGTTGTTGC
RP: GCAAGGTATCGTCTGTGGGT
Phytoene synthase 1 (PSY1) FP: CTGGAGAACGGACGATGACATC
RP: CAGTTGCCTCTTCACCAAGGC
Geranylgeranyl pyrophosphate synthase FP: ACCTAAGATCCATGAAGCAATGCG
2 (GGPS2) RP: AGGCAGCAAGACAGAGCATCG
1-Deoxy-D-xylulose-5-phosphate FP: ATGAACCTTTTCCATCGTCG synthase (DXS) RP: CAATGTGTTGGACCATCTGC
Actin FP: CATGCCATTCTTCGTTTGG
RP: TCAGCAGTGGTGGTGAACA
TIP4 a FP: ATGGAGTTTTTGAGTCTTCTGC a (Expósito-Rodríguez et al., 2008) RP: GCTGCGTTTCTGGCTTAG
44 consisted of an initial step of 95°C for 30 seconds followed by 40 cycles of 95°C for 10 seconds and 60°C for 30 seconds in 96-well reaction plate. Gene expression analysis was carried out from three biological replicates and three technical replicates of each sample. The fold change was calculated based on ΔΔCt method as follow:
ΔCt = Ct Gene of interest – Ct Housekeeping gene Equation 1.2
ct ΔΔ = ΔCtsample – (mean of ΔCtcontrol) Equation 1.3
Relative gene expression = 2-(Δct) Equation 1.3
Fold change = 2-(ΔΔct) Equation 1.4
2.2.8 Statistical analysis
Data obtained in the study from a completely randomized design (CRD) were analyzed using Minitab 14. Analysis of variance was performed by ANOVA procedure and significant (p<0.05) differences between means were determined using Tukey’s test.
2.3 Results
2.3.1 Phosphatidylinositol related enzyme gene expression during vine-ripened tomato ripening
Expression of several phosphatidylinositol (PI) related genes such as PI3K, phosphatidylinositol 4-kinase (PI4K) and phosphatidylinositol phosphate phosphatase
(PIP) were analyzed in tomato fruit at various stages of maturity (Figure 2.1).
Expression of Sl-PI3K was initially low at mature green and turning orange, but significantly increased at the orange stage and then its expression was significantly
45
Figure 2.1. Gene expression analyses of several genes involved in PI metabolism in cherry tomato fruit (cultivar Sweeties) at different maturity stages. The maturity stages of tomato include; mature green (MG), turning orange (TO), orange (OR) and complete red (RED). Relative gene expression was calculated by comparing with the expression of actin as a housekeeping gene. The means followed by different letters are significantly different at (p <0.05). Phosphatidylinositol 3-kinase (PI3K), phosphatidylinosiltol 4-kinase (PI4K) and phosphatidylinositol phosphatase (PIP).
46 decreased at red stage. However, Sl-PI4K gene expression increased significantly from mature green to turning orange and maintained a higher level at orange and red stages than at mature green stage. Expression of Sl-PIP was significantly higher in fruit turning orange than in mature green and orange stages.
2.3.2 Physiological changes in tomatoes during storage
εature green tomato fruit treated with wortmannin (0.5 με), hexanal (1%) and 1-MCP
(10 ppm) were stored at room temperature and sampled on day 1, 3, 6 and 10 days of treatment. Color development in tomatoes during the storage period was observed and recorded for each treatment (Figure 2.2). As shown in Figure 2.2, control fruit gradually changed from green to red by day 10 and ripened normally in a timely manner. On the contrary, ripening was inhibited in wortmannin treated fruit that remained green even after 10 days of storage. As expected, tomatoes treated with 1-
MCP showed delayed ripening and remained green until day 6, though some orange color development was noticed by day 10. In hexanal treated fruit, orange color development started at day 6, which became more prominent after 10 days of storage. However, ripening was also delayed and slower in hexanal treated tomato whencompared to that of control. These results showed that based on colour development, wortmannin was the most effective treatment in inhibiting ripening than other inhibitors.
2.3.3 Colour index
Tomato colour index (TCI) indicates changes in tomato colour measured at the mid region as L (brightness), a (a+-red colour intensity; a—green colour intensity) and b
(b+- yellow colour intensity). A change in TCI for different treatments during the storage time is presented in Figure 2.3. The red/green colour intensity for control fruit
47
Figure 2.2. Colour changes in tomato fruits subjected to various treatments and analyzed on day 1, 3, 6 and 10. Fruits from control, wortmannin (0.5 με), hexanal (0.1 mM) and 1-MCP (10 ppm) treatments are shown. Data represent one set of treatments from three sets.
48
Figure 2.3. Colour index (CI) of control, wortmannin (1%), hexanal (0.1 mM) and 1-
MCP (10 ppm) treated tomatoes during storage at room temperature. The data represents mean ± standard error of a+/a= from three different biological replicates.
Means followed by different letters are significantly different at p<0.05.
49 gradually increased during storage and the green colour on day 0 (a-) gradually decreased and turned positive on day10. Fruits treated with the inhibitors showed varying degrees of inhibition of colour development. Wortmannin and MCP treatments resulted in the highest level of ripening inhibition, and the fruits were still green on day
10 of analysis. Hexanal treated tomatoes had low a+ values which increased to positive value on day 10.
2.3.4 Firmness
The effect of different treatments on tomato fruit firmness during the storage was measured and the results are as shown in Figure 2.4. Firmness of control fruits fruit decreased gradually during storage.Fruits subjected to wortmannin and hexanal treatments showed similar trends as noticed the control. In contrast, 1-MCP treated fruit had higher firmness values than the control, hexanal and wortmannin treated fruit from day 03 until day 10.
2.3.5 Ethylene production
The levels of ethylene production in tomato fruits subjected to various treatments and control was measured from the headspace, and the pattern is as shown in Figure 2.5.
According to the results, an increase in ethylene production in control with respect to storage time was noticed. Wortmannin treated tomatoes followed a similar pattern of ethylene production rate as that of control and significant differences were not noticed between wortmannin and control treaments. Ethylene levels did not show much variation during the initial days of storage in hexanal treated tomatoes, but elevated level of ethylene was
50
Figure 2.4. Firmness (g/mm) of control, wortmannin (0.5 με), hexanal (1%) and 1-
MCP (10 ppm) treated tomatoes during storage at room temperature. The data represents mean ± standard error from three biological replicates. Means followed by different letters are significantly different at p<0.05.
51
Figure 2.5. Ethylene production of control, wortmannin (0.5 με), hexanal (1%) and 1-
MCP (10 ppm) treated tomatoes during storage at room temperature. The data represents mean ± standard error from three different biological replicates. Means followed by different letters are significantly different at p<0.05.
52 noticed at 6 and 10 days of storage. On the other hand, ethylene production was suppressed in 1-MCP treated tomatoes during the initial 6 days of storage, however, a dramatic rise in ethylene production was noticed on day 10. In general, except for
MCP treatment, other treatments did not show any significant differences in amount of ethylene released from tomatoes..
2.3.6 Respiration
Respiratory carbon dioxide production in control fruits was very similar throughout the storage period (Figure 2.6). Respiration rate of tomatoes treated with wortmannin and hexanal was significantly higher than the control initially, particularly on day 1, and 3.
But, during the later stages of storage, carbon dioxide production from wortmannin and hexanal treated tomatoes did not differ significantly from that of the control.
Tomato fruit treated with 1-MCP released significantly lower amount of carbon dioxide compared to control on day 1 and 6. However, on day 10, no significant difference in respiratory activity was detected among various treatments and control.
2.3.7 Lycopene content
As shown in Figure 2.7, lycopene content of tomatoes was low during the initial days of storage. However, lycopene content of control increased remarkably from day 6 onwards. In the present study, lycopene content in the control increased from 88.37 ±
29.5 mg/100 g tissues on day 6 to 154.06 ± 11.1 mg/100 g tissue on day 10 and was significantly higher than the other treatments. Wortmannin treated tomatoes had significantly lower lycopene content than the control particularly on day 3, 6 and day
10.The lycopene content of wortmannin treated fruit did not differ significantly from those that were treated with 1-MCP. Lycopene content in hexanal treated fruits followed the same trend as in control with an increase from day 6 to day 10.
53
Figure 2.6. Carbon dioxide production by control, wortmannin (0.5 με), hexanal (1%) and 1-MCP (10 ppm) treated tomatoes during storage. The data represents mean ± standard error from three different biological replicates. Means followed by different letters are significantly different at p<0.05.
54
Figure 2.7. Lycopene content of control, wortmannin (0.5 με), hexanal (1%) and 1-
MCP (10 ppm) treated tomatoes during storage at room temperature. The data represents mean ± standard error from three different biological replicates. Means followed by different letters are significantly different at p<0.05.
55 Tomatoes treated with 1-MCP had the lowest lycopene content at all time points and it did not vary considerably throughout the storage period.
2.3.8 Weight loss
The effect of different treatments on weight loss during the storage of tomatoes was evaluated, and the results are as shown in Figure 2.8. There is a gradual decrease in fruit weight in the control with respect to storage time. Interestingly, 1-MCP treated fruit exhibited the highest fruit weight loss by the end of the storage period which is also equivalent to that of the hexanal treated tomatoes on day 10. In general, control and wortamannin treatments had lower weight loss compared to the other treatments.
2.3.9 Quantitative analysis of gene expression by Real-time PCR
In the present study, targeted sites in the ethylene signal transduction sequence were inhibited to compare the downstream changes in gene expression that are involved signal transduction and evolution of quality characteristics. ETR, the ethylene receptor was blocked by using the ethylene analogue 1-MCP, PI3K action was inhibited by wortmannin, and PLD was inhibited by hexanal. Expression patterns of genes encoding several proteins and enzymes that are involved in tomato fruit ripening were measured. Fold change values of respective gene expression at different storage time were compared with that of the control on days 1, 3, 6 and 10 after treatment.
2.3.9.1 Expression analysis of genes involved in ethylene biosynthesis
Results from the present study suggest that various treatments influence the degree of ripening and quality parameters of tomato fruits. Ethylene biosynthesis continues to proceed during ripening of climacteric fruits manifested as the autocatalytic ethylene
56 production. During this process, genes involved in ethylene biosynthesis are overexpressed, and if the autocatalytic ethylene biosynthesis is inhibited, this should be reflected in the expression of genes involved in ethylene biosynthesis. Therefore, expression analysis of genes involved in ethylene biosynthesis such as 1- aminocyclopropane-1-carboxylate synthase 1 (ACS1), 1-aminocyclopropane-1- carboxylate synthase 2 (ACS2), 1-aminocyclopropane-1-carboxylate oxidase 1
(ACO1) and S-adenosyl methionine synthestase (SAM1) were carried out to determine the possible effects of various treatments on the transcript accumulation
(Figure 2.9). Wortmannin treatment resulted in an upregulation of Sl-SAM in fruit on day 1 and day 6 compared to the control. SAM synthase channels Methionine into S- adenosyl methionine, the precursor to ACC. Initial increase in SAM synthase gene expression may be due to the physiological effects of treatment. Though an increase was observed on day 6 in wortmannin treated fruits, this did not persist, and on day
10, the expression of SAM synthase was similar to that of the control fruits.
Expression of ACS1 was variable showing an initial upregulation followed by a subsequent downregulation; while ACS2 was continuously upregulated than the control during the storage period. Similarly, ACO1 also showed increased accumulation of transcripts than the control during the 10 day storage period. Thus
ACS2 and ACO1 were upregulated in response to wortmannin treatment as illustrated in Figure 2.9.
The effect of the hexanal and 1-MCP treatments on the expression of genes involved in ethylene biosynthesis was also carried out as shown in Figure 2.10.
Initially, on day 1, expression of Sl-SAM, ACS2 and Sl-ACS1 showed an upregulated expression in both hexanal and MCP treated tomatoes. On day 3, downregulation of
Sl-SAM was detected in both 1-MCP and hexanal treatments. In 1-MCP treated tomatoes, a sharp peak in the Sl-SAM expression was detected on day 6 which decreased towards the end of storage period. Expression of Sl-ACS1 showed a similar pattern in both hexanal and 1-MCP treatment until day 6 and later on day 10,
57
Figure 2.8. Weight loss in control, wortmannin (0.5 με), hexanal (1%) and 1-MCP (10 ppm) treated tomatoes during storage at room temperature. Data represent means ± standard errors from three biological replicates. Means followed by different letters are significantly different at p<0.05..
58
Figure 2.9. Effect of wortmannin treatment (0.5 με) on gene expression analyses for ethylene-related biosynthetic enzymes. The data represents mean ± standard error of the fold change by comparing with housekeeping gene (Actin) and control. Means followed by different letters are significantly different at p<0.05.
59
Figure 2.10 Effect of hexanal (0.1mM) and 1-MCP (10 ppm) treatments on gene expression of ethylene related biosynthesis enzymes as compared with control. The data represents mean ± standard error of the fold change by comparing with housekeeping gene and control. Means followed by different letters are significantly different at p<0.05.
60 elevated expression was noticed in MCP treated fruits than the control and hexanal treated fruits. Continuous upregulation of Sl-ACS1 during the storage period was noticed in hexanal treated fruits. Only a marginal change in expression of ACS2 was detected in 1-MCP-treated fruits during storage. In contrast, Sl-ACO1 was downregulated initially (1day) in the hexanal and MCP treated fruit, but showed increased expression on day 3 of storage. Hexanal treated fruits showed a higher level of Sl-ACC2 during storage, while the expression levels of Sl-ACO1 was similar to that in control fruits during the latter part of storage In the present study, hexanal treatment significantly increased the expression of Sl-ACS2 and Sl-ACO1 than the control and on the contrary, 1-MCP treatment significantly reduced the gene expression of Sl-ACS2 and Sl-ACO1 at certain sampling times.
2.3.9.2 Expression analysis of genes involved ethylene signal transduction
Several genes involved in ethylene signal transduction were analyzed in tomato fruits subjected to various treatments. These genes included ETR1, ETR4, CTR1 and a ubiquitous transcription factor, MADS box transcription factor (MADF-TF). There were no major changes in the expression of the receptor genes ETR1, while a significant down regulation of ETR4 was observed in response to wortmannin treatment (Figure
2.11). A consistent pattern was not observed in the expression of Sl-CTR1 after wortmannin treatment (Figure 2.12). Sl-MADSTF expression in general showed downregulation with respect to control from day 3 till day 10 of storage, though it was upregulated on day 1 in tomatoes treated with wortmannin.
Hexanal and MCP treatments did not alter the expression of ETR 1 in tomato fruits, as observed with wortmannin treatment. Hexanal treated fruits showed a slight increase in ETR4 expression, but it was stable in 1-MCP treated fruits. 1-MCP treatment resulted in a general reduction in CTR1 transcript levels. A significant upregulation of Sl-ETR4 detected in 1-MCP treated fruits on day 1 was followed by
61
Figure 2.11. Effect of wortmannin treatment (0.5 με) on gene expression for ethylene signal transduction-related genes. The data represents mean ± standard error of the fold change by comparing with housekeeping gene and control. Means followed by different letters are significantly different at p<0.05.
62
Figure 2.12 Effect of hexanal (1%) and 1-MCP (10 ppm) treatments on gene expression of ethylene signal transduction genes. The data represent mean ± standard error of the fold changes obtained after comparison with the housekeeping gene and control. Means followed by different letters are significantly different at p<0.05.
63 downregulation on day 3 and day 6 of storage. Except for an upregulation of Sl-
MADSTF on day 3 of 1-MCP treatment; levels of Sl-MADSTF was almost undetectable during the remainder of the storage period. Upregulated expression of
Sl-ETR4 and Sl-MADSTF was noticed in tomatoes subjected to hexanal treatment and the expression was highest on day 1. In general, expression patterns of signal transduction genes was quite variable in fruits subjected to Wortmannin, 1-MCP, and hexanal.
2.3.9.3 Expression analysis of genes involved in carotenoid biosynthesis
Biosynthesis of carotenoids is a highly regulated process during tomato fruit ripening.
Expression levels of several genes in carotenoid biosynthetic pathway are modulated during ripening of tomato fruits. Thus carotenoid biosynthetic pathway genes are key indicators of the ripening status of tomato fruits. In this study, expression levels of
DXS, GGPPS, PSY1, and CRTISO, were analyzed after Wortmannin, hexanal and 1-
MCP treatment. Expression of Sl-DXS, GGPPS, Sl-PSY1 and CRTISO followed a very similar pattern of increase during storage in response to wortmannin treatment
(Figure 2.13) even though on day 1 after treatment, the expression patterns were inconsistent. GGPPS transcript levels were upregulated in Wortmannin treated fruits on day 10 of storage. Thus, Wortmannin treatment did not result in a downregulation of carotenoid biosynthetic genes.
Hexanal treatment significantly increased the expression of Sl-GGPS2, Sl-
DXS, Sl-CRTISO and Sl-PSY1 than the control (Figure 2.14). Expression of these genes was also highest on day 01 than the other later sampling times which showed a gradual decline in expression level. In general, expression levels of these genes were much higher than 1-MCP treated fruits throughout the storage period. Pigment development genes Sl-DXS and Sl-CRTISO responded in a similar way in 1-MCP treated tomato fruits with an almost stable expression throughout the sampling time.
64
Figure 2.13 Effect of wortmannin (0.5 με) treatment on the gene expression of genes involved in pigment development during storage as compared with control. Data represents mean ± standard error of the fold change by comparing with housekeeping gene and control. Means followed by different letters are significantly different at p<0.05.
65
Figure 2.14 Effect of hexanal (1%) and 1-MCP (10 ppm) treatments on gene expression of genes involved in pigment development during storage. Data represents mean ± standard error of the fold change by comparing with housekeeping gene and control. Means followed by different letters are significantly different at p<0.05.
66 except for an upregulated expression which was noticed on day 3 of storage. On the other hand, Sl-PSY1 exhibited a highly variable expression pattern in response to 1-
MCP treatment. Downregulated expression of Sl-PSY1 detected on day 01 was dramatically enhanced to an upregulation by day 03, and subsequently reduced during storage. In general, hexanal and 1-MCP showed contrasting expression patterns. While 1-MCP downregulated carotenoid biosynthetic genes, hexanal upregulated the expression of these genes
2.3.9.4 Expression analysis of genes involved in PI metabolism
In order to evaluate if Wortmannin treatment which inhibits PI3K activity, also down regulates the expression of other PI metabolism related genes as a compensative process, expression profiling of genes including phoshatidylinositol 3-kinase (PI3K), phoshatidylinositol 4-kinase (PI4K), phosphatidylinositol 4-phosphate 5-kinase (PI4P
5K) and phosphatidylinositol phosphatase (PIP) were conducted in tomato fruits subjected to different treatments. As well, expression levels of genes for phospholipid degrading enzymes such as phospholipase C (PLC) and phospholipase D (PLD) were carried out in tomato fruit subjected to various treatments (Figure 2.15).
Wortmannin treatment significantly reduced the expression of PI3K, only on day 3 of storage compared to the control, while analysis during the rest of the storage period showed upregulated levels of PI3K transcripts. Interestingly, significant downregulation of Sl-PI4K in response to wortmannin treatment was detected throughout the storage period. Wortmannin induced downregulated expression of Sl-
PI4P5K noticed on days 1 and 3 was gradually enhanced to upregulation on day 10 of storage. Also, lower expression of Sl-PIP than the control was detected in fruit on days 1 and 3 in response to wortmannin treatment. A noticeable decrease in the transcript levels of Sl-PLC and Sl-PLD was also noticed in response to wortmannin treatment in tomato fruit (Figure 2.15).
67
Figure 2.15 Effect of wortmannin treatment (0.5 με) on gene expression analysis of phosphatidylinositol-related biosynthesis enzymes and plasma membrane lipid degrading enzymes in tomato fruits during storage. Data represents mean ± standard error of the fold change by comparing with housekeeping gene and control. Means followed by different letters are significantly different at p<0.05.
68
Figure 2.16 Effect of hexanal (1%) and 1-MCP (10 ppm) treatments on gene expression analyses for phosphatidylinositol-related biosynthesis enzymes and membrane lipid degrading enzymes during storage as compared with control. Data represents mean ± standard error of the fold change by comparing with housekeeping gene and control. Means followed by different letters are significantly different at p<0.05.
69 According to the gene expression data, expression of Sl-PI3K and Sl-PI4K, did not vary from the control in response to hexanal and 1-MCP treatment as presented in
Figure 2.16. Expression levels of PI3K, PI4K and PIP were relatively stable during the storage period in both hexanal and 1-MCP treated fruits. PLC gene expression was increased on day 6 and 10 in fruits subjected to MCP treatment, while hexanal treatment had only a minimal effect. By contrast, both MCP and hexanal treatment downregulated PLD expression during storage (Fig 2.16).
2.4 Discussion
2.4.1 Comparison of physiological changes of tomatoes in response to wortmannin, hexanal and 1-MCP treatments
Fruit ripening is a complex, highly regulated and coordinated process that involves the activation of many biochemical processes. Ethylene plays a vital role in ripening of tomato fruit. The development and use of hexanal as an inhibitor of phospholipase D to prolong the shelf life and quality of produces have been previously reported
(Sharma et al. 2010; Tiwari and Paliyath 2011a; Cheema et al. 2014). Also, the involvement of PLD in membrane catabolism that occurs during ripening of fruits and senescence has also been established (Paliyath et al., 1987; Paliyath and Droillard,
1992; Pinhero et al., 2003; T iwari and Paliyath 2011a). The role of PLD in membrane phospholipid degradation, and the mechanisms involved in activation of PLD during fruit ripening has been a subject of thorough investigation. Hexanal has been identified as an effective inhibitor of PLD and is under trials for the preservation and extension of shelf life in fruits.
PLD action is a part of ethylene signal transduction. PLD binds to the membrane during the induction of senescence which was mediated by a calcium stimulated activation of the C2 domain and enabling its membrane translocation that
70 initiates phospholipid degradation. It was also found that PLD C2 domain has an increased affinity to anionic lipids such as its own product PA, and phosphoinositides.
Thus in the cycle of membrane lipid degradation, generation of negatively charged microdomains may enable the membrane binding of PLD when ripening is activated by ethylene. PI3K is another enzyme which possesses a C2 domain. To analyze the interaction of these major components, inhibitors were used to evaluate their influence on ripening of tomato fruits and expression of key genes involved in ethylene signal transduction pathway. With this goal, tomato fruits were treated with wortmannin (an inhibitor of PI3K), hexanal (an inhibitor of PLD) and 1-MCP (an ethylene receptor blocker), and were stored at room temperature for 10 days after treatment to evaluate and compare their effects on fruit ripening and senescence. Wortmannin, a furanosteroid metabolite from fungi including Penicillium funiculosum and
Talaromyces wortmanni is an inhibitor of PIγKs and PIγ’kinase-related kinases
(PIKKs) such as DNA-dependent protein kinase (DNA-PK) (Walker et al., 2000). 1-
MCP has been extensively used commercially to delay ripening and increase the shelf life of various fruit through blocking ethylene receptors (Wills and Ku, 2002; Watkins and Miller, 2005). Utilizing these chemicals of known activities/actions enabled us to understand how their actions are modulated during metabolic processes involved in ripening. Evidences from this study demonstrated that wortmannin treatment delayed the ripening and senescence of tomato fruit considerably prolonging their shelf life.
Fruit subjected to wortmannin treatment remained green until day 10 in a manner better than those treated with 1-MCP. Hexanal treatment also delayed tomato ripening to some extent, but not to the level of 1-MCP or wortmannin treatments. This is in agreement with previous reports wherein hexanal/hexanal formulation applied as a preharvest spray or as postharvest dip was able to extend the shelf life of tomato during storage (Tiwari and Paliyath, 2011a; Cheema et al., 2014). Firmness of both wortmannin and hexanal treated fruits decreased gradually during storage similar to
71 that of control. In contrast, 1-MCP treated fruit maintained higher firmness even after storage for 10 days, higher than control and other treatments.
The level of ethylene production in various treatments was not significantly different except for 1-MCP treated fruits that showed suppressed ethylene production during the first 6 days of storage followed by a sudden rise in ethylene production on day 10 which was similar to that of control. This response is not unusual for 1-MCP, which is an ethylene blocker that exerts its action by inhibiting ethylene production through receptor binding. A dramatic increase in ethylene production during the final day of storage might be the effort of fruit trying to overcome the block in ethylene synthesis by trying to overproduce ethylene. For other treatments, ethylene production was similar to the control.
Wortmannin and 1-MCP treated fruit had negative TCI values on day 10 which indicated that the fruit were remaining green, while TCI for control and hexanal treated fruit gradually increased during the storage. The lowest lycopene content, firmness and TCI was found in 1-MCP treated fruits. Expression profiles of carotenoid biosynthesis related genes were in agreement with the data on lycopene and color index. Accumulation of carotenoid pigments including lycopene and –carotene are responsible for the characteristic red color of ripe tomato fruit (Fraser et al., 1994).
Biosynthesis of carotenoids occurs through a complex pathway involving many enzymes including DXP synthase (DXS), GGPP synthase (GGPS), phytoene synthase (PSY) and carotene isomerise (CRTISO) (Bramley, 2002). Many of these genes are upregulated during ripening. Expression of Sl-DXS, Sl-CRTISO and Sl-
PSY1 showed an overall downregulation than the control as a consequence of wortmannin treatment. It was also noticed that 1-MCP treatment did not induce much changes in the expression of these genes. On the contrary hexanal treatment significantly increased the expression of Sl-GGPS2, Sl-DXS, Sl-CRTISO and Sl-PSY1 than the control. Hexanal treatment is known to increase the red colour values of treated tomatoes (Cheema et al., 2014).
72 2.4.2 Genes involved in ethylene biosynthesis and signaling
Distinct differences in the expression patterns of some of the genes involved in ethylene biosynthesis, reception and signal transduction were noticed in response to wortmannin, hexanal and 1-MCP treatment, when compared to the control. Increased accumulation of transcripts of Sl-ACS2 and Sl-ACO1 genes involved in ethylene biosynthesis were noticed in response to wortmannin treatment. Hexanal treatment also resulted in upregulation of Sl-ACS2 and Sl-ACO1, while transcripts of Sl-ACS2 and Sl-ACO1 were reduced in 1-MCP treated fruits. ETR1 expression did not fluctuate in response to various treatments, while ETR4 showed a downregulation in response to wortmannin and 1-MCP. Expression of the major regulator of ethylene signaling, CTR4, increased at certain sampling time, and the downstream MADS box transcription factor gene was downregulated in wortmannin treatment. The overall transcript accumulation in response to treatments was evaluated. Generally there was a downregulation of ethylene biosynthesis receptors, CTR1 and transcription factor of ethylene biosynthesis genes in response to 1-MCP treatment since 1-MCP is a potent ethylene biosynthesis inhibitor. Some common similarities in the expression profiles of genes were identified for both hexanal and wortmannin treatments. The expression profiles of genes involved in ethylene biosynthesis suggest there is ethylene production occurring in hexanal and wortmannin treated fruits, but there might be a suppression or inhibition in the ethylene signal transduction and downstream procedures that prevent or lowers the downstream gene expression.
73 2.4.3 Differences in the expression of genes involved in phospholipid metabolism
Wortmannin is known to be a potent PI3K inhibitor and is able to inactivate PI3K by binding to positively charged amino acid region at enzyme catalytic domain such as
Lys-802-to-Arg (Wymann et al., 1999). Wortmannin is also able to inhibit PI4K activity in the plant system (Jung et al., 2002). Interestingly, the levels of PI3K transcripts remained stable in wortmannin treated fruits. However there was a marked downregulation of the PI4K activity in fruits in response to wortmannin. At present the levels of PI, and PI3P and PI4P could not be determined because the lack of sensitivity in experimental methods. It is likely that while PI3K may respond to the ethylene signal transduction, PI4K activity may also be involved in generating negatively charged domains in the membrane that would attract PLD from the cytosol.
Besides this, down regulation of Sl-PLC and Sl-PLD throughout the various sampling time was also noticed in wortmannin treated fruits.
Downregulation of Sl-PLD and Sl-PLC were detected in response to hexanal treatment. Thus in the present investigation we were able to further confirm the previously reported PLD inhibitory activity of hexanal, and its influence on ripening and senescence. Reduction in the expression of PI-related enzymes including the
PI3K and PI4K in the plant system by wortmannin treatment has been reported previously (Jung et al., 2002). Hexanal treatment on the other hand did not significantly modify the expression of PI-related enzymes, PI3K and PI4K during the
10 day storage period. But it indeed altered the transcript levels of Sl-PLD and Sl-
PLC. This evidence further supports the PLD inhibitory mechanism of hexanal in delaying senescence and prolonging shelf life of produced via inhibition of plasma membrane degradation (Tiwari and Paliyath, 2011a). Modification in the expression of either PI3K or PI4K was noticed in tomatoes with respect to 1-MCP treatment. But in response to 1-MCP treatment, a notable reduction in the expression of PLD, and PLC
74 was detected. The reduction in the expression of PLD/PLC may result in a decrease in the level of PA, another second messenger which is also involved in inhibiting CTR in the ethylene signal transduction pathway.
2.4.4 Proposed mechanism of inhibition of PI3K mediated inhibition/suppression of ripening and senescence
There is a rapid increase in autocatalytic ethylene synthesis at the onset of ripening in climacteric fruits and also in senescing ethylene-sensitive plant organs (Nakatsuka et al., 1998; Barry et al., 2000; Kim et al., 2001b). Ethylene perception occurs through ethylene receptors that are negative regulators of ethylene signaling. Ethylene binding turns the receptor activity on, resulting in the removal of the downstream block on ethylene signal transduction (Lin et al., 2009). Recently, it has been reported that ethylene receptor degradation controls the timing of tomato fruit ripening and that ethylene receptors, ETR4 and ETR6 are rapidly degraded in the presence of ethylene through a proteasome-dependent pathway (Kevany et al., 2008). Ethylene signaling is mediated through the intervention of CTR1 (MAPKKK Raf-1) located downstream of the receptors exerting a major regulatory role in regulating ethylene signal transduction (Testerink et al., 2007). Once ethylene binds to the receptor, the association between receptor and CTR1 turn CTR1 into inactive state and pathways downstream of CTR1 such as EIN2 and EIN3 become activated and enhancing ethylene-related gene expression (Stepanova and Alonso, 2005). It has been reported that LeCTR1 expression was induced by ripening and exogenous ethylene application
(Adams-Phillips et al., 2004b). Activity of CTR1 can be controlled by the binding of PA to its kinase domain (Testerink et al., 2007). So the amount of PA might be a regulator of CTR1 activity and ethylene signaling. Generally, PA is produced by two modes, either by the direct activity of phospholipase D (PLD, EC 3.1.4.4) or by the sequential activity of phospholipase C and diacylglycerol kinase (Munnik and Testerink, 2009).
75 Increased generation of PA has been reported to occur as an early response to stress
(Wang, 2005; Bargmann and Munnik, 2006). One of the direct effects of enhanced levels of PA in the system may be the turning on and triggering of the ethylene signalling system and downstream response processes through CTR1. It has been reported that PA may directly affect the ethylene signal transduction pathway via an inhibitory effect on CTR1 (Jakubowicz et al., 2010).
There is an increase in PLD activity in fruits generating PA during tomato fruit ripening (Pinhero et al., 2003). PLD-derived PA has also been implicated in promoting stomatal closure in Vicia faba (Jacob et al., 1999). Suppression of PδDα1 also conferred freezing tolerance in Arabidopsis (Rajashekar et al., 2006). According to the present investigation, delayed ripening in tomato induced by PLD inhibition was further intensified by PI3K inhibition. PLD has a C2 domain that can bind Ca and it also has affinity towards lipid binding to acidic phospholipids such as PI, PIP, and
PI4,5P2. It is also possible that phsophatidylinositol 3-phosphate (PI3P) may favour the activities of PLD by generating anionic domains through phosphorylation of phosphatidylinositol catalyzed by PI3K, to form phosphoinositides (Pak-Dek et al.,
2014). The Solanum lycopersicum PδDα-C2 domain shows a higher affinity towards acidic phospholipids such as PA, PI, PI3P and PI4,5P2 as compared to phosphatidylcholine which is the major membrane phospholipid present in plants, and a substrate of PLD (Tiwari and Paliyath, 2011a). Thus, phosphorylation of phosphatidylinositol is catalyzed by PI3K, and subsequent generation of phosphoinositides may generate the anionic domains for PLD binding and could be an upstream event of PLD binding and membrane lipid catabolism. Increased levels of cytosolic PLD may progressively bind to these domains propagating the membrane lipid degradation. Thus, PI3K might be acting upstream of PLD. Therefore, inhibiting
PI3 can reduce the activities of PLD and the progression of ethylene signal progression and transduction. It is also likely that inhibition of PI3K might have
76 lowered the levels of lipolytic products of PI3K that act as signaling molecules in a number of processes (Wang et al.2002b).
When the activity of PLD was inhibited or suppressed through hexanal application, a delay in ripening of tomato was noticed. But when PI3K was inhibited, a dramatic increase in the inhibition of the ripening process occurred which was much more effective than the ripening inhibition attained through PLD inhibition or by 1-MCP treatment. Though several reports on the involvement of PI3K in stress response, defense, and other functions in plants systems are available, this is the first report that clearly demonstrate the involvement of PI3K in the ripening process. This finding has promising commercial applications in the sense that by inhibiting PI3K activity, the ripening of climacteric fruits such as tomato canl be delayed or inhibited. Inhibition of both PLD and PI3K activities will be a better and improved way to improve the shelf life and quality of produces.
2.5 Conclusions
Ripening is an important process in the fruit development though studied in detail, there is very little information on PI metabolism and its role in fruit ripening. PI3K is the first enzyme that initiates PI phosphorylation. Results from this study shows that PI- metabolism is required for normal fruit ripening. The regulation of PI3K in climacteric fruit ripening offers another control point that can be used in order to prolong the fruit shelf life and delay senescence which is regulated by ethylene. Understanding the roles of PI3K at the genetic level will provide detail information regarding PI metabolism and ripening. The study also identifies PI3K as a regulatory point in ethylene signal transduction. Detailed investigations are needed to fully understand the precise mode of activity of PI3K/P14K in fruit ripening and ethylene signaling.
77 CHAPTER III
MODULATION OF Sl-PHOSPHATIDYLINOSITOL 3-KINASE (Sl-PI3K) ENHANCES
ETHYLENE BIOSYNTHESIS AND SENESCENCE IN NICOTIANA TABACUM
3.1. Introduction
Plant senescence is a complex process that involves a network of molecular and enzymatic events that start with activation of receptors by hormones, signal transduction, gene expression, and synthesis of related proteins and enzymes, and finally results in a physiological response (Zimmermann & Zentgraf, 2005). Ethylene is the primary hormone that initiates senescence manifested in fruit ripening, wilting of flowers, protection from fungal pathogens, and adaptation to environmental stresses
(Noode & Penney, 2001). In plant systems, senescence is associated with a progressive increase in ethylene biosynthesis (Reid, 1995; Bleecker and Kende,
2000) observed during leaf senescence, wilting of flowers as well as ripening and senescence of fruits, often combined with a climacteric peak resulting from autocatalytic ethylene biosynthesis (Aharoni & Lieberman, 1979). Moreover, the action of several other key components is associated with senescence including calcium ion, abscisic acid (ABA) salicylic acid (SA), jasmonic acid (JA) and polyamines, which have been proven to interact with ethylene at biochemical and genetic levels (Tuteja, and Sopory, 2008; Botha and Whitehead, 1992).
Ethylene receptors are analogous to bacterial two component systems, such as ETR1 (Schaller and Bleecker, 1995; Rodrıgueź et al., 1999; Clack et al., 1998;
Cancel and Larsen, 2002), ERS1 (Clack et al., 1998) and EIN4 are transferring ethylene signals to downstream component including CTR1 through phosphorelay mechanisms (Ju et al., 2012). A Raf-like kinase termed CTR1 (Gao et al., 2008) regulates downstream signal transduction processes from the ethylene receptor.
78 Naturally, CTR1 functions as negative regulator of ethylene signal transduction, inhibiting the action of downstream components (eg. EIN 2, 3), in the absence of ethylene. Upon binding of ethylene to its receptors such as ETR1, ETR2, ERS1,
ERS2 and EIN4, CTR1 has been proposed to dissociate from the receptors, thus becoming unable to continually phosphorylate EIN2 and inhibit signal transduction.
Free EIN2 changes its C-terminal cleavage and nuclear localization allowing the expression of ethylene signal by activating transcription factors for ethylene responsive genes and promoting ethylene induced gene expression (Ju et al., 2012).
Metabolism and degradation of endoplasmic reticulum and plasma membrane has been identified as an early event that occurs during plant senescence (Paliyath et al., 1987; Paliyath and Droillard, 1992; Pinhero et al., 2003), however, the precise link between ethylene receptor activation and initiation of membrane degradation has not been fully unraveled. Phospholipids are degraded through a cascade of catabolic reactions (Paliyath and Thompson, 1987), stimulated by calcium at micromolar levels.
Phospholipase D (PLD) is the key enzyme that initiates and propagates phospholipid degradation resulting in the generation of phosphatidic acid. PLDs of the α, , and types are cytosolic enzymes which possess a calcium-binding N-terminal C2 domain, that enables them to translocate to the membrane in response to a physiological increase in cytosolic calcium that may occur in response to ethylene stimulation (Qin et al., 1997; Tiwari and Paliyath, 2011a). However, under certain conditions, these enzymes can bind to the membrane even without getting activated by calcium, because of their ability to bind to anionic sites in the membrane. In addition, phosphatidic acid (PA) which is a direct product of PLD action has been shown to inhibit the key negative regulator of ethylene signal transduction, CTR1 (Testerink et al., 2007). Thus, PLD action can play multiple roles during ethylene signal transduction.
This study also evaluates the potential link between PI3K activation and initiation of membrane lipid degradation by phospholipase D (PLD). Solanum
79 lycopersicum PδDα-C2 domain shows more affinity towards acidic phospholipids such as PA, phosphatidylinositol, phosphatidylinositol monophosphate (PIP), and phosphatidylinositol 4,5-diphosphate (PIP2) as compared to phosphatidylcholine, which is the major membrane phospholipid present in plants, and a substrate of PLD
(Tiwari and Paliyath, 2011b). This suggests that creation of anionic domains after ethylene receptor activation may be a preferred means of attracting PLD to the membrane. Once PLD action is initiated and PA domains generated, increasing in cytosolic PLD may progressively bind to the PA domains propagating the membrane lipid degradation. Leakage of calcium from the apoplast resulting as a result of increasing membrane destabilization may also drive this process (Pinhero et al.,
2003). Thus, phosphorylation of phosphatidylinositol catalyzed by PI3K, and subsequent generation of phosphoinositides may generate the anionic domains for
PLD binding and could be an upstream event of PLD binding and membrane lipid catabolism. Negatively charged PIP and PIP2 could also serve as binding site for enzymes having plextrin homology (PH fold) (Frech et al., 1997). Enzymes such as phospholipase C strongly binds to phospholipids vesicle in the presence of phosphatidylinositol 4,5-biphosphate (Rebecchi et al., 1992).
In the present study, the potential role of PI3K in plant senescence was investigated. Phosphatidylinositol 3-kinase (PI3K) is an enzyme that phosphorylates
PI at 3-hydroxyl position to produce PI3-P (Raynaud et al., 2007). Uniquely in plant, only one class (class III) of PI3K has been identified so far, while mammalian systems have two other classes. In mammalian system, PI3K class III can only phosphorylate
PI to produce PIP, with phosphorylation at 3 position of inositol head group (Lee et al.,
2008b; Foster et al., 2003). In the present study, Solanum lycopersicum PI3K genes were overexpressed in tobacco (Nicotiana tabacum) with its full coding sequence
(OX), and its function downregulated using a short hairpin antisense (sh) construct in order to investigate the function of PI3K in ethylene biosynthesis and senescence.
Ethylene production levels from the flowers as well as morphological changes
80 associated with the overexpression or reducing the expression of PI3K was monitored in transgenic tobacco plants. Our findings suggested a model sequence of signal transduction events involving PI3K that are induced after ethylene perception during senescence.
3.2 Materials and Methods
3.2.1 Total RNA extraction and cDNA synthesis
Total RNA extraction and first-strand cDNA were carried out as described in section
2.2.7.
3.2.2 Construction of the PI3K overexpression and short-hairpin antisense plasmids
The full sequence of PI3K was designed based on the sequence data of Solanum lycopersicum PI3K in Genbank and was amplified using PCR. The sequences for
PI3K overexpression (OX), and PI3K short-hairpin antisense (sh) at C2 domain, were amplified via PCR amplification with full sequence of plasmid DNA as a template and primers listed in Table 3.1. Each PCR reaction was conducted using 0.5 μδ Platinum
Taq DNA Polymerase (Invitrogen), 1 X reaction buffer, 1.5 mM MgCI2, 0.β με forward primer and reverse primers, and 1 μδ of cDNA in a total volume of 50 μδ. The amplified fragments were digested with BamH1 and ligated to the N terminus of the
GFP coding region in pGreen vector (Hellens et al., 2000). The ligated plasmid was transformed into (E. coli strain DH5-α) using heat-shock technique and positive colonies were selected by PCR. Plasmids retrieved from positive colonies were
81 Table 3.1. List of primers for cloning and real time PCR amplification.
Gene cDNA Forward and Reverse Primers
*Sl-Phosphatidylinositol 3-kinase FP:CGGATCCATGAGTGGAAACGAATTCAGG
(PI3K) RP:ATGGATCCCACGCCAGTACTGAGC
*Sl-Phosphatidylinositol 3-kinase FP: AATGGATCCGGTCCCAAGGGAGG
(PI3K) shorthaipin antisense (sh) RP:AAAGGATCCCTGCAAAAATCAACAACCACAT
AC
**Nt- Phosphatidylinositol 3- FP:GTCTCCTCTTGCCCCTGAT kinase RP:TCGAAATGCCAACCGTAAT
**Nt-1-Aminocyclopropane-1- FP:TTGTGAGAACTGGGGCTTC carboxylate oxidase 1 (ACO1) RP:TCCCTTTGTCATTTTCTCCA
**Nt-1-Aminocyclopropane-1- FP:GGGTGATTGCTCAGCCTC carboxylate oxidase 2 (ACO2) RP:CAACAATTGTGGTGCTGGA
**Nt-Actin FP:TTCTTCGTTTGGACCTTGCT
RP:TCAGCAGTGGTGGTGAACAT
Solanum lycopersicum (Sl) ; Nicotiana tabacum (Nt). * Cloning. ** Real time PCR.
82 sequenced and compared with database sequences using the BLAST program
(http://blast.ncbi.nlm.nih.gov/Blast.cgi).
3.2.3 Agrobacterium tumefaciens-mediated transformation
Both constructs were introduced into Agrobacterium C58 (harboring pSoup plasmid) by electroporation technique. The transformation into tobacco (Nicotiana tabacum L. cv. PetH4) plant was carried out using leaf-disc method as described by Horsch et al.
(1984). Transgenic plants were selected on Murashige and Skoog (MS) medium
(PhytoTechnology Laboratories, Overland Park, KS) containing 100 μg/mδ kanamycin
(Sigma, Markham, ON) and γ00 μg/mδ timentin (PhytoTechnology δaboratories,
Overland Park, KS). The generated shoots were transferred into MS media and rooted plants were later transferred into greenhouse (temperature 25 °C with photoperiod of 12 h light, 8 hour dark cycle).
3.2.4 Triple-response assay
Triple-response assay on transgenic seeds was conducted according to the method reported by Guzmán and Ecker (1990). Seeds were surface sterilized using 20% bleach for 10 min, followed by washing with water five times, each for five minutes.
Then, the seeds were germinated in Murashige and Skoog medium, pH 5.8, 8.0 % agar, 100 μg/mδ kanamycin (Sigma, Markham, ON) and γ00 μg/mδ timentin. 1-
Aminocyclopropane-1-carboxylic acid (ACC) was added into media post sterilization at 1με ACC (Sigma, Markham, ON). All seeds were grown in darkness for 10 days at
25 °C before the hypocotyl-lengths were measured.
83 3.2.5 Ethylene measurement
Tobacco plants were grown in the Bovey greenhouse chamber at 22 ± 2°C with 16/8h photoperiod. The flowers were categorized according to developmental stages. The ethylene levels were measured using gas chromatography and according to the method described in section 2.2.2. The flowers (stage 5) for physiology were stored in dark at room temperature and images were taken every 24 hours.
3.2.6 Extraction and genomic DNA
DNA extraction from leaves of transgenic tobacco was performed using QIAGEN
Dneasy Plant Minikit (Qiagen) according to the manufacturer instructions. The genomic PCR reaction was performed with 100 ng DNA, 0.β με of forward primer, 0.β
με of reverse primer, Taq DNA polymerase and buffer according to manufacturer’s protocol (Fermentas). The PCR product was loaded and separated on 1.2 % agarose gels with Gel-Red staining.
3.2.7 Gene expression analyses
Total RNA extraction and cDNA synthesis of all transgenic flower petals were carried out as described in section 2.2.7. Primers used for gene expression analyses are listed in Table 3.1. The threshold cycle (CT) values for each gene were normalized to those of Nt-Actin. CT values for each gene were normalized with Nt-Actin.
3.2.8 Subcellular localization of PI3K
The images for PI3K sub cellular localization were captured using Upright Leica DM
5000B microscope. Image acquisition and instrument control was performed by
84 Hamamatsu EM-CCD digital camera and Volocity™ imaging software, respectively.
The green fluorescence signal was detected using epifluorescence optical filters, equipped with a Semrock BrightLine FITC-3540B filter cube with excitation and emission at 482 nm and 536 nm, respectively.
3.2.9 Statistical analyses
Data obtained in the study was analyzed as desribed in 2.2.8. The Student T-test was used to compare means between two different populations.
3.3 Results
3.3.1 Cloning of Solanum lycopersicum PI3K cDNA.
Cloning of full length for Sl-PI3K was performed by using tomato cDNA as a template and Sl-PI3K specific primers according to established sequence
(Solyc04g015350.2.1) in tomato genome database (http://solgenomics.net/). The orientation and codon arrangement were confirmed through plasmid sequencing and alignment. A 2455 base pair coding sequence of Sl- PI3K cDNA which encoded a polypeptide of 815 amino acids was identified from tomato cDNA. Predicted amino acid sequence of Nicotiana tabacum cDNA) Nt-PI3K cDNA resulted in a polypeptide of 814 amino acids (Figure 3.1A). A comparison of Sl-PI3K with Nicotiana tabacum
PI3K (Nt-PI3K), showed the nucleotide identity and homology with Sl PI3K to be 92.3
% (Figure 3.1A). Figure 3.1B shows the domain organizations of PI3K and PI4K, with that of phospholipase D and phospholipase C superfamily. The domain Organizations for PI3K and PI4K are different between each other.
85 A
86 Figure 3.1. (A) Protein alignment between S. lycopersicum PI3K and Nicotiana tabacum PI3K using ClustalW. C2 domain , PI3Ka superfamily. and PKC like superfamily (B) Domain analysis of PI metabolism related enzymes. The domain analysis was conducted using The domain analysis has been constructed using the
C-D Search (NCBI) using amino acid sequence. C2 domain (in blue) presents in plant
PI3K, PLC and PLD.
87 PI3Ks are characterized by an N-terminal C2 domain that has strong negatively charged pockets responsible for calcium binding. By contrast, PI4K does not possess a C2 domain. Amino acid sequences in the mid-region of the polypeptides of PI3K and PI4K are characteristic of their superfamily. Both the catalytic sites and the ATP binding cassettes are located at the C-terminal end of
PI3K and PI4K. PI-Phospholipase C possesses the catalytic site at the C-terminal region, and a catalytic site at the C-terminal end. Phospholipase Dα, , all possess
C2 domains at the N-terminal end, and the catalytic sites (2 HKD motifs) downstream of the C2 domain (Zheng et al., 2000)(Figure 3.1B).
The integrity of the Sl-PI3K insert into tobacco genome was confirmed by genomic PCR (Figure 3.2A). The amplicon size varied according to the insert size since the same primer sets were used for all PCR. The forward primer covered 35S dual promoter, and reverse primer consisted of a region of GFP (green fluorescence protein) at C-terminal of the multiple cloning site of the plasmid (pGreen). Genomic
DNA from WT plants showed the shortest amplicon size at 240 bp representative of the pGreen plasmid. Genomic DNA from PI3K-overexpressed (OX) plants had a total amplicon size at 2,688 bp, accounting for a full sequence of PI3K at 2,448 bp.
Antisense lines expressing short hairpin (sh) had a total amplicon size at 466 bp including the PI3K sh antisense sequences that encoding 65 amino acid residues
(Figure 3.2B).
3.3.2 Subcellular localization of PI3K in tobacco seedlings
Expression characteristics of PI3K were studied to confirm the level of expression and its cell/tissue localization to evaluate the effect of PI3K expression on developmental events. Seedlings from OX and WT were observed under the microscope with green fluorescence protein (GFP) filter as shown in Figure 3.3. The figure shows fluorescent images of leaf tissue (panel A) in both control (WT) and PI3K-GFP overexpressed
88
Figure 3.2. Molecular characterization of transgenic tobacco plants. (A) PCR analysis of genomic DNA extracted from transgenic plants was used as template for PCR amplification with forward primer and reverse primers specific for 35S Dual Promoter
CaMV promoter and green fluorescence protein (GFP), respectively. WT, wild-type tobacco plants (negative control); OX, transgenic plant line transformed with PI3K full sequence; sh, short-hairpin antisense PI3K C2 domain. (B) The amino acid sequence in sh antisense. The PI3K short hairpin antisense has a DNA coding for 65 amino acid residues prior to green fluorescent protein (GFP). (C) Alignment of nucleotide for short hairpin antisense (sh) construct using NCBI blastn. The query and subject were
Solanum lycopersicum phosphatidylinositol 3-kinase (Sl-PI3K) for sh and Nicotiana tabacum phosphatidylinositol 3-kinase (Nt-PI3K), respectively. The identical nucleotides was 90% and no gap strand. Nt-PI3K (AY701317); Sl-PI3K
(Solyc04g015350.2.1)
89
90 Figure 3.3. Subcellular localization of phosphatidylinositol 3-kinase (PI3K-GFP) in
Nicotiana tabacum seedlings. Panels (OX) show tissues of PI3K-GFP overexpressed tobacco; panel (sh) shows the shPI3K-GFP expression; panels (WT) show the wild type tissues of 35S-GFP expressing positive control. (A) Leaf, epidermal arae; (B) magnified image of regions in leaf showing a stomata; (C) cotyledon; (D) Trichome ;
(E) root. The seedlings were grown in selection media containing kanamycin 100
μg/mδ for β0 days before conducting microscopy analysis under fluorescence microscope (Excitation 488 nm; Emission 509 nm). Scale bar, A = 1γ0 μm; B and D=
γγ μm; C and E= 60 μm. The images are representative of several images from the specified tissues.
91 (OX) seedlings. In leaf tissues of both wild type and the PI3K- overexpressed seedlings, localization of PI3K was observed in the plasma membrane region adjacent to the apoplast, with a marginal increase in visible intensity in the OX plants.
Magnified regions of the leaves from both WT and OX plants show a differential expression of GFP and PI3K in WT and OX plants, respectively. While the GFP localization was apparent in the nucleus of WT plants, PI3K-GFP was expressed specifically in the guard cell plasma membrane adjacent to the stomatal aperture
(Figure 3.3, panels B).
In the WT tobacco seedling roots, GFP was localized at the root tip, primarily in the vascular region, while in the roots of OX plants PI3K-GFP was localized in the epidermal region of the root cap (Figure 3.3). In the antisense plants, GFP fluorescence from the leaf did not show any clear pattern (panels, A, B), while in the cotyledonary tissue, fluorescence was localized in the apoplast region (panel C), just as in WT and OX plants. In the trichomes of antisense plants, GFP fluorescence was localized at the tip (Figure 3.3, panel D), while in the root tips, GFP fluorescence was localized in the periphery of root cap and internal meristematic cells of xylem and phloem.
3.3.3 PI3K expression and developmental characteristics of tobacco flowers
The effect of sense or antisense transformations of tobacco with PGreen-PI3K-GFP and sh PI3K-GFP on plant growth and development was assessed. In terms of plant morphology there were only marginal changes between the WT, OX and the sh- antisense (sh) plants. While there were no major differences in the flower characteristics between WT and OX plants, there were significant differences in some of the flower characteristics of sh-antisense plants. Antisense inhibition of PI3K expression using short hairpin interference impaired the plant development (Figure
3.4A, Figure 3.4B and Figure 3.4C). OX plants had similar flower phenotype as
92
Figure 3.4. Changes on the flower development of different transgenic lines. (A)
Cross section of Nicotiana tabacum flowers from different transgenic line. (B) Different in pistil and stamen length of transgenic Nicotiana tabacum flowers. The transgenic lines consisted of wild type (WT), phosphatidylinositol 3-kinase (PI3K) over express
(OX) and PI3K short hairpin antisense (sh). Data shown are means ± SE for a total of n = 5 flowers from three replicates.
93 compared with WT. Meanwhile, sh-antisense plants had a different flower phenotype, specifically in having a shorter flower, and a different petal shape, compared with those from WT and OX plants. The pistil and stamen length for OX and WT flowers were not significantly different. By contrast, sh flowers had significantly shorter stamens as compared with pistil for all lines (Figure 3.4B). Another major effect of antisense transformation of tobacco plants was on pollen development (Figure 3.5).
Over expression of PI3K did not affect pollen development and self pollination that occur naturally as with WT plants. By contrast, inhibition of PI3K expression affected pollen development and no seeds were produced following self- pollination(Figure 3.5B). Antisense sh plants required assisted hybridization with normal pollen to enable them to produce seed. Microscopic observation revealed that
OX pollen has normal shape and symmetry similar with WT. The fluorescence signal for OX and WT pollen were strong where the pollen showed green fluorescence protein evenly on all surfaces. By contrast, short haipin antisense expression of Sl-
PI3K caused the pollen to be round and asymmetric compared with that from wild type flowers. Exine deposition was much reduced in pollen from antisense plants. As well, green fluorescence signal was not equally distributed on the pollen surface for sh.
3.3.4 Developmental and senescence characteristics of flowers
Senescence characteristics of flowers such as ethylene production, respiration, changes in gene expression etc., were monitored in flowers from WT, OX and sh- antisense plants. Normal development and senescence pattern of flowers is shown in
Figure 3.6A, demarcated into stages, ranging from 1- 8, where stage 1 is a tight bud and stage 8 is a completely wilted flower, with intermediate stages in between (Figure
3.6A). Temporal pattern of senescence of flowers from WT, OX and sh-antisense flowers after detaching from the plant is shown in Figure 3.6B. The flowers were at
94
Figure 3.5. Changes on the fruit and pollen characteristics of different transgenic lines.
(A) Wild type Nicotiana tabacum fruits, OX represents the fruits from overexpressed plants. sh(A) was the fruits formed after self fertilization of sh transgenic lines, and sh(B) shows the fruits formed after manual fertilization by using normal Nicotiana tabacum pollen. (B) Nicotiana tabacum pollen from different transgenic lines. The transgenic lines consisted of wild type (WT), phosphatidylinositol 3-kinase (PI3K) over express (OX) and PI3K short hairpin antisense (sh).
95 1 2 3 4 5 6 7 8
Figure 3.6A. Corolla petal of flowers of Nicotiana tabacum (WT) at different developmental stages on the plant. (1-4) Developing stages; (5) anthesis; (6) transition; (7) senescence; (8) late senescence.
Figure 3.6B. Changes in Nicotiana tabacum flowers physiology stage 5 after detaching from the plant. The flower pedicel was immersed in water containing 100
μg/mδ kanamycin and stored in dark at room temperature. The pictures were taken every 24 hours. In addition to the WT, transgenic lines included PI3K-over expressed
(OX) and PI3K-short hairpin antisense (sh). Data shown are means ± SE for a total of n = 5 flowers from three replicates.
96 stage 5 as depicted in Figure 3.6A, and after collection, the pedicels were wetted with distilled water, and immediately immersed in distilled water containing kanamycin (100
μg/mδ). The flowers were stored in the dark. As shown in Figure γ.6B, the WT flowers started to wilt after 48 hours and were fully senesced after 96h of initiating incubation.
All OX flowers showed accelerated senescence and the flowers faded and wilted between 48 and 72 hours. By contrast, for sh flowers, petal color was still maintained until 72 hours. The sh-antisense flowers were wilted after 96 hours (Figure 3.6B).
3.3.5 Ethylene production from tobacco flowers
Since both over-expression and antisense inhibition of PI3K resulted in the modulation of flower senescence as compared to WT flowers, the former leading to an advancement of senescence, and the latter leading to a delay in senescence, it was apparent that PI3K has a clear role in ethylene signal transduction process.
Autocatalytic ethylene production in fruits and climacteric-like increase in ethylene production in flowers result from an increase in ethylene production with the downstream activation of gene expression and enzyme synthesis. In the present study, ethylene released from WT flowers, Sl-PI3K over-expressed flowers and antisense sh flowers were evaluated. For each individual OX transgenic line, the flowers at stage 5 released significantly higher ethylene per hour as compared with
WT (Figure 3.7). OX1 and OX3 released more ethylene per hour as compared to WT for the first 48 hours. Meanwhile OX11 released a high level of ethylene during the first 24 hours of incubation, and maintained this level for another 24 hours. By contrast, for flowers from sh- antisense plants, all transgenic lines released significantly lower amount of ethylene for all times (over 80%) as compared with WT.
No ethylene climacteric-like peak was observed for all sh flowers. No significant differences were observed in the pattern of respiration between wild type, overexpressed and antisense plants (data not shown).
97
Figure 3.7. Temporal changes in ethylene production by Nicotiana tabacum flowers from WT and different transgenic lines. The flowers were selected at stage 5. The transgenic lines consisted of PI3K-over expressed (OX) and PI3K short hairpin antisense (sh). Rate of ethylene production was determined every 24 hour. Data shown are means ± SE for a total of n = 7-10 flowers from three biological replicates.
Different letter shows significantly different at P<0.05 for mean comparison for each day between the lines.
98 3.3.6 Ethylene-related gene expression analysis
Previous results showed that there was a considerable variation in the rate and amount of ethylene production among flowers of the WT, PI3K-overexpressed and
PI3K-sh- antisense tobacco plants. Ethylene production rates in PI3K-OX flowers were higher than that of WT flowers, which was far higher than that of PI3K-sh antisense flowers. Therefore, gene expression for Nt-PI3K and orthologs of Nt 1- aminocyclopropane-1-carboxylic acid oxidase (Nt-ACO1, Nt-ACO2) in WT and transgenic flowers were measured at 0h and 48 h after excision as shown in Figure
3.8. There was a 100 % increase in the expression levels of Nt-PI3K in flowers of WT plants during 48 h of incubation. Nt-PI3K expression in the OX flowers increased significantly during 48 h of incubation when compared with that at 0 h. The pattern was similar to that with WT, but with a higher level (~200 %) of PI3K gene expression for OX1 and OX2. In comparison with the flowers of WT and PI3K-OX plants, flowers of PI3K sh antisense plants showed a much higher level of PI3K expression constitutively (Figure 3.8).
However, there was no significant change in Nt-PI3K expression during 48 h of incubation. Nt-ACO1 showed similar trend of increase in expression as PI3K in flowers of WT and OX plants, with a 3-fold increase in expression in the WT flowers, and 6-8 fold increase in expression in flowers of PI3K OX plants during 48 h of incubation, respectively. By contrast, there was no significant change in Nt-
ACO1expression for PI3K-shantisense plants during the same period. Nt-ACO2 showed a different pattern in gene expression as compared with Nt-ACO1. Nt-ACO2 significantly decreased for flowers of WT and OX plants at 48 h, as compared with 0 h. While the Nt-ACO2 expression in sh-antisense flowers was much higher than that of WT and OX flowers initially, it remained unchanged during 48 h of incubation
(Figure 3.8).
99
Figure 3.8. Gene expression analyses of Nicotiana tabacum (Nt) flowers from different tobacco lines during 0 hour and 48 hours. The genes are Nt-phosphatidylinositol 3- kinase (PI3K), 1-aminocyclopropane-1-carboxylic acid oxidase 1 (ACO1) and 1- aminocyclopropane-1-carboxylic acid oxidase 2 (ACO2). The flowers were selected at stage 5 and incubated in water. The relative gene expression of each sample is indicated as mean ± SE. The results are from three biological replicates of each tobacco line including wild type (WT), PI3K overexpress (OX), and PI3K- short hairpin antisense (sh). Different letter shows significantly different at P<0.05 for mean comparison between 0 hour and 48 hours.
100 3.3.7 Triple response in tobacco seedlings
Dark-grown seedling show the characteristic triple response in the presence of ethylene, with shortening of hypocotyls, increase in stem diameter and the formation of the hypocotyl hook. If ethylene action is upregulated, this will be reflected in the intensity of the triple response. Seeds of wild type and PI3K-overexpressed tobacco were germinated and maintained in the dark and hypocotyl length measured. The hypocotyl length for PI3K-OX seedlings was significantly shorter than that of WT seedlings (Figure 3.9).
3.4 Discussions
3.4.1 PI3Kinases in plants
Phosphatidylinositol 3-kinase is a ubiquitous enzyme present in both plants and animals indicating their functional significance. PI3K is a key member of signal transduction pathway in mammals and has been identified as a key step of signal transduction system, and is a major target for pharmacological interventions. There are three classes of PI3Kinases in mammalian systems including class I, II and III.
Class I PI3K involves in activation for tyrosine kinase receptors and G protein coupled receptor (Vanhaesebroeck et al., 2001). In addition, class I PI3K has been identified as one of the marker for cancer development (Martini et al., 2014). Class II PI3K regulates the biosynthesis of the membrane fraction including plasma membrane and vesicle (Acaro et al., 1998; De Matteis and D'Angelo, 2007). Meanwhile class III PI3K is associated with autophagy process (Backer, 2008).
101
Figure 3.9. Triple response phenotype of Nicotiana tabacum seedlings at different condition. (A) Hypocotyl length after 10 days incubation in different environments. (B)
Hypocotyl seedling after 10 days incubations at different environment. Wild type (WT), phosphatidylinositol 3-kinase (PI3K) overexpress (OX), air (control) and 1- aminocyclopropane-1-carboxylic acid at 1 µM (ACC1). Data shown are means ± SE for a total of n = 7-10 seedlings from three biological replicates. Different letter shows significantly different at P<0.05 for mean comparison between WT and OX.
102 There have been fewer studies on PI3K in plants which have identified PI3K to be involved in multiple processes and localization. A knockout of PI3K in Arabidopsis resulted in a lethal mutant indicating that PI3K plays a key role in this species (Welters et al., 1994; Lee et al., 2008b). Previous studies have shown that PI3K has vital roles in plant growth and development. The presence of only a single copy of the PI3K gene and its ubiquitous occurrence in plant kingdom indicates its roles in plant development (Welters et al., 1994). Plant PI3K has a similar protein structure domain with class III mammalian PI3K, which only phosphorylates PI into PI3P. PI3K has been localized in nucleolus region of carrot suspension cells, and possibly has a function in the central dogma of genetic regulation of development via transcription processes (Bunney et al., 2000).
Mutation of Arabidopsis thaliana PI3K resulted in abnormal segregation ratio in the male gametophyte, and affected mitosis, also causing the formation of large vacuoles in pollen grains. These observations suggest the function of PI3K in vacuole reorganization and pollen development (Lee et al., 2008b). PI3K also regulates cell plate growth during cytokinesis of bright yellow (BY-2) cell (Vermeer et al., 2006), and root hair cell elongation of Arabidopsis (Lee et al., 2008a). Interestingly, PI3K acts synergistically with auxin for auxin-mediated formation of reactive oxygen species
(ROS), and root gravitropism in Arabidopsis root (Joo et al., 2005). PI3K plays a vital function during signal transduction inducing salt stress tolerance in A. thaliana, with the activation of NADPH oxidase resulting in the formation of intercellular reactive oxygen species (ROS). A PI3K mutant was able to produce ROS only in the presence of external PI3P and not in the presence of PI4P and PI 4,5P2 (Leshem et al., 2007).
PI3P has been localized in cytosol, central vacuole of stomata and in endosomal vesicles that are close to Golgi stacks (Vermeer et al., 2006). Similarly,
PI3P has been found to localize in internal vesicles of endosomes and vacuoles in yeast cells. These results suggest the role of PI3K in early stage of endosome formation, in particular, prior to the formation of multivesicular structures (Gillooly et
103 al., 2000). Similar observations were reported in Arabidopsis thaliana mutation on
VPS34 gene, which encodes PI3K, resulting in gametophytic defects when homozygous and normal as the wild type when heterozygous (Lee et al., 2008b).
Expression of antisense At VPS34 which has similar structure with Sl-PI3K, severely affected the growth and development of second-generation of transformed
Arabidopsis plants (Welters et al., 1994).
3.4.2 Cloning and characterization of Solanum lycopersicum PI3K
A high degree of homology between PI3K in tomato and tobacco at ~ 92.3% enabled the selection of tobacco as a model system to study the functional role of Sl-PI3K.
Expression of the catalytic domain of plant PI3K from Arabidopsis thaliana At VPS34 which has 40 % identity with Saccharomyces cerevisiae Sc VPS34 was able to rescue yeast vps34 deletion mutant (Welters et al., 1994). Tobacco is a simple model plant system for the selection of chimeric proteins with a high degree of homology that is also required for optimum enzyme gene expression and enzyme activity. Both tomato and tobacco are Solanaceae family members, thus provides an advantage to express
Sl-PI3K into tobacco (Venkatesh and Park, 2012).
Nucleotide sequences encoding the N-terminal C2 domain of Sl PI3K was used to design and construct a short hairpin sequence. This sh sequence had similarity at nucleotide level between corresponding regions of PI3K sequences from tomato and tobacco at 90 %. This sh segment was designed according to sense sequence that corresponded to amino acids in the PI3K C2 domain region from
Arg159 until Asp215. It was anticipated that the antisense cDNA introduced into the plant could get transcribed generating sh antisense RNA that could bind to the complementary strand of native PI3K RNA in tobacco. This may reduce the translation of full length PI3K mRNA via complementary binding to native mRNA.
104 3.4.3 PI3K in ethylene signal transduction
Ethylene signal transduction involves several components that are typical to hormone/growth regulator/environmental cues. The primary signal is received by a receptor, analogous to a bacterial two component system which transduces the signal via response regulators and receivers and into secondary messengers such as calcium, inositol trisphosphate, phosphatidic acid etc (Stevenson et al., 2000; Munnik,
2001). An interesting aspect of ethylene signal transduction is that it is under negative regulation through an intermediary Raf Kinase like protein CTR1, which in the absence of ethylene continuously downregulates ethylene action. Once ethylene binds to the receptor, the association between receptor and CTR 1 is disrupted, and pathways downstream of CTR1 such as EIN2 and EIN3, gets activated enhancing gene expression (Stepanova and Alonso, 2005). Several molecular events in downstream ethylene signaling have been unravelled. However, the immediate events that occur after ethylene perception are still under investigation.
Membrane deterioration is an early event that occurs during ripening and senescence and is enhanced soon after ethylene perception (Paliyath et al., 1987).
The first perceivable changes associated with membrane deterioration such as the formation of gel phase lipid occurs on endoplasmic reticulum and then on plasma membrane (Paliyath and Thompson, 1990). Within 60 minutes of ethylene treatment, there is a clear inhibition of calcium ATPase (Paliyath and Thompson, 1988).
Enzymes that catabolize membrane phospholipids such as phospholipase D (PLD) are activated at elevated physiological levels of calcium (Paliyath and Thompson,
1984). Cloning of several PLDs from Arabidopsis (Qin and Wang, 2002), tomato
(Whitaker et al., 2001; Pinhero et al., 2003; Tiwari and Paliyath, 2011b), and strawberry (Yuan et al., 2005) show that these PLDs belonging to several classes, and possess a calcium sensitive C2 domain that enable calcium dependent migration of cytosolic PLD into the membrane initiating phospholipid degradation. It also
105 became clear that the C2 domains had a higher affinity towards acidic phospholipids such as phosphatidic acid, phosphatidylinositol and its phosphorylated derivatives
(Tiwari and Paliyath, 2011b) even in the absence of calcium. This suggested that perhaps calcium dependent membrane association of PLD to the membrane is a downstream event (as when Ca-ATPase is inhibited and cytosolic calcium level increases).
Thus, generation of negatively charged domains in the membrane may be an initial event upstream of PLD activation and initiation of phospholipid catabolism
(Pinhero et al., 2003). At this stage, it is not clear if there is an increase in cytosolic calcium soon after ethylene binding. Interestingly, phosphatidic acid (PA), the immediate product of PLD action is also able to bind and inhibit the activity of CRT1, releasing the system from negative regulation and causing the activation of ethylene response proteins such as EIN2 and EIN3 (Testerink et al., 2007). Thus, PI3K appeared to be a potential candidate protein that may act upstream of PLD. An interesting feature of PI3K is that the enzyme is normally cytosolic and is transported to membrane domains that are populated with acidic phospholipids. Though PI3K possesses a C2 domain just as PLD, and showing a high affinity to PI (Sabri et al.,2014), both these enzymes share the common feature of having higher degree of affinity towards acidic phospholipids. The major difference is that while PLD C2 shows very high binding to PA domains, PI3K C2 shows no binding to PA. Though the precise sequence of action of PI3K and PLD is hypothetical at present, it is clear that both the enzymes are involved in the activation of ethylene signal transduction pathway.
An interesting aspect that becomes apparent on the role of PI3K in ethylene signal transduction is the effect of overexpression of PI3K-GFP, and short hairpin antisense expression of Sl-PI3K in tobacco and its impact on flower development, morphology and senescence. Overexpression resulted in acceleration of senescence by ~24h which normally occurs in 72 hours in the wild type, while antisense
106 suppression resulted in delaying senescence by ~ 24h keeping the flower without wilting for ~72 hours, in a total span of 96 h for full senescence (stage 8) of cut flowers. The expression of ethylene biosynthesis related genes including 1- aminocyclopropane 1-carboxylate (ACC) oxidase (ACO) and ACC synthase (ACS) are correlated with flower senescence (Nadeau et al., 1993). In carnation flowers, ethylene exposure is associated with flower senescence and petal inrolling (Paliyath et al., 1987).
Since ethylene biosynthesis in plants is tightly regulated via positive feedback regulation upon ethylene binding to its receptors, the initial synthesis of ethylene triggers an autocatalytic cascade of events increasing ethylene biosynthesis manifested as the climacteric (Nakatsuka et al., 1998). Interestingly, the pattern of flower wilting was very similar to the trend in ethylene production (Figure 3.7) where
OX plants produced significantly higher levels of ethylene during 48 h as compared to those from wild type. These results suggest that PI3K has a key role in the activation of ethylene biosynthesis which is a downstream process involving increased expression of genes such as ACS (ACC synthase) and ACO (ACC oxidase). This contention is supported by the expression profiles for Nt-PI3K and Nt-ACO1 which show a consistent trend with ethylene production for OX and WT lines. The expression level of Nt-PI3K and Nt-ACO1 significantly increased during 48 h of incubation of both WT and OX flowers as compared with their levels at 0 h.
Expression of Sl-PI3K in antisense caused an increase in the constitutive level of expression but no increase could be noticed during the incubation of flowers for 48 h.
Expression levels of PI3K in sh-antisense plants showed a different pattern as compared to the PI3K-overexpressed plants. While the constitutive expression of the transcripts was much higher, at 48 h after incubation, there was only a marginal increase in PI3K transcript levels. An increased level of PI3K transcript, may be a compensation for the antisense inhibition of PI3K, and need not reflect the level of the functional enzyme within the plant. Irrespective of this increased expression of PI3K
107 transcripts, antisense transformation clearly reduced the levels of ethylene production as well as the transcript levels of ACO transcripts, suggesting that the antisense transformation resulted in a modified response. Fluorescence imaging clearly showed the accumulation of sh peptide-GFP which is the potential product of the antisense chimeric cDNA to varying extent in different tissues. This indicated that the antisense sh cDNA is indeed transcribed and translated in transformed plants. Since a complete suppression of PI3K resulted in lethal mutations in Arabidopsis thaliana (Walters et al., 1994), it is possible that the antisense inhibition of PI3K in tobacco may be partial, which resulted in delayed senescence in flowers, though this affected other developmental events such as pollen viability.
Triple response is a simple phenotypic test for identifying constitutive expression of ethylene related growth effects in plants (Guzmán and Ecker, 1990).
Dark grown seedlings in general show an elongated hypocotyl, apical hook and etiolation. In the presence of ethylene, an exaggeration of apical hook, a radially swollen short hypocotyl and development of shorter roots can be noticed. The results from this study indicate that PI3K overexpression results in a seedling showing triple response phenotype as compared with WT in air, when germinated in the dark. This is consistent with the finding that ethylene production and signaling are activated in the
PI3K overexpressed plants.
3.4.4 Subcellular localization of PI3K
PI3K has been reported as a vital enzyme for plant development. Arabidopsis expressing antisense PI3K showed impaired growth and development, including its inability to produce a normal vacuole (Welters et al., 1994). Several reports imply
PI3K function in plants including membrane biogenesis and trafficking from Golgi body
(Vermeer et al., 2006), pollen development (Gao and Zhang, 2012), cytoskeleton formation (Dove et al., 1994), inhibition the guard cell function (Jung et al, 2002) and
108 root hair growth (Lee et al., 2008b). These observations suggest that PI3K plays a central role in multiple hormone actions through interacting and overlapping signaling pathways and cross talk with other plant growth regulators such as auxin (Stepanova et al., 2007), gibberellin (Vriezen et al., 2004) and jasmonic acid (Zhang et al., 2014).
Only one copy of PI3K gene has been identified in various plant genomes. The present study showed the localization of PI3K at the plasma membrane, stomata, root apical meristem and root cap region, as well as the pollen grains. These observations are in parallel with other reports where PI3K has been localized in multiple organs
(Jung et al., 2002; Vermeer et al., 2006, Lee et al., 2008b). The localization of PI3K on root cap showed the possible interaction between PI3K and auxin during root elongation. Phosphoinositide metabolism could affect the localization of auxin efflux facilitator and involve in generation of secondary messenger for root gravitropic signaling (Perera et al., 2001). The localization of PI3K at the plasma membrane supports the function of phosphatidylinositol signaling which starts at the plasma membrane and subsequently directs the localization of auxin efflux facilitators during early stage of root gravitropism before root curvature (Strohm et al., 2012).
A diagrammatic model depicting the differences in the potential mode of action of PI3K in flowers of PI3K-over expressed and sh-antisense plants is shown in Figure
3.10. A unique aspect of ethylene signal transduction is the major regulatory role of
CTR1 controlling downstream signal transduction events. In normal ethylene responsive systems, CTR1 acts as a negative regulator, inhibiting downstream events in the absence of ethylene, and releasing the suppression once ethylene is bound to the receptor. CTR1 gets inactivated after ethylene stimulation and is believed to get detached from the receptor releasing the downstream phosphorelay and suppression of the pathway. Phosphatidic acid, the direct product of PLD action on phospholipids can bind to CTR1 (Testerink et al., 2007) and inactivate the enzyme (Raf-like kinase).
It is also possible that, under conditions where phospholipase C activated,
109
Figure 3.10. A model depicting the involvement of phosphatidylinositol 3-kinase (PI3K) in ethylene signal transduction pathway and downstream gene expression.
Compartment A depicts the components of ethylene signal transduction pathway as known today localized on the endoplasmic reticulum. Inactivation of CTR (red hexagon attached to ETR in blue) is proposed to occur by phosphatidic acid generated by PLD action. The compartment B shows the proteasomal degradation of
EIN2 regulated by active CTR1 in the absence of ethylene. There are three possible systems for PA biosynthesis which later may cause CTR inhibition, by PLD action on plasma membrane and endoplasmic reticulum, and by PLC/DG Kinase action on plasma membrane. PI3K is localized at the plasma membrane which generates phosphatidylinositol-3-phosphate providing negatively charged domains on the plasma membrane to which PLD may bind even in the absence of calcium (Tiwari and
Paliyath, 2011). PA pools are formed from PLD or (PLC) activities. PA formed on the
110 diacylglycerols may be converted back to phosphatidic acid by diacylglycerol kinase. plasma membrane may migrate into cytosol and fuse with endoplasmic reticulum (ER) by microvesiculation (Yao et al., 1991) and be able to inhibit CTR1. PA can also be generated at the ER by PLD action (Pinhero et al., 2003). PI3K overexpression accelerates ethylene biosynthesis and 1-aminocyclopropanecarboxylate oxidase
(ACO) gene expression. Antisense PI3K reduces ethylene biosynthesis. CTR1 activation and deactivation of EIN2 has been reported by Ju et al., 2012 (compartment
B). The role of plasma membrane localized ERS (Ma et al., 2006) and its links to CTR and PI3K is presently not clear and may involve stress related ethylene signaling. PC, phosphatidylcholine; PI3P, phosphatidyinositol 3-phosphate; PI, phsophatidylinositol;
DG, diacylglycerol; PI4,5P2, phosphatidylinositol 4,5-biphosphate; DGK, diacylglycerol kinase; ER, endoplasmic reticulum; ETR1, ethylene receptor 1; CTR1, constitutive triple response 1; EIN2, ethylene insensitive 2; ERS, ethylene response sensor; EIN3, ethylene insensitive 3; EIL1, EIN3-like protein 1; ERF1, ethylene response factor 1;
GGPS, geranylgeranyl pyrophosphate synthase; ACS,
1aminocyclopropanecarboxylate synthase; CTRISO, carotenoid isomerase; PYSI,
Phytoene synthase; DXS, 1-Deoxy-D-xylulose-5-phosphate synthase; MAPK
Cascade, mitogen-activated protein kinase cascade.
111 Both events can ultimately result in increased PA levels in the membrane.
Under these conditions, the activity of CTR1 may be controlled through the level of phosphatidic acid in the membrane. Thus, the ratio of active CTR1 to inactive CTR1
(bound with PA), may control the intensity of downstream signaling and release from suppression. The expression of ethylene biosynthetic enzymes such as ACS and
ACO is activated during fruit ripening and flower senescence (Lin et al., 2009) and upstream inhibition of these events (by 1-MCP at the receptor level, or inhibition of
PLD) leads to the downregulation of several enzymes and proteins involved (Tiwari and Paliyath, 2011b). PLD is activated during tomato fruit ripening increasing PA levels in the membrane (Tiwari and Paliyath, 2011a), which may regulate the level of active/inactive CTR1. PI3 Kinase could serve as the step prior to PLD activation, generating negatively charged membrane domains where PLD can bind and generate increasing levels of PA. The direct demonstration of these possible events needs to be accomplished in future research.
3.5 Conclusions
The present study showed that phosphatidylinositol phosphorylation by PI3K has a clear role in the regulation of senescence in tobacco flowers. PI3K over expression resulted in increased ethylene biosynthesis by flowers with a concomitant acceleration of flower senescence as compared to the wild type flowers. By contrast, antisense transformation of plants resulted in decreased ethylene biosynthesis and delayed flower senescence as compared to the flowers of wild type plants. Increased functioning of ethylene signal transduction events in PI3K overexpressed plants were also evident by their triple response phenotype. Antisense transformation also resulted in multiple developmental changes including flower petal development, filament length and pollen, which suggest the possible impairment of ethylene biosynthesis.
112 CHAPTER IV
CHARACTERIZATION OF SOLANUM LYCOPERSICUM (TOMATO)
PHOSPHATIDYLINOSITOL 3-KINASE C2 DOMAIN
4.1 Introduction
Phosphatidylinostol 3-kinase (PI3K) is one of the kinase ezymes in phosphoinositide metabolism. It phosphorylates phosphatydlinositol (PI) at 3-OH position of the head group to produce PI3P (Welters et al. 1994; Kim et al. 2001a). PI3K is involved in phospholipid signalling after phosphatidylinositol synthase and before phosphatidylinositol 3-phosphate kinase (Meijer and Munnik, 2003). Interestingly, in plant system, there is only a single copy of PI3K that has been reported so far, and it has similar protein domain arrangement with class III mammalian PI3K. By contrast, mammalian system has three classes of PI3K according to domain structure and substrate specificity (Fruman et al., 1998).
Phosphatidylinositol 3-phosphate (PI3P) is a product of PI3K activity. The function of PI3P is required for nuclear transcription of carrot suspension cells
(Bunney et al., 2000), vesicle trafficking from the Golgi network to the vacuole (Kim et al., 2001a) and stomatal closure (Jung et al., 2002; Park et al., 2003). The function of
PI3K in plant is broader than only for vesicle formation since PI3K is generally required for normal plant growth and development (Welters et al., 1994) and pollen tube development (Lee et al., 2008b). Expression of Arabidopsis thaliana PI3K in antisense orientation inhibits second generation plant growth and development(Welters et al., 1994). Similarly, A. thaliana VPS34/vps34 shows gametophytic defects and abnormal segregation ratios (Lee et al., 2008b). PI3P has been observed to localize in plant cells (tobacco BY-2) in endosomal vesicles, vacuolar membranes, and Golgi stacks. It also has also been suggested to play a role
113 in plant cell cytokinesis (Vermeer et al., 2006). Even though PI3K is vital for plant growth and development, several aspects of its function are unknown.
Currently only a single copy of PI3K has been discovered in the plant genome.
This makes PI3K become essential for normal plant growth (Welters et al., 1994).
Previous reports have elucidated PI3K subcellular localization and function by using
PI3K inhibitor, wortmannin, or PI3P specific antibodies. These studies demonstrate that PI3K localizein many parts and is involved in many processes of plant growth/development including root nodule formation (Hong and Verma, 1994), root gravitropism (Joo et al., 2005) pollen development (Lee et al., 2008b), stomata regulation (Jung et al., 2002; Park et al., 2003), salt tolerance (Leshem et al., 2007), root hair elongation (Lee et al., 2008a) nuclear cytoskeleton arrangement (Drobak and
Watkins, 1994) and vesicle formation (Matsuoka et al., 1995). PI3K is also required for interaction with other plant growth regulator such as in abscisic acid (Park et al., 2003) and auxin (Joo et al., 2005).
Class III mammalian PI3K has a similar structure to plant PI3K. Class III PI3K has a C2 domain at the N-terminal end, followed by a helical domain and a catalytic domain at the C-terminal (Liu et al., 2009). The predicted structure for Solanum lycopersicum PI3K is shown in Figure 4.1. The C2 domain has been identified in synaptotagmin I, which is a calcium sensitive protein. The calcium binding region is located at the site II and III of Synaptotagmin I C2 domain loop (Sutton et al., 1995).
C2 domain is also known as calmodulin bonding domain (CalB) that has membrane- docking element in a conserved structure. The C2 domain is also sensitive to calcium ion, metal ions and able to bind to lipids. Interestingly, the C2 domain is related to the calcium-lipid binding domain. However, the response to calcium and lipid is divergent between proteins and isoforms (Meijer and Munnik, 2003). Plant systems have fewer proteins with C2 domains than animals. Apart from PI3K, C2 domains are also present in proteins involved in signaling and membrane trafficking such as phospholipase D (PLD), and phospholipase C (PLC) (Kopka et al., 1998,
114
Figure 4.1. Structural analysis for plant/yeast phosphatidylinositol 3-kinase (PI3K) as compared with mammalian PIK. The domain structures were predicted using NCBI
Conserved Domain Database. Ras, ras-binding domain;PX, Phox homology domain;
PI3Ka; phosphoinositide 3-kinase family, accessory domain; PI3Kc, catalytic domain of the protein kinase superfamily; HEAT, HEAT repeats.
115 Nalefski and Falke, 1996). The different features of class III PI3K compared with class
I and II is the presence of only one C2 domain at the N-terminal end, without a ras- binding domain (Liu et al, 2006). This makes the PI3K C2 domain more important for activation and function of class III PI3K and plant PI3K.
The amino acid sequence of the C2 domain in PI3K differs from the C2 domains of PLC, and PLD. The crystal structure of human class I PI3K has C2 domain with 8 beta strand amino acid with an alpha turn (Walker et al., 1999). Several studies show the function of the C2 domain is as an enzyme docking domain with various phospholipids. For example, several PKCs that are inactive in the cytoplasm, become active upon calcium ion signal that activates the C2 domain and later, this domain binds to phosphatidylserine (PS) and PI4,5P2 at the plasma membrane (Li et al., 2014).
Therefore, there is possibile that C2 domains may activate enzymes upon calcium ion binding. However, there are also C2 domains that are insensitive to calcium. For instance, PKC-epsilon C2 does not require calcium to bind to phosphatidylserine (Corbalan-Garcia et al., 2003). This suggests that the C2 domain varies functionally depending on the protein.
PI is the forth major component of plasma membrane phospholipids in plant
(Picchioni et al., 1994). However, PI is a relatively minor phospholipid with amounts ranging from one to two percent. PI has unique properties as compared with other phospholipids. Its inositol head group can be phosphorylated by kinase enzymes to form phosphorylated derivatives of phosphatidylinositol which are collectively known as phosphoinositides (Fruman et al., 1998). During PI biosynthesis, subsequent phosphorylation of PI3P by phosphatidylinositol 3-phosphate 5-kinase forms PI3,5P2.
Inositol also involves in signalling and growth for plant system (Stevenson et al.,
2000). However, the amount of phosphoinositides is too low in plants and difficult to be measured even it increases during flower senescence or in response to osmotic stress (Paliyath et al., 1985; Meijer et al., 1999). Further phosphorylation and de-
116 phosphorylation of PI4P generates PI-4,5-bisphosphate (PI4,5P2) which is widely known to be a substrate for PI-phospholipase C (PI-PLC) in plant system (Rupwate and Rajasekharan, 2012).
Interestingly, the PLC gene is expressed during multiple environmental stresses, and is sensitive to changes in cytosolic calcium ion levels (Hirayama et al.,
1995). PI4,5P2 has been localized in cytosol of tobacco Bright Yellow-2 (BY-2) cells, but become concentrated at the plasma membrane upon salt stress (van Leeuwen et al., 2007). Upon stimulation, PLC hydrolyses PI4,5P2 into two plant second messenger molecules, inositol 1,4,5-trisphosphate (IP3) and diacylglycerol (DAG)
(Munnik and Testerink, 2009). IP3 diffuses into the cytosol and can be immediately turned into myo-inositol hexakisphosphate (IP6). IP6 can trigger calcium-release from vacuoles and other endomembranes in the plants even at concentrations 10-fold lower than IP3 (Lemtiri-Chlieh et al., 2003). DAG that remains in the membrane will be further phosphorylated by DAG-kinase into phosphatidic acid (PA). PA binds and inhibits constitutive triple response (CTR1), a negative regulator for ethylene signal transduction pathway (Testerink and Munnik, 2005). Meanwhile, C2 domain of another key plasma membrane phospholipid degrading enzyme PδDα has higher affinity toward phosphoinositides and PA (Tiwari and Paliyath, 2011b). Down regulation of PLD gene expression in tomato fruit by antisense is able to delay tomato ripening and reduce PA formation (Pinhero et al., 2003).
In the present study, the full sequence of Solanum lycopersicum PI3K-C2 domain (Sl-PI3K C2 domain) was cloned into a bacterial expression system with a his tag at the C-terminal. The binding property of purified Sl-PI3K C2 domain with different phospholipids was analyzed. The effect of calcium and pH on protein conformation and phospholipid binding properties were also evaluated. Results demonstrate that PI3K C2 domain binds to all tested polyphosphoinositides and phosphatidylserine (PS). The PI3K-C2 domain structure is sensitive to calcium ions and pH. However, the binding of Sl-PI3K-C2 domain with PI does not require calcium
117 ions. Transient expression shows the localization of PI3K at plasma membrane and nucleus region. Amino acid sequence alignment and structure prediction of Sl-PI3K
C2 domain has similarity with mammalian class I PI3K C2 domain. The possible PI binding region has also been identified.
4.2 Materials and Methods
4.2.1 Total RNA extraction and cDNA synthesis
Total RNA extraction and first-strand cDNA were carried out as described in section
2.2.7.
4.2.2 Construction of PI3K C2 domain plasmid
The full sequence of the PI3K C2 domain was designed according to the sequence of
Solanum lycopersicum PI3K in NCBI Genbank (XP_004236633.1). The C2 domain was identified according to NCBI conserved domain search. The Sl-PI3K C2 was amplified using PCR reaction from tomato cDNA with 0.5 μδ Platinum Taq DNA
Polymerase (Invitrogen), 1 X reaction buffer, 1.5 mM MgCI2, 0.β με forward primer (5’
GATATACCATGGGCATGAGTGGAAAC γ’) and 0.β με reverse primers (5’
GGTAGATGTCGACTCAACGCCAGT γ’) and 1 μδ of cDNA in a total of 50 μδ. PCR was conducted at initial denaturation at 94 °C for 3 min, followed by denaturation at
94 °C for 30 seconds, annealing at 55 °C for 30 seconds and elongation at 72 °C for 1 min for 30 cycles. The amplified fragments were cloned into a pET-28b (+) (Novagen) between NcoI and SalI restriction sites with 6 histidine residues at the C-terminal end.
The alignment was confirmed by plasmid sequencing and compared with database sequences for C2 domain.
118 4.2.3 Expression and purification of the PI3K C2-His domain
The chimeric construct was transformed into E. coli Rosetta 2(DE3)pLysS competent cells (Novagen). The plasmid transformation was carried out using a heat-shock technique at 42°C for 1 minute. The positive colonies were selected using LB agar containing kanamycin 35 μg/mδ (Sigma, Markham, ON) and chloramphenicol 50
μg/mδ (PhytoTechnology δaboratories, Overland Park, KS) using colony PCR. The cells were grown in γ δ δB broth containing kanamycin γ5 μg/mδ, (Sigma) and chloramphenicol 50 μg/mδ (PhytoTechnology δaboratories, Overland Park, KS) at
37°C until the absorbance at A600 nm reached 0.4. Immediately, protein expression was induced with isopropyl- -D-1-thiogalactopyranoside (IPTG) to a final concentration of 0.4 mM and the cells were returned to the incubator shaker. The cells were harvested after 4 hours, and centrifuged at 1600 x g for 10 minutes at 4°C. The supernatant was decanted and the pellet was frozen at -80°C.
The protein extraction from inclusion bodies was carried out according to the method reported by Tiwari and Paliyath (2011b). The frozen cells were thawed and mixed with 5 mL B-per reagent (Pierce). The cells were sonicated in ice using a
Branson Sonifier 450 (Emerson Industrial Automation, Danbury, USA) with intensity setting at number 6 and 50 % duty cycle for 1 min. The suspension was collected by centrifugation at 1600 x g for 1 minute (Thermo Electron Corporation, Burlington, ON,
Canada) and the supernatant was decanted. The pellet was re-dissolved with fresh 5 mL B-per reagent (Pierce) and the procedures were repeated three times or until the pellet became white. The pellet was solubilzed in denaturation buffer (50 mM Tris-
HCl, 5 mM dithiothreitol and 8 M urea at pH 8.2) by gently mixing on a platform shaker
(Labline) for 2 hrs at room temperature. The mixture was centrifuged at 16,200 x g for
10 min using a Sorvall Legend Microcentifuge 21 (Thermo Electron Corporation,
Burlington, ON, Canada) to separate insoluble debris and the clear supernatant was passed through a 0.2 mm nylon membrane syringe filter into dialysis tube with 10 kDa
119 cut off. The tube was dialyzed overnight against 50 mM Tris-HCl, pH 8.2 at 4 °C. The solution was centrifuged at 24, 501 x g for 10 min (Thermo Electron Corporation,
Burlington, ON, Canada) to separate insoluble debris and soluble protein. The soluble protein was passing through a Nickel-charged His-resin column that was previously equilibrated with 5 column volumes (CV) of 50 mM Tris-HCl, pH 8.0. The column was washed with 5 CV of 10 % elution buffer (50 mM Tris-HCl, 300 mM Imidazole, pH
8.0). Finally, the bound protein was eluted with 3 CV elution buffer. The elution protein was dialyzed overnight against 50 mM Tris-HCl, pH 8.2 at 4°C. The dialyzed protein was concentrated using lyophilisation for overnight. The protein was dissolved in 50 mM Tris-HCl, pH 8.2 and stored at 4°C.
Protein quantity was estimated according to Bradford’s dye binding method using bovine serum albumin as a standard. The protein was mixed with SDS-protein lysis buffer and heated at 95°C for 10 min. The denatured protein was separated by
SDS-PAGE using a 12% running gel. The separated proteins were detected by staining with Coomassie blue R-250 stain. Western blot was performed on separated proteins from soluble and inclusion body fractions as described by Tiwari and Paliyath
(2011b) in order to determine the exact protein location with his-tag. The separated protein was detected using monoclonal anti-his antibody conjugate with alkaline phosphatase (Sigma, Markham, ON). The colour was developed using BioRad colour development reagent according to manufacturer’s protocols.
4.2.4 PI3K C2 domain binding measurement with phospholipids strip and array
Binding of PI3K C2 domain with different phospholipids was conducted according to the manufacturer’s protocol. A nitrocellulose membrane with immobilized phospholipids (PIP Strips and PIP array; Echelon Biosciences) was blocked in TBS-T buffer (10 mM Tris-HCl, 150 mM NaCl, and 0.1% (v/v) Tween 20 and 3% bovine serum albumin, pH 8.0) with moderate shaking at room temperature for 1 hour. Then,
120 the strip was incubated with 1mg/mL Sl-PI3K C2 purified protein in incubation buffer
(10 mM Tris-HCl, 250 mM NaCl and 1% bovine serum albumin, pH 6.8) with moderate shaking at room temperature for 2 hours. Then, the PIP strip and array were washed with 10 mM Tris-HCl with 0.1% (v/v) Tween 20 with medium shaking for five minutes and was repeated three times. The strip was transferred into a new dish and incubated with 1:10,000 dilution of anti-his antibody conjugate with alkaline phosphatase (Sigma, Markham, ON) for 2 hours with medium shaking at room temperature. The strip was washed with PBS-1% Tween 20 (v/v) for three times.
Colour was developed using BioRad colour development reagent as described for
Western blot.
4.2.5 Effect of calcium and pH on the PI3K C2 domain conformational changes
The conformation changes of PI3K C2 domain at different calcium concentration and pH was conducted using fluorescence emitted by three tryptophan residues (W) located at 81, 105 and 140. The purified protein at 0.5 mg/mL was incubated in 50 mM Tris-HCl at with different concentration of calcium chloride (0-600 με). The mixture was incubated for 30 minutes at room temperature prior to fluorescence measurement using tryptophan as energy donor. The fluorescence was measured using a Varian Cary Eclipse fluorescence spectrophotometer (Agilent Technologies) with excitation at 280 nm and emission at 290 nm to 450 nm. The slit widths for both excitation and emission were kept at 5 nm. The fluorescence was recorded at 343 nm. Similar procedure was carried out for the effect of different pH on PI3K C2 domain conformation changes. The protein was incubated with 50 mM Tris-HCl at different pH as adjusted with 1 N NaOH and 1 N HCl. The effect of calcium and pH on
PI3K C2 domain binding to membrane spotted PI was carried out according to procedure described in section 4.2.4.
121 4.2.6 Transient expression of Sl-PI3K:GFP
The construct, Sl-PI3K:GFP was prepared as described in section 3.2.1. Gene bombardment of Sl-PI3K:GFP was performed on onion epidermis as described by
Sherif et al (2012). The construct at concentration more than 1 μg/μδ was coated into
β5 μδ of gold particles (50 mg/mδ). Then the mixture was washed with distilled water for three times and decanted. Finally, the mixture was mixed with β0 μδ CaCI2 (2.5M) and 10 μδ spermidine (0.1 M) and incubated on ice for 20 min with occasional vortexing for 1 minute. Then, β00 μδ of absolute ethanol was added and vortexed.
The pellet was collected by centrifugation at 24, 501 x g for 1 min (Thermo Electron
Corporation, Burlington, ON, Canada) at room temperature. The excess ethanol was removed and this step was repeated at least 5 times or until the particles were well distributed. The gold particle was suspended in 10 μδ absolute ethanol and kept in ice until gene bombardment into onion epidermis. Biolistic transformation was carried out using PDS-1000/He Biolistic Particle Delivery System (BioRad). The outer layers of healthy onions were removed. Then, the adaxial epidermis was peeled from the underlying tissue and was placed facing the particle gun on MS agar plates (0.5 X MS and 30 % sucrose). For gene bombardment, 10 ul of DNA-coated particles was speeded onto the macrocarrier disc. Then the helium tank gauge was adjusted to
1300 Psi. DNA-coated gold particles were fired into the onion epidermis at a distance of 85 mm with 1100 Psi rupture discs. Bombarded onion tissues were sealed and kept in the dark at room temperature for 16 h before observation. The images were captured as described in section 3.2.7.
122 4.2.7 Conformational analysis of PI3K C2 domain
The alignment of three dimensional structure of tomato PI3K C2 domain was predicted using I-Tasser (Ambrish et al., 2010). The similarity structure was generated using Protein Homology/analogY Recognition Engine (PHYRE) (Kelley and Sternberg,
2009). The constructed 3D image was analyzed and visualized using UCSF Chimera
1.10rc (Pettersen et al., 2004). The hydropathic index for protein was estimated using
ProtScale (http://web.expasy.org/protscale/) according to Kyte and Doolittle (1982) index.
4.2.8 Statistical analyses
Data obtained in the study was analyzed as desribed in 2.2.8.
4.3 Results
4.3.1 Cloning and expression of Sl-PI3K C2 domain
Full sequences of PI3K C2 domain was cloned from tomato cDNA into pET-28b expression vector under the regulation of T7 promoter and T7 terminator. The chimeric protein of PI3K C2:his-tag was expressed and purified using bacterial expression system. The chimeric PI3K C2 protein was localized mainly in inclusion body as confirmed with SDS-PAGE and Western blotting as shown in Figure 4.2A and
Figure 4.2B.
123 1 A 1 2 3 B 1 2 3 50kD 50kD 37kD 37kD 1 2 3 4 5 6 C
50kD 37kD
Figure 4.2. SDS-Page and Western Blot of chimeric phosphatidylinositol 3-kinase C2 domain protein. (A) SDS-Page gel (12%) separation of soluble protein and inclusion body was visualized by staining with 0.025 % Coomassie Brilliant Blue. (B) Western blot for soluble protein and inclusion body on SDS-PAGE gel (12%). 1= Molecular mass marker; 2 = Soluble protein; and 3 = Inclusion body. (C) SDS-PAGE gel (10%) separation of purified inclusion body was visualized by Coomassie Brilliant Blue. 1=
Molecular mass marker; 2= Re-folded inclusion body; 3= Flow through; 4= Washing;
5= Elution 1; and 6= Elution 2.
124 The inclusion bodies were washed with B-per solution until a white pellet was formed. The protein pellet was solubilized in denaturing solution (50 mM Tril-HCl, 5 mM dithiothreitol and 8 M urea at pH 8.2) and was centrifuged to separate the debris from soluble protein. Soluble protein was filtered with nylon membrane filter (0.45
μm) and dialyzed against Tris-HCl buffer, pH 8.0 at 4ºC using a 10 KDa cut off dialysis bag. The PI3K C2 protein was refolded by overnight dialysis against 50 mM Tris-HCl, pH 8.2. The refolded PI3K C2 protein was purified using agarose with nickel-affinity column. The final elution was dialyzed overnight against 50 mM Tris-HCl, pH 8.2. The dialyzed protein was concentrated by lyophilizing. The dry protein was dissolved and quantified with Bradford reagent (Bradford, 1976). The quality of purified PI3K C2 was confirmed by SDS-PAGE as shown in Figure 4.2C.
4.3.2 Phospholipid binding properties
C2 domains enable the binding of proteins or enzymes to translocate to the membrane after hormone stimulation enabling them to bind to phospholipids, usually in a calcium dependent manner. The binding property of PI3K C2 domain with different phospholipids was carried out to understand specific characteristics of PI3K
C2 domain. Phospholipids with different headgroups spotted on to nitrocellulose membrane at a concentration of 100 pmol were initially used. Purified C2-his tag protein was incubated with immobilized phospholipids in TBS-T buffer, pH 8.0 and the binding signal was detected using anti-polyhistidine conjugated with alkaline phosphatase (AP). Results of the study showed that PI3K C2 domain selectively bound to certain phospholipids, particularly those with negative charges as shown in
Figure 4.3A. PI3K C2 bound to all tested phosphoinositides including phosphatidylinositol (PI), phosphatidylinositol 3-phosphate (PI3P), phosphatidylinositol
125
Figure 4.3A. Binding affinity of phosphatidylinositol 3-kinase C2 domain to various immobilized membrane lipids on PIP Strips (100 pmol). (A) The protein was incubated with PIP Strips in TBS-T buffer, pH 8.0 for two hour. The PI3K C2-HisTag protein that bound on the phospholipids was detected using anti-his primary antibody with alkaline phosphatase detection method. (B) The relative intensity of A as estimated using
ImageJ.
126 4-phosphate (PI4P), phosphatidylinositol 5-phosphate (PI5P), phosphatidylinositol
3,4-bisphosphate (PI3,4P2), phosphatidylinositol 3,5-bisphosphate (PI3,5P2), phosphatidylinositol 4,5-bisphosphate (PI4,5P2), phosphatidylinositol 3,4,5- trisphosphate (PI3,4,5P3) and phosphatidylserine (PS). In contrast, PI3K C2 domain did not bind to lysophosphatidic acid (LPA), lysophosphatidylcholine (PC), phosphatidylethanolamine (PE), phosphatidylcholine (PC), sphingosine 1-phosphate, and phosphatidic acid (PA). The amount of protein that bound to PI monophosphates in general showed a higher intensity than PI bisphosphate. Further binding analysis with phosphoinositides at different concentrations showed a similar trend but very much decreased in intensity. The PI3K- C2 domain bound to all tested phosphoinositides is shown in Figure 4.3B. The amount of PI3K- C2 domain bound to phosphoinositides was concentration dependent manner. Similarly, the binding of
PI3K C2 domain towards PI monophosphate was higher than PI diphosphate.
4.3.3 Effect of calcium and pH on lipid binding affinity of the PI3K-C2 domain
Most of the C2 domains are known to possess one or more calcium ion binding domain/s that enables or enhances their binding to a membrane, a classical model being PKC-C2 domain. However, there are also several proteins that have calcium ion-independent C2 domains. Similarly, pH also could affect the binding properties of
PI3K- C2 domain. Therefore, effect of calcium ion and pH on the PI3K C2 binding affinity toward PI was assessed. Results of the study showed that the binding affinity of PI3K C2 towards PI decreased in a calcium ion concentration dependent manner as shown in Figure 4.4A. Meanwhile, changing pH from 5.5 to 8.5 did not inhibit the binding properties of PI3K C2 domain toward PI. However, the optimum pH for PI3K
C2 domain with PI was at 7.0 as shown in Figure 4.4B.
127
Figure 4.3B. Binding affinity of phosphatidylinositol 3-kinase C2 domain to various immobilized phosphoinositides at different concentration of on PIP Arrays (100 to 1.16 pmol). (A) The protein was incubated with PIP Strips in TBS-T buffer, pH 8.0 for two hour. The PI3K C2-HisTag protein that bound on the phospholipids was detected using anti-his primary antibody with alkaline phosphatase detection method. (B) The relative intensity of A as estimated using ImageJ.
128
Figure 4.4A. Calcium induced binding characteristics of phosphatidylinositol 3-kinase
(PI3K) C2 domain with phosphatidylinositol (PI). (A) Changes in C2 binding with PI at different calcium concentration, 0 με to γ0 με. The protein was 0.5 mg/mδ and PI was at 5 ug immobilized on the nylon membrane prior to binding. The PI3K C2-HisTag protein that bound on the phospholipids was detected using anti-His primary antibody with alkaline phosphatase detection. (B) The relative intensity of A as estimated using
ImageJ.
129
Figure 4.4B. pH induced binding characteristics of phosphatidylinositol 3-kinase
(PI3K) C2 domain with phosphatidylinositol (PI). (A) Changes in C2 binding with PI at different pH. The protein was 0.5 mg/mL and PI was at 5 ug immobilized on the nylon membrane prior to binding. The PI3K C2-HisTag protein that bound on the phospholipids was detected using anti-His primary antibody with alkaline phosphatase detection. (B) The relative intensity of A as estimated using ImageJ.
130 4.3.4 Effect of calcium and pH on the Sl-PI3K C2 domain conformation
Previous section showed that the binding affinity of PI3K C2 domain with PI was affected by calcium and pH, which suggested that both these parameters could affect the conformational state of the C2 protein, affecting binding properties. Therefore, the effects of calcium ion and pH on the PI3K-C2 conformation were monitored using fluorescence resonance energy transfer (FRET). PI3K- C2 protein was incubated with different concentration of calcium in the range of 0 με to 600 με. Results of the study showed that the tryptophan fluorescence quenching signal decreased in a calcium ion dependent manner as shown in Figure 4.5A. Regression analysis showed a strong correlation between calcium ion concentration and fluorescence intensity with the “r” value > 96%. The effect of pH on PI3K C2 domain conformation change also was carried out by incubating protein in different pH solution in range of 5.5 to 8.5. Results showed that fluorescence energy did not change significantly at acidic and basic pH as shown in Figure 4.5B. The highest Trp fluorescence was at pH 7, the pH optimum observed earlier for PI binding of C2.
4.3.5 Subcellular localization of Sl-PI3K
The subcellular localization of Sl-PI3K was carried out using a transient expression system. The full coding sequence of Sl-PI3K was fused into Pgreen expression vector at the γ’ end (C-terminal) of the coding sequence end of green fluorescent protein
(GFP) and under the regulation of a dual CaMV 35S promoter. The intact plasmid containing GFP alone was used as a control. Both the control and the C2-GFP construct were bombarded on onion epidermal cells. Localization of the green fluorescent protein (GFP) was observed under microscope with a GFP filter. Result of
131
Figure 4.5A. Calcium induced conformational changes of phosphatidylinositol 3- kinase (PI3K) C2 domain as measured from tryptophan fluorescence. (A) Changes for
PI3K C2 domain fluorescence intensity at different calcium concentrations, R2 = 0.96.
(B) Fluorescence scanning of PI3K C2 domain at different calcium concentrations.
Changes in fluorescence that occurred in response to calcium were measured in different calcium concentration containing 0.2 mM EGTA. Tryptophan fluorescence was measured using a fluorescence spectrophotometer with excitation at 280 nm and emission between 290 nm to 450 nm at room temperature. The fluorescence intensity was recorded at 340 nm. The protein was incubated with 50 mM Tris-HCl at pH 8.0.
Added calcium concentration was in range of 0-600 με. The data are mean ± standard error from three replications.
132
Figure 4.5B. pH induced conformational changes of phosphatidylinositol 3-kinase
(PI3K) C2 domain as measured from tryptophan fluorescence. (A) Changes for PI3K
C2 domain fluorescence intensity at different pH. (B) Fluorescence scanning of PI3K
C2 domain at different pH. Changes in fluorescence that occurred in response to pH were measured in different pH in range 5.5 to 8.5. Tryptophan fluorescence was measured using a fluorescence spectrophotometer with excitation at 280 nm and emission between 290 nm to 450 nm at room temperature. The fluorescence intensity was recorded at 340 nm. The protein was incubated with 50 mM Tris-HCl at different pH. The pH was adjusted using 1 N HCl or 1 N NaOH. The data are mean ± standard error from three replications.
133 the study showed different GFP expression pattern between Sl-PI3K C2 and control as shown in Figure 4.6. The GFP signal for the empty vector without Sl-PI3K was uniformly localized throughout the cytoplasm, nucleus and plasma membrane.
Meanwhile Sl-PI3K C2-GFP signal was localized in the plasma membrane and nucleus.
4.3.6 Structural analysis of Sl-PI3K C2 domain
Based on the sequence information of amino acid residues, and X-ray crystal structure of PKC α Cβ (Guerrero-Valero et al., 2009), a complete structure of Sl-PI3K
C2 domain was predicted using Protein Homology/analogy Recognition Engine
(PHYRE). Three dimensional image of the protein was generated using UCFS
Chimera 1.10rc. The PI3K C2 domain fold followed type-II for protein topology with amino acids grouped in six antiparallel β-strandsand α-helices adjoining β1 and β2, and β4and β5, as shown in Figure 4.7A. Structure based amino acid sequence alignments showed the presence of highly conserved regions for others plant PI3K C2 domains as shown in Figure 4.7B. The conserved region mainly covered positively charged amino acid residues such as lysine and asparagine in 1 and γ strands, and loops between 1 and γ, and C-terminal of C2 domain. Negatively charged amino acid such as glutamic acid and aspartic acid were highly conserved in 1, β, 4, α1,
αβ strands and loops at C-terminal of C2 domain.
Further analysis of structure comparison using I-Tasser showed several similarities of Sl-PI3K C2 domain with other predicted structures including murine class IA PIγK p110 (βXγ8), human PIγK p110α (βENQ) and human PIγK p110
(2WXL) as shown in Figure 4.8A. Plant PI3K-C2s in general have much longer loop regions (α helix) between beta strands 1 and β. Potential acidic motifs may exist in α1
(DNVDS) and β (E) enriched in glutamic acid, as well as towards the C-terminal end
134
Figure 4.6. Localization of Sl-PI3K-C2 in onion epidermis. (A) Schematic diagram of control without Sl-PI3K-C2 and image of onion epidermis with GFP filter and bright field images (B) Schematic diagram of the chimeric constructs for Sl-PI3K C2:GFP and image of onion epidermis with GFP filter and bright field images. The constructs were introduced into onion epidermal cells by gold particle bombardment. The images were visualized by fluorescence microscopy after 18 h incubation at room temperature. The scale = 100 μm. Arrows indicate plasma membrane (1) and the nucleus (2). GFP filter (I); Bright field (II).
135
Figure 4.7A. Predicted topology of Solanum lycopersicum phosphatidylinositol 3- kinase (Sl-PI3K) C2 domains. The predicted topology of Sl-PI3K C2 domain is type II.
136
Figure 4.7B. Amino acid sequence alignment of phosphatidylinositol 3-kinase (PI3K)
C2 domains from several plant species using ClustalW. In the overall tertiary structure of PI3K, C2 domain occupies a unique position with 3 characteristic antiparallel beta- sheets, hydrophobic regions, acidic as well as alkaline motifs that enable its membrane binding upon activation. C2 domain appears as a region comprising around 170 amino acids. Overall sequences are highly conserved among all the plant species indicated. Motifs that constitute the beta sheets 1-6, and intervening alpha helices are shown in Fig 4.7. The function of PI3K implies that the C2 domain efficiently binds to phosphatidylinositol moieties with high affinity. An interesting feature of the PI3K C2 domain is that in the overall sequence, there are very few acidic (stretches enriched in amino acids such as Glu (E), Asp (D), Gln (Q), Asn(N),
Ser (S) etc.) that would enable binding of calcium ions. This absence of acidic pockets suggests that calcium ions may not be involved in the membrane binding of C2
137 domain. Binding studies suggest that calcium inhibits binding of C2 domain to PI. This property is of very high importance, in the sense that, C2 binding to the membrane can occur in the absence of calcium ions, and can occur before any activation of calcium channels. This is in great contrast to the C2 domain of PLD (Tiwari and
Paliyath, 2011) which shows calcium dependent binding of C2 to acidic phospholipids such as phosphoinositides and PA. As well, this very property suggests that PI3K action is upstream of PLD action. PI3K C2 also possesses several small motifs of basic amino acids (Arg, Lys (K), His (H) etc.). These motifs that lie in the exterior region of C2 protein, may enable the binding of C2 to phosphorylated PI
(Phosphoinositides). Overall, the amino acid sequences and predicted 3D structure support the functional properties of PI3K C2 domain, which places their action upstream of PLD action in the ethylene signal transduction sequence.
138
Figure 4.8. Comparison Solanum lycopersicum phosphatidylinositol 3-kinase (Sl-
PI3K) C2 domain with established protein. (A) Predicted three dimension (3D) structure of Sl-PI3K C2 with other structures using I-Tasser and PHYRE. The 3D structure was developed using UCSF Chimera 1.10rc. (B) Amino acid alignment Sl-
PI3K C2 domain with others established mammalian PI3K C2 domains. Murine Class
IA PI3K p110 Delta (2X38); Human PI3K p110 Alpha (2ENQ); Human PI3K p110
Delta (2WXL); Humsn class II C2 domain (2B3R).
139 of C2. The difference between amino acid sequences for plant PI3K C2 and mammalian PI3K C2 are shown in Figure 4.8B. The predicted surface charge distribution of PI3K-C2 domain according to amino acid sequence was generated using Chimera as shown in Figure 4.9A anf Figure 4.9B. The electropositive area and electronegative area are illustrated in blue and red, respectively. The predicted surface charge showed that PI3K C2 domain has more electropositive (basic) area as compared with electronegative (acidic) area. The electropositive regions covered the loops and conserved regions of positively charged amino acid such as Lys, Arg and
His. Meanwhile the negatively charged surface appears to be embedded towards the interior of the protein. The hydropbobicity analysis of full sequence of PI3K showed three strong hydrophobic regions as shown in Figure 4.10. One of the most hydrophobic regions is located at the C2 domain region towards the beginning of the
N-terminal end of C2.
4.4 Discussion
PI3K is a ubiquitous and a key enzyme that regulates a multitude of physiological processes in animals and plants. In plants, PI3K has been shown to be involved in cell division, cell elongation, stomatal physiology, secretory function (Welters et al., 1994;
Lee et al., 2010), and now senescence/ripening. The PI3K/AKT/mTOR pathway is critical for normal growth and physiology in mammalian systems, and any malfunction of this intricate network of pathways (Zhang et al., 2010; Hers et al., 2011; Zoncu et al., 2011; Laplante and Sabatini, 2015) results in the development of various forms of cancer. PI3K is central to the function of these pathways as it generates the first phosphorylated product of PI, which subsequently leads to the generation of a variety of phosphorylated phosphatidylinositols, which may function as substrates for phospholipase C and phospholipase D (Jones et al., 2006; Paliyath et al. 2008), generating further second messengers and amplifying the
140
Figure 4.9. Domain characteristic of Solanum lycopersicum phosphatidylinositol 3- kinase (Sl-PI3K) C2 domain. (A-B) Predicted electrostatic potential surface property of the Sl-PI3K C2 domain. The image was generated using Chimera 1.10rc. (C)
Hydropathy score of the Sl-PI3K C2 domain. The average hydrophobicity of each amino acid wes calculated using the algorithm of Kyte and Doolittle (1982). H1 and H2 indicate two potential trans-membrane domains (membrane-spinning regions). The positive values for hydropathy show the more energy is required for transfer to water and having hydrophobic regions.
141
Figure 4.10. Predicted three dimension (3D) structure of full sequence of Solanum lycopersicum phosphatidylinositol 3-kinase (Sl-PI3K). (A) The 3D was predicted using
I-Tasser and PHYRE. The 3D structure was developed using UCSF Chimera 1.10rc.
(B) Hydrophobicity plot of Sl-PI3K was estimated through the Kyte-Doolittle method
(1982). The positive values indicate the hydrophobic regions are high. H1, H2 and H3 the most hydrophobic region for Sl-PI3K.
142 signal, or potentially increasing negatively charges domains in the inner plasma membrane facilitating the binding of enzymes and proteins such as PLC and PLD, these enzymes possess calcium/lipid binding domains including C2 domain, pleckstrin homology (PH) domain and EF-hand motifs (Rebecchi and Pentyala, 2000), thus initiating the production of other second messengers such as phosphatidic acid. In our previous studies, we have demonstrated the involvement of PI3K in tobacco flower senescence (Pak-Dek et al., manuscripts in submission). Overexpression of PI3K in tobacco plants resulted in an accelerate flower senescence when compared to flowers from control plants. By contrast, antisense suppression of PI3K, showed the opposite effect by delaying senescence. Down stream senescence related gene expression was also affected through these processes. Further confirming the role of PI3K in fruit senescence, mature green tomato fruits subjected to dip treatment with a specific inhibitor of PI3K, Wortmannin, and inhibited fruit ripening as efficiently as the ethylene receptor blocker 1-MCP, but involving alternate pathways. These results confirmed the regulatory role of PI3K and its product PIP, in the ethylene signal transduction pathway.
Though the involvement of membrane in plant senescence has been well demonstrated (Paliyath and Droillard, 1992; Paliyath et al, 2008) the precise link between the activation of the ethylene receptor and initiation of membrane degradation is not fully understood. Previous studies (Tiwari and Paliyath, 2011b) have shown that the presence of a C2 domain in PLD enables its membrane translocation, and this is a key event in the signal transduction process.
Demonstration that phosphatidic acid, the direct product of PLD action (or generated through phosphorylation of diacylglycerols, a product of phospholipase C), is an inhibitor of CTR1 (Testerink et al., 2007), provided a potential link between the PLD action release of suppression from CTR1, that could activate senescence-associated gene expression. Plant PLDs (and PLCs) possess a C2 domain, which would enable the translocation of PLD to the membrane, after activation of the receptor. Cloned and
143 expressed PLD-C2 showed unique properties with high affinity calcium binding at low micromolar levels, ability to bind to negatively charged phospholipids such as PI, PIP and PIP2 either in the presence or absence of calcium, total inability to bind to phospholipids with positively charged head groups (eg. Phosphatidylcholine, a major phospholipid in plants which may serve as a protective mechanism preventing accidental binding and membrane damage) etc. This suggested that creation of negative charges on the inner membrane may be a more critical event than build up of cytosolic calcium for the activation of PLD. Thus, PI3K was hypothesized to be the enzyme that generates the initial negatively charged domain where PLD could bind, and thus act upstream of PLD.
Interestingly, among the gene sequences identified for the enzymes involved in PI phosphorylation and metabolism, only PI3K possesses a C2 domain, which again supported its regulatory nature in physiological events. To further understand the physicochemical characteristics of the PI3K-C2, gene sequences corresponding to the N-terminal 180 amino acid of the C2 domain were cloned and expressed in bacteria. Amino acid sequences delineated from the cloned C2 in plasmid DNA indicated the predicted molecular mass and isoelectric point for chimeric Sl-PI3K C2 domain to be 22.17 KDa and 8.38, respectively. The protein had 44.7% non-polar amino acid residues indicating a high degree of membrane binding capacity; and
23.6% polar-uncharged amino acid residues (ser, thr). Positively charged and negatively charged amino acids were18.3% and 13.2%, respectively. Leucine was the most abundant amino acid with 24 residues. C2 also possessed three tryptophan residues which were located at Trp81, Trp105 and Trp140 and were used for fluorescence resonance energy transfer (FRET) analysis.
Previous study has shown the expression of class II mammalian PIγK using animal cell line (Misawa et al., 1998; Walker et al., 1999). As compared with protein expression in mammalian systems, expression of foreign protein in bacterial systemz
144 has limitations such as different codon preference, lack of post-translation modification and low expression of protein as soluble protein (Sahdev et al., 2008).
Previous report on expression of class I and class II mammalian PI3K in bacterial system has localized chimeric protein at cytosolic area (Arcaro et al., 1998;
Liu et al. 2006). In the present study, PI3K C2 domain was expressed in E. coli
Rosetta™ β and the protein was localized mainly in the inclusion body. This expression pattern is similar to a previously reported study on S. lycopersicum PδDα-
C2 domain expression under similar conditions used in this study (Tiwari and Paliyath,
2011b). pRare-β plasmid inside Rosetta™ β encodes for bacterial limited tRNA. The presence of seven rare tRNA improves amino acid synthesis process. The expression cell also expresses T7 lysozyme that suppresses the basal expression of T7 RNA polymerase after IPTG induction. The presence of T7 lysozyme stabilizes protein translation (Gräslund et al., 2008). The lysozyme facilitates the cell lysis during freeze- thawing step and catalyzes the hydrolysis of bacterial cell wall (Chipman et al., 1968).
The hydrolyzed cell wall looses the linkage of inclusion body and makes the purification of the target protein more efficient.
The expression of recombinant protein in a bacterial system resulted in the localization of 95% of the total protein in the inclusion bodies (Sørensen and
Mortensen, 2005). The native characteristic of inserted protein determines the localization of foreign protein in bacterial expression system (Carbonell and
Villaverde, 2002). Several methods such as dilution, dialysis or on-column refolding have been used to recover native chimeric protein from inclusion body (Middelberg,
2002; Sørensen et al., 2003). Denaturation with urea and gradual removal of urea by dialysis facilitated the reconstitution of active C2 domain protein from inclusion body
(Tiwari and Paliyath, 2011b). The immobilized metal affinity chromatography (IMAC) using nickel as stationary phase was able to purify the target PI3K- C2 domain to homogeneity.
145 C2 domain has been discovered in protein kinase C (PKC) of mammalian system. Mammalian PKC has four conserved domains namely C1, C2, C3 and C4.
However, C2 is unique domain as compared with others due to its calcium-regulatory property (Hug and Sarre, 1993). In addition, the C2 domain has been identified in various proteins involved in cellular membrane processes such as signal transduction, membrane trafficking, enzyme activation and catalytic reaction (Nalefski and Falke. 1996). However, the number of proteins that possess a C2 domain in their structure is greater in mammalian systems as compared with plant systems (Kopka et al., 1998). In plant systems, C2 has been identified in PI3K (Welters et al., 1994), PI- phospholipase C (PI-PLC), phospholipase D (PLD) and other unidentified protein
(Kopka et al., 1998). In plant system, the C2 domain containing-enzymes such as PI-
PLC and PLD are indicators of environmental changes such as freezing (Vergnolle.,
2005), pathogen infection (Laxalt et al., 2001) and cold-induced condition (Hirayama et al., 1995). PLD expression is also indicator for cell senescence and fruit ripening
(Pinhero et al., 2003). Phosphatidic acid (PA) is a product from hydrolysis of phosphatidylinositides by PLC and PLD (Testerink and Munnik, 2005). PA is known to be a secondary messenger of PLD and PLC activity. PA binds to other protein and recruits the protein movement to membrane and triggers the downstream signaling such as inhibiting CTR1 and releasing downstream suppression during ethylene signal transduction (Meijer and Munnik, 2003; Testerink et al., 2007).
PI3K is involved in several process such as growth and development (Welters et al., 1994), root hair growth (Lee et al., 2008a), generating reactive oxygen species
(Lee et al., 2008a, Park et al., 2003), stomatal closing (Park et al., 2003), autophagy process (Han et al., 2011), pollen development (Lee et al., 2008b), nodule organogenesis and membrane proliferation (Hong and Verma, 1994). PI3K is also involves in lipid signaling processes in plant systems (Lee et al., 2010). However, there are far fewer studies on the function of C2 domain in plants. C2 domain is highly conserved in all classes of PI3K in plants. Interestingly, the expression of PI3K is
146 confined to specific organs or tissues. For instance, class II mammalian PI3K family is only expressed in the liver and not in other organ parts. In addition, the C2 domain is required for normal enzymatic phosphorylation of PI and PI4P (Misawa et al., 1998) by class II PI3K.
In the present study, PI3K C2 domain bound specifically to all tested phosphoinositides and PS. This biding pattern toward PS is in alignment with mammalian PI3K C2 domain. Previous study on mammalian class II PI3K C2 domain showed selective binding towards several phosphoinositides as well as to PS
However, it can also bind to PA and PE (Liu et al. 2006). The binding capability of other C2 domain such as PLD with lipids has been reported through several studies.
Arabidopsis thaliana PLD (At-PLD) in At-PδDα Cβ domain and At-PδD Cβ domains also have binding affinity toward PI45P2 (Zheng et al., 2000). Similarly, Sl-PδDα Cβ domain also showed nearly similar degree of binding with PA, PI, PI3P and PI45P2, and a lesser degree of binding with PE and DAG (Tiwari and Paliyath, 2011b).
PI4,5P2 is not a major phospholipid in the plasma membrane as compared with other phospholipids such as PC and PE. PI4,5P2 covers only around 0.1% of the cytoplasmic leaflet phospholipids in plants (Paliyath et al., 1987). However, PI4,5P2 is a source for three secondary messengers namely PA, DAG and IP3 through PLC and
PLD enzymatic reactions (McLaughlin and Murray, 2005). Most of the binding mechanism for PI4,5P2 with other protein such as PH domain, C2 domain and FYVE domain is via electrostatic interaction (Gambhir et al., 2004; McLaughlin and Murray,
2005; Liu et al. 2006). Electrostatic interaction also determines subcellular targeting for lipid-protein complex, membrane binding and proteins organization at the point of interaction (Mulgrew-Nesbitt et al., 2006). The presence of native basic or hydrophobic amino acid residues could bind to PI4,5P2 via electrostatic or hydrophobic interaction (calcium will not compete for these sites as it is already positively charged) (McLaughlin and Murray, 2005). There is also hydrophobic interaction involve during the binding of PKCα-C2 domain with PS (Verdaguer et al.,
147 1999). Positively charged amino acids such as Lys, Arg and His form positively charged domains or pockets on the protein surface. The binding of PKCα-C2 domain with PI4,5P2 is possible occurs through lysine rich region (LRR) of the protein.
Interestingly, PKCα-C2 domain has higher binding affinity toward PI4,5P2 as compared with PS (Guerrero-Valero et al., 2009). Therefore in the present study, the bindings of PI3K C2 domain to phosphoinositides and PS are mainly due to electrostatic interaction from positively charged amino acid residue and LRR.
The binding of Sl-PI3K C2 domain toward PI reduces with increasing the number of phosphate moieties on the inositol head group. This observation is similar to those which demonstrate binding of several C2 domain proteins to phosphoinositides (Nalefski and Falke, 1996; Dunn et al., 2004; Tiwari and Paliyath,
2011b). For example, the binding property of PδDα Cβ domain with phosphoinositides decreases with the number of phosphate at inositol head group (Tiwari and Paliyath,
2011b). Similarly, the presence of a third phosphate group at the inositol head group reduced the binding properties of mammalian PI3K C2 domain with phosphoinositides. Mammalian PI3K C2 domain has a higher binding affinity towards
PI-4,5P2 and PI-3,4P2 as compared with PI-3,4,5P2, and the reduction in the binding property is probably due to a potential space resistant effect of PI trisphosphate as compared with PI bisphosphate (Lui et al., 2006). In the present study, the binding of
PI3K C2 domain with phosphoinositides decreased with increasing number of phosphate molecules at the PI head group, probably due to space limitation at the protein binding site Interestingly, PI3K C2 domain also can bind to PI without phosphate on the PI head group, which suggests that phosphate is not required for protein binding with PI. However, the presence of monophosphate will enhance the binding as shown by PI monophosphate. Thus, the formation of trisphosphate reduces
PI3K C2 binding affinity with phosphoinositides suggesting that the biosynthesis of PI triphosphate less enhance the binding as compared with PI monophosphate.
148 In mammalian PI3K, C2 domain is located as a distinct domain differentiating from from the catalytic domain and the ATP binding domain (Walker et al., 2000) A similar 3D structure was for the C2 domain, the catalytic domain and the ATP binding domain in Sl-PI3K-C2 (Figure 4.1). The first PI phosphorylation process catalyzed by
PI3K could be considered as first step in PI metabolism since PI3P can be further phosphorylated by other kinases into a variety of phosphoinositides. These phosphoinositides can function as docking sites for enzymes (C2 domains) with increased affinity towards negatively charged lipid domains. Plasma membrane degrading enzymes such as, PLC could hydrolysis PI4,5P2 into secondary messenger, diacylglycerol (DAG) and inositol triphosphate (IP3), while PLD could generate Phosphatidic acid (Paliyath et al., 1987; Paliyath and Droillard 1992; Garcia et al, 1995).
The binding affinity of PδDα Cβ domain toward phosphoinositides suggests thatthe generation of negatively charged domains on the membrane would facilitate
PδDα translocation from the cytosol to the plasma membrane, and could be an early event after stimulation of receptors (Tiwari and Paliyath, 2011a).
The general structure of the C2 domain has 8- -stranded antiparallel protein domain with α-helix at the loop region. The loop could also become CBR (calcium binding region) for calcium ion binding on the C2 domain. In the classical model, the binding of C2 domain with phospholipids is calcium ion-dependent (Nalefski and
Falke, 1996). However in the present study, the binding of PI3K C2 domain towards
PI is calcium ion-independent. The presence of a calcium ion reduced the binding capacity of PI3K C2 domain. The possible function of C2 domain in Sl-PI3K that is maybe able to bind to PI in the absence of calcium ion, similar to mammalian PI3K
C2 domain. The ability to bind to plasma membrane phosphoinositides without the changes in calcium level in cytosol makes PI3K a potential candidate enzyme that involves in early event of plant senescence signalling pathways. Generation of negatively charged regions could potentially serve as binding sites for PLD-C2 and
149 catalytic function generating PA. Calcium level may become elevated in the cytosol either through an ion channel, or membrane destabilization further enhancing PLD binding and initiating the autocatalytic membrane lipid catabolism, a prerunner to plant senescence (Paliyath and Thompson, 1984: Paliyath and Droillard, 1992).
Results of the study suggest the maximum fluorescence can be considered as the most ideal and stable conformation for PI3K C2 domain, the presence of calcium ion reduced its stability. Similarly, different pH also alters PIγK Cβ domain’s stability.
Therefore, the most stable pH for PI3K C2 domain is at neutrality. Too basic or acidic pH reduces PI3K C2 stability. These suggest that PI3K C2 domain is sensitive to environmental changes. PI3K C2 binding affinity towards PI decreased with increasing calcium concentration. The presence of calcium at 10 με to γ0 με inhibited PIγK Cβ domain binding to PI. Similarly, the PI3K C2 domain binding towards PI was also affected by pH. Optimum binding was observed at neutral pH as compared with acidic or basic conditions.
Several C2 domains have been reported to be sensitive to calcium changes such as PδDα Cβ domain (Tiwari and Paliyath, β011b) and phospholipase Aβ
(Nalefski and Falke, 1996), indicating a conformational change. In certain casesthe presence of calcium ions functions as a link between C2 protein domains with their ligands. Mammalian class II PIγK binds to PI and PI4P, but not PI4,5P2, in the presence of calcium or magnesium ions, and in combination with ATP during phosphorylation reactions (Arcaro et al., 1998). In the present study, we have observed calcium ion induced changes in PI3K C2 domain conformation as revealed by a decrease in Trp fluorescence signal. Binding of PI3K C2 to PI decreased with increasing calcium ion concentration. The variation in tryptophan fluorescence indicates a change in protein conformation. PI3K C2 domain has three tryptophan residues. First two tryptophan residues, Trp81 and Trp105 are located at conserved region of C2 domain structure. Meanwhile third tryptophan, Trp140 is located at the end of C-terminal. Conformational changes in the C2 protein may enhance the FRET
150 between the Trp residues and other acceptor amino acids (eg., His). Similarly, the presence of calcium ion reduced PδDα Cβ domain tryptophan fluorescence signal
(Tiwari and Paliyath, 2011b) indicating a conformational change.
The plasma membrane metabolism generates many secondary messengers for cell signal transduction when exposed to different environmental cues (Meijer and
Munnik, 2003). The membrane localized enzymes such as PLD and PLC activity are examples of downstream signals that can be activated during phospholipids metabolism in tomato during ripening (Pinhero et al., 2003, Tiwari and Paliyath,
2011a). PA is a product from phospholipid hydrolysis by PLD in both plant and mammalian systems. PA is able to bind and inhibit several proteins including CTR1, a negative regulator for ethylene biosynthesis (Testerink et al., 2007). As a result from binding of PA to CTR1, the downstream of ethylene biosynthesis reactions are activated.
Subcellular localization of C2 domain couple with fluorescence protein such as
GFP has been reported in mammalian system as compared with plant systems.
Usually the subcellular localization C2 domain in vivo follows the in vitro localization
(Cho and Stahelin, 2006). In mammalian system, the C2 domain protein that has binding affinity towards PS such as PδC Cβ domain (Ananthanarayanan et al.,
β00β), and PKCα Cβ domain (Corbalan-Garcia et al., 1999; Stahelin et al., 2003) have been reported to be localized at PS-rich regions such as the cytosolic leaflet of the plasma membrane. Similarly, for C2 domains that bind to PI4,5P2 have been reported to be localized in PI4,5P2-rich area such as plasma membrane (Evans et al.,
2004). Therefore, the subcellular localization of C2 domain is usually predictable according to the lipid binding pattern. The C2 domain that is able to bind plasma membrane usually has binding affinity for phosphoinositides and PS. The Rsp5 ubiquitin ligase C2 domain that binds to phosphoinositides is localized only at endosomal vesicles (Dunn et al., 2004). In certain cases, the native function of protein itself determines the subcellular localization of its C2 domain (Cho and Stahelin,
151 2006). In Sl-PI3K C2 and PI3K (Pak-Dek et al., manuscript in submission) have both been localized on the plasma membrane predominantly, which suggests that PI3K is involved in senescence.
Cβ domain structure generally consists of -strand cores as the main structure connected by flexible loops of α-Helices, usually much lower in abundance. In the present study, Sl-PI3K C2 domain has type II topology. The PI3K C2 domain showed protein folding similar to mammalian PI3K C2 domains. In mammalian system, there are three classes of PI3K. The classification is based on the type of substrate utilized for the phosphorylation reaction. Class I uses PI4,5P2 as a substrate, class II uses
PI4P as a substrate and class III uses PI as a substrate (Lui et al., 2005; Jean and
Kiger, 2014). Numerous studies are reported for the class I and class II mammalian
PI3K since these enzymes have been considered as marker for certain biological processes includingcancer development (Liu et al., 2009).
PI3K in plant systems belong to class III. Therefore, PI3K plays an important roles in early step of PI metabolism together with phosphatidyinositol 4-kinase (PI4K).
The C2 domain has a different number of beta-sheets as a main structure.
εammalian PKCα (βBγR) has eight anti-parallel beta-sandwich folds with three shallow PIPβ binding sites (δui et al., β005). Class IA PIγK p110 Cβ domain (βXγ8) has seven anti-parallel beta-sandwich folds (Berndt et al., 2010). Protein kinase C C2 domain (PDB ID: 1GMI) has eight anti-parallel beta-sandwiches (Ochoa et al., 2001).
Plant PI3K consists of conserved regions of C2 domain at N-terminal end, in both monocots and dicots. Amino acid such as lysine and arginine are well conserved which is a common feature of C2 that can bind phosphoinositides. In comparison with
NMR and crystal structure, Sl-PI3K C2 domain structure folding has similarity with mammalian PI3K C2 domain. The amino acid sequence alignment showed the highest similarity with murine class IA PIγK p110 Cβ domain (βXγ8). εeanwhile, structural comparison showed Sl-PIγK Cβ has similarity with human PIγK p110α Cβ domain (2ENQ).
152 4.5 Conclusion
C2 domain is located at the N-terminal end of PI3K. Results from this study suggest that PI3K C2 domain could function as a regulatory moiety for PI3K binding to plasma membrane in early event of ethylene signal transduction, prior to phospholipase D binding and the initiation of membrane lipid catabolism as illustrated in Figure 4.11.
The interaction between PI3K C2 with PI was electrostatic and calcium ion- independent modes which suggests that the binding could occur before the increment of calcium ion in the cytoplasm. There is a possibility that first step of PI phosphorylation by PI3K may occur during the beginning of cell senescence where calcium ion concentration is at normal basal level within the cytoplasm.
153
Figure 4.11. Schematic diagram of PI3K function in signal transduction. The activated
C2 domain at the N-terminal of PI3K binds to the plasma membrane to PI rafts creating negatively charged domains that serve as docking sites for PLD alpha/beta
(PδDα/ ) and probably phospholipase C (PδC). PδD action will generate phosphatidic acid PA, and activating ethylene signal transduction cascade. Another potential route via PLC is also shown.Phosphatidylinositol (PI); phosphatidylinositol 3-phosphate
(PI3); phosphatidylinositol 4,5-biphosphate (PI4,5P2); phosphatidic acid (PA); phosphatidylcholine (PC); diacylglycerol (DG).
154 CHAPTER V
GENERAL CONCLUSION AND FUTURE RECOMMENDATION
Phosphatidiylinositol 3-kinase (PI3K) is an enzyme that initiates phosphatidylinositol
(PI) metabolism by the phosphorylation of PI at 3-hydroxyl position resulting in the production of phosphoinositides, which function as secondary messengers, thus serving as regulators of various developmental processes.. In the present study, the function of PI3K during tomato fruit ripening was evaluated. Mature green tomato fruit were treated with wortmannin (0.5 με), hexanal (0.1mε) and 1-methylcyclopropane
(1-MCP). Various ripening parameters and gene expression of ripening related genes were evaluated. Results of the study showed that wortmannin treatment delayed the tomato ripening process similar to that caused by 1-MCP. Wortmannin treatment preserved tomato shelf life and inhibited lycopene development as compared to that of the control. However, other fruit ripening parameters such as ethylene production, carbon dioxide production and texture of wortmannin-treated tomato were almost similar to that of the control. Lycopene biosynthesis in fruit treated with wortmannin or
1-MCP was inhibited, and the fruits remained green during storage. Hexanal treatment delayed tomato ripening significantly slower than control without inhibition on lycopene biosynthesis.
Gene expression analysis showed that wortmannin treatment significantly reduced the expression of genes involved in PI-metabolism related enzymes, membrane phospholipid degrading enzymes, as well as those involved in ethylene biosynthesisand carotenoid biosynthesis. Meanwhile, hexanal and 1-MCP treatments showed different expression pattern of these genes. Hexanal treatment significantly reduced the expression of PLD and PLC involved in membrane phospholipid degradationwhile inducing the expression of carotenoid biosynthesis genes. 1-MCP treatment reduced the expression of genes involved in ethylene biosynthesis,
155 ethylene receptors and carotenoid biosynthesis. The present study suggests that PI3K is required for ripening process and the possible modes of PI3K regulation is via ethylene signal transduction pathway.
The function of Solanum lycopersicum PI3K (Sl-PI3K) in ethylene signal transduction processes was also studied by transgenic expression of Sl-PI3K in
Nicotiana tabacum and delineating its effect on flower senescence. Flowers from Sl-
PI3K-overexpressed plants released significantly higher ethylene as compared with the wild type. These flowers showed a temporal advancement in the climacteric- like ethylene production peak earlier than the wild type flowers. By contrast, downregulating PI3K expression with short hairpin antisense resulted in over 80% inhibition of ethylene production by flowers, and delayed flower senescence as compared with wild type. These flowers from transgenic antisense plants also showed altered flower and pollen development, suggesting the overall involvement of ethylene and PI3K in plant development. Subcellular localization of Sl-PI3K:GFP chimera protein revealed its localization at plasma membrane, inner part of stomata and dividing cells of roots. Pollen development and self-hybridization were impaired in flowers of PI3K downregulated plants suggesting that impairment of PI3K function can adversely affect an array of developmental processes mediated by ethylene.
Formation of PI3P is a key step in the signal transduction pathway facilitated by the membrane translocation of the cytosolic enzyme through the activation of an N- terminal, calcium-sensitive C2 domain. Genomic analyses have confirmed that only one copy of the gene encoding PI3K (Class III) is present in plant genome as compared with mammalian systems which have all three classes. Complementary
DNA encoding Solanum lycopersicum PI3K (Sl-PI3K) C2 domain was cloned into
PET28b (+) vector and expressed in E. coli (RosettaTM2) as a chimeric protein along with a carboxy terminal his-tag. Expressed protein was localized in inclusion bodies, and was purified by solubilization/reconstitution using Nickel-affinity column.
156 Results showed that PI3K C2 domain had a higher binding affinity toward all tested phosphoinositides and phosphatidyserine. The binding decreased with increasing degree of phosphorylation at inositol head group. PI3K C2 domain did not bind to phosphatidic acid (PA) and other phospholipids such as phosphatidylcholine
(PC) and phosphatidylethanolamine (PE). Interestingly, the binding of PI3K C2 domain towards PI did not require calcium and the presence of calcium reduced its binding capacity. Transient expression revealed that Sl-PI3K was localized on nucleus and plasma membrane. The ability of PI3K C2 domain to bind to all phosphoinositides including PI suggesting that PI3K may participate in ethylene signal transduction as an early event, upstream of phospholipase D. A possible model for the action of plant phosphoinositides in plant senescence will be discussed.
In future, the full comparison of mRNA in PI3K OX and sh via RNAseq as compared with the control may give details on how PI3K regulates ethylene biosynthesis in plant system. RNAseq offer broader transcripts to be evaluated. The interaction between PI3K with other plant growth regulators that are known to have interaction with ethylene during normal growth and developemtent will be the main target for evaluation.
157 REFERENCES:
Adams-Phillips, L., Barry, C. and Giovannoni, J. 2004a. Signal transduction systems regulating fruit ripening. Trends in Plant Science, 9, 331-338.
Adams-Phillips, L., Barry, C., Kannan, P., Leclercq, J., Bouzayen, M. and Giovannoni,
J. 2004b. Evidence that CTR1-mediated ethylene signal transduction in tomato is encoded by a multigene family whose members display distinct regulatory features.
Plant Molecular Biology, 54, 387-404.
Agranoff, B.W., Bradley, R.M., Brady, R.O. 1958.The enzymatic synthesis of inositol phosphatide. The Journal of Biological Chemistry, 233, 1077-1083.
Aharoni, N and Lieberman, M. 1979. Ethylene as a regulator of senescence in tobacco leaf discs. Plant Physiology, 64, 801-804.
Akbudaka, B. and Murata, S. 2013. 1-MCP, low O2 and high CO2 reduce disorders and extend vase life of “Rosalin” gerberas during storage. Acta Agriculturae
Scandinavica Section B-Soil and Plant Science, 63, 176-183.
Alexander, L. and Grierson, D. 2002. Ethylene biosynthesis and action in tomato: a model for climacteric fruit ripening. Journal of Experimental Botany, 53, 2039-2055.
Alonso, J.M., Hirayama, T., Roman, G., Nourizadeh, S. and Ecker, J.R. 1999. EIN2, a bifunctional transducer of ethylene and stress responses in Arabidopsis. Science,
284, 2148-2152.
158 Altman, S.A. and Solomos, T. 1995. Differential respiratory and morphological responses of carnations pulsed or continuously treated with silver thiosulfate.
Postharvest Biology and Technology, 5, 331-343.
Ambrish, R., Alper, K., and Yang, Z. 2010. I-TASSER: a unified platform for automated protein structure and function prediction. Nature Protocols, 5, 725-738.
Ananthanarayanan, B., Das, S., Rhee, S.G., Murray, D. and Cho, W. 2002.
Membrane targeting of C2 domains of phospholipase C- isoforms. The Journal of
Biological Chemistry, 277 3568–3575.
Anna, M.B., Sonia, S., Guglielmo, C., Emidio, S., Vanina, Z., Stefania, B., and
Patrizia, T. 2002. Peach (Prunus persica) fruit ripening: aminoethoxyvinylglycine
(AVG) and exogenous polyamines affect ethylene emission and flesh firmness.
Physiologia Plantarum, 114, 472-481.
Aparicio-Fabre,R., Guillén, G., Estrada, G., Olivares-Grajales, J., Gurrola, G. and
Sánchez, F. 2006. Profilin tyrosine phosphorylation in poly-L-proline-binding regions inhibits binding to phosphoinositide 3-kinase in Phaseolus vulgaris. The Plant Journal,
47, 491-500.
Arc, E., Sechet, J., Corbineau, F., Rajjou, L. and Marion-Poll, A. 2013. ABA crosstalk with ethylene and nitric oxide in seed dormancy and germination. Frontiers in Plant
Science, 63, 1-19.
Arcaro, A., and Wymann, M.P.1993. Wortmannin is a potent phosphatidylinositol 3- kinase inhibitor: the role of phosphatidylinositol 3,4,5-trisphosphate in neutrophil responses. The Biochemical Journal, 296, 297-301.
159 Arcaro, A., Volinia, S., Zvelebil, M.J., Stein, R., Watton, S.J., Layton, M.L., Gout, I.,
Ahmadi, K., Downward, J. and Waterfield, M.D. 1998. Human Phosphoinositide 3-
Kinase Cβ , the Role of Calcium and the Cβ Domain in Enzyme Activity. The Journal of Biological Chemistry, 273, 33082-33090.
Arisz, S.A., Testerink, C. and Munnik, T. 2009. Plant PA signaling via diacylglycerol kinase. Biochimica et Biophysica Acta, 1791, 869-875.
Ashrafuzzaman, M. and Tuszynski, J. 2013. Structure of Membranes. In Membrane
Biophysics, Biological and Medical Physics, Biomedical Engineering 9-30.
Atra-Aly, M.A., Saltveit, M.E.Jr. and Hobson, G.E. 1987. Effect of Silver Ions on
Ethylene Biosynthesis by Tomato Fruit Tissue. Plant Physiology, 83, 44-48.
Auger, K.R., Serunian, L.A., Soltoff, S.P., Libby, P. and Cantley, L.C. 1989. PDGF- dependent tyrosine phosphorylation stimulates production of novel polyphosphoinositides in intact cells. Cell, 57, 167-175.
Backer, J.M. 2008. The regulation and function of Class III PI3Ks: novel roles for
Vps34. The Biochemical Journal, 410, 1-17.
Bae, Y.S., Cantley, L.G., Chen, C.S., Kim, S.R., Kwon, K.S. and Rhee, S.G. 1998.
Activation of phospholipase C-gamma by phosphatidylinositol 3,4,5-trisphosphate.
The Journal of Biological Chemistry, 273, 4465-4469.
Bak, G., Lee, E.J., Lee, Y., Kato, M., Segami, S., Sze, H., Maeshima, M., Hwang, J.U. and Lee, Y. 2013. Rapid structural changes and acidification of guard cell vacuoles
160 during stomatal closure require phosphatidylinositol 3,5-bisphosphate. The Plant Cell,
25, 2202-2216.
Balla, T. 2013. Phosphoinositides: tiny lipids with giant impact on cell regulation.
Physiological Review, 93, 1019-1137.
Bargmann, B.O. and Munnik, T. 2006. The role of phospholipase D in plant stress responses. Current Opinion in Plant Biology, 9, 515-522.
Bari, R. and Jones, J.D. 2009. Role of plant hormones in plant defence responses.
Plant Molecular Biology, 69, 473-488.
Barry, C.S., Blume, B., Bouzayen, M., Cooper, W., Hamilton, A.J. and Grierson, D.
1996. Differential expression of the 1-aminocyclopropane-1-carboxylate oxidase gene family of tomato. The Plant Journal, 9, 525-535.
Barry, C.S., Llop-Tous, M.I. and Grierson, D. 2000. The regulation of 1- aminocyclopropane-1-carboxylic acid synthase gene expression during the transition from system-1 to system-2 ethylene synthesis in tomato. Plant Physiology, 123, 979-
986.
Barry, C.S. and Giovannoni, J.J. 2007. Ethylene and fruit ripening. Journal of Plant
Growth Regulation, 26, 143-159.
Batra, P. and Sharma, A.K. Anti-cancer potential of flavonoids: recent trends and future perspectives. 3 Biotech, 3,439-459.
161 Batu, A. 2004. Determination of acceptable firmness and colour values of tomatoes.
Journal of Food Engineering, 61, 471-475.
Baur, A.H. and Yang, S.F. 1972. Methionine metabolism in apple tissue in relation to ethylene biosynthesis. Phytochemistry, 11, 3207-3214.
Benz, R. and Bauer, K. 1988. Permeation of hydrophilic molecules through the outer membrane of gram-negative bacteria. Review on bacterial porins. European Journal of Biochemistry, 176, 1-19.
Berndt, A., Miller, S., Williams, O., Le, D.D., Houseman, B.T., Pacold, J.I., Gorrec, F.,
Hon, W.C., Liu, Y., Rommel, C., Gaillard, P., Rückle, T., Schwarz, M.K., Shokat, K.M.,
Shaw, J.P., and Williams, R.L. 2010. The p110 delta structure: mechanisms for selectivity and potency of new PI(3)K inhibitors. Nature Chemical Biology, 6, 117-124.
Berridge, M.J. 1987. Inositol Trisphosphate and Diacylglycerol: Two Interacting
Second Messengers. Annual Reviews of Biochemistry, 56, 159-193.
Berridge, M.J. and Irvine, R.F. 1989. Inositol phosphates and cell signalling. Nature,
341, 197-205.
Besterman, J.M. and Low, R.B. 1983. Endocytosis: a review of mechanisms and plasma membrane dynamics. Biochemical Journal, 210, 1-13.
Beutelmann, P. and Kende, H. 1977. Membrane Lipids in Senescing Flower Tissue of
Ipomoea tricolor. Plant Physiology, 59, 888-893.
Binder, B.M., Walker, J.M., Gagne, J.M., Emborg, T.J., Hemmann, G., Bleecker, A.B. and Vierstra, R.D. 2007. The Arabidopsis EIN3 binding F-Box proteins EBF1 and
162 EBF2 have distinct but overlapping roles in ethylene signaling. The Plant Cell, 19,
509-523.
Binder, B.M. 2008. The ethylene receptors: complex perception for a simple gas.
Plant Science, 175, 8-17.
Bisson, M.M., Bleckmann, A., Allekotte, S. and Groth, G. 2009. EIN2, the central regulator of ethylene signalling, is localized at the ER membrane where it interacts with the ethylene receptor ETR1. The Biochemical Journal, 424, 1-6.
Blankenship, S. and Dole, J.M. 2003. 1-Methylcyclopropene: A review. Postharvest
Biology and Technology, 28, 1-25.
Blatt, M.R., Thiel, G. and Trentham, D.R. 1990. Reversible inactivation of K+ channels of Vcia stomatal guard cells following the photolysis of caged inositol 1,4,5- trisphosphate. Nature 346, 766-769.
Bleecker, A.B., Estelle, M.A., Somerville, C. and Kende, H. 1988. Intensitivity to ethylene conferred by a dominant mutation in Arabidopsis thaliana. Science, 241,
1086-1089.
Bleecker, A.B. and Kende, H. 2000. Ethylene: a gaseous signal molecule in plants.
Annual Review of Cell and Developmental Biology, 16, 1-40.
Bohdanowicz, M. and Grinstein, S. 2013. Role of Phospholipids in Endocytosis,
Phagocytosis, and Macropinocytosis. Physiological Reviews, 93, 69-106.
163 Boss, W.F. and Im, Y.J. 2012. Phosphoinositide Signaling. Annual Review of Plant
Biology, 63, 409-429.
Botha, M-L. and Whitehead, C.S. 1992. The effect of polyamines on ethylene synthesis during normal and pollination-induced senescence of Petunia hybrida L. flowers. Planta, 188, 478-483.
Bovet, L., Müller, M-O., and Siegenthaler, P-A. 2001. Three distinct lipid kinase activities are present in spinach chloroplast envelope membranes: phosphatidylinositol phosphorylation is sensitive to wortmannin and not dependent on chloroplast ATP. Biochemical and Biophysical Research Communications, 289, 269–
275.
Bradford, M.M. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Analytical
Biochemistry, 72, 248-254.
Bramley, P.M. 2002. Regulation of carotenoid formation during tomato fruit ripening and development. Journal of Experimental Botany, 53, 2107-2113.
Bunney, T.D., Watkins, P.A., Beven, A.F., Shaw, P.J., Hernandez, L.E., Lomonossoff,
G.P., Shanks, M., Peart, J. and Drobak, B.K. 2000. Association of phosphatidylinositol
3-kinase with nuclear transcription sites in higher plants. The Plant Cell, 12, 1679-
1688.
Burg, S.P. and Burg, E.A. 1965. Ethylene action and the ripening of fruit. Science,
148, 1190-1196.
164 Byfield, M.P., Murray, J.T. and Backer, J.M. 2005. hVps34 is a nutrient-regulated lipid kinase required for activation of p70 S6 kinase. The Journal of Biological Chemistry,
280, 33076-33082.
Camprubi, P. and Nichols, R. 1978. Effect of ethylene on carnation flowers (Dianthus caryophyllus L.) cut at different stages of development. Journal of Horticultural
Science, 53, 17-22.
Cancel, J.D. and Larsen, P.B. 2002. Loss-of-function mutations in the ethylene receptoretr1 cause enhanced sensitivity and exaggerated response to ethylene in
Arabidopsis. Plant Physiology, 129, 1557-1567.
Cano, A., Acosta, M. and Arnao, M.B. 2003. Hydrophilic and lipophilic antioxidant activity changes during on-vine ripening of tomatoes (Lycopersicon esculentum Mill.).
Postharvest Biology and Technology, 28, 59-65.
Cara, B. and Giovannoni, J.J. 2008. Molecular biology of ethylene during tomato fruit development and maturation. Plant Science, 175, 106-113.
Carbonell, X. and Villaverde, A. 2002. Protein aggregated into bacterial inclusion bodies does not result in protection from proteolytic digestion. Biotechnology Letters,
24, 1939-1944.
Chang, C., Kwok, S.F., Bleecker, A.B. and Meyerowitz, E.M. 1993. Arabidopsis ethylene-response gene ETR1: similarity of product to two-component regulators.
Science, 262, 539-544.
165 Chang-Ileto, B., Frere, S.G. and Di Paolo, G. 2012. Acute manipulation of phosphoinositide levels in cells. Methods Cell Biology, 108, 187-207.
Cheema, A., Padmanabhan, P., Subramanian, J., Blom, T. and Paliyath, G. 2014.
Improving quality of greenhouse tomato (Solanum lycopersicum L.) by pre- and postharvest applications of hexanal-containing formulations. Postharvest Biology and
Technology, 95, 13-19.
Chen, Y.F., Randlett, M.D., Findell, J.L. and Schaller, G.E. 2002. Localization of the
Ethylene Receptor ETR1 to the Endoplasmic Reticulum of Arabidopsis. The Journal of
Biological Chemistry, 277: 19861-19866.
Cheng, M.C., Liao, P.M., Kuo, W.W. and Lin, T.P. 2013. The Arabidopsis ETHYLENE
RESPONSE FACTOR1 regulates abiotic stress-responsive gene expression by binding to different cis-acting elements in response to different stress signals. Plant
Physiology, 162, 1566-1582.
Chipman, D.M.,Pollock, J.J. and Sharon, N. 1968. Lysozyme-catalyzed hydrolysis and transglycosylation reactions of bacterial cell wall oligosaccharides. The Journal of
Biological Chemistry, 243, 487-496.
Cho, W., and Stahelin. R.V. 2006. Membrane binding and subcellular targeting of C2 domains. Biochimica et Biophysica Acta, 1761, 838–849.
Clark, K.L., Larsen, P.B., Wang, X. and Chang, C. 1998. Association of the
Arabidopsis CTR1 Raf-like kinase with the ETR1 and ERS ethylene receptors.
Proceedings of the National Academy of Sciences USA, 95, 5401-5406.
166 Clayton, M., Biasi, W.V., Southwick, S.M. and Mitcham, E.J. 2000. Retain TM affects maturity and ripening of ‘Bartlett’ pear. HortScience, γ5, 1β94-1299.
Cockcroft, S. and Carvou, N. 2007. Biochemical and biological functions of class I phosphatidylinositol transfer proteins. Biochimica et Biophysica Acta, 1771, 677-691.
Corbalan-Garcia, S., Rodriguez-Alfaro, J.A. and Gomez-Fernandez, J.C.1999.
Determination of the calcium-binding sites of the C2 domain of protein kinase Calpha that are critical for its translocation to the plasma membrane. Biochemical Journal,
337, 513–521.
Corbalan-Garcia, S., Sánchez-Carrillo, S., García-García, J., and Gómez-Fernández,
J.C. 2003. Characterization of the membrane binding mode of the C2 domain of
PKC . Biochemistry, 42, 11661–11668.
Davies, J.N. 1966. Changes in the non-volatile organic acids of tomato fruit during.
Journal of the Science of Food and Agriculture, 17, 396-400.
De Matteis, M.A. and D'Angelo, G. 2007. The role of the phosphoinositides at the
Golgi complex. Biochemical Society Symposium, 74, 107-116.
Deamer, D.W. and Dworkin, J.P. 2005. Chemistry and physics of primitive membranes. Prebiotic Chemistry, 259, 1-27.
Dennis, E.A., Rhee, S.G., Billah, M.M. and Hannun, Y. A. 1991. Role of phospholipase in generating lipid second messengers in signal transduction. The
FASEB Journal, 5, 2068-2077.
167 DePierre, J.W. and Karnovsky, M.L. 1973. Plasma membranes of mammalian cells. a review of methods for their characterization and isolation. Journal of Cell Biology, 56,
275-303.
Domin, J., Pages, F., Volinia, S., Rittenhouse, S.E., Zvelebil, M.J., Stein, R.C. and
Waterfield, M.D. 1997. Cloning of a human phosphoinositide 3-kinase with a C2 domain that displays reduced sensitivity to the inhibitor wortmannin. The Biochemical
Journal, 326, 139-147.
Dong, C.H., Rivarola, M., Resnick, J.S., Maggin, B.D. and Chang, C. 2008.
Subcellular co-localization of Arabidopsis RTE1 and ETR1 supports a regulatory role for RTE1 in ETR1 ethylene signalling. The Plant Journal, 53, 275-286.
Dove, S.K., Cooke, F.T., Douglas, M.R., Sayers, L.G., Parker, P.J. and Michell, R.H.
1997. Osmotic stress activates phosphatidylinositol-3,5-bisphosphate synthesis.
Nature, 390, 187-192.
Dove, S.K., Lloyd, C.W., and Drøbak, B.K. 1994. Identification of a phosphatidylinositol 3-hydroxy kinase in plant cells: association with the cytoskeleton.
Biochemical Journal, 303, 347-350.
Drobak, B.K. 1993. Plant Phosphoinositides and Intracellular Signaling. Plant
Physiology, 102, 705-709.
Drobak, B.K., and Watkins, P.A.C. 1994. Inositol(1,4,5)trisphosphate production in plant cells: Stimulation by the venom peptides, mellitin and mastoparan. Biochemical and Biophysical Research Communications, 205, 739–745.
168 Dunn, R., Klos, D.A., Adler, A.S., and Hicke, L. 2004. The C2 domain of the Rsp5 ubiquitin ligase binds membrane phosphoinositides and directs ubiquitination of endosomal cargo. Journal of Cell Biology, 165, 135–144.
Edwards, J.I., Saltveit, M.E. and Henderson, W.R. 1983. Inhibition of lycopene synthesis in tomato pericarp tissue by inhibitors of ethylene biosynthesis and reversal with applied ethylene. Journal of the American Society for Horticultural Science, 108,
512-514.
Eliás, M., Potocký, M., Cvrcková, F. and Zárský, V. 2002. Molecular diversity of phospholipase D in angiosperms. BMC Genomics, 3,1-15.
Ellson, C.D., Gobert-Gosse, S., Anderson, K.E., Davidson, K., Erdjument-Bromage,
H., Tempst, P., Thuring, J.W., Cooper, M.A., Lim, Z., Holmes, A.B., Gaffney, P.R.J.,
Coadwell, J., Chilvers, E.R., Hawkins, P.T. and Stephens, L.R. 2001. PtdIns(3)P regulates the neutrophil oxidase complex by binding to the PX domain of p40phox.
Nature Cell Biology, 3, 679-682.
Essen, L.-O., Perisic, O., Cheung, R.,, Katan M. and Williams, R.L. 1996. Crystal structure of a mammalian phosphoinositide-specific phospholipase C . Nature, γ80,
595–602.
Evans, J.H., Gerber, S.H., Murray, D., and Leslie, C.C. 2004. The calcium binding loops of the cytosolic phospholipase A2 C2 domain specify targeting to Golgi and ER in live cells. Molecular Biology of the Cell, 15, 371–383.
169 Expósito-Rodríguez, M., Borges, A.A., Borges-Pérez, A. and Pérez, J.A. 2008.
Selection of internal control genes for quantitative real-time RT-PCR studies during tomato development process. BMC Plant Biology, 8, 131.
Fahy, E., Subramaniam, S., Brown, H.A., Glass, C.K., Merrill, A.H.Jr., Murphy, R.C.,
Raetz, C.R., Russell, D.W., Seyama, Y., Shaw, W., Shimizu, T., Spener, F., van Meer,
G., VanNieuwenhze, M.S., White, S.H., Witztum, J.L. and Dennis, E.A. 2013. A comprehensive classification system for lipids. Journal of Lipid Research, 46, 839-
861.
Fan, X., Argenta, L. and Mattheis, J.P. 2000. Inhibition of ethylene action by 1- methylcyclopropane prolongs storage life of apricots. Postharvest Biology and
Technology, 20, 135-142.
Fish, W.W., Perkins-Veazie, P. and Collins, J.K. 2002. A quantitative assay for lycopene that utilizes reduced volumes of organic solvents. Journal of Food
Composition and Analysis, 15, 309-317.
Foster, F.M., Traer, C.J., Abraham, S.M. and Fry, M.J. 2003. The phosphoinositide
(PI) 3-kinase family. Journal of Cell Science, 116, 3037-3040
Fraser, P.D., Truesdale, M.R., Bird, C.R., Schuch, W. and Bramley, P.M. 1994.
Carotenoid biosynthesis during tomato fruit development (evidence for tissue-specific gene expression). Plant Physiology, 105, 405-413.
Frech, M., Andjelkovic, M., Ingley, E., Reddy, K.K., Falck, J.R., Hemmings, B.A. 1997.
High affinity binding of inositol phosphates and phosphoinositides to the pleckstrin
170 homology domain of RAC/protein kinase B and their influence on kinase activity. The
Journal of Biological Chemistry, 272, 8474-8481.
Fruman, D.A., Snapper, S.B., Yballe, C.M., Davidson, L., Yu, J.Y., Alt, F.W. and
Cantley, L.C. 1999. Impaired B cell development and proliferation in absence of phosphoinositide 3-kinase p85α. Science, β8γ, γ9γ-397.
Fruman, D.A.1., Meyers, R.E., and Cantley, L.C. 1998. Phosphoinositide kinases.
Annual Review of Biochemistry, 67, 481-507.
Fujimoto, M., Suda, Y., Vernhettes, S., Nakano, A. and Ueda, T. 2015.
Phosphatidylinositol 3-kinase and 4-kinase have distinct roles in intracellular trafficking of cellulose synthase complexes in Arabidopsis thaliana. Plant and Cell
Physiology, 56, 287-298.
Gaidarov, I., Smith, M.E., Domin, J. and Keen, J.H. 2001. The class II phosphoinositide 3-kinase C2alpha is activated by clathrin and regulates clathrin- mediated membrane trafficking. Molecular Cell, 7, 443-449.
Gambhir, A, Hangyás-Mihályné G, Zaitseva. I., Cafiso, D.S., Wang, J., Murray, D.,
Pentyala, S.N., Smith, S.O. and McLaughlin, S. 2004. Electrostatic sequestration of
PIP2 on phospholipid membranes by basic/aromatic regions of proteins. Biophysical
Journal, 86, 2188-2207.
Gao, Z., Chen, Y.F., Randlett, M.D., Zhao, X.C., Findell, J.L., Kieber, J.J. and
Schaller, G.E. 2003. Localization of the Raf-like kinase CTR1 to the endoplasmic reticulum of Arabidopsis through participation in ethylene receptor signaling complexes. The Journal of Biological Chemistry, 278, 34725-34732.
171 Gao, X-Q. and Zhang, X.S. 2012. Metabolism and roles of phosphatidylinositol 3- phosphate in pollen development and pollen tube growth in Arabidopsis. Plant
Signaling and Behavior, 7, 165-169.
Garcia, M.L. and Strehler, E.E. 1999. Plasma membrane calcium ATPases as critical regulators of calcium homeostasis during neuronal cell function. Frontiers in
Bioscience, 4, 869-882.
Garcia, P., Gupta. R., Shah, S., Morris, A.J., Rudge, S.A., Scarlata, S., Petrova, V.,
McLaughlin, S., and Rebecchi, M.J. 1995. The pleckstrin homology domain of phospholipase C-ä1 binds with high affinity to phosphatidylinositol 4,5-bisphosphate in bilayer membranes. Biochemistry, 34, 16228–16234.
Garcia, R.A., Forde, C.E. and Godwin, H.A. 2000. Calcium triggers an intramolecular association of the C2 domains in synaptotagmin. Proceedings of the National
Academy of Sciences USA, 97, 5883–5888.
Gibbs, C.S. and Zoller, M.J. 1991. Rational scanning mutagenesis of a protein kinase identifies functional regions involved in catalysis and substrate interactions. The
Journal of Biological Chemistry, 266, 8923-8931.
Gillooly, D.J., Morrow, I.C., Lindsay, M., Gould, R., Bryant, N.J., Gaullier, J.M., Parton,
R.G. and Stenmark, H. 2000. Localization of phosphatidylinositol 3-phosphate in yeast and mammalian cells. The EMBO Journal, 19, 4577-4588.
Gilroy, S., Read, N.D. and Trewavas, A.J. 1990. Elevation of cytoplasmic calcium by caged calcium or caged inositol triphosphate initiates stomatal closure. Nature,
346,769-771.
172 Giovannoni, J.J. 2004. Genetic Regulation of Fruit Development and Ripening. The
Plant Cell, 16, S170-S180.
Gräslund, S., Sagemark, J., Berglund, H., Dahlgren, L.G., Flores, A., Hammarström,
M., Johansson, I., Kotenyova, T., Nilsson, M., Nordlund, P. and Weigelt, J. 2007. The use of systematic N- and C-terminal deletions to promote production and structural studies of recombinant proteins. Protein Expression and Purification, 58, 210-221.
Gray, J.E., Picton, S., Giovannoni, J.J. and Grierson, D. 1994. The use of transgenic and naturally‐occurring mutants to understand and manipulate tomato fruit ripening.
Plant, Cell and Environment, 17, 557-571.
Grefen, C., Stadele, K., Ruzieka, K., Obrdlik, P., Harter, K. and Horak, J. 2008.
Subcellular localization and in vivo interactions of the Arabidopsis thaliana ethylene receptor family members. Molecular Plant, 1, 308-320.
Groves, M.R., Hanlon, N., Turowski, P., Hemmings, B.A. and Barford, D. 1999. The structure of the protein phosphatase 2A PR65/A subunit reveals the conformation of its 15 tandemly repeated HEAT motifs. Cell, 96, 99-110.
Guerrero-Valero, M., Ferrer-Orta, C., Querol-Audí, J., Marin-Vicente, C., Fita, I.,
Gómez-Fernández, J.C., Verdaguer, N. and Corbalán-García, S. 2009 Structural and mechanistic insights into the association of PKCalpha-C2 domain to PtdIns(4,5)P2.
Proceedings of the National Academy of Sciences USA, 106, 6603-6607.
Guzmán, P. and Ecker, J.R. 1990. Exploiting the triple response of Arabidopsis to identify ethylene-related mutants. The Plant Cell 2, 513-523
173 Han, S., Yu, B., Wang, Y., and Liu, Y. 2011. Role of plant autophagy in stress response. Protein and Cell, 2, 784-791.
Hedrich, R. and Schroeder, J.I. 1989. The physiology of ion channels and electrogenic pumps in higher plants. Annual Review of Plant Physiology and Plant Molecular
Biology, 1989. 40, 539-569.
Heilmann, M., and Heilmann, I. 2015. Plant phosphoinositides-complex networks controlling growth and adaptation. Biochimica et Biophysica Acta (BBA) - Molecular and Cell Biology of Lipids, 1851, 759-769.
Hellens, R.P., Edwards, E.A., Leyland, N.R., Bean, S. and Mullineaux, P.M. 2000. pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant transformation. Plant Molecular Biology, 42, 819-832.
Herman, P.K. and Emr, S.D. 1990. Characterization of VPS34, a gene required for vacuolar protein sorting and vacuole segregation in Saccharomyces cerevisiae.
Molecular and Cellular Biology, 10, 6742-6754.
Hers, I., Vincent, E.E. and Tavaré, J.M. 2011. Akt signalling in health and disease.
Cellular Signalling, 23, 1515-1527.
Hirano, T., Matsuzawa, T., Takegawa, K. and Sato, M.H. 2011. Loss-of-function and gain-of-function mutations in FAB1A/B impair endomembrane homeostasis, conferring pleiotropic developmental abnormalities in Arabidopsis. Plant Physiology, 155, 797-
807.
174 Hirayama, T., Ohto, C., Mizoguchi, T., and K Shinozaki, K. 1995. A gene encoding a phosphatidylinositol-specific phospholipase C is induced by dehydration and salt stress in Arabidopsis thaliana. Proceedings of the National Academy of Sciences
USA, 92, 3903–3907.
Hokin L.E. and Hokin M.R. 1964. The incorporation of 32P from triphosphate into polyphosphoinositides [ -32P]adenosine and phosphatidic acid in erythrocyte membranes. Biochimica et Biophysica Acta, 84, 563-575.
Hokin, L.E. 1985. Receptors and phosphoinositi-gegenerated second messengers.
Annual Review of Biochemistry, 54, 205-235.
Hong, J.H. and Gross, K.C. 2000. Involvement of ethylene in development of chilling injury in fresh-cut tomato slices during cold storage. Journal of the American Society for Horticultural Science, 125, 736-741.
Hong, Z. and Verma, D.P. 1994. A phosphatidylinositol 3-kinase is induced during soybean nodule organogenesis and is associated with membrane proliferation.
Proceedings of the National Academy of Sciences of the USA, 91, 9617-9621.
Horsch, R.B., Fraley, R.T., Rogers, S.G., Sanders, P.R., Lloyd, A. and Hoffmann, N.
1984. Inheritance of functional foreign genes in plants. Science 223: 496-498.
Hua, J., Sakai, H., Nourizadeh, S., Chen, Q.G., Bleecker, A.B., Ecker, J.R. and
Meyerowitz, E.M. 1998. EIN4 and ERS2 are members of the putative ethylene receptor gene family in Arabidopsis. The Plant Cell, 10, 1321-1332.
175 Hug, H., and Sarre, T.F. 1993. Protein kinase C isoenzymes: divergence in signal transduction? Biochemical Journal, 291, 329-343.
Ischebeck, T., Stenzel, I. and Heilmann, I. 2008. Type B phosphatidylinositol-4- phosphate 5-kinases mediate Arabidopsis and Nicotiana tabacum pollen tube growth by regulating apical pectin secretion. The Plant Cell, 20, 3312-3330.
Ischebeck, T., Stenzel, I., Hempel, F., Jin, X., Mosblech, A. and Heilmann, I. 2011.
Phosphatidylinositol-4,5-bisphosphate influences Nt-Rac5-mediated cell expansion in pollen tubes of Nicotiana tabacum. The Plant Journal, 65, 453-468.
Jacob, T., Ritchie, S., Assmann, S.M., and Gilroy, S. 1999. Abscisic acid signal transduction in guard cells is mediated by phospholipase D activity. Proceedings of the National Academy of Sciences USA, 96, 12192-12197.
Jakubowicz, ε., Gałgańska, H., Nowak, W. and Sadowski, J. 2010. Exogenously induced expression of ethylene biosynthesis, ethylene perception, phospholipase D, and Rboh-oxidase genes in broccoli seedlings. Journal of Experimental Botany, 61,
3475-3491.
Jean, S. and Kiger, A.A. 2014. Classes of phosphoinositide 3-kinases at a glance.
Journal of Cell Science, 127, 923-928.
Jeong, J., Huber, D.J. and Sargent, S.A. 2002. Influence of 1-methylcyclopropene (1-
MCP) on ripening and cell wall matrix polysaccharides of avocado. Postharvest
Biology and Technology, 25, 241-256.
176 Johnston, J.W., Gunaseelan, K., Pidakala, P., Wang, M. and Schaffer, R.J. 2009. Co- ordination of early and late ripening events in apples is regulated through differential sensitivities to ethylene. Journal of Experimental Botany, 60, 2689-2699.
Jones, D.R., Bultsma, Y., Keune, W.J., Halstead, J.R., Elouarrat, D. and Mohammed,
S. 2006. Nuclear PtdIns5P as a transducer of stress signaling: an in vivo role for
PIP4Kbeta. Molecular cell, 23, 685-695.
Joo, J.H., Yoo, H.J., Hwang, I., Lee, J.S., Nam, K.H., and Bae, Y.S. 2005. Auxin- induced reactive oxygen species production requires the activation of phosphatidylinositol 3-kinase. FEBS Letter, 579, 1243-1248.
Ju, C., Yoon, G.M., Shemansky, J.M., Lin, D.Y., Ying, Z.I., Chang, J., Garrett, W.M.,
Kessenbrock, M., Groth, G., Tucker, M.L., Cooper, B., Kieber, J.J. and Chang, C.
2012. CTR1 phosphorylates the central regulator EIN2 to control ethylene hormone signalling from the ER membrane to the nucleus in Arabidopsis. Proceedings of the
National Academy of Sciences of the USA, 109, 19486-19491.
Jung, J.Y., Kim, Y.W., Kwak, J.M., Hwang, J.U., Young, J., Schroeder, J.I., Hwang, I and Lee, Y. 2002. Phosphatidylinositol 3- and 4-phosphate are required for normal stomatal movements. The Plant Cell, 14, 2399-2412.
Kader, A.A. and Mitchell, F.G. 1989. Maturity and quality. In LaRue, J.H. and
Johnson, R.S. (eds). Peaches, plums and nectarines-growing and handling for fresh market, 3331, University of California Division of Agriculture and Natural Resources, pp 191-196.
177 Kanai, F., Liu, H., Field, S.J., Akbary, H., Matsuo, T., Brown, G.E., Cantley, L.C. and
Yaffe, M.B. 2001. The PX domains of p47phox and p40phox bind to lipid products of
PI(3)K. Nature Cell Biology, 3, 675-678.
Kato, U., Inadome, H., Yamamoto, M., Emoto, K., Kobayashi, T. and Umeda, M.
2012. Role for phospholipid flippase complex of ATP8A1 and CDC50A proteins in cell migration. Journal of Biological Chemistry, 288, 4922-4934.
Katso, R., Okkenhaug, K., Ahmadi, K., White, S., Timms, J., Waterfield, M.D. 2001.
Cellular function of phosphoinositide 3-kinases: implications for development, homeostasis, and cancer. Annual Review of Cell and Developmental Biology, 17, 615-
675.
Kelley, L.A., and Sternberg, M.J.E. 2009. A case study using the Phyre server. Nature
Protocols, 4, 363-371.
Kevany, B., Taylor, M. and Klee, H. 2008. Fruit-specific suppression of the ethylene receptor ETR4 results in early ripening tomato fruit. Plant Biotechnology Journal, 6,
295-300.
Kim, D.H., Eu, Y-J., Yoo, C.M., Kim, Y-W., Pih, K.T., Jin, J.B., Kim, S.J., Stenmark, H. and Hwang, I. 2001a. Trafficking of phosphatidylinositol 3-phosphate from the trans-
Golgi network to the lumen of the central vacuole in plant cells. The Plant Cell, 13,
287–301.
Kim, J.H., Kim, W.T. and Kang, B.G. 2001b. IAA and N(6)-benzyladenine inhibit ethylene-regulated expression of ACC oxidase and ACC synthase genes in mungbean hypocotyls. Plant and Cell Physiology, 42, 1056-1061.
178 Kim, Y.J., Guzman-Hernandez, M.L. and Balla, T. 2011. A highly dynamic ER-derived phosphatidylinositol-synthesizing organelle supplies phosphoinositides to cellular membranes. Development Cell, 21, 813-824.
Kitinoja, L. and J.F. Thompson. 2010. Pre-cooling systems for small-scale producers.
Stewart Postharvest Review, 2, 1-14.
Klee, H. and Tieman, D. 2002. The tomato ethylene receptor gene family: form and function. Physiologia Plantarum, 115, 336-341.
Kluge, R.A. and Jacomino, A.P. 2002. Shelf life of peaches treated with 1- methylcyclopropene. Scientia Agricola, 59, 69-72.
Kopka, J., Pical, C., Hetherington, A.M., and Müller-Röber, B. 1998.Ca2+/phospholipid- binding (C2) domain in multiple plant proteins: novel components of the calcium- sensing apparatus. Plant Molecular Biology, 36, 627-637.
Kost, B., Lemichez, E., Spielhofer, P., Hong, Y., Tolias, K., Carpenter, C. and Chua,
N.H. 1999. Rac homologues and compartmentalized phosphatidylinositol 4, 5- bisphosphate act in a common pathway to regulate polar pollen tube growth. The
Journal of Cell Biology, 145, 317-30.
Kuno, M. and Gardner, P. 1987. Ion channels activated by inositol 1,4,5-trisphosphate in plasma membrane of human T-lymphocytes. Nature, 326, 301-304.
Kyte, J. and Doolittle, R.F. 1982. A simple method for displaying the hydropathic character of a protein. Journal of Molecular Biology, 157, 105-132.
179 Laplante, M. and Sabatini, D.M. 2012. mTOR signaling in growth control and disease.
Cell, 149, 274-293.
Lashbrook, C.C., Tieman, D.M. and Klee, H.J. 1998. Differential regulation of the tomato ETR gene family throughout plant development. The Plant Journal, 15, 243-
252.
Lawton, K.A., Raghothama, K.G., Goldsbrough, P.B. and Woodson, W.R. 1990.
Regulation of senescence-related gene expression in carnation flower petals by ethylene. Plant Physiology, 93, 1370-1375.
Laxalt, A.M., ter Riet, B., Verdonk, J.C., Parigi, L., Tameling, W.I., Vossen, J., Haring,
M., Musgrave, A., and Munnik, T. 2001. Characterization of five tomato phospholipase
D cDNAs: rapid and specific expression of LePLDβ1 on elicitation with xylanase. The
Plant Journal, 26, 237–247.
Leclercq, J., Adams-Phillips, L.C., Zegzouti, H., Jones, B., Latché, A., Giovannoni,
J.J., Pech, J.C. and Bouzayen, M. 2002. LeCTR1, a tomato CTR1-like gene, demonstrates ethylene signaling ability in Arabidopsis and novel expression patterns in tomato. Plant Physiology, 130, 1132-1142.
Lee, J.O., Yang, H., Georgescu, M.M., Di Cristofano, A., Maehama, T., Shi, Y., Dixon,
J.E., Pandolfi, P. and Pavletich, N.P. 1999. Crystal structure of the PTEN tumor suppressor: implications for its phosphoinositide phosphatase activity and membrane association. Cell, 99, 323-334.
Lee, Y., Bak, G., Choi, Y., Chuang, W.I., Cho, H.T. and Lee, Y. 2008a. Roles of phosphatidylinositol 3-kinase in root hair growth. Plant Physiology, 147, 624-635.
180 Lee, Y., Kim, E., Choi, Y., Hwang, I., Staiger, C.J., Chung, Y. and Lee, Y. 2008b. The
Arabidopsis phosphatidylinositol 3-kinase is important for pollen development. Plant
Physiology, 147, 1886–1897.
Lee, Y., Munnik, T. and Lee, Y. 2010. Plant Phosphatidylinositol 3-Kinase. In T.
Munnik (Ed.), Lipid Signaling in Plants. Plant Cell Monographs, Springer-Verlag,
Heidelberg, Berlin, pp 95-106.
Lelièvre, J.M., Latché, A., Jones, B., Bouzayen, M. and Pech, J.C. 1997. Ethylene and fruit ripening. Physiologia Plantarum, 101, 727-739.
Lemmon, M.A. 2008. Membrane recognition by phospholipid-binding domains. Nature
Reviews Molecular Cell Biology, 9, 99-111.
Lemtiri-Chlieh F, MacRobbie EA, Webb AA, Manison NF, Brownlee C, Skepper JN,
Chen J, Prestwich GD, Brearley CA.2003. Inositol hexakisphosphate mobilizes an endomembrane store of calcium in guard cells. Proc Natl Acad Sci U S A, 100, 10091-
10095.
Leon-Reyes, A., Spoel, S.H., De Lange, E.S., Abe, H., Kobayashi, M., Tsuda, S.,
Millenaar, F.F., Welschen, R.A., Ritsema, T. and Pieterse, C.M. 2009. Ethylene modulates the role of Nonexpressor of Pathogenesis-Related Genes1 in cross talk between salicylate and jasmonate signaling. Plant Physiology, 149, 1797-1809.
Leshem, Y., Seri, L., and Levine, A. 2007. Induction of phosphatidylinositol 3-kinase- mediated endocytosis by salt stress leads to intracellular production of reactive oxygen species and salt tolerance. Plant Journal, 51, 185-197.
181 Li, J,, Ziemba, B.P., Falke, J.J. and Voth, G.A. 2014. Interactions of protein kinase C-
α C1A and C1B domains with membranes: a combined computational and experimental study. Journal of the American Chemical Society, 136, 11757-11766.
Lin, Z., Zhong, S. and Grierson, D. 2009. Research advances in ethylene research.
Journal of Experimental Botany, 60, 3311-3336.
Liu, L., Song, X., He, D., Komma, C., Kita, A., Virbasius, J.V., Huang, G., Bellamy,
H.D., Miki, K., Czech, M.P. and Zhou, G.W. 2006. Crystal structure of the C2 domain of class II phosphatidylinositide 3-kinase C2alpha.The Journal of Biological Chemistry,
281, 4254-4260.
Liu, M.L., Shen, B.W., Nakaya, S., Pratt, K.P., Fujikawa, K., Davie, E.W., Stoddard,
B.L. and Thompson, A.R. 2000. Hemophilic factor VIII C1- and C2-domain missense mutations and their modeling to the 1.5-angstrom human C2-domain crystal structure.
Blood, 96, 979-987.
Liu, P., Cheng, H., Roberts, T.M. and Zhao, J.J. 2009. Targeting the phosphoinositide
3-kinase (PI3K) pathway in cancer. Nature Reviews Drug Discovery, 8, 627-644.
Liu, Q., Xu, C. and Wen, C.K. 2010a. Genetic and transformation studies reveal negative regulation of ERS1 ethylene receptor signaling in Arabidopsis. BMC Plant
Biology, 10, 60-74.
Liu, Q., Zhang, C., Yang, Y. and Hu, X. 2010b. Genome-wide and molecular evolution analyses of the phospholipase D gene family in Poplar and Grape. BMC Plant
Biology, 10, 117-132.
182 Liu, Y., Shreder, K.R., Gai, W., Corral, S., Ferris, D.K. and Rosenblum, J.S. 2005.
Wortmannin, a widely used phosphoinositide 3-kinase inhibitor, also potently inhibits mammalian polo-like kinase. Chemistry and Biology, 12, 99-107.
Lofke, C., Ischebeck, T., Konig, S., Freitag, S. and Heilmann, I. 2008. Alternative metabolic fates of phosphatidylinositol produced by phosphatidylinositol synthase isoforms in Arabidopsis thaliana. Biochemical Journal, 413, 115-124.
Lomasney, J.W., Cheng, H., Wang, L., Kuan, Y.S., Liu, S.M., Fesik, S.W. and King, K.
1996. Phosphatidylinositol 4,5-bisphosphate binding to the Pleckstrin Homology domain of phospholipase C- 1 enhances enzyme activity. The Journal of Biological
Chemistry, 271, 25316-25326.
Lorenzo, O., Piqueras, R., Sánchez-Serrano, J.J. and Solano, R. 2003. ETHYLENE
RESPONSE FACTOR1 integrates signals from ethylene and jasmonate pathways in plant defense. The Plant Cell, 15, 165-178.
Ma, B., Cui, M-L., Sun, H-J., Takada, K., Mori, H., Kamada, H. And Ezura, H. 2006a.
Subcellular localization and membrane topology of the melon ethylene receptor
CmERS1. Plant Physiology, 141, 587-597.
Ma, N., Tan, H., Liu, X., Xue, J., Li, Y. and Gao, J. 2006b. Transcriptional regulation of ethylene receptor and CTR genes involved in ethylene-induced flower opening in cut rose (Rosa hybrida) cv. Samantha. Journal of Experimental Botany, 57, 2763-2773.
MacDougall, L.K., Domin, J. and Waterfield, M.D. 1995. A family of phosphoinositide
3-kinases in Drosophila identifies a new mediator of signal transduction. Current
Biology, 5, 1404-1415.
183 Martini, M., Santis, M.C.D., Braccini, L., Gulluni, F. and Hirsch, E. 2014. PI3K/AKT signaling pathway and cancer: an updated review. Annals of Medicine, 46, 372-383.
Matsuoka, K., Bassham, D.C., Raikhel, N.V. and Nakamura, K. 1995. Different sensitivity to wortmannin of two vacuolar sorting signals indicates the presence of distinct sorting machineries in tobacco cells. The Journal of Cell Biology, 130, 1307-
1318.
Mayerhofer, H., Mueller-Dieckmann, C. and Mueller-Dieckmann, J. 2011. Cloning, expression, purification and preliminary X-•ray analysis of the protein kinase domain of constitutive triple response 1 (CTR1) from Arabidopsis thaliana. Acta
Crystallographica Section F, 67, 117-120.
Mayers, A., Newman, J., Reid, M. and Dodge, L. 1997. New ethylene inhibitor could extend flower life. Perishables Handling Quarterly Issue, 92, 9-11.
McLaughlin, S. and Murray, D. 2005. Plasma membrane phosphoinositide organization by protein electrostatics. Nature, 438, 605-611.
Medlicott, A.P. and Thompson, A.K. 1985. Analysis of sugars and organic acids in ripening mango fruit (Mangifera indica L. var. Keitt) by high performance liquid chromatography. Journal of the Science of Food and Agriculture, 36, 561–566.
Meijer, H.J., and Munnik, T. 2003. Phospholipid-based signaling in plants. Annual
Review of Plant Biology, 54, 265-306.
Meijer, H.J., Berrie, C.P., Iurisci, C., Divecha, N., Musgrave, A., and Munnik, T. 2001.
Identification of a new polyphosphoinositide in plants, phosphatidylinositol 5-
184 monophosphate (PtdIns5P), and its accumulation upon osmotic stress. The
Biochemical Journal, 1, 491-498.
Meijer, H.J.G., Divecha, N., van den End, H., Musgrave, A. and Munnik, T. 1999.
Hyperosmotic stress induces rapid synthesis of phosphatidyl-D-inositol 3,5- bisphosphate in plant cells. Planta, 208, 294-298.
Meisel, L., Fonseca, B., González, S., Baeza-Yates, R., Cambiazo, V., Campos, R.,
Gonźalez, ε., Orellana, A., Retamales, J. Silva, H. β005. A rapid and efficient method for purifying high quality total RNA from peaches (Prunus persica) for functional genomics analyses. Biological research, 38,83-88.
Michell, R.H. 2008. Inositol derivatives: evolution and functions. Nature Reviews
Molecular Cell Biology, 9, 151-161.
Middelberg, A., 2002. Preparative protein refolding. Trends in Biotechnology, 20, 437-
443.
Misawa, H., Ohtsubo, M., Copeland, N.G., Gilbert, D.J., Jenkins, N.A., and
Yoshimura, A. 1998. Cloning and characterization of a novel class II phosphoinositide
3-kinase containing C2 domain. Biochem Biophys Res Commun, 244, 531-539.
Mohapatra, P.K., Naik, P.K. and Rajesh, P. 2000. Ethylene inhibitors improve dry matter partitioning and development of late flowering spikelets on rice panicles.
Australian Journal of Plant Physiology, 27, 311-323.
Monaghan, J. and Zipfel, C. 2012. Plant pattern recognition receptor complexes at the plasma membrane. Current Opinion in Plant Biology, 15, 349-357.
185 Mordy, A.A., Mikal, E.S. and Graeme, E.H. 1987. Effects of silver ions on ethylene biosynthesis by tomato fruit tissue. Plant Physiology, 83, 44-48.
Morgan, P.W. and Drew, M.C. 1997. Ethylene and plant responses to stress.
Physiologia Plantarum, 100, 620-630.
Mueller-Roeber, B. and Pical, C. 2002. Inositol phospholipid metabolism in
Arabidopsis. Characterized and putative isoforms of inositol phospholipid kinase and phosphoinositide-specific phospholipase C. Plant Physiology, 130, 22-46.
Mulgrew-Nesbitt, A., Diraviyam, K., Wang, J., Singh, S., Murray, P., Li, Z., Rogers, L.,
Mirkovic, N., and Murray, D. 2006. The role of electrostatics in protein-membrane interactions. Biochimica et Biophysica Acta (BBA), 1761, 812–826.
Munnik, T. Arisz, S.A. De Vrije, T. and Musgrave,A. 1995. G Protein activation stimulates Phospholipase D signaling in plants. The Plant Cell, 7, 2197-2210.
Munnik, T. 2001. Phosphatidic acid: an emerging plant lipid second messenger.
Trends in Plant Science, 6, 227-233.
εunnik T. and Testerink C. β009. Plant phospholipid signaling: ‘in a nutshell’. Journal of Lipid Research, 50, S260-S265.
Nadeau, J.A., Zhang, X.S., Nair, H. and O'Neill, S.D. 1993. Temporal and spatial regulation of 1-aminocyclopropane-1-carboxylate oxidase in the pollination-induced senescence of orchid flowers. Plant Physiology, 103, 31-39.
186 Nakanishi, S., Kakita, S., Takahashi, I., Kawahara, K., Tsukuda, E., Sano, T.,
Yamada, K., Yoshida, M., Kase, H. and Matsuda, Y. 1992. Wortmannin, a microbial product inhibitor of myosin light chain kinase. The Journal of Biological Chemistry,
267, 2157-2163.
Nakatsuka, A., Murachi, S., Okunishi, H., Shiomi, S., Nakano, R., Kubo, Y. and
Inaba, A. 1998. Differential expression and internal feedback regulation of l- aminocyclopropane-l-carboxylate synthase, 1-aminocyclopropane-l-carboxylate oxidase and ethylene receptor genes in tomato fruit during development and ripening.
Plant Physiology, 118, 1295-1305.
Nalefski, E.A., and Falke, J.J. 1996. The C2 domain calcium-binding motif: Structural and functional diversity. Protein Science, 5, 2375–2390.
Nicolson, G.L. 2014. The Fluid-Mosaic Model of Membrane Structure: Still relevant to understanding the structure, function and dynamics of biological membranes after more than 40 years. Biochimica et Biophysica Acta, 1838, 1451-1466.
Nobukuni, T., Joaquin, M., Roccio, M., Dann, S.G., Kim, S.Y., Gulati, P., Byfield, M.P.,
Backer, J.M., Natt, F., Bos, J.L., Zwartkruis, F.J. and Thomas, G. 2005. Amino acids mediate mTOR/raptor signaling through activation of class 3 phosphatidylinositol
3OH-kinase. Proceedings of the National Academy of Sciences of the USA, 102,
14238-14243.
Noodén, L.D. and Penney, J.P. 2001. Correlative controls of senescence and plant death in Arabidopsis thaliana (Brassicaceae). Journal of Experimental Botany, 52,
2151-2159.
187 Nováková, P., Hirsch, S., Feraru, E., Tejos, R.,van Wijk, R., Viaene, T., Heilmann, M.,
Lerche, J., Rycke, R.D., Feraru, M.I., Grones, P.,Van Montagu, M., Heilmann, I.,
Munnik, T. and Friml, J. 2014. SAC phosphoinositide phosphatases at the tonoplast mediate vacuolar function in Arabidopsis. Proceedings of the National Academy of
Sciences of the USA, 111, 2818-2823.
Obara, K., Sekito, T., Niimi, K. and Ohsumi, Y. 2008. The Atg18-Atg2 complex is recruited to autophagic membranes via phosphatidylinositol 3-phosphate and exerts an essential function. The Journal of Biological Chemistry, 283, 23972-23980.
Ochoa, W.F., Corbalan-Garcia, S., Eritja, R., Rodríguez-Alfaro, J.A., Gómez-
Fernández, J.C., Fita, I. and Verdaguer, N. Additional Binding Sites for Anionic
Phospholipids and Calcium Ions in the Crystal Structures of Complexes of the C2
Domain of Protein Kinase Cα. Journal of εolecular Biology, γβ0, 277-291.
Oetiker, J.H. and Yang, S.F. 1995. The Role of Ethylene in Fruit Ripening. Acta
Horticulturae, 398, 167-178.
Oh, E.S., Woods, A., Lim, S.T., Theibert, A.W. and Couchman, J.R. 1998. Syndecan-
4 proteoglycan cytoplasmic domain and phosphatidylinositol 4,5-bisphosphate coordinately regulate protein kinase C activity. The Journal of Biological Chemistry,
273, 10624-10629.
Ohmori, M. and Yamada, M. 1974. Composition of phosphogly cerides and glycosyl glycerides in castor bean mitochondria. Plant Cell Physiology, 15, 1129-1132.
Okada, T., Kawano, Y., Sakakibara, T., Hazeki, O. and Ui, M. 1994. Essential role of phosphatidylinositol 3-kinase in insulin-induced glucose transport and antilipolysis in
188 rat adipocytes. Studies with a selective inhibitor wortmannin. The Journal of Biological
Chemistry, 269, 3568-3573.
Okkenhaug, K., Bilancio, A., Farjot, G., Priddle, H., Sancho, S., Peskett, E., Pearce,
W., Meek, S.E., Waterfield, M.D., Smith, A.J.H. and Vanhaesebroeck, B. 2002.
Impaired B and T cell antigen receptor signaling in p110 PI γ-kinase mutant mice.
Science, 297, 1031-1034.
Pak-Dek, M.S., Tiwari, T., Sherif, S., Subramanian, J and Paliyath, P. 2014.
Characterization of tomato (Solanum lycopersicum) phosphatidylinositol 3-kinase C2 domain. Eastern Regional Meeting of the Canadian Society of Plant Biologists.
November 28-29, University of Guelph, Ontario, P25.
Paliyath, G. and Thompson, J.E. 1987. Calcium and calmodulin-regulated breakdown of phospholipid by microsomal membranes from bean cotyledons. Plant Physiology,
83, 63-68.
Paliyath. G,, Lynch, D.V. and Thompson, J.E. 1987. Regulation of membrane phospholipid catabolism in senescing carnation flowers. Physiologia Plantarum, 71,
503-511.
Paliyath, G. and Thompson, J.E. 1990. Evidence for early changes in membrane structure during post-harvest development of cut carnation (Dianthus caryophyllus L.) flowers. New Phytologist , 114, 555-562.
Paliyath, G. and Droillard, M.J. 1992. The mechanisms of membrane deterioration and disassembly during senescence. Plant Physiology and Biochemistry, 30, 789-
812.
189 Paliyath, G., Murr, D.P. and Thompson, J.E. 1995. Catabolism of phosphorylated phosphatidylinositols by carnation petal microsomal membranes enriched in plasmalemma and endoplasmic reticulum. Physiology and Molecular Biology of
Plant,1, 141–150.
Paliyath, G., Pinhero, R.G., Yada, R.Y. and Murr, D.P. 1999. Effect of processing conditions on phospholipase D activity of corn kernel subcellular fractions. Journal of
Agricultural and Food Chemistry, 47, 2579-2588.
Paliyath, G., Murr, D.P.,Yada, R.Y. and Pinhero, R.G. 2003. Inhibition of phospholipase D. US patent no 6514914.
Paliyath, G., Tiwari, K., Yuan, H. and Whitaker, B.D. 2008. Structural Deterioration in
Produce: Phospholipase D, Membrane Deterioration, and Senescence. In Paliyath,
G., Murr, D.P., Handa, A.K. and Lurie, S. (Eds). Postharvest Biology and Technology of Fruits, Vegetables, and Flowers. Wiley-Blackwell, Ames, pp 195-239.
Palmgren, M.G. 2001. Plant Plasma Membrane H+-ATPases: Powerhouses for nutrient uptake. Annual Review of Plant Physiology and Plant Molecular Biology,
52,817-845.
Pappan, K., Zheng, S. and Wang, X. 1997. Identification and characterization of a novel plant phospholipase D that requires polyphosphoinositides and submicromolar calcium for activity in Arabidopsis. The Journal of Biological Chemistry, 272, 7048-
7054.
190 Pardo, J.M. and Serrano, R. 1989. Structure of a plasma membrane H+-ATPase gene from the plant Arabidopsis thaliana. The Journal of Biological Chemistry, 264, 8557-
8562.
Park, K., Jung, J., Park, J., Hwang, J., Kim, Y., Hwang, I., and Lee,Y. 2003. A role for phosphatidylinositol 3-phosphate in abscisic acid-induced reactive oxygen species generation in guard cells. Plant Physiology, 132, 92–98.
Payrastre, B., Missy, K., Giuriato, S., Bodin, S., Plantavid, M. and Gratacap, M. 2001.
Phosphoinositides: key players in cell signalling, in time and space. Cellular
Signalling, 13, 377-387.
Pereira-Netto, A.B. 2001. Effect of inhibitors of ethylene biosynthesis and signal transduction pathway on the multiplication of in vitro-grown Hancornia speciosa. Plant
Cell Tissue Organ Culture, 66, 1-7.
Perera, I.Y., Heilmann, I., Chang, S.C., Boss, W.F. and Kaufman, P.B. 2001. A role for inositol 1,4,5-trisphosphate in gravitropic signaling and the retention of cold- perceived gravistimulation of oat shoot pulvini. Plant Physiology, 125, 1499-1507.
Pettersen, E.F., Goddard, T.D., Huang, C.C., Couch, G.S., Greenblatt, D.M., Meng,
E.C. and Ferrin, T.E. 2004. UCSF Chimera--a visualization system for exploratory research and analysis. Journal of Computational Chemistry, 25, 1605-1612.
Picchioni, G.A., Watada, A.E., Roy, S., Whitaker, B.D. and Wergin, W.P. 1994.
Membrane lipid metabolism, cell permeability, and ultrastructural changes in lightly processed carrots. Journal of Food Science, 59, 597-601.
191 Pinhero, R.G., Almquist, K.C., Novotna, Z., and Paliyath, G. 2003. Developmental regulation of phospholipase D in tomato fruits. Plant Physiology and Biochemistry, 41,
223–240.
Powis, G., Bonjouklian, R., Berggren, M.M., Gallegos, A., Abraham, R., Ashendel, C.,
Zalkow, L., Matter, W.F., Dodge, J., Grindey, G. and Vlahos, C.J. 1994. Wortmannin, a potent and selective inhibitor of phosphatidylinositol-3-kinase. Cancer Research, 54,
2419-2423.
Pozo, L., Yuan, R., Kostenyuk, I., Alferez, F., Zhong, G.Y. and Burns, J.K. 2004.
Differential effects of 1-methylcyclopropane on citrus leaf and mature fruit abscission.
Journal of the American Society for Horticultural Science, 129, 473–478.
Prasanna, V., Prabha, T.N. and Tharanathan, R.N. 2007. Fruit ripening phenomena- an overview. Critical Reviews in Food Science and Nutrition, 47, 1-19.
Pribat, A., Sormani, R., Rousseau-Gueutin, M., Julkowska, M.M., Testerink, C.,
Joubès, J., Castroviejo, M., Laguerre, M., Meyer, C., Germain, V. and Rothan, C.
2012. A novel class of PTEN protein in Arabidopsis displays unusual phosphoinositide phosphatase activity and efficiently binds phosphatidic acid. Biochemical Journal, 441,
161-171.
Qiao, H., Chang, K. N., Yazaki, J. and Ecker, J. R. 2012. Interplay between ethylene,
ETP1/ETP2 F-box proteins, and degradation of EIN2 triggers ethylene responses in
Arabidopsis. Genes and Development, 23, 512-521.
Qin, W., Pappan, K. and and Wang, X. 1997. Molecular heterogeneity of phospholipase D (PLD). Cloning of PLDgamma and regulation of plant PLDgamma, -
192 beta, and -alpha by polyphosphoinositides and calcium. The Journal of Biological
Chemistry, 272, 28267-28273.
Qin, C. and Wang, X. 2002. The Arabidopsis phospholipase D family.
Characterization of a calcium-independent and phosphatidylcholine-selective PLD zeta 1 with distinct regulatory domains. Plant Physiology, 128, 1057-1068.
Raiborg, C., Schink, K.O. and Stenmark, H. 2013. Class III phosphatidylinositol 3- kinase and its catalytic product PtdIns3P in regulation of endocytic membrane traffic.
The FEBS Journal, 280, 2730-2742.
Rajashekar C.B., Zhou, H.E., Zhang, Y., Li, W. and Wang, X. 2006. Suppression of phospholipase Dα1 induces freezing tolerance in Arabidopsis: response of cold- responsive genes and osmolyte accumulation. Journal of Plant Physiology, 163, 916-
926.
Rameh, L.E., Tolias, K.F., Duckworth, B.C., and Cantley, L.C. 1997. A new pathway for synthesis of phosphatidylinositol-4,5-bisphosphate. Nature, 390, 192-196.
Raynaud, F.I., Eccles, S., Clarke, P.A., Hayes, A., Nutley, B., Alix, S., Henley, A., Di-
Stefano, F., Ahmad, Z., Guillard, S., Bjerke, L.M., Kelland, L., Valenti, M., Patterson,
L., Gowan, S., de Haven Brandon, A., Hayakawa, M., Kaizawa, H., Koizumi, T.,
Ohishi, T., Patel, S., Saghir, N., Parker, P., Waterfield, M. and Workman, P. 2007.
Pharmacologic characterization of a potent inhibitor of class I phosphatidylinositide 3- kinases. Cancer Research, 67, 5840-5850.
193 Rebecchi, M., Peterson, A. and McLaughlin, S. 1992. Phosphoinositide-specific phospholipase C-delta 1 binds with high affinity to phospholipid vesicles containing phosphatidylinositol 4,5-bisphosphate. Biochemistry, 31, 12742-12747.
Rebecchi, M.J. and Pentyala, S.N. 2000. Structure, function, and control of phosphoinositide-specific phospholipase C. Physiological Reviews, 80, 1291-1335.
Reganold, J.P., Glover, J.D., Andrews, P.K. and Hinman, H.R. 2001. Sustainability of three apple production systems. Nature, 410, 926-930.
Reid, M.S. 1995. Ethylene in plant growth, development, and senescence. In Plant
Hormones, Physiology, Biochemistry and Molecular Biology, ed. P.J. Davies, pp. 486-
508. California, USA: Springer Link.
Reid, M.S. and Wu, M.J. 1992. Ethylene and flower senescence. Plant Growth
Regulation, 11, 37-43.
Reid, M.S., Paul, J.L., Farhoomand, M.B., Kofranek, A.M. and Staby, G.L. 1980.
Pulse treatment with the silver thiosulfate complex extend the vase life of cut carnations. Journal of the American Society for Horticultural Science, 105, 25-27.
Reinhold, S.L., Prescott, S.M., Zimmerman, G.A. and McIntyre, T.M. 1990. Activation of human neutrophil phospholipase D by three separable mechanisms. The FASEB
Journal, 4, 208-214.
Remans, K., Bürger, M., Vetter, I.R. and Wittinghofer, A. 2014. C2 domains as protein-protein interaction modules in the ciliary transition zone. Cell Reports, 8, 1-9.
194 Rhee. S.G. 2001. Regulation of Phosphoinositide-Specific Phospholipase C. Annual
Review of Biochemistry, 70, 281-312.
Robinson, M.J., Harkins, P.C., Zhang, J., Baer, R., Haycock, J.W., Cobb, M.H. and
Goldsmith, E.J. 1996. Mutation of position 52 in ERK2 creates a nonproductive binding mode for adenosine 5'-triphosphate. Biochemistry, 35, 5641-5646.
Rodríguez, F.I., Esch, J.J., Hall, A.E., Binder, B.M., Schaller, G.E. and Bleecker, A.B.
1999. A copper cofactor for the ethylene receptor ETR1 from Arabidopsis. Science,
283, 996-998.
Rodriguez, L., Gonzalez-Guzman, M., Diaz, M., Rodrigues, A., Izquierdo-Garcia, A.C.,
Peirats-Llobet, M., Fernandez, M.A., Antoni, R., Fernandez, D., Marquez, J.A., Mulet,
J.M., Albert, A. and Rodriguez, P.L. 2014. C2-domain abscisic acid-related proteins mediate the interaction of PYR/PYL/RCAR abscisic acid receptors with the plasma membrane and regulate abscisic acid sensitivity in Arabidopsis. The Plant Cell, 26,
4802-4820.
Ron, P., Eitan, S., Margrethe, S., Edward, C.S. and Amihud, B. 1995. 1-
Methylcyclopropane inhibits ethylene action in cut phlox flowers. Postharvest Biology and Technology, 6, 313-319.
Rupwate, S.D. and Rajasekharan, R. 2012. Plant phosphoinositide-specific phospholipase C. Plant Signal Behav., 7, 1281–1283.
Sahdev, S., Khattar, S.K., and Saini. K.S. 2008. Production of active eukaryotic proteins through bacterial expression systems: a review of the existing biotechnology strategies. Molecular and Cellular Biochemistry, 307, 249-264.
195 Saltveit, M.E., Bradford, K.J. and Dilley, D.R. 1978. Silver ion inhibits ethylene synthesis and action in ripening fruits. Journal of the American Society for Horticultural
Science, 103, 472-475.
Saltveit, M.E. and Larson, R.A. 1981. Reducing leaf epinasty in mechainically stressed poinsettia plants. Journal of the American Society for Horticultural Science,
106, 156-159.
Saltveit, M.E. 2005. Aminoethoxyvinylglycine (AVG) reduces ethylene and protein biosynthesis in excised discs of mature-green tomato pericarp tissues. Postharvest
Biology and Technology, 35, 183-190.
Sambrook, J., Fritschi, E.F. and Maniatis, T. 1989. Molecular cloning: a laboratorymanual, Cold Spring Harbor Laboratory Press, New York.
Sasaki, T., Sasaki, J., Sakai, T., Takasuga, S. and Suzuki, A. 2007. The physiology of phosphoinositides. Biological and Pharmaceutical Bulletin, 30, 1599-1604.
Savin, K.W., Baudinette, S.C., Graham, M.W., Michael, M.Z., Greg, D. Nugent, Lu, C.,
Chandler, S.F. and Cornish, E.C. 1995. Antisense ACC oxidase RNA delays carnation petal senescence. Hortscience, 30, 970-972.
Schaller, G.E. and Bleecker, A.B. 1995. Ethylene-binding sites generated in yeast expressing the Arabidopsis ETR1 gene. Science, 270, 1809-1811.
Schu, P.V., Takegawa, K., Fry, M.J., Stack, J.H., Waterfield, M.D. and Emr, S.D.
1993. Phosphatidylinositol 3-kinase encoded by yeast VPS34 gene essential for protein sorting. Science, 260, 88-91.
196 Serek, M., Sisler, E.C. and Reid, M.S. 1995. 1-Methylcyclopropene, a novel gaseous inhibitor of ethylene action, improves the life of fruits, cut flowers and potted plants.
Acta Horticulturae, 394, 337–345.
Sharma, M., Jacob, J.K., Subramanian, J. and Paliyath, G. 2010. Hexanal and 1-MCP treatments for enhancing the shelf life and quality of sweet cherry (Prunus avium L.).
Scientia Horticulturae, 125, 239-247.
Sherif, S., Paliyath, G. and Jayasankar, S. 2012. Molecular characterization of peach
PR genes and their induction kinetics in response to bacterial infection and signalling molecules. Plant Cell Report, 31, 697–711.
Shiratsuchi, T., Oda, K., Nishimori, H., Suzuki, M., Takahashi, E., Tokino, T. and
Nakamura, Y. 1998. Cloning and characterization of BAP3 (BAI-associated protein 3), a C2 domain-containing protein that interacts with BAI1. Biochemical and Biophysical
Research Communications, 251, 158-165.
Siddhanta, U., Mcllroy, J., Shah, A., Zhang, Y. and Backer, J.M. 1998. Distinct roles for the p110α and hVPSγ4 phosphatidylinositol γ′-kinases in vesicular trafficking, regulation of the actin cytoskeleton, and mitogenesis. The Journal of Cell Biology,
143, 1647-1659.
Singer, S.J. and Nicolson, G.L. 1972. The fluid mosaic model of the structure of cell membranes. Science, 175, 720-731.
Sisler, E.C. and Serek, M. 1997. Inhibitors of ethylene responses in plants at the receptor level: Recent developments. Physiologia Plantarum, 100, 577–582.
197 Sisler, E.C. and Serek, M. 2003. Compounds interacting with the ethylene receptor in plants. Plant Biology, 5, 473-480.
Song, J., Hildebrand, P.D., Fan, L., Forney, C.F., Renderos, W.E., Campbell-Palmer,
L. and Doucette, C. 2007. Effect of hexanal vapor on the growth of postharvest pathogens and fruit decay. Journal of Food Science, 72, 108-112.
Song, J., Fan, L., Forney, C., Campbell-Palmer, L. and Fillmore, S. 2010. Effect of hexanal vapor to control postharvest decay and extend shelf-life of highbush blueberry fruit during controlled atmosphere storage. Canadian Journal of Plant
Science, 90, 359-366.
Sørensen, H.P. and Mortensen, K.K. 2005. Advanced genetic strategies for recombinant protein expression in Escherichia coli. Journal of Biotechnology, 115,
113–128.
Sørensen, H.P., Sperling-Petersen, H.U., and Mortensen, K.K., 2003. A favorable solubility partner for the recombinant expression of streptavidin. Protein Expr. Purif.
32, 252–259.
Spotts, R.A., Sholberg, P.L., Randall, P., Maryna Serdani, M. and Chen, P.M. 2007.
Effects of 1-εCP and hexanal on decay of d’Anjou pear fruit in long-term cold storage.
Postharvest Biology and Technology, 44, 101-106.
Stahelin, R.V., Burian, A., Bruzik, K.S., Murray, D. and Cho, W. 2003. Membrane binding mechanisms of the PX domains of NADPH oxidase p40phox and p47phox.
The Journal of Biological Chemistry, 278 14469–14479.
198 Statistics Canada. 2003. Food Statistics 2002. Vol. 2(1&2). Catalogue no. 21-020-XIE.
Steinmetz, K.A. and Potter, J.D. 1996. Vegetables, fruit, and cancer prevention: a review. Journal of the American Dietetic Association, 96, 1027-1039.
Stenzel, I., Ischebeck, T., König, S., Hołubowska, A., Sporysz, ε., Hause, B. and
Heilmann I. 2008. The type B phosphatidylinositol-4-phosphate 5-kinase 3 is essential for root hair formation in Arabidopsis thaliana. The Plant Cell, 20, 124-141.
Stepanova, A.N., Hoyt, J.M., Hamilton, A.A. and Alonso, J.M. 2005. A Link between ethylene and auxin uncovered by the characterization of two root-specific ethylene- insensitive mutants in Arabidopsis. The Plant Cell, 8, 2230-2242.
Stepanova, A.N., Yun, J., Likhacheva, A.V. and Alonso, J.M. 2007. Multilevel interactions between ethylene and auxin in arabidopsis roots. The Plant Cell, 19,
2169-2185.
Stephens, L.R., Hughes, K.T. and Irvine, R.F. 1991. Pathway of phosphatidylinositol(3,4,5)-trisphosphate synthesis in activated neutrophils. Nature,
351, 33-39.
Stevenson, J.M., Perera,. I.Y. and Boss, W.F. 1998. A phosphatidylinositol 4-kinase pleckstrin homology domain that binds phosphatidylinositol 4-monophosphate. The
Journal of Biological Chemistry, 273, 22761-22767.
Stevenson, J.M., Perera, I.Y., Heilmann, I., Persson, S. and Boss, W.F. 2000. Inositol signaling and plant growth. Trends in Plant Science, 5, 252-258.
199 Strohm, A.K., Baldwin, K.L. and Masson, P.H. 2012. Multiple roles for membrane- associated protein trafficking and signaling in gravitropism. Frontiers in Plant Science,
3, 1-12.
Sutton, R.B., and Sprang, S.R. 1998. Structure of the protein kinase C phospholipid- binding C2 domain complexed with Ca2+. Structure, 6, 1395–1405.
Sutton, R.B., Davletov, B.A., Berghuis, A.M., Südhof, T.C. and Sprang, S.R. 1995.
Structure of the first C2 domain of synaptotagmin I: a novel Ca2+/phospholipid- binding fold. Cell, 80, 929-938.
Tassoni, A., Watkins, C.B. and Davies, P.J. 2006. Inhibition of the ethylene response by 1-MCP in tomato suggests that polyamines are not involved in delaying ripening, but may moderate the rate of ripening or over-ripening. Journal of Experimental
Botany, 57, 3313-3325.
Tejos, R., Sauer, M., Vanneste, S., Palacios-Gomez, M., Li, H., Heilmann, M., van
Wijk, R., Vermeer, J.E., Heilmann, I., Munnik, T. and Frim, J. 2014. Bipolar plasma membrane distribution of phosphoinositides and their requirement for auxin-mediated cell polarity and patterning in Arabidopsis. The Plant Cell, 26, 2114-2128.
Testerink, C., and Munnik, T. 2005. Phosphatidic acid: a multifunctional stress signaling lipid in plants. Trends in Plant Science, 10, 368–375.
Testerink, C., Larsen, P.B., van der Does, D., van Himbergen, J.A. and Munnik, T.
2007. Phosphatidic acid binds to and inhibits the activity of Arabidopsis CTR1. Journal of Experimental Botany, 58, 3905-3914.
200 Testerink, C. and Munnik, T. 2011. Molecular, cellular, and physiological responses to phosphatidic acid formation in plants. Journal of Experimental Botany, 62, 2349-2361.
Thole, J.M. and Nielsen, E. 2008. Phosphoinositides in plants: novel functions in membrane trafficking. Current Opinion in Plant Biology, 11, 620-631.
Tieman, D.M., Taylor, M.G., Ciardi, J.A. and Klee, H.J. 2000. The tomato ethylene receptors NR and LeETR4 are negative regulators of ethylene response and exhibit functional compensation within a multigene family. Proceedings of the National
Academy of Sciences USA, 97, 5663-5668.
Tiwari, K. and Paliyath, G. 2011a. Microarray analysis of ripening-regulated gene expression and its modulation by 1-MCP and hexanal. Plant Physiology and
Biochemistry, 49, 329-340.
Tiwari, K., and Paliyath, G. 2011b. Cloning, expression and functional characterization of the C2 domain from tomato phospholipase Dα. Plant Physiology and Biochemistry,
49, 18-32.
Toker, A. and Cantley, L.C. 1997. Signalling through the lipid products of phosphoinositide-3-OH kinase. Nature, 387, 673-676.
Tuteja, N. and Sopory, S.K. 2008. Chemical signaling under abiotic stress environment in plants. Plant Signaling and Behavior, 3, 525-536
Utto, W., Mawson. A.J. and Bronlund J.E. 2008. Hexanal reduces infection of tomatoes by Botrytis cinerea whilst maintaining quality. Postharvest Biology and
Technology, 47, 434-437.
201 van Leeuwen, W., Vermeer, J.E.M., Gadella, T.W.J. and Munnik, T. 2007.
Visualization of phosphatidylinositol 4,5-bisphosphate in the plasma membrane of suspension-cultured tobacco BY–2 cells and whole Arabidopsis seedlings. The Plant
Journal, 52, 1014-1026.
Vanhaesebroeck, B., and Waterfield, M.D. 1999. Signaling by distinct classes of phosphoinositide 3-kinases. Experimental Cell Research, 253, 239-254.
Vanhaesebroeck, B., Leevers, S.J., Ahmadi, K., Timms, J., Katso, R., Driscoll, P.C.,
Woscholski, R., Parker, P.J. and Waterfield, M.D. 2001. Synthesis and function of 3- phosphorylated inositol lipids. Annual Review of Biochemistry, 70, 535-602.
Veen, H. and Van de Geijn, S.C. 1978. Mobility and ionic form of silver as related to longevity of cut carnations. Planta, 140, 93-96.
Veen, H. 1979. Effects of silver on ethylene synthesis and action in cut carnations.
Planta, 145, 467-470.
Venkatesh, J. and Park, S.W. 2012. Plastid genetic engineering in Solanaceae.
Protoplasma, 249, 981-999.
Verdaguer, N., Corbalan-Garcia, S., Ochoa, W.F., Fita, I., and Gómez-Fernández,
J.C. 1999. Ca2+ bridges the C2 membrane-binding domain of protein kinase Cα directly to phosphatidylserine. The EMBO Journal, 18, 6329–6338.
Vergnolle, C., Vaultier, M.N., Taconnat, L., Renou, J.P., Kader, J.C., Zachowski, A., and Ruelland, E. 2005. The cold-induced early activation of phospholipase C and D
202 pathways determines the response of two distinct clusters of genes in Arabidopsis cell suspensions. Plant Physiology, 139, 1217-1233.
Vermeer, J.E.M., van Leeuwen, W., Tobena-Santamaria, R., Laxalt, A.M., Jones,
D.R., Divecha, N., Gadella, T.W.J. and Munnik, T. 2006. Visualization of PtdIns3P dynamics in living plant cells. The Plant Journal, 47, 687-700.
Vermeer, J.E.M., Thole, J.M., Goedhart, J., Nielsen, E., Munnik, T. and Gadella,
T.W.J. 2009. Imaging phosphatidylinositol 4-phosphate dynamics in living plant cells.
The Plant Journal, 57, 356-372.
Vieira, O.V., Botelho, R.J., Rameh, L., Brachmann, S.M., Matsuo, T., Davidson, H.W.,
Schreiber, A., Backer, J.M., Cantley, L.C. and Grinstein, S. 2001. Distinct roles of class I and class III phosphatidylinositol 3-kinases in phagosome formation and maturation. The Journal of Cell Biology, 155, 19-25.
Voet-van-Vormizeele, J. and Groth, G. 2008. Ethylene controls autophosphorylation of the histidine kinase domain in ethylene receptor ETR1. Molecular Plant, 1, 380-387.
Vriezen, W.H., Achard, P., Harberd, N.P., Van Der Straeten, D. 2004. Ethylene- mediated enhancement of apical hook formation in etiolated Arabidopsis thaliana seedlings is gibberellin dependent. The Plant Journal, 37, 505-516.
Walker, E.H., Pacold, M.E., Perisic, O., Stephens, L., Hawkins, P.T., Wymann, M.P. and Williams, R.L. 2000. Structural determinants of phosphoinositide 3-kinase inhibition by wortmannin, LY294002, quercetin, myricetin, and staurosporine.
Molecular Cell, 6, 909-919.
203 Wang, X. 1999. The Role of Phospholipase D in Signaling Cascades. Plant
Physiology, 120, 645-651.
Walker, E.H., Perisic, O., Ried, C., Stephens, L. and Williams, RL. 1999. Structural insights into phosphoinositide 3-kinase catalysis and signalling. Nature, 402, 313-320.
Wang, Z. and. Dilley, D.R. 2001. Aminoethoxyvinylglycine, Combined with Ethephon,
Can Enhance Red Color Development without Over-ripening Apples. Hortscience, 36,
328-331.
Wang, X. 2002. Phospholipase D in hormonal and stress signalling. Current Opinion in Plant Biology, 5, 408-414.
Wang, F., Herzmark, P., Weiner, O.D., Srinivasan, S., Servant, G. and Bourne, H.R.
2002a. Lipid products of PI(3)Ks maintain persistent cell polarity and directed motility in neutrophils. Nature Cell Biology, 4, 513-518.
Wang, K.L.C., Li, H. and Ecker, J.R. 2002b. Ethylene Biosynthesis and Signaling
Networks. The Plant Cell, 14, S131–S151.
Wang, X. 2005. Regulatory functions of phospholipase D and phosphatidic acid in plant growth, development, and stress responses. Plant Physiology, 139, 566-573.
Watada, A.E., Herner, R.C., Kader, A.A., Romani, R.J. and Staby, G.L. 1984.
Terminology for the description of developmental stages of horticultural crops.
HortScience, 19, 20-21.
204 Watkins, C.B. and Miller, W.B. 2005. 1-Methylcyclopropene (1-MCP) based technologies for storage and shelf-life extension. Acta Horticulturae, 687, 201-208.
Watkins, C.B. 2006. The use of 1-methylcyclopropene (1-MCP) on fruits and vegetables. Biotechnology Advances, 24, 389-409.
Wawrzynezak, A. and Goszezynska, D.M. 2003. Effect of ethylene inhibitors on longevity of cut carnations (Dianthus caryophyllus L.) and ethylene production by flowers. Journal of Fruit and Ornamental Plant Research, 11, 89-98.
Welters, P., Takegawa, K., Emr, S.D. and Chrispeels, M.J. 1994. AtVPS34, a phosphatidylinositol 3-kinase of Arabidopsis thaliana, is an essential protein with homology to a calcium-dependent lipid binding domain. Proceedings of the National
Academy of Sciences USA, 91, 11398-11402.
Whitaker, B.D., Smith, D.L. and Green, K.C. 2001. Cloning, characterization and functional expression of a phospholipase Dα cDNA from tomato fruit. Physiologia
Plantarum, 112, 87-94.
White, M.D., Tustin, D.S., Foote, K.F., Volz, R.K., Stokes, J., Campbell, J., Marshall,
R. and Howard, C. 1999. The Influence of Preharvest Treatments with ReTain™ (An
Ethylene Biosynthesis Inhibitor) on the Fruit Maturation and Quality of `Royal Gala'
Apple in New Zealand. HortScience, 34, 3543.
Wilkinson, J.Q., Lanahan, M.B., Yen, H.C., Giovannoni, J.J. and Klee, H.J. 1995. An ethylene-inducible component of signal transduction encoded by never-ripe. Science,
270, 1807-1809.
205 Wills, R.B.H and Ku, V.V.V. 2002. Use of 1-MCP to extend the time to ripen of green tomatoes and postharvest life of ripe tomatoes. Postharvest Biology and Technology,
26, 85-90.
Woodson, W.R. and Lawton, K.A. 1998. Ethylene-induced gene expression in carnation petals. Relationship to autocatalytic ethylene production and senescence.
Plant Physiology, 87, 498-503.
Woodson, W.R., Park, K.Y., Drory, A., Larsen, P.B. and Wang, H. 1992. Expression of ethylene biosynthetic pathway transcripts in senescing carnation flowers. Plant
Physiology, 99, 526-532.
Wymann, M.P., Bulgarelli-Leva, G., Zvelebil, M.J., Pirola, L., Vanhaesebroeck, B.,
Waterfield, M.D. and Panayotou, G. 1996. Wortmannin inactivates phosphoinositide
3-kinase by covalent modification of Lys-802, a residue involved in the phosphate transfer reaction. Molecular and Cellular Biology, 16, 1722-1733.
Xue, H.W. Pical, C. Brearley, C. Elge, S. and Muller-Rober,B. 1999. A plant 126-kDa phosphatidylinositol 4-kinase with a novel repeat structure. Cloning and functional expression in baculovirus-infected insect cells. The Journal of Biological Chemistry,
274, 5738-5745.
Xue, H.W., Hosaka, K., Plesch, G. and Mueller-Roeber, B. 2000. Cloning of
Arabidopsis thaliana phosphatidylinositol synthase and functional expression in the yeast pis mutant. Plant Molecular Biology, 42, 757-764.
Yang, S.F. and Hoffman, N.E. 1984. Ethylene biosynthesis and its regulation in higher plants. Annual Review of Plant Physiology, 35, 155-189.
206 Yang, C.S., Lee, M.J., Chen, L. and Yang, G.Y. 1997. Polyphenols as inhibitors of carcinogenesis. Environmental Health Perspectives, 105, 971-976.
Yano, H., Nakanishi, S., Kimura, K., Hanai, N., Saitoh, Y., Fukui, Y., Nonomura, Y. and Matsuda, Y. 1993. Inhibition of histamine secretion by wortmannin through the blockade of phosphatidylinositol 3-kinase in RBL-2H3 cells. The Journal of Biological
Chemistry, 268, 25846-25856.
Yao, K., Paliyath, G., Humphrey, R.W., Hallett, F.R. and Thompson, J.E. 1991.
Identification and characterization of nonsedimentable lipid-protein microvesicles.
Proceedings of the National Academy of Sciences USA, 88, 2269-2273.
Yuan, H., Chen, L., Paliyath, G., Sullivan, A. and Murr, D.P. 2005. Characterization of microsomal and mitochondrial phospholipase D activities and cloning of phospholipase D alpha cDNA from strawbery fruits. Plant Physiology and
Biochemistry, 43, 535-547.
Yuan, H., Hu, X.L., Li, X., Li, Y.H. and Paliyath, G. 2009. Effect of hexanal treatment on postharvest quality of 'darselect' strawberry (Fragaria ×Ananassa duch.) fruit. Acta
Horticulturae, 839, 315-321.
Yuan, R. and Carbaugh, D.H. 2007. Effects of NAA, AVG, and 1-MCP on ethylene biosynthesis, preharvest fruit drop, fruit maturity, and quality of ‘Golden Supreme’ and
‘Golden Delicious’ apples. HortScience, 4β, 101-105.
Zhang, X., Loijens, J.C., Boronenkov, I.V., Parker, G.J, Norris, F.A, Chen, J., Thum,
O., Prestwich, G.D., Majerus, P.W. and Anderson, R.A. 1997. Phosphatidylinositol-4- phosphate 5-Kinase Isozymes Catalyze the Synthesis of 3-Phosphate-containing
207 Phosphatidylinositol Signaling Molecules. The Journal of Biological Chemistry, 272,
17756-17761.
Zhang, X., Zhu, Z., An, F., Hao, D., Li, P., Song, J., Yi, C., and Guo, H. 2014.
Jasmonate-Activated MYC2 represses ethylene insensitive3 activity to antagonize ethylene-promoted apical hook formation in Arabidopsis. The Plant Cell, 26, 1105-
1117.
Zheng, L., Krishnamoorthi, R., Zolkiewski, M. and Wang, X. 2000. Distinct Ca2+
Binding Properties of Novel Cβ Domains of Plant Phospholipase Dα and . The
Journal of Biological Chemistry, 275, 19700-19706.
Zhong, R., Burk, D.H., Nairn, C.J., Wood-Jones, A., Morrison, W.H.3rd. and Ye, Z.H.
2005. Mutation of SAC1, an Arabidopsis SAC domain phosphoinositide phosphatase, causes alterations in cell morphogenesis, cell wall synthesis, and actin organization.
The Plant Cell, 17, 1449-1466.
Zhong, R., Burk, D.H., Morrison, W.H.3rd. and Ye, Z.H. 2004. FRAGILE FIBER3, an
Arabidopsis gene encoding a type II inositol polyphosphate 5-phosphatase, is required for secondary wall synthesis and actin organization in fiber cells. The Plant
Cell, 16, 3242-3259.
Zhong, S., Linm Z. and Grierson, D. 2008. Tomato ethylene receptor-CTR interactions: visualization of NEVER-RIPE interactions with multiple CTRs at the endoplasmic reticulum. Journal of Experimental Botany, 59, 965-972.
208 Zimmermann, P. and Zentgraf, U. 2005. The correlation between oxidative stress and leaf senescence during plant development. Cellular and Molecular Biology Letters, 10,
515-534.
Zoncu, R., Bar-Peled, L., Efeyan, A., Wang, S., Sancak, Y. and Sabatini, D.M. 2011. mTORC1 senses lysosomal amino acids through an inside-out mechanism that requires the vacuolar H(+)-ATPase. Science, 334, 678-683.
209
APPENDIX
Analysis of Variance
Analysis of variance corresponding to Figure 2.1. Gene expression analyses of several genes involved in PI metabolism in cherry tomato fruit (cultivar Sweeties) at different maturity stages. The GLM Procedure DOF F Value P Value Maturity 3 85.55 0.000 Gene 3 181.34 0.000 Maturity*Gene 6 44.30 0.000
Analysis of variance corresponding to Figure 2.3. Colour index (TCI) of control, wortmannin (0.5 με), hexanal (1%) and 1-εCP (10 μδ/δ) treated tomatoes during storage at room temperature. The GLM Procedure DOF F Value P Value Treatment 3 76.13 0.000 Time 3 212.69 0.000 Treatment*Time 9 25.95 0.000
Analysis of variance corresponding to Figure 2.4. Firmness (g/mm) of control, wortmannin (0.5 με), hexanal (1%) and 1-εCP (10 μδ/δ) treated tomatoes during storage at room temperature. The GLM Procedure DOF F Value P Value Treatment 3 26.53 0.000 Time 3 65.57 0.000 Treatment*Time 9 6.68 0.000
Analysis of variance corresponding to Figure 2.5. Ethylene production of control, wortmannin (0.5 με), hexanal (1%) and 1-εCP (10 μδ/δ) treated tomatoes during storage at room temperature The GLM Procedure DOF F Value P Value Treatment 3 4.50 0.010 Time 3 64.46 0.000 Treatment*Time 9 9.71 0.000
Analysis of variance corresponding to Figure 2.6. Carbon dioxide production by control, wortmannin (0.5 με), hexanal (1%) and 1-MCP (10 μδ/δ) treated tomatoes during storage. The GLM Procedure DOF F Value P Value Treatment 3 33.25 0.000 Time 3 69.27 0.000 Treatment*Time 9 9.27 0.000
210
Analysis of variance corresponding to Figure 2.7. Lycopene content of control, wortmannin (0.5 με), hexanal (1%) and 1-εCP (10 μδ/δ) treated tomatoes during storage at room temperature. The GLM Procedure DOF F Value P Value Treatment 3 209.21 0.000 Time 3 339.42 0.000 Treatment*Time 9 97.45 0.000
Analysis of variance corresponding to Figure 2.8. Weight loss in control, wortmannin (0.5 με), hexanal (1%) and 1-εCP (10 μδ/δ) treated tomatoes during storage at room temperature. The The GLM Procedure DOF F Value P Value Treatment 3 27.86 0.000 Time 3 462.95 0.000 Treatment*Time 9 10.42 0.000
Analysis of variance corresponding to Figure 2.9. Effect of wortmannin treatment (0.5 με) on gene expression analyses for ethylene-related biosynthesis enzymes. The GLM Procedure Sl-SAMT Effect DOF F Value P Value Treatment 1 245.61 0.000 Time 3 151.20 0.000 Treatment*Time 3 151.34 0.000 Sl-ACS1 Treatment 1 398.95 0.000 Time 3 109.42 0.000 Treatment*Time 3 106.71 0.000 Sl-ACS2 Treatment 1 28.56 0.000 Time 3 274.53 0.000 Treatment*Time 3 179.68 0.000 Sl-ACO1 Treatment 1 8.41 0.010 Time 3 130.39 0.000 Treatment*Time 3 127.84 0.000
Analysis of variance corresponding to Figure 2.10 Effect of hexanal (1%) and 1-MCP (10 μδ/δ) treatments on gene expression of ethylene related biosynthesis enzymes as compared with control The GLM Procedure Sl-SAMT Effect DOF F Value P Value Treatment 2 8.62 0.002 Time 3 71.13 0.000 Treatment*Time 6 25.75 0.000 Sl-ASC1 Treatment 2 130.46 0.000 Time 3 132.76 0.000 Treatment*Time 6 113.79 0.000
211 Sl-ASC2 Treatment 2 204.38 0.000 Time 3 64.90 0.000 Treatment*Time 6 27.03 0.000 Sl-ACO1 Treatment 2 136.28 0.000 Time 3 44.08 0.000 Treatment*Time 6 16.95 0.000
Analysis of variance corresponding to Figure 2.11. Effect of wortmannin treatment (0.5 με) on gene expression for ethylene receptor, CTR1, ETR1, ETR4 and εADF-TF. The GLM Procedure Sl-CTR1 Effect DOF F Value P Value Treatment 1 98.29 0.000 Time 3 17.08 0.000 Treatment*Time 3 17.08 0.000 Sl-ETR1 Treatment 1 7.21 0.016 Time 3 0.35 0.791 Treatment*Time 3 0.32 0.811 Sl-ETR4 Treatment 1 0.71 0.410 Time 3 91.66 0.000 Treatment*Time 3 91.77 0.000 Sl-MAFD-TF Treatment 1 1.40 0.254 Time 3 403.99 0.000 Treatment*Time 3 405.09 0.000
Analysis of variance corresponding to Figure 2.12 Effect of hexanal (1%) and 1-MCP (10 μδ/δ) treatments on gene expression of ethylene receptor, CTR1, ETR1, ETR4 and MADF-TF. The GLM Procedure Sl-CTR1 Effect DOF F Value P Value Treatment 2 49.73 0.000 Time 3 17.55 0.000 Treatment*Time 6 16.38 0.000 Sl-ETR1 Treatment 2 7.20 0.004 Time 3 4.93 0.008 Treatment*Time 6 9.86 0.000 Sl-ETR4 Treatment 2 746.52 0.000 Time 3 276.86 0.000 Treatment*Time 6 137.18 0.000 Sl-MADF-TF Treatment 2 357.04 0.000 Time 3 179.92 0.000 Treatment*Time 6 98.43 0.000
212 Analysis of variance corresponding to Figure β.1γ Effect of wortmannin (0.5 με) treatment on gene expression for enzymes involved in pigment development during storage. The GLM Procedure Sl-GGPS Effect DOF F Value P Value Treatment 1 11.91 0.003 Time 3 43.95 0.000 Treatment*Time 3 43.95 0.000 Sl-DXS Treatment 1 181.08 0.000 Time 3 375.83 0.000 Treatment*Time 3 373.96 0.000 Sl-CTRISO Treatment 1 432.20 0.000 Time 3 481.53 0.000 Treatment*Time 3 474.03 0.000 Sl-PSY1 Treatment 1 7.00 0.018 Time 3 159.15 0.000 Treatment*Time 3 160.11 0.000
Analysis of variance corresponding to Figure 2.14. Effect of hexanal (0.1mM) and 1- MCP (10 ppm) treatments on gene expression of genes involved in pigment development in tomato fruits during storage The GLM Procedure Sl-GGPS Effect DOF F Value P Value Treatment 2 849.90 0.000 Time 3 273.55 0.000 Treatment*Time 6 273.93 0.000 Sl-DXS Treatment 2 537.28 0.000 Time 3 79.59 0.000 Treatment*Time 6 25.54 0.000 Sl-CTRISO Treatment 2 215.04 0.000 Time 3 81.71 0.000 Treatment*Time 6 102.28 0.000 Sl-PSY1 Treatment 2 251.33 0.000 Time 3 14.92 0.000 Treatment*Time 6 5.66 0.001
Analysis of variance corresponding to Figure 2.15 Effect of wortmannin treatment (0.5 με) on gene expression analysis of phosphatidylinositol-related biosynthetic enzymes and plasma membrane lipid degrading enzymes in tomato during storage. The GLM Procedure Sl-PI3K Effect DOF F Value P Value Treatment 1 0.31 0.584 Time 3 52.12 0.000 Treatment*Time 3 51.19 0.000
213 Sl-PI4K Treatment 1 330.38 0.000 Time 3 14.49 0.000 Treatment*Time 3 13.90 0.000 Sl-PIP Treatment 1 143.39 0.000 Time 3 35.59 0.000 Treatment*Time 3 34.27 0.000 Sl-PI3P5K Treatment 1 1.66 0.216 Time 3 13.33 0.000 Treatment*Time 3 13.04 0.000 Sl-PLC Treatment 1 205.35 0.000 Time 3 10.17 0.001 Treatment*Time 3 9.74 0.001 Sl-PLD Treatment 1 278.60 0.000 Time 3 29.79 0.000 Treatment*Time 3 30.46 0.000
Analysis of variance corresponding to Figure 2.16 Effect of hexanal (1%) and 1-MCP (10 μδ/δ) treatments on gene expression analyses for phosphatidylinositol-related biosynthetic enzymes and plasma membrane lipid degrading enzymes during storage. The GLM Procedure Sl-PI3K Effect DOF F Value P Value Treatment 2 4.29 0.026 Time 3 9.42 0.000 Treatment*Time 6 2.39 0.059 Sl-PI4K Treatment 2 9.99 0.001 Time 3 5.58 0.005 Treatment*Time 6 2.70 0.038 Sl-PIP Treatment 2 16.86 0.000 Time 3 3.93 0.021 Treatment*Time 6 5.17 0.002 Sl-PI3P5K Treatment 2 73.96 0.000 Time 3 85.53 0.000 Treatment*Time 6 64.80 0.000 Sl-PLC Treatment 2 545.31 0.000 Time 3 90.31 0.000 Treatment*Time 6 155.35 0.000 Sl-PLD Treatment 2 525.87 0.000 Time 3 23.07 0.000 Treatment*Time 6 8.95 0.000
214 Analysis of variance corresponding to Figure 3.7. Temporal changes in ethylene production by Nicotiana tabacum flowers from WT and different transgenic lines. The GLM Procedure DOF F Value P Value Lines 6 205.05 0.000 Time 3 379.25 0.000 Lines*Time 18 36.84 0.000
Analysis of variance corresponding to Figure 3.9. Triple response phenotype of Nicotiana tabacum seedlings The GLM Procedure DOF F Value P Value Treatment 1 114.20 0.000 Lines 1 19.86 0.000 Treatment*Lines 1 18.53 0.000
Analysis of variance corresponding to Figure 4.3A. Binding affinity of phosphatidylinositol 3-kinase C2 domain to various immobilized membrane lipids on PIP Strips (100 pmol). The ANOVA Procedure DOF Sum of Mean F P Value Significance at the Square Square Value 0.05 level Model 13 0.78097 0.06007 35.48 0.000 Yes Error 40 0.06773 0.00169
Analysis of variance corresponding to Figure 4.3B. Binding affinity of phosphatidylinositol 3-kinase C2 domain to various immobilized phosphoinositides at different concentration of on PIP Arrays (100 to 1.16 pmol) The GLM Procedure DOF F Value P Value Phospholipids 6 110.05 0.000 Concentration 6 602.61 0.000 Phospholipids*Concentration 36 17.44 0.000
Analysis of variance corresponding to Figure 4.4A. Calcium induced binding characteristics of phosphatidylinositol 3-kinase (PI3K) C2 domain with phosphatidylinositol (PI). The ANOVA Procedure DOF Sum of Mean F P Value Significance at the Square Square Value 0.05 level Model 3 0.25418 0.08473 19.29 0.000 Yes Error 20 0.08787 0.00439
Analysis of variance corresponding to Figure 4.4B. pH induced binding characteristics of phosphatidylinositol 3-kinase (PI3K) C2 domain with phosphatidylinositol (PI). The ANOVA Procedure DOF Sum of Mean F P Value Significance at the Square Square Value 0.05 level Model 4 0.28402 0.07100 14.54 0.000 Yes Error 39 0.19050 0.00488
215 Analysis of variance corresponding to Figure 4.5A. Calcium induced conformational changes of phosphatidylinositol 3-kinase (PI3K) C2 domain as measured from tryptophan fluorescence. The ANOVA Procedure DOF Sum of Mean F P Value Significance at the Square Square Value 0.05 level Model 14 37878.98 2705.64 297.69 0.000 Yes Error 30 272.67 9.09
Analysis of variance corresponding to Figure 4.5B. pH induced conformational changes of phosphatidylinositol 3-kinase (PI3K) C2 domain as measured from tryptophan fluorescence. The ANOVA Procedure DOF Sum of Mean F P Value Significance at the Square Square Value 0.05 level Model 6 3830.9 638.5 63.68 0.000 Yes Error 14 140.4 10.0
216