Pyruvate-Phosphate Dikinase of Oxymonads and Parabasalia and the Evolution of Pyrophosphate-Dependent Glycolysis in Anaerobic Eukaryotes† Claudio H
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent -
Characterization and Phylogeny of the Pfp Gene of Amycolatopsis Methanolica Encoding
JOURNAL OF BACTERIOLOGY, Jan. 1996, p. 149–155 Vol. 178, No. 1 0021-9193/96/$04.0010 Copyright q 1996, American Society for Microbiology Characterization and Phylogeny of the pfp Gene of Amycolatopsis methanolica Encoding PPi-Dependent Phosphofructokinase ALEXANDRA M. C. R. ALVES, WIM G. MEIJER, JAN W. VRIJBLOED, AND LUBBERT DIJKHUIZEN* Department of Microbiology, Groningen Biomolecular Sciences and Biotechnology Institute (GBB), University of Groningen, 9751 NN Haren, The Netherlands Received 28 July 1995/Accepted 2 November 1995 The actinomycete Amycolatopsis methanolica employs a PPi-dependent phosphofructokinase (PPi-PFK) (EC 2.7.1.90) with biochemical characteristics similar to those of both ATP- and PPi-dependent enzymes during growth on glucose. A 2.3-kb PvuII fragment hybridizing to two oligonucleotides based on the amino-terminal amino acid sequence of PPi-PFK was isolated from a genomic library of A. methanolica. Nucleotide sequence analysis of this fragment revealed the presence of an open reading frame encoding a protein of 340 amino acids with a high degree of similarity to PFK proteins. Heterologous expression of this open reading frame in Escherichia coli gave rise to a unique 45-kDa protein displaying a high level of PPi-PFK activity. The open reading frame was therefore designated pfp, encoding the PPi-PFK of A. methanolica. Upstream and transcribed divergently from pfp, a partial open reading frame (aroA) similar to 3-deoxy-D-arabino-heptulosonate-7- phosphate synthase-encoding genes was identified. The partial open reading frame (chiA) downstream from pfp was similar to chitinase genes from Streptomyces species. A phylogenetic analysis of the ATP- and PPi- dependent proteins showed that PPi-PFK enzymes are monophyletic, suggesting that the two types of PFK evolved from a common ancestor. -
Galactokinase (B) Glucokinase (C) Galactose-1-Phosphate Uridyltransferase (D) UDP-Galactose 4- Epimerase Sol
1. Which of the following enzymes are not involved in galactose metabolism? (a) Galactokinase (b) Glucokinase (c) Galactose-1-Phosphate Uridyltransferase (d) UDP-Galactose 4- epimerase Sol. (b) Glucokinase. 2. Which of the following enzymes leads to a glycogen storage disease known as Tarui’s disease? (a) Glucokinase (b) Pyruvate Kinase (c) Phosphofructokinase (d) Phosphoglucomutase Sol. (c) Phosphofructokinase. 3. Which of the following enzymes is defective in galactosemia- a fatal genetic disorder in infants? (a) Glucokinase (b) Galactokinase (c) UDP-Galactose 4- epimerase (d) Galactose-1-Phosphate Uridyltransferase Sol. (d) Galactose-1-Phosphate Uridyltransferase. 4. Which of the following enzyme deficiency leads to hemolytic anaemia? (a) Glucokinase (b) Pyruvate Kinase (c) Phosphoglucomutase (d) Phosphofructokinase Sol. (b) Pyruvate Kinase. 5. Which of the following glucose transporters are important in fructose transport in the intestine? (a) GLUT5 (b) GLUT3 (c) GLUT4 (d) GLUT7 Sol. (a) GLUT5. 6. Which of the following is a tricarboxylic acid? (a) Acetic acid (b) Succinic acid (c) Oxaloacetic acid (d) Citric acid Sol.(d) Citric acid. 7. Which of the following enzymes plays an important role in tumour metabolism? (a) Glucokinase (b) Pyruvate Kinase M2 (c) Phosphoglucomutase (d) Phosphofructokinase Sol. (b) Pyruvate Kinase M2. 8. Which of the following metabolites negatively regulates pyruvate kinase? 1. (a) Citrate (b) Alanine (c) Acetyl CoA (d) Fructose-1,6-Bisphosphate Sol. (b) Alanine 9. The glycerol phosphate shuttle functions in___________. (a) Lipid catabolism (b) Triglyceride synthesis (c) Anaerobic glycolysis for the regeneration of NAD (d) Aerobic glycolysis to transport NADH equivalents resulting from glycolysis into mitochondria. Sol. (d) Aerobic glycolysis to transport NADH equivalents resulting from glycolysis into mitochondria. -
The Oxymonad Genome Displays Canonical Eukaryotic Complexity in the Absence of a Mitochondrion Anna Karnkowska,*,1,2 Sebastian C
The Oxymonad Genome Displays Canonical Eukaryotic Complexity in the Absence of a Mitochondrion Anna Karnkowska,*,1,2 Sebastian C. Treitli,1 Ondrej Brzon, 1 Lukas Novak,1 Vojtech Vacek,1 Petr Soukal,1 Lael D. Barlow,3 Emily K. Herman,3 Shweta V. Pipaliya,3 TomasPanek,4 David Zihala, 4 Romana Petrzelkova,4 Anzhelika Butenko,4 Laura Eme,5,6 Courtney W. Stairs,5,6 Andrew J. Roger,5 Marek Elias,4,7 Joel B. Dacks,3 and Vladimır Hampl*,1 1Department of Parasitology, BIOCEV, Faculty of Science, Charles University, Vestec, Czech Republic 2Department of Molecular Phylogenetics and Evolution, Faculty of Biology, Biological and Chemical Research Centre, University of Warsaw, Warsaw, Poland 3Division of Infectious Disease, Department of Medicine, University of Alberta, Edmonton, Canada 4Department of Biology and Ecology, Faculty of Science, University of Ostrava, Ostrava, Czech Republic Downloaded from https://academic.oup.com/mbe/article-abstract/36/10/2292/5525708 by guest on 13 January 2020 5Department of Biochemistry and Molecular Biology, Dalhousie University, Halifax, Canada 6Department of Cell and Molecular Biology, Uppsala University, Uppsala, Sweden 7Institute of Environmental Technologies, Faculty of Science, University of Ostrava, Ostrava, Czech Republic *Corresponding authors: E-mails: [email protected]; [email protected]. Associate editor: Fabia Ursula Battistuzzi Abstract The discovery that the protist Monocercomonoides exilis completely lacks mitochondria demonstrates that these organ- elles are not absolutely essential to eukaryotic cells. However, the degree to which the metabolism and cellular systems of this organism have adapted to the loss of mitochondria is unknown. Here, we report an extensive analysis of the M. -
Structural Basis for the Sheddase Function of Human Meprin Β Metalloproteinase at the Plasma Membrane
Structural basis for the sheddase function of human meprin β metalloproteinase at the plasma membrane Joan L. Arolasa, Claudia Broderb, Tamara Jeffersonb, Tibisay Guevaraa, Erwin E. Sterchic, Wolfram Boded, Walter Stöckere, Christoph Becker-Paulyb, and F. Xavier Gomis-Rütha,1 aProteolysis Laboratory, Department of Structural Biology, Molecular Biology Institute of Barcelona, Consejo Superior de Investigaciones Cientificas, Barcelona Science Park, E-08028 Barcelona, Spain; bInstitute of Biochemistry, Unit for Degradomics of the Protease Web, University of Kiel, D-24118 Kiel, Germany; cInstitute of Biochemistry and Molecular Medicine, University of Berne, CH-3012 Berne, Switzerland; dArbeitsgruppe Proteinaseforschung, Max-Planck-Institute für Biochemie, D-82152 Planegg-Martinsried, Germany; and eInstitute of Zoology, Cell and Matrix Biology, Johannes Gutenberg-University, D-55128 Mainz, Germany Edited by Brian W. Matthews, University of Oregon, Eugene, OR, and approved August 22, 2012 (received for review June 29, 2012) Ectodomain shedding at the cell surface is a major mechanism to proteolysis” step within the membrane (1). This is the case for the regulate the extracellular and circulatory concentration or the processing of Notch ligand Delta1 and of APP, both carried out by activities of signaling proteins at the plasma membrane. Human γ-secretase after action of an α/β-secretase (11), and for signal- meprin β is a 145-kDa disulfide-linked homodimeric multidomain peptide peptidase, which removes remnants of the secretory pro- type-I membrane metallopeptidase that sheds membrane-bound tein translocation from the endoplasmic membrane (13). cytokines and growth factors, thereby contributing to inflammatory Recently, human meprin β (Mβ) was found to specifically pro- diseases, angiogenesis, and tumor progression. -
(12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun. -
Protein Family Classification with Neural Networks
Protein Family Classification with Neural Networks Timothy K. Lee Tuan Nguyen Program in Biomedical Informatics Department of Statistics Stanford University Stanford University [email protected] [email protected] Abstract Understanding protein function from amino acid sequence is a fundamental prob- lem in biology. In this project, we explore how well we can represent biological function through examination of raw sequence alone. Using a large corpus of protein sequences and their annotated protein families, we learn dense vector rep- resentations for amino acid sequences using the co-occurrence statistics of short fragments. Then, using this representation, we experiment with several neural net- work architectures to train classifiers for protein family identification. We show good performance for a multi-class prediction problem with 589 protein family classes. 1 Introduction Next-generation sequencing technologies generate large amounts of biological sequence informa- tion in the form of DNA/RNA sequences. From DNA sequences we also know the amino acid sequences of proteins, which are the fundamental molecules that perform most biological functions. The functionality of a protein is thus encoded in the amino acid sequence and understanding the sequence-function relationship is a major challenge in bioinformatics. Investigating protein func- tional often involves structural studies (crystallography) or biochemical studies, which require time consuming efforts. Protein families are defined to group together proteins that share similar function, and the aim of our project is to predict protein family from raw sequence. We focus on training infor- mative vector representations for protein sequences and investigate various neural network models for the task of predicting a protein’s family. -
Superorganisms of the Protist Kingdom: a New Level of Biological Organization
Foundations of Science https://doi.org/10.1007/s10699-020-09688-8 Superorganisms of the Protist Kingdom: A New Level of Biological Organization Łukasz Lamża1 © The Author(s) 2020 Abstract The concept of superorganism has a mixed reputation in biology—for some it is a conveni- ent way of discussing supra-organismal levels of organization, and for others, little more than a poetic metaphor. Here, I show that a considerable step forward in the understand- ing of superorganisms results from a thorough review of the supra-organismal levels of organization now known to exist among the “unicellular” protists. Limiting the discussion to protists has enormous advantages: their bodies are very well studied and relatively sim- ple (as compared to humans or termites, two standard examples in most discussions about superorganisms), and they exhibit an enormous diversity of anatomies and lifestyles. This allows for unprecedented resolution in describing forms of supra-organismal organiza- tion. Here, four criteria are used to diferentiate loose, incidental associations of hosts with their microbiota from “actual” superorganisms: (1) obligatory character, (2) specifc spatial localization of microbiota, (3) presence of attachment structures and (4) signs of co-evolu- tion in phylogenetic analyses. Three groups—that have never before been described in the philosophical literature—merit special attention: Symbiontida (also called Postgaardea), Oxymonadida and Parabasalia. Specifcally, it is argued that in certain cases—for Bihos- pites bacati and Calkinsia aureus (symbiontids), Streblomastix strix (an oxymonad), Joe- nia annectens and Mixotricha paradoxa (parabasalids) and Kentrophoros (a ciliate)—it is fully appropriate to describe the whole protist-microbiota assocation as a single organism (“superorganism”) and its elements as “tissues” or, arguably, even “organs”. -
Table S1. List of Oligonucleotide Primers Used
Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG -
Characterization of a Eukaryotic Type Serine/Threonine Protein Kinase And
Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates Linda Nova´ kova´ 1, Lenka Saskova´ 1, Petra Pallova´ 1, Jirˇı´ Janecˇek1, Jana Novotna´ 1, Alesˇ Ulrych1, Jose Echenique2, Marie-Claude Trombe3 and Pavel Branny1 1 Cell and Molecular Microbiology Division, Institute of Microbiology, Czech Academy of Sciences, Prague, Czech Republic 2 Departamento de Bioquı´mica Clı´nica, Facultad de Ciencias Quı´micas, Universidad Nacional de Co´ rdoba, Medina Allende esq Haya de la Torre, Ciudad Universitaria, Co´ rdoba, Argentina 3 Centre Hospitalo-Universitaire de Rangueil, Universite´ Paul Sabatier, Toulouse, France Keywords Searching the genome sequence of Streptococcus pneumoniae revealed the phosphoglucosamine mutase; presence of a single Ser ⁄ Thr protein kinase gene stkP linked to protein phosphoproteome; protein phosphatase; phosphatase phpP. Biochemical studies performed with recombinant StkP serine ⁄ threonine protein kinase; suggest that this protein is a functional eukaryotic-type Ser ⁄ Thr protein Streptococcus pneumoniae kinase. In vitro kinase assays and Western blots of S. pneumoniae subcellu- Correspondence lar fractions revealed that StkP is a membrane protein. PhpP is a soluble P. Branny, Cell and Molecular Microbiology protein with manganese-dependent phosphatase activity in vitro against a Division, Institute of Microbiology, Czech synthetic substrate RRA(pT)VA. Mutations in the invariant aspartate resi- Academy of Sciences, Vı´denˇ ska´ 1083, dues implicated in the metal binding completely abolished PhpP activity. 142 20 Prague 4, Czech Republic Autophosphorylated form of StkP was shown to be a substrate for PhpP. Fax: +420 2 41722257 These results suggest that StkP and PhpP could operate as a functional Tel: +420 2 41062658 E-mail: [email protected] pair in vivo. -
Gent Forms of Metalloproteinases in Hydra
Cell Research (2002); 12(3-4):163-176 http://www.cell-research.com REVIEW Structure, expression, and developmental function of early diver- gent forms of metalloproteinases in Hydra 1 2 3 4 MICHAEL P SARRAS JR , LI YAN , ALEXEY LEONTOVICH , JIN SONG ZHANG 1 Department of Anatomy and Cell Biology University of Kansas Medical Center Kansas City, Kansas 66160- 7400, USA 2 Centocor, Malvern, PA 19355, USA 3 Department of Experimental Pathology, Mayo Clinic, Rochester, MN 55904, USA 4 Pharmaceutical Chemistry, University of Kansas, Lawrence, KS 66047, USA ABSTRACT Metalloproteinases have a critical role in a broad spectrum of cellular processes ranging from the breakdown of extracellular matrix to the processing of signal transduction-related proteins. These hydro- lytic functions underlie a variety of mechanisms related to developmental processes as well as disease states. Structural analysis of metalloproteinases from both invertebrate and vertebrate species indicates that these enzymes are highly conserved and arose early during metazoan evolution. In this regard, studies from various laboratories have reported that a number of classes of metalloproteinases are found in hydra, a member of Cnidaria, the second oldest of existing animal phyla. These studies demonstrate that the hydra genome contains at least three classes of metalloproteinases to include members of the 1) astacin class, 2) matrix metalloproteinase class, and 3) neprilysin class. Functional studies indicate that these metalloproteinases play diverse and important roles in hydra morphogenesis and cell differentiation as well as specialized functions in adult polyps. This article will review the structure, expression, and function of these metalloproteinases in hydra. Key words: Hydra, metalloproteinases, development, astacin, matrix metalloproteinases, endothelin. -
Novel Lineages of Oxymonad Flagellates from the Termite Porotermes Adamsoni (Stolotermitidae): the Genera Oxynympha and Termitim
Protist, Vol. 170, 125683, December 2019 http://www.elsevier.de/protis Published online date 21 October 2019 ORIGINAL PAPER Novel Lineages of Oxymonad Flagellates from the Termite Porotermes adamsoni (Stolotermitidae): the Genera Oxynympha and Termitimonas a,1 b a c b,1 Renate Radek , Katja Meuser , Samet Altinay , Nathan Lo , and Andreas Brune a Evolutionary Biology, Institute for Biology/Zoology, Freie Universität Berlin, 14195 Berlin, Germany b Research Group Insect Gut Microbiology and Symbiosis, Max Planck Institute for Terrestrial Microbiology, 35043 Marburg, Germany c School of Life and Environmental Sciences, The University of Sydney, Sydney, NSW 2006, Australia Submitted January 21, 2019; Accepted October 9, 2019 Monitoring Editor: Alastair Simpson The symbiotic gut flagellates of lower termites form host-specific consortia composed of Parabasalia and Oxymonadida. The analysis of their coevolution with termites is hampered by a lack of informa- tion, particularly on the flagellates colonizing the basal host lineages. To date, there are no reports on the presence of oxymonads in termites of the family Stolotermitidae. We discovered three novel, deep-branching lineages of oxymonads in a member of this family, the damp-wood termite Porotermes adamsoni. One tiny species (6–10 m), Termitimonas travisi, morphologically resembles members of the genus Monocercomonoides, but its SSU rRNA genes are highly dissimilar to recently published sequences of Polymastigidae from cockroaches and vertebrates. A second small species (9–13 m), Oxynympha loricata, has a slight phylogenetic affinity to members of the Saccinobaculidae, which are found exclusively in wood-feeding cockroaches of the genus Cryptocercus, the closest relatives of termites, but shows a combination of morphological features that is unprecedented in any oxymonad family.