Transport of Glucose in to Cells
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												
												Interaction of 6-Phosphofructo-2-Kinase/Fructose-2,6- Bisphosphatase (PFK-2/Fbpase-2) with Glucokinase Activates Glucose Phospho
Interaction of 6-Phosphofructo-2-Kinase/Fructose-2,6- Bisphosphatase (PFK-2/FBPase-2) With Glucokinase Activates Glucose Phosphorylation and Glucose Metabolism in Insulin-Producing Cells Laura Massa,1 Simone Baltrusch,1 David A. Okar,2,3 Alex J. Lange,2 Sigurd Lenzen,1 and Markus Tiedge1 The bifunctional enzyme 6-phosphofructo-2-kinase/ fructose-2,6-bisphosphatase (PFK-2/FBPase-2) was re- cently identified as a new intracellular binding partner he enzyme glucokinase (GK) plays a pivotal role for glucokinase (GK). Therefore, we studied the impor- in the recognition of glucose in pancreatic tance of this interaction for the activity status of GK -cells and the regulation of glucose metabolism and glucose metabolism in insulin-producing cells by Tin the liver (1–7). In pancreatic -cells, GK acts overexpression of the rat liver and pancreatic islet as a glucose sensor and catalyzes the rate-limiting step for isoforms of PFK-2/FBPase-2. PFK-2/FBPase-2 overex- initiation of glucose-induced insulin secretion (6). GK is pression in RINm5F-GK cells significantly increased the regulated in a complex manner in pancreatic -cells by GK activity by 78% in cells expressing the islet isoform, posttranslational modifications of the enzyme protein that by 130% in cells expressing the liver isoform, and by mainly depend on the intracellular glucose concentration 116% in cells expressing a cAMP-insensitive liver S32A/ (8–13). These posttranslational mechanisms of GK activity H258A double mutant isoform. Only in cells overex- regulation are comprised of conformational changes pressing the wild-type liver PFK-2/FBPase-2 isoform (14,15), sulfhydryl-group conversions (16–18), and inter- was the increase of GK activity abolished by forskolin,  apparently due to the regulatory site for phosphoryla- actions with -cell matrix proteins (13,19), insulin gran- tion by a cAMP-dependent protein kinase. - 
												
												New Nucleotide Sequence Data on the EMBL File Server
.=) 1991 Oxford University Press Nucleic Acids Research, Vol. 19, No. 2 413 New nucleotide sequence data on the EMBL File Server October 30, 1990 to November 13, 1990 New nucleotide sequence data, available from the EMBL File Server, (see Stoehr, P.J. and Omond, R.A. (1989) Nucleic Acids Res., 17 (16), 6763 -6764), are reported below. Availability of all the newest sequence data is the result of collaboration between.the EMBL Data Library and GenBank' , and data are supplied regularly by both groups. Updates to existing data are not reported here. This report has been prepared by the EMBL Data Library. PRIMATES: Human casein kinase II alpha subunit mRNA, complete cds. Human specific HS5 DNA Lozeman F.J., Litchfield D.W., Piening C., Takio K., Walsh Ueda S., Washio K., Kurosaki K.; K.A., Krebs E.G.; Genomics 8:7-12(1990). X17579 Biochemistry 29:8436-8447(1990). M55268 Human mRNA for heat shock protein HSP27 Human mRNA for actin-binding protein (ABP-280) Carper S.W., Rocheleau T.A., Storm F.K.; Gorlin J.B., Yamin R., Egan S., Stewart M., Stossel T.P., Nucleic Acids Res. 18:6457-6457(1990). X54079 Kwiatkowski D.J., Hartwig J.H.; J. Cell Biol. 111:1089-1105(1990). X53416 Human Ig germline H-chain D-region Dxpl and Dxp'1 genes, 3' Human amiloride-binding protein, complete cds. end. Barbry P., Champe M., Chassande O., Munemitsu S., Champigny Huang C., Stollar B.David.; G., Lingueglia E., Maes P., Frelin C., Tartar A., Ullrich A., Unpublished. M37485 Lazdunski M.; Proc. Natl. Acad. - 
												
												Cdna Sequence and Tissue Expression Analysis of Glucokinase from Liver of Grass Carp (Ctenopharyngodon Idella )
African Journal of Biotechnology Vol. 11(3), pp. 534-542, 10 January, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3174 ISSN 1684–5315 © 2012 Academic Journals Full Length Research Paper cDNA sequence and tissue expression analysis of glucokinase from liver of grass carp (Ctenopharyngodon idella ) CHENG Han-liang*, JI Nan-jing, PENG Yong-xing, SHEN Xin, XU Jian-he, DONG Zhi-guo and WU Chen-chen Jiangsu Key Laboratory of Marine Biotechnology, Huaihai Institute of Technology, Lianyungang 222005, People’s Republic of China. Accepted 19 December, 2011 A full-length cDNA coding glucokinase (GK) was cloned from the liver of grass carp ( Ctenopharyngodon idella ) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends methods. The cDNA obtained was 2066 bp exclusive of poly (A) residues with a 1431 bp open reading frame encoding 476 amino acids. The GK protein has a calculated molecular weight of 53.7 kDa and isoelectric point of 5.11. Some conserved functional sites were found including one conserved hexokinase signature sequence Leu 156 -Phe 181 ; two N-linked glycosylation sites Asn 176 and Asn 214 ; one cell attachment sequence Arg 202 -Asp 204 ; one glycosaminoglycan attachment site Ser455 -Gly 458 . The amino acid sequence has a high similarity to GK of other species, the percent identity compared with topmouth culter, common carp, human and rat are 98.1, 96.8, 80.3 and 79.8%, respectively. Tissue distribution of GK mRNA in brain, mesenteric adipose tissue, spleen, white muscle and liver of grass carp was analyzed by SYBR real-time fluorescence quantitative RT-PCR method using β-actin as an internal control for cDNA normalization. - 
												
												Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG - 
												
												Yeast As a Tool to Understand the Significance of Human Disease
G C A T T A C G G C A T genes Review Yeast as a Tool to Understand the Significance of Human Disease-Associated Gene Variants Tiziana Cervelli and Alvaro Galli * Yeast Genetics and Genomics Group, Laboratory of Functional Genetics and Genomics, Institute of Clinical Physiology CNR, Via Moruzzi 1, 56125 Pisa, Italy; [email protected] * Correspondence: [email protected] Abstract: At present, the great challenge in human genetics is to provide significance to the growing amount of human disease-associated gene variants identified by next generation DNA sequencing technologies. Increasing evidences suggest that model organisms are of pivotal importance to addressing this issue. Due to its genetic tractability, the yeast Saccharomyces cerevisiae represents a valuable model organism for understanding human genetic variability. In the present review, we show how S. cerevisiae has been used to study variants of genes involved in different diseases and in different pathways, highlighting the versatility of this model organism. Keywords: yeast; Saccharomyces cerevisiae; functional assays; Mendelian disease; cancer; human gene variants 1. Introduction The advent of next generation DNA sequences technologies allows us to identify Citation: Cervelli, T.; Galli, A. Yeast individual genetic variants, and this revolutionized the strategy for discovering the cause as a Tool to Understand the of several genetic and multifactorial diseases. The association between genetic variants Significance of Human and disease risk can potentially overturn our understanding of common disease. The Disease-Associated Gene Variants. discovery of pathways and processes that are causally involved in a disease, so far not Genes 2021, 12, 1303. https:// linked, may open the way towards the development of targeted therapies and prevention doi.org/10.3390/genes12091303 strategies. - 
												
												Structures, Functions, and Mechanisms of Filament Forming Enzymes: a Renaissance of Enzyme Filamentation
Structures, Functions, and Mechanisms of Filament Forming Enzymes: A Renaissance of Enzyme Filamentation A Review By Chad K. Park & Nancy C. Horton Department of Molecular and Cellular Biology University of Arizona Tucson, AZ 85721 N. C. Horton ([email protected], ORCID: 0000-0003-2710-8284) C. K. Park ([email protected], ORCID: 0000-0003-1089-9091) Keywords: Enzyme, Regulation, DNA binding, Nuclease, Run-On Oligomerization, self-association 1 Abstract Filament formation by non-cytoskeletal enzymes has been known for decades, yet only relatively recently has its wide-spread role in enzyme regulation and biology come to be appreciated. This comprehensive review summarizes what is known for each enzyme confirmed to form filamentous structures in vitro, and for the many that are known only to form large self-assemblies within cells. For some enzymes, studies describing both the in vitro filamentous structures and cellular self-assembly formation are also known and described. Special attention is paid to the detailed structures of each type of enzyme filament, as well as the roles the structures play in enzyme regulation and in biology. Where it is known or hypothesized, the advantages conferred by enzyme filamentation are reviewed. Finally, the similarities, differences, and comparison to the SgrAI system are also highlighted. 2 Contents INTRODUCTION…………………………………………………………..4 STRUCTURALLY CHARACTERIZED ENZYME FILAMENTS…….5 Acetyl CoA Carboxylase (ACC)……………………………………………………………………5 Phosphofructokinase (PFK)……………………………………………………………………….6 - 
												
												Metabolic Plasticity Is an Essential Requirement of Acquired Tyrosine Kinase Inhibitor Resistance in Chronic Myeloid Leukemia
cancers Article Metabolic Plasticity Is an Essential Requirement of Acquired Tyrosine Kinase Inhibitor Resistance in Chronic Myeloid Leukemia Miriam G. Contreras Mostazo 1,2,3, Nina Kurrle 3,4,5, Marta Casado 6,7 , Dominik Fuhrmann 8, Islam Alshamleh 4,9, Björn Häupl 3,4,5, Paloma Martín-Sanz 7,10, Bernhard Brüne 5,8,11 , 3,4,5 4,9 3,4,5, 1,2,7,12, , Hubert Serve , Harald Schwalbe , Frank Schnütgen y , Silvia Marin * y 1,2,7,12, , and Marta Cascante * y 1 Department of Biochemistry and Molecular Biomedicine, Faculty of Biology, Universitat de Barcelona, 08028 Barcelona, Spain; [email protected] 2 Institute of Biomedicine of University of Barcelona, 08028 Barcelona, Spain 3 Department of Medicine, Hematology/Oncology, University Hospital Frankfurt, Goethe-University, 60590 Frankfurt am Main, Germany; [email protected] (N.K.); [email protected] (B.H.); [email protected] (H.S.); [email protected] (F.S.) 4 German Cancer Consortium (DKTK), Partner Site Frankfurt/Mainz, and German Cancer Research Center (DKFZ), 69120 Heidelberg, Germany; [email protected] (I.A.); [email protected] (H.S.) 5 Frankfurt Cancer Institute (FCI), Goethe University, 60590 Frankfurt am Main, Germany; [email protected] 6 Biomedicine Institute of Valencia, IBV-CSIC, 46010 Valencia, Spain; [email protected] 7 CIBER of Hepatic and Digestive Diseases (CIBEREHD), Institute of Health Carlos III (ISCIII), 28029 Madrid, Spain; [email protected] 8 Institute of Biochemistry I, Faculty of - 
												
												2 Points Chem 465 Biochemistry II Test 1 Spring 2017 Multiple Choice
Name: 2 points Chem 465 Biochemistry II Test 1 Spring 2017 Multiple choice (4 points apiece): 1. Which of the following statements about the oxidative decarboxylation of pyruvate in aerobic conditions in animal cells is correct? A) One of the products of the reactions of the pyruvate dehydrogenase complex is a thioester of acetate. B) The methyl (-CH3) group is eliminated as CO2. C) The process occurs in the cytosolic compartment of the cell. D) The pyruvate dehydrogenase complex uses all of the following as cofactors: NAD+, lipoic acid, pyridoxal phosphate (PLP), and FAD. E) The reaction is so important to energy production that pyruvate dehydrogenase operates at full speed under all conditions. 2. In comparison with the resting state, actively contracting human muscle tissue has a: A) higher concentration of ATP. B) higher rate of lactate formation. C) lower consumption of glucose. D) lower rate of consumption of oxygen E) lower ratio of NADH to NAD+. 3.The metabolic function of the pentose phosphate pathway is: A) act as a source of ADP biosynthesis. B) generate NADPH and pentoses for the biosynthesis of fatty acids and nucleic acids. C) participate in oxidation-reduction reactions during the formation of H2O. D) provide intermediates for the citric acid cycle. E) synthesize phosphorus pentoxide. 4. Gluconeogenesis must use "bypass reactions" to circumvent three reactions in the glycolytic pathway that are highly exergonic and essentially irreversible. Reactions carried out by which three of the enzymes listed must be bypassed in the gluconeogenic pathway? 1) Hexokinase 2) Phosphoglycerate kinase 3) Phosphofructokinase-1 4) Pyruvate kinase 5) Triosephosphate isomerase A) 1, 2, 3 B) 1, 2, 4 C) 1, 4, 5 D) 1, 3, 4 E) 2, 3, 4 5. - 
												
												Physiological and Proteomic Responses of Diploid and Tetraploid Black Locust (Robinia Pseudoacacia L.) Subjected to Salt Stress
Int. J. Mol. Sci. 2013, 14, 20299-20325; doi:10.3390/ijms141020299 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Physiological and Proteomic Responses of Diploid and Tetraploid Black Locust (Robinia pseudoacacia L.) Subjected to Salt Stress Zhiming Wang 1,†, Mingyue Wang 1,†, Likun Liu2 and Fanjuan Meng 1,* 1 College of Life Science, Northeast Forestry University, Harbin 150040, China; E-Mails: [email protected] (Z.W.); [email protected] (M.W.) 2 Department of Medical Biotechnology, College of Biomedical Science, Kangwon National University, Chuncheon, Gangwon-do 200-701, Korea; E-Mail: [email protected] † These authors contributed equally to this work. * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +86-451-8219-2170; Fax: +86-451-8643-3905. Received: 17 June 2013; in revised form: 31 August 2013 / Accepted: 9 September 2013 / Published: 14 October 2013 Abstract: Tetraploid black locust (Robinia pseudoacacia L.) is adaptable to salt stress. Here, we compared morphological, physiological, ultrastructural, and proteomic traits of leaves in tetraploid black locust and its diploid relatives under salt stress. The results showed that diploid (2×) plants suffered from greater negative effects than those of tetraploid (4×) plants. After salt treatment, plant growth was inhibited, photosynthesis was reduced, reactive oxygen species, malondialdehyde content, and relative electrolyte leakage increased, and defense-related enzyme activities decreased in 2× compared to those in 4×. In addition, salt stress resulted in distorted chloroplasts, swollen thylakoid membranes, accumulation of plastoglobules, and increased starch grains in 2× compared to those in 4×. - 
												
												Insulin Resistance Related Signaling Pathways in the Liver
INSULIN RESISTANCE RELATED SIGNALING PATHWAYS IN THE LIVER by Yuchun Wang A thesis submitted to Johns Hopkins University in conformity with the requirements for the degree of Master of Science in Engineering Baltimore, Maryland May, 2020 © 2020 Yuchun Wang All rights reserved Abstract Over the past 20 years, the worldwide toll of diabetes has tripled to more than 400 million, which makes it one of the fastest-growing health challenges of the 21st century. There are three main categories of diabetes: type 1, type 2 and gestational diabetes mellitus. Among them, Type 2 diabetes(T2D) makes up to 90% of diabetes worldwide. Hyper- glycemia can be effectively controlled by giving insulin injection for type 1 and gestational diabetes mellitus. However, because insulin resistance is one of the causes of T2D, those with T2D do not respond as well to insulin as those with T1D or gestational diabetes. Fur- thermore, our lack of knowledge about the underlying physiology of T2D makes it difficult to find reliable treatments. While high blood glucose concentration is one of the major symptoms of T2D, changes in lipid metabolism are characteristic of insulin resistance(IR). In the human body, the liver plays a major role in glucose homeostasis and lipid metabolism. Hence, this essay pro- vides an overview of signaling pathways in the liver and presents their interrelationship to better understand the underlying IR mechanism. Primary Reader and Advisor: Marc D. Donohue Secondary Reader: Gregory Aranovich ii Acknowledgements I wish to express my deepest gratitude to my advisor, Professor Marc D. Donohue, for introducing me to the fantastic world of science, and for his patient guidance along the road of my Master’s study. - 
												
												Supplemental Information
Supplemental Figures Supplemental Figure 1. 1 Supplemental Figure 1. (A) Fold changes in the mRNA expression levels of genes involved in glucose metabolism, pentose phosphate pathway (PPP), lipid biosynthesis and beta cell markers, in sorted beta cells from MIP-GFP adult mice (P25) compared to beta cells from neonatal MIP-GFP mice (P4). (N=1; pool of cells sorted from 6-8 mice in each group). (B) Fold changes in the mRNA expression levels of genes involved in glucose metabolism, pentose phosphate pathway (PPP), lipid biosynthesis and beta cell markers, in quiescent MEFs compared to proliferating MEFs. (N=1). (C) Expression Glut2 (red) in representative pancreatic sections from wildtype mice at indicated ages, by immunostaining. DAPI (blue) counter-stains the nuclei. (D) Bisulfite sequencing analysis for the Ldha and AldoB loci at indicated regions comparing sorted beta cells from P4 and P25 MIP-GFP mice (representative clones from N=3 mice). Each horizontal line with dots is an independent clone and 10 clones are shown here. These regions are almost fully DNA methylated (filled circles) in beta cells from P25 mice, but largely hypomethylated (open circles) in beta cells from P4 mice. For all experiments unless indicated otherwise, N=3 independent experiments. 2 Supplemental Figure 2. 3 Supplemental Figure 2. (A) Expression profile of Dnmt3a in representative pancreatic sections from wildtyype mice at indicated ages (P1 to 6 weeks) using immunostaining for Dnmt3a (red) and insulin (Ins; green). DAPI (blue) counter-stains the nuclei. (B) Representative pancreatic sections from 2 weeks old 3aRCTom-KO and littermate control 3aRCTom-Het animals, immunostained for Dnmt3a (red) and GFP (green). - 
												
												The Effects of Bone Marrow Adipocytes on Metabolic Regulation in Metastatic Prostate Cancer" (2017)
Wayne State University Wayne State University Dissertations 1-1-2017 The ffecE ts Of Bone Marrow Adipocytes On Metabolic Regulation In Metastatic Prostate Cancer Jonathan Diedrich Wayne State University, Follow this and additional works at: https://digitalcommons.wayne.edu/oa_dissertations Part of the Oncology Commons Recommended Citation Diedrich, Jonathan, "The Effects Of Bone Marrow Adipocytes On Metabolic Regulation In Metastatic Prostate Cancer" (2017). Wayne State University Dissertations. 1797. https://digitalcommons.wayne.edu/oa_dissertations/1797 This Open Access Dissertation is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Dissertations by an authorized administrator of DigitalCommons@WayneState. THE EFFECTS OF BONE MARROW ADIPOCYTES ON METASTATIC PROSTATE CANCER CELL METABOLISM AND SIGNALLING by JONATHAN DRISCOLL DIEDRICH DISSERTATION Submitted to the Graduate School of Wayne State University, Detroit, Michigan in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY 2017 MAJOR: CANCER BIOLOGY Approved By: Advisor Date © COPYRIGHT BY JONATHAN DIEDRICH 2017 All Rights Reserved DEDICATION To my Family, Friends, and Wally ii ACKNOWLEDGMENTS When I joined the Podgorski laboratory in April of 2014, I had finished my rotations and spent some time in a collaborating laboratory honing my technical and creative thinking skills to become a valuable asset to her team; however, I was still unprepared for the exciting journey it would be through Izabela’s laboratory over the last three years. I was extremely lucky to have landed in Dr. Podgorski’s laboratory and will be forever thankful for the tremendous support she has given me to aid in my development as an independent investigator.