Glycolysis and Gluconeogenesis Are Regulated Independently
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Galactokinase (B) Glucokinase (C) Galactose-1-Phosphate Uridyltransferase (D) UDP-Galactose 4- Epimerase Sol
1. Which of the following enzymes are not involved in galactose metabolism? (a) Galactokinase (b) Glucokinase (c) Galactose-1-Phosphate Uridyltransferase (d) UDP-Galactose 4- epimerase Sol. (b) Glucokinase. 2. Which of the following enzymes leads to a glycogen storage disease known as Tarui’s disease? (a) Glucokinase (b) Pyruvate Kinase (c) Phosphofructokinase (d) Phosphoglucomutase Sol. (c) Phosphofructokinase. 3. Which of the following enzymes is defective in galactosemia- a fatal genetic disorder in infants? (a) Glucokinase (b) Galactokinase (c) UDP-Galactose 4- epimerase (d) Galactose-1-Phosphate Uridyltransferase Sol. (d) Galactose-1-Phosphate Uridyltransferase. 4. Which of the following enzyme deficiency leads to hemolytic anaemia? (a) Glucokinase (b) Pyruvate Kinase (c) Phosphoglucomutase (d) Phosphofructokinase Sol. (b) Pyruvate Kinase. 5. Which of the following glucose transporters are important in fructose transport in the intestine? (a) GLUT5 (b) GLUT3 (c) GLUT4 (d) GLUT7 Sol. (a) GLUT5. 6. Which of the following is a tricarboxylic acid? (a) Acetic acid (b) Succinic acid (c) Oxaloacetic acid (d) Citric acid Sol.(d) Citric acid. 7. Which of the following enzymes plays an important role in tumour metabolism? (a) Glucokinase (b) Pyruvate Kinase M2 (c) Phosphoglucomutase (d) Phosphofructokinase Sol. (b) Pyruvate Kinase M2. 8. Which of the following metabolites negatively regulates pyruvate kinase? 1. (a) Citrate (b) Alanine (c) Acetyl CoA (d) Fructose-1,6-Bisphosphate Sol. (b) Alanine 9. The glycerol phosphate shuttle functions in___________. (a) Lipid catabolism (b) Triglyceride synthesis (c) Anaerobic glycolysis for the regeneration of NAD (d) Aerobic glycolysis to transport NADH equivalents resulting from glycolysis into mitochondria. Sol. (d) Aerobic glycolysis to transport NADH equivalents resulting from glycolysis into mitochondria. -
Isozymes of Pyruvate Kinase in Liver and Hepatomas of the Rat1
[CANCER RESEARCH 34, 1439-1446, June 1974] Isozymes of Pyruvate Kinase in Liver and Hepatomas of the Rat1 Francis A. Farina,2 Jennie B. Shatton, Harold P. Morris, and Sidney Weinhouse The Fels Research Institute and the Department of Biochemistry, Temple University School oj Medicine, Philadelphia. Pennsylvania IV140 (F. A. F., J. B. S.. S. W.\, and the Department of Biochemistry. Howard University School of Medicine. Washington. D. C. 20001 [H. P. M .\ SUMMARY 23, 32, 41, 57). These alterations involve the replacement of those isozymes that are under dietary and hormonal control Pyruvate kinase (PK) (EC 2.7.1.40) isozymes were assayed by the host, and that have important metabolic functions in in normal rat liver and a series of transplantable rat the adult differentiated liver by other isozymes which are hepatomas ranging widely in growth rate and degree of normally either low in, or absent from, the adult tissue. As differentiation, with the use of gradient elution by chloride part of an ongoing study of this phenomenon, we have ion from columns of DEAE-cellulose. In agreement with examined the alteration of PK3 (EC 2.7.1.40) isozymes in other studies, three noninterconvertible forms were found in the Morris hepatomas (30. 31), a series of chemically rat tissues: isozyme I, the major form in adult rat liver: induced, transplantable rat hepatomas ranging widely in isozyme II, the sole form in heart and skeletal muscle: and growth rate and degree of differentiation. This enzyme isozyme III, the sole form in poorly differentiated hepato occupies a key position in the metabolism of cells and, as we mas, the major form in normal kidney and lung, and the pointed out previously (27, 28. -
Pyruvate Kinase: Function, Regulation and Role in Cancer
Pyruvate kinase: Function, regulation and role in cancer The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Israelsen, William J., and Matthew G. Vander Heiden. “Pyruvate Kinase: Function, Regulation and Role in Cancer.” Seminars in Cell & Developmental Biology 43 (2015): 43–51. As Published http://dx.doi.org/10.1016/j.semcdb.2015.08.004 Publisher Elsevier Version Author's final manuscript Citable link http://hdl.handle.net/1721.1/105833 Terms of Use Creative Commons Attribution-NonCommercial-NoDerivs License Detailed Terms http://creativecommons.org/licenses/by-nc-nd/4.0/ HHS Public Access Author manuscript Author Manuscript Author ManuscriptSemin Cell Author Manuscript Dev Biol. Author Author Manuscript manuscript; available in PMC 2016 August 13. Published in final edited form as: Semin Cell Dev Biol. 2015 July ; 43: 43–51. doi:10.1016/j.semcdb.2015.08.004. Pyruvate kinase: function, regulation and role in cancer William J. Israelsena,1,* and Matthew G. Vander Heidena,b,* aKoch Institute for Integrative Cancer Research, Massachusetts Institute of Technology, Cambridge, MA 02139, USA bDepartment of Medical Oncology, Dana-Farber Cancer Institute, Boston, MA 02115, USA Abstract Pyruvate kinase is an enzyme that catalyzes the conversion of phosphoenolpyruvate and ADP to pyruvate and ATP in glycolysis and plays a role in regulating cell metabolism. There are four mammalian pyruvate kinase isoforms with unique tissue expression patterns and regulatory properties. The M2 isoform of pyruvate kinase (PKM2) supports anabolic metabolism and is expressed both in cancer and normal tissue. The enzymatic activity of PKM2 is allosterically regulated by both intracellular signaling pathways and metabolites; PKM2 thus integrates signaling and metabolic inputs to modulate glucose metabolism according to the needs of the cell. -
Interaction of 6-Phosphofructo-2-Kinase/Fructose-2,6- Bisphosphatase (PFK-2/Fbpase-2) with Glucokinase Activates Glucose Phospho
Interaction of 6-Phosphofructo-2-Kinase/Fructose-2,6- Bisphosphatase (PFK-2/FBPase-2) With Glucokinase Activates Glucose Phosphorylation and Glucose Metabolism in Insulin-Producing Cells Laura Massa,1 Simone Baltrusch,1 David A. Okar,2,3 Alex J. Lange,2 Sigurd Lenzen,1 and Markus Tiedge1 The bifunctional enzyme 6-phosphofructo-2-kinase/ fructose-2,6-bisphosphatase (PFK-2/FBPase-2) was re- cently identified as a new intracellular binding partner he enzyme glucokinase (GK) plays a pivotal role for glucokinase (GK). Therefore, we studied the impor- in the recognition of glucose in pancreatic tance of this interaction for the activity status of GK -cells and the regulation of glucose metabolism and glucose metabolism in insulin-producing cells by Tin the liver (1–7). In pancreatic -cells, GK acts overexpression of the rat liver and pancreatic islet as a glucose sensor and catalyzes the rate-limiting step for isoforms of PFK-2/FBPase-2. PFK-2/FBPase-2 overex- initiation of glucose-induced insulin secretion (6). GK is pression in RINm5F-GK cells significantly increased the regulated in a complex manner in pancreatic -cells by GK activity by 78% in cells expressing the islet isoform, posttranslational modifications of the enzyme protein that by 130% in cells expressing the liver isoform, and by mainly depend on the intracellular glucose concentration 116% in cells expressing a cAMP-insensitive liver S32A/ (8–13). These posttranslational mechanisms of GK activity H258A double mutant isoform. Only in cells overex- regulation are comprised of conformational changes pressing the wild-type liver PFK-2/FBPase-2 isoform (14,15), sulfhydryl-group conversions (16–18), and inter- was the increase of GK activity abolished by forskolin,  apparently due to the regulatory site for phosphoryla- actions with -cell matrix proteins (13,19), insulin gran- tion by a cAMP-dependent protein kinase. -
(PDE 1 B 1) Correlates with Brain Regions Having Extensive Dopaminergic Innervation
The Journal of Neuroscience, March 1994, 14(3): 1251-l 261 Expression of a Calmodulin-dependent Phosphodiesterase lsoform (PDE 1 B 1) Correlates with Brain Regions Having Extensive Dopaminergic Innervation Joseph W. Polli and Randall L. Kincaid Section on Immunology, Laboratory of Molecular and Cellular Neurobiology, National Institute on Alcohol Abuse and Alcoholism, Rockville, Maryland 20852 Cyclic nucleotide-dependent protein phosphorylation plays PDE implies an important physiological role for Ca2+-regu- a central role in neuronal signal transduction. Neurotrans- lated attenuation of CAMP-dependent signaling pathways mitter-elicited increases in cAMP/cGMP brought about by following dopaminergic stimulation. activation of adenylyl and guanylyl cyclases are downre- [Key words: CAMP, cyclase, striatum, dopamine, basal gulated by multiple phosphodiesterase (PDE) enzymes. In ganglia, DARPP-321 brain, the calmodulin (CaM)-dependent isozymes are the major degradative activities and represent a unique point of Cyclic nucleotides, acting as “second messengers”or via direct intersection between the cyclic nucleotide- and calcium effects, regulate a diverse array of neuronal functions, from ion (Ca*+)-mediated second messenger systems. Here we de- channel conductance to gene expression. Hydrolysis of 3’,5’- scribe the distribution of the PDEl Bl (63 kDa) CaM-depen- cyclic nucleotidesto 5’-nucleosidemonophosphates is the major dent PDE in mouse brain. An anti-peptide antiserum to this mechanismfor decreasingintracellular cyclic nucleotide levels. isoform immunoprecipitated -3O-40% of cytosolic PDE ac- This reaction is catalyzed by cyclic nucleotide phosphodiester- tivity, whereas antiserum to PDElA2 (61 kDa isoform) re- ase (PDE) enzymes that constitute a large superfamily (Beavo moved 60-70%, demonstrating that these isoforms are the and Reifsynder, 1990). -
New Nucleotide Sequence Data on the EMBL File Server
.=) 1991 Oxford University Press Nucleic Acids Research, Vol. 19, No. 2 413 New nucleotide sequence data on the EMBL File Server October 30, 1990 to November 13, 1990 New nucleotide sequence data, available from the EMBL File Server, (see Stoehr, P.J. and Omond, R.A. (1989) Nucleic Acids Res., 17 (16), 6763 -6764), are reported below. Availability of all the newest sequence data is the result of collaboration between.the EMBL Data Library and GenBank' , and data are supplied regularly by both groups. Updates to existing data are not reported here. This report has been prepared by the EMBL Data Library. PRIMATES: Human casein kinase II alpha subunit mRNA, complete cds. Human specific HS5 DNA Lozeman F.J., Litchfield D.W., Piening C., Takio K., Walsh Ueda S., Washio K., Kurosaki K.; K.A., Krebs E.G.; Genomics 8:7-12(1990). X17579 Biochemistry 29:8436-8447(1990). M55268 Human mRNA for heat shock protein HSP27 Human mRNA for actin-binding protein (ABP-280) Carper S.W., Rocheleau T.A., Storm F.K.; Gorlin J.B., Yamin R., Egan S., Stewart M., Stossel T.P., Nucleic Acids Res. 18:6457-6457(1990). X54079 Kwiatkowski D.J., Hartwig J.H.; J. Cell Biol. 111:1089-1105(1990). X53416 Human Ig germline H-chain D-region Dxpl and Dxp'1 genes, 3' Human amiloride-binding protein, complete cds. end. Barbry P., Champe M., Chassande O., Munemitsu S., Champigny Huang C., Stollar B.David.; G., Lingueglia E., Maes P., Frelin C., Tartar A., Ullrich A., Unpublished. M37485 Lazdunski M.; Proc. Natl. Acad. -
Serum 5-Nucleotidase by Theodore F
J Clin Pathol: first published as 10.1136/jcp.7.4.341 on 1 November 1954. Downloaded from J. clin. Path. (1954), 7, 341. SERUM 5-NUCLEOTIDASE BY THEODORE F. DIXON AND MARY PURDOM t0o From the Biochemistry Department, the Institute of Orthopaedics, Stanmore, Middlesex (RECEIVED FOR PUBLICATION DECEMBER 8. 1953) Reis (1934, 1940, 1951) has demonstrated the add the molybdate solution, and dilute with washings to presence of alkaline phosphatase in various tissues 1 litre with water. specifically hydrolysing 5-nucleotidase such as Standard Phosphate Solution.-KH2PO4 0.02195 g., adenosine and inosine-5-phosphoric acids. The and 50 g. trichloracetic acid, made up to 1 litre. This enzyme has its optimum action at pH 7.8 and in all solution contains 0.02 mg. P in 4 ml. human tissues except intestinal mucosa its activity, at the physiological pH range, is much more Methods pronounced than that of the non-specific alkaline Non-specific alkaline phosphatase activity is high at phosphatase. Thus ossifying cartilage, one of the pH 9 towards phenylphosphate adenosine phosphate classical sites of high alkaline phosphatase activity, and glycerophosphate, in this decreasing order (cf. Reis, although very active against say phenyl phosphoric 1951). At pH 7.5, however, the total phosphatase acids at pH 9, is more active against adenosine-5- activity is equally low towards phenyl- or glycero-phos- phosphoric at pH 7.5. This finding suggested to phate -nd the higher activity towards adenosine-5- phosphate at this reaction is reasonably inferred to be Reis that the enzyme might play a part in calcifica- due to the specific 5-nucleotidase. -
Regulation of Calmodulin-Stimulated Cyclic Nucleotide Phosphodiesterase (PDE1): Review
95-105 5/6/06 13:44 Page 95 INTERNATIONAL JOURNAL OF MOLECULAR MEDICINE 18: 95-105, 2006 95 Regulation of calmodulin-stimulated cyclic nucleotide phosphodiesterase (PDE1): Review RAJENDRA K. SHARMA, SHANKAR B. DAS, ASHAKUMARY LAKSHMIKUTTYAMMA, PONNIAH SELVAKUMAR and ANURAAG SHRIVASTAV Department of Pathology and Laboratory Medicine, College of Medicine, University of Saskatchewan, Cancer Research Division, Saskatchewan Cancer Agency, 20 Campus Drive, Saskatoon SK S7N 4H4, Canada Received January 16, 2006; Accepted March 13, 2006 Abstract. The response of living cells to change in cell 6. Differential inhibition of PDE1 isozymes and its environment depends on the action of second messenger therapeutic applications molecules. The two second messenger molecules cAMP and 7. Role of proteolysis in regulating PDE1A2 Ca2+ regulate a large number of eukaryotic cellular events. 8. Role of PDE1A1 in ischemic-reperfused heart Calmodulin-stimulated cyclic nucleotide phosphodiesterase 9. Conclusion (PDE1) is one of the key enzymes involved in the complex interaction between cAMP and Ca2+ second messenger systems. Some PDE1 isozymes have similar kinetic and 1. Introduction immunological properties but are differentially regulated by Ca2+ and calmodulin. Accumulating evidence suggests that the A variety of cellular activities are regulated through mech- activity of PDE1 is selectively regulated by cross-talk between anisms controlling the level of cyclic nucleotides. These Ca2+ and cAMP signalling pathways. These isozymes are mechanisms include synthesis, degradation, efflux and seque- also further distinguished by various pharmacological agents. stration of cyclic adenosine 3':5'-monophosphate (cAMP) and We have demonstrated a potentially novel regulation of PDE1 cyclic guanosine 3':5'- monophosphate (cGMP) within the by calpain. -
Cdna Sequence and Tissue Expression Analysis of Glucokinase from Liver of Grass Carp (Ctenopharyngodon Idella )
African Journal of Biotechnology Vol. 11(3), pp. 534-542, 10 January, 2012 Available online at http://www.academicjournals.org/AJB DOI: 10.5897/AJB11.3174 ISSN 1684–5315 © 2012 Academic Journals Full Length Research Paper cDNA sequence and tissue expression analysis of glucokinase from liver of grass carp (Ctenopharyngodon idella ) CHENG Han-liang*, JI Nan-jing, PENG Yong-xing, SHEN Xin, XU Jian-he, DONG Zhi-guo and WU Chen-chen Jiangsu Key Laboratory of Marine Biotechnology, Huaihai Institute of Technology, Lianyungang 222005, People’s Republic of China. Accepted 19 December, 2011 A full-length cDNA coding glucokinase (GK) was cloned from the liver of grass carp ( Ctenopharyngodon idella ) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends methods. The cDNA obtained was 2066 bp exclusive of poly (A) residues with a 1431 bp open reading frame encoding 476 amino acids. The GK protein has a calculated molecular weight of 53.7 kDa and isoelectric point of 5.11. Some conserved functional sites were found including one conserved hexokinase signature sequence Leu 156 -Phe 181 ; two N-linked glycosylation sites Asn 176 and Asn 214 ; one cell attachment sequence Arg 202 -Asp 204 ; one glycosaminoglycan attachment site Ser455 -Gly 458 . The amino acid sequence has a high similarity to GK of other species, the percent identity compared with topmouth culter, common carp, human and rat are 98.1, 96.8, 80.3 and 79.8%, respectively. Tissue distribution of GK mRNA in brain, mesenteric adipose tissue, spleen, white muscle and liver of grass carp was analyzed by SYBR real-time fluorescence quantitative RT-PCR method using β-actin as an internal control for cDNA normalization. -
Prevalence of Pyruvate Kinase Deficiency
P3513 Prevalence of Red Cell Pyruvate Kinase Deficiency: A Systematic Literature Review Mike Storm1, Matthew H Secrest2*, Courtney Carrington2, Deb Casso2, Keely Gilroy1, Leanne Pladson1, Audra N Boscoe1 1Agios Pharmaceuticals Inc., Cambridge, MA, USA; 2IQVIA Epidemiology & Drug Safety, Seattle, WA and Cambridge, MA, USA; *Affiliation at the time research was conducted BACKGROUND METHODS (continued) RESULTS (continued) RESULTS (continued) • Pyruvate Kinase (PK) deficiency is a rare congenital hemolytic anemia Exclusion Criteria The remaining 34 studies were grouped based on methods and study Among these 4 studies, an important distinction was made between studies characterized by diminished activity of the PK enzyme in red blood population (Table 1). reporting diagnosed prevalence (n=3) and overall disease prevalence cells (RBC).1 • Non-human studies; (diagnosed and undiagnosed PK deficiency; n=1). Table 1. Distribution of extracted studies by type of study (n=34) • Low PK enzyme activity can lead to lifelong chronic hemolysis with • Publications that were not the primary report of the data • Two studies estimated diagnosed PK deficiency prevalence as 3.2 per associated symptoms and complications such as anemia, jaundice, (e.g., literature reviews); Type of study Number million4 and 8.5 per million5 by identifying diagnosed PK deficiency cases of studies gallstones, splenectomy and associated thrombosis, iron overload, and • Studies of PK deficiency prevalence/incidence conducted within a source from source populations of known size. liver cirrhosis.2 Population-based prevalence 2 population of patients with symptoms of PK deficiency such as anemia • We estimated the prevalence of diagnosed PK deficiency in a general • PK deficiency is caused by compound heterozygosity or homozygosity for or jaundice; Molecular PKLR screening in a general population 5 population to be 6.5 per million6 using data from another high-quality study 3 one or more of the >300 known mutations to the PKLR gene. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Analyses of PDE-Regulated Phosphoproteomes Reveal Unique and Specific Camp-Signaling Modules in T Cells
Analyses of PDE-regulated phosphoproteomes reveal unique and specific cAMP-signaling modules in T cells Michael-Claude G. Beltejara, Ho-Tak Laua, Martin G. Golkowskia, Shao-En Onga, and Joseph A. Beavoa,1 aDepartment of Pharmacology, University of Washington, Seattle, WA 98195 Contributed by Joseph A. Beavo, May 28, 2017 (sent for review March 10, 2017; reviewed by Paul M. Epstein, Donald H. Maurice, and Kjetil Tasken) Specific functions for different cyclic nucleotide phosphodiester- to bias T-helper polarization toward Th2, Treg, or Th17 pheno- ases (PDEs) have not yet been identified in most cell types. types (13, 14). In a few cases increased cAMP may even potentiate Conventional approaches to study PDE function typically rely on the T-cell activation signal (15), particularly at early stages of measurements of global cAMP, general increases in cAMP- activation. Recent MS-based proteomic studies have been useful dependent protein kinase (PKA), or the activity of exchange in characterizing changes in the phosphoproteome of T cells under protein activated by cAMP (EPAC). Although newer approaches various stimuli such as T-cell receptor stimulation (16), prosta- using subcellularly targeted FRET reporter sensors have helped glandin signaling (17), and oxidative stress (18), so much of the define more compartmentalized regulation of cAMP, PKA, and total Jurkat phosphoproteome is known. Until now, however, no EPAC, they have limited ability to link this regulation to down- information on the regulation of phosphopeptides by PDEs has stream effector molecules and biological functions. To address this been available in these cells. problem, we have begun to use an unbiased mass spectrometry- Inhibitors of cAMP PDEs are useful tools to study PKA/EPAC- based approach coupled with treatment using PDE isozyme- mediated signaling, and selective inhibitors for each of the 11 PDE – selective inhibitors to characterize the phosphoproteomes of the families have been developed (19 21).