Table 6. Putative Genes Involved in the Utilization of Carbohydrates in G

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Table 6. Putative genes involved in the utilization of carbohydrates in G. thermodenitrificans NG80-2 genome Carbohydrates* Enzymes Gene ID Glycerol Glycerol Kinase GT1216 Glycerol-3-phosphate dehydrogenase, aerobic GT2089 NAD(P)H-dependent glycerol-3-phosphate dehydrogenase GT2153 Enolase GT3003 2,3-bisphosphoglycerate-independentphosphoglycerate mutase GT3004 Triosephosphate isomerase GT3005 3-phosphoglycerate kinase GT3006 Glyceraldehyde-3-phosphate dehydrogenase GT3007 Phosphoglycerate mutase GT1326 Pyruvate kinase GT2663 L-Arabinose L-arabinose isomerase GT1795 L-ribulokinase GT1796 L-ribulose 5-phosphate 4-epimerase GT1797 D-Ribose Ribokinase GT3174 Transketolase GT1187 Ribose 5-phosphate epimerase GT3316 D-Xylose Xylose kinase GT1756 Xylose isomerase GT1757 D-Galactose Galactokinase GT2086 Galactose-1-phosphate uridyltransferase GT2084 UDP-glucose 4-epimerase GT2085 Carbohydrates* Enzymes Gene ID D-Fructose 1-phosphofructokinase GT1727 Fructose-1,6-bisphosphate aldolase GT1805 Fructose-1,6-bisphosphate aldolase type II GT3331 Triosephosphate isomerase GT3005 D-Mannose Mannnose-6 phospate isomelase GT3398 6-phospho-1-fructokinase GT2664 D-Mannitol Mannitol-1-phosphate dehydrogenase GT1844 N-Acetylglucosamine N-acetylglucosamine-6-phosphate deacetylase GT2205 N-acetylglucosamine-6-phosphate isomerase GT2204 D-Maltose Alpha-1,4-glucosidase GT0528, GT1643 Sucrose Sucrose phosphorylase GT3215 D-Trehalose Alpha-glucosidase GT1643 Glucose kinase GT2381 Inositol Myo-inositol catabolism protein iolC;5-dehydro-2- GT1807 deoxygluconokinase Myo-inositol 2-dehydrogenase GT1817 Myo-inositol catabolism protein iolE GT1809 IolD protein GT1810 Putative myo-inositol catabolism proteiniolB GT1808 Fructose-1,6-bisphosphate aldolase GT1805 Methylmalonate-semialdehyde dehydrogenase GT1806 Triosephosphate isomerase GT3005 Carbohydrates* Enzymes Gene ID Methyl-α-D-Glucopyranoside (MDG) Phospho- alpha -glucosidase GT0528, GT1643 Esculin ferric citrate Phospho-beta-glucosidase GT2266, GT3135, GT1747, GT3133 D-Cellobiose Beta -glucosidase GT1202 D-Melibiose Alpha -galactosidase GT2088 D-Melezitose Alpha-glucosidase GT0528, GT1643 Starch Alpha-amylase GT0614 Neopullulanase GT0610 Pullulanase type I GT2731 D-Turanose Phospho- alpha -glucosidase GT0528, GT1643 Putative protease and peptidase genes in G. thermodenitrificans NG80-2 genome Gene ID Gene product Class/family Specificity/comment GT1002 Lipoprotein signal peptidase A8, Signal peptidase (SPase) II GT0849 Acylaminoacyl-peptidase AXE1 GT2272, GT2288 Xaa-Pro aminopeptidase Creatinase_N GT2753 Putative peptidase DLH, Dienelactone hydrolase family GT1240 D-alanyl-D-alanine dipeptidase M15, D-ala-D-ala dipeptidase GT1125 Mitochondrial processing peptidase-like M16, Insulinase GT2899 Thermostable leucine aminopeptidase M17, Cytosol aminopeptidase family, catalytic domain Gene ID Gene product Class/family Specificity/comment GT1659, GT2291, GT2735 Putative peptidase T M20 GT0212, GT0214 Glycoprotein endopeptidase M22, Glycoprotease family Similar to O-sialoglycoprotein endopeptidase GT0127, GT1723, GT2342, Aminopeptidase M24, metallopeptidase family GT2676 GT2033 Aminopeptidase II M29, Thermophilic metalloprotease GT0702, GT0851, GT1704† Oligopeptidase F M3 Cleave medium sized peptides GT1393 Thermostable carboxypeptidase 1 M32, Carboxypeptidase Taq Thermostable carboxypeptidase GT2925 Cell wall endopeptidase, family M23/M37 M37 GT2637, GT2725 Deblocking aminopeptidase M42, glutamyl aminopeptidase GT0025 Signal peptidase II PSP1 GT1154 Renal dipeptidase family protein Renal_dipeptase GT0010, GT2214, GT2242† D-alanyl-D-alanine carboxypeptidase S11,D-alanyl-D-alanine carboxypeptidase GT0587, GT1056, GT1970 Type I signal peptidase S26, Signal peptidase I GT2694 Signal peptide peptidase S49 GT2482, GT2483 Peptidase, U32 family U32 GT1428† Carboxypeptidase VanY, D-alanyl-D-alanine carboxypeptidase GT2380 Endopeptidase I Zn_carbOpept, Zinc carboxypeptidase GT0221, GT2180 CAAX amino terminal protease family protein Abi, CAAX amino terminal protease family GT1299 Intracellular protease DJ-1_PfpI, DJ-1/PfpI family GT0210 Zinc metalloprotease DUF335, Putative metallopeptidase (SprT family) Gene ID Gene product Class/family Specificity/comment GT1141, GT1142 Zinc protease Peptidase_M16_C GT3353 Membrane metalloprotease Peptidase_M50 GT1721 Secreted protease metal-dependent protease Peptidase_M6, Immune inhibitor A peptidase GT3040 Putative protease Peptidase_S41 GT0188, GT1368, GT3101 Putative alkaline serine proteinase Peptidase_S8, Subtilase family GT2447 Spore protease Peptidase_U3, Germination protease GT0036 Sporulation-specific protease YabG Peptidase_U57, YabG peptidase GT0230 Membrane-bound protease, putative Transglut_core, Transglutaminase-like superfamily GT0286, GT2765, GT3410 Serine protease Trypsin GT0678, GT0856, GT1066, ATP-dependent protease ATPase family GT1067 GT2579, GT2580, GT2581 Lon protease S16 *Carbohydrates utilized by NG80-2 as tested by using API 50 CHB/E test strips (BioMérieux, Marcyl étoile, France) (Wang et al., 2006) (1). †Genes having signal peptides but no transmembrane domains. 1. Wang L, Tang Y, Wang S, Liu RL, Liu MZ, Zhang Y, Liang FL, Feng L (2006) Extremophiles 10:347-356..
Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB

    Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB

    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
  • An Atpase Domain Common to Prokaryotic Cell Cycle Proteins

    An Atpase Domain Common to Prokaryotic Cell Cycle Proteins

    Proc. Natl. Acad. Sci. USA Vol. 89, pp. 7290-7294, August 1992 Biochemistry An ATPase domain common to prokaryotic cell cycle proteins, sugar kinases, actin, and hsp7O heat shock proteins (structural comparison/property pattern/remote homology) PEER BORK, CHRIS SANDER, AND ALFONSO VALENCIA European Molecular Biology Laboratory, D-6900 Heidelberg, Federal Republic of Germany Communicated by Russell F. Doolittle, March 6, 1992 ABSTRACT The functionally diverse actin, hexokinase, and hsp7O protein families have in common an ATPase domain of known three-dimensional structure. Optimal superposition ofthe three structures and alignment ofmany sequences in each of the three families has revealed a set of common conserved residues, distributed in five sequence motifs, which are in- volved in ATP binding and in a putative interdomain hinge. From the multiple sequence aliment in these motifs a pattern of amino acid properties required at each position is defined. The discriminatory power of the pattern is in part due to the use of several known three-dimensional structures and many sequences and in part to the "property" method ofgeneralizing from observed amino acid frequencies to amino acid fitness at each sequence position. A sequence data base search with the pattern significantly matches sugar kinases, such as fuco-, glucono-, xylulo-, ribulo-, and glycerokinase, as well as the prokaryotic cell cycle proteins MreB, FtsA, and StbA. These are predicted to have subdomains with the same tertiary structure as the ATPase subdomains Ia and Ha of hexokinase, actin, and Hsc7O, a very similar ATP binding pocket, and the capacity for interdomain hinge motion accompanying func- tional state changes.
  • Comparison of Strand-Specific Transcriptomes Of

    Comparison of Strand-Specific Transcriptomes Of

    Landstorfer et al. BMC Genomics 2014, 15:353 http://www.biomedcentral.com/1471-2164/15/353 RESEARCH ARTICLE Open Access Comparison of strand-specific transcriptomes of enterohemorrhagic Escherichia coli O157:H7 EDL933 (EHEC) under eleven different environmental conditions including radish sprouts and cattle feces Richard Landstorfer1, Svenja Simon2, Steffen Schober3, Daniel Keim2, Siegfried Scherer1 and Klaus Neuhaus1* Abstract Background: Multiple infection sources for enterohemorrhagic Escherichia coli O157:H7 (EHEC) are known, including animal products, fruit and vegetables. The ecology of this pathogen outside its human host is largely unknown and one third of its annotated genes are still hypothetical. To identify genetic determinants expressed under a variety of environmental factors, we applied strand-specific RNA-sequencing, comparing the SOLiD and Illumina systems. Results: Transcriptomes of EHEC were sequenced under 11 different biotic and abiotic conditions: LB medium at pH4, pH7, pH9, or at 15°C; LB with nitrite or trimethoprim-sulfamethoxazole; LB-agar surface, M9 minimal medium, spinach leaf juice, surface of living radish sprouts, and cattle feces. Of 5379 annotated genes in strain EDL933 (genome and plasmid), a surprising minority of only 144 had null sequencing reads under all conditions. We therefore developed a statistical method to distinguish weakly transcribed genes from background transcription. We find that 96% of all genes and 91.5% of the hypothetical genes exhibit a significant transcriptional signal under at least one condition. Comparing SOLiD and Illumina systems, we find a high correlation between both approaches for fold-changes of the induced or repressed genes. The pathogenicity island LEE showed highest transcriptional activity in LB medium, minimal medium, and after treatment with antibiotics.
  • Non-Homologous Isofunctional Enzymes: a Systematic Analysis Of

    Non-Homologous Isofunctional Enzymes: a Systematic Analysis Of

    Omelchenko et al. Biology Direct 2010, 5:31 http://www.biology-direct.com/content/5/1/31 RESEARCH Open Access Non-homologousResearch isofunctional enzymes: A systematic analysis of alternative solutions in enzyme evolution Marina V Omelchenko, Michael Y Galperin*, Yuri I Wolf and Eugene V Koonin Abstract Background: Evolutionarily unrelated proteins that catalyze the same biochemical reactions are often referred to as analogous - as opposed to homologous - enzymes. The existence of numerous alternative, non-homologous enzyme isoforms presents an interesting evolutionary problem; it also complicates genome-based reconstruction of the metabolic pathways in a variety of organisms. In 1998, a systematic search for analogous enzymes resulted in the identification of 105 Enzyme Commission (EC) numbers that included two or more proteins without detectable sequence similarity to each other, including 34 EC nodes where proteins were known (or predicted) to have distinct structural folds, indicating independent evolutionary origins. In the past 12 years, many putative non-homologous isofunctional enzymes were identified in newly sequenced genomes. In addition, efforts in structural genomics resulted in a vastly improved structural coverage of proteomes, providing for definitive assessment of (non)homologous relationships between proteins. Results: We report the results of a comprehensive search for non-homologous isofunctional enzymes (NISE) that yielded 185 EC nodes with two or more experimentally characterized - or predicted - structurally unrelated proteins. Of these NISE sets, only 74 were from the original 1998 list. Structural assignments of the NISE show over-representation of proteins with the TIM barrel fold and the nucleotide-binding Rossmann fold. From the functional perspective, the set of NISE is enriched in hydrolases, particularly carbohydrate hydrolases, and in enzymes involved in defense against oxidative stress.
  • Catalytic Properties and Inhibition of Proline-Specific Dipeptidyl Peptidases II, IV and VII

    Catalytic Properties and Inhibition of Proline-Specific Dipeptidyl Peptidases II, IV and VII

    UC Berkeley UC Berkeley Previously Published Works Title Catalytic properties and inhibition of proline-specific dipeptidyl peptidases II, IV and VII Permalink https://escholarship.org/uc/item/4nf146zf Journal Biochemical Journal, 371 ISSN 0264-6021 Authors Leiting, B Pryor, K D Wu, J K et al. Publication Date 2003-04-01 Peer reviewed eScholarship.org Powered by the California Digital Library University of California Biochem. J. (2003) 371, 525–532 (Printed in Great Britain) 525 Catalytic properties and inhibition of proline-specific dipeptidyl peptidases II, IV and VII Barbara LEITING*1, KellyAnn D. PRYOR*, Joseph K. WU*, Frank MARSILIO*, Reshma A. PATEL*, Charles S. CRAIK†, Jonathan A. ELLMAN‡, Richard T. CUMMINGS* and Nancy A. THORNBERRY* *Department of Metabolic Disorders, Merck Research Laboratories, Mail code RY50G-236, P.O. Box 2000, Rahway, NJ 07065, U.S.A., †Department of Pharmaceutical Chemistry, University of California, 513 Parnassus Avenue, San Francisco, CA 94143-0446, U.S.A., and ‡Department of Chemistry, University of California, Berkeley, CA 94720, U.S.A. There is currently intense interest in the emerging group of strates and inhibitors for these enzymes, a complete biochemical proline-specific dipeptidases, and their roles in the regulation profile of these enzymes was obtained. The pH profiles, substrate of biological processes. Dipeptidyl peptidase IV (DPP-IV) is specificities as determined by positional scanning, Michaelis– involved in glucose metabolism by contributing to the regulation Menten constants and inhibition profiles for DPP-VII and DPP- of glucagon family peptides and has emerged as a potential target II were shown to be virtually identical, strongly supporting the for the treatment of metabolic diseases.
  • Supplementary Materials

    Supplementary Materials

    Supplementary Materials Figure S1. Differentially abundant spots between the mid-log phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 3. Figure S2. Differentially abundant spots between the stationary phase cells grown on xylan or xylose. Red and blue circles denote spots with increased and decreased abundance respectively in the xylan growth condition. The identities of the circled spots are summarized in Table 4. S2 Table S1. Summary of the non-polysaccharide degrading proteins identified in the B. proteoclasticus cytosol by 2DE/MALDI-TOF. Protein Locus Location Score pI kDa Pep. Cov. Amino Acid Biosynthesis Acetylornithine aminotransferase, ArgD Bpr_I1809 C 1.7 × 10−4 5.1 43.9 11 34% Aspartate/tyrosine/aromatic aminotransferase Bpr_I2631 C 3.0 × 10−14 4.7 43.8 15 46% Aspartate-semialdehyde dehydrogenase, Asd Bpr_I1664 C 7.6 × 10−18 5.5 40.1 17 50% Branched-chain amino acid aminotransferase, IlvE Bpr_I1650 C 2.4 × 10−12 5.2 39.2 13 32% Cysteine synthase, CysK Bpr_I1089 C 1.9 × 10−13 5.0 32.3 18 72% Diaminopimelate dehydrogenase Bpr_I0298 C 9.6 × 10−16 5.6 35.8 16 49% Dihydrodipicolinate reductase, DapB Bpr_I2453 C 2.7 × 10−6 4.9 27.0 9 46% Glu/Leu/Phe/Val dehydrogenase Bpr_I2129 C 1.2 × 10−30 5.4 48.6 31 64% Imidazole glycerol phosphate synthase Bpr_I1240 C 8.0 × 10−3 4.7 22.5 8 44% glutamine amidotransferase subunit Ketol-acid reductoisomerase, IlvC Bpr_I1657 C 3.8 × 10−16
  • (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al

    (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al

    US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun.
  • Table S1. List of Oligonucleotide Primers Used

    Table S1. List of Oligonucleotide Primers Used

    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
  • Pyruvate-Phosphate Dikinase of Oxymonads and Parabasalia and the Evolution of Pyrophosphate-Dependent Glycolysis in Anaerobic Eukaryotes† Claudio H

    Pyruvate-Phosphate Dikinase of Oxymonads and Parabasalia and the Evolution of Pyrophosphate-Dependent Glycolysis in Anaerobic Eukaryotes† Claudio H

    EUKARYOTIC CELL, Jan. 2006, p. 148–154 Vol. 5, No. 1 1535-9778/06/$08.00ϩ0 doi:10.1128/EC.5.1.148–154.2006 Copyright © 2006, American Society for Microbiology. All Rights Reserved. Pyruvate-Phosphate Dikinase of Oxymonads and Parabasalia and the Evolution of Pyrophosphate-Dependent Glycolysis in Anaerobic Eukaryotes† Claudio H. Slamovits and Patrick J. Keeling* Canadian Institute for Advanced Research, Botany Department, University of British Columbia, 3529-6270 University Boulevard, Vancouver, British Columbia V6T 1Z4, Canada Received 29 September 2005/Accepted 8 November 2005 In pyrophosphate-dependent glycolysis, the ATP/ADP-dependent enzymes phosphofructokinase (PFK) and pyruvate kinase are replaced by the pyrophosphate-dependent PFK and pyruvate phosphate dikinase (PPDK), respectively. This variant of glycolysis is widespread among bacteria, but it also occurs in a few parasitic anaerobic eukaryotes such as Giardia and Entamoeba spp. We sequenced two genes for PPDK from the amitochondriate oxymonad Streblomastix strix and found evidence for PPDK in Trichomonas vaginalis and other parabasalia, where this enzyme was thought to be absent. The Streblomastix and Giardia genes may be related to one another, but those of Entamoeba and perhaps Trichomonas are distinct and more closely related to bacterial homologues. These findings suggest that pyrophosphate-dependent glycolysis is more widespread in eukaryotes than previously thought, enzymes from the pathway coexists with ATP-dependent more often than previously thought and may be spread by lateral transfer of genes for pyrophosphate-dependent enzymes from bacteria. Adaptation to anaerobic metabolism is a complex process (PPDK), respectively (for a comparison of these reactions, see involving changes to many proteins and pathways of critical reference 21).
  • Characterization of a Eukaryotic Type Serine/Threonine Protein Kinase And

    Characterization of a Eukaryotic Type Serine/Threonine Protein Kinase And

    Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates Linda Nova´ kova´ 1, Lenka Saskova´ 1, Petra Pallova´ 1, Jirˇı´ Janecˇek1, Jana Novotna´ 1, Alesˇ Ulrych1, Jose Echenique2, Marie-Claude Trombe3 and Pavel Branny1 1 Cell and Molecular Microbiology Division, Institute of Microbiology, Czech Academy of Sciences, Prague, Czech Republic 2 Departamento de Bioquı´mica Clı´nica, Facultad de Ciencias Quı´micas, Universidad Nacional de Co´ rdoba, Medina Allende esq Haya de la Torre, Ciudad Universitaria, Co´ rdoba, Argentina 3 Centre Hospitalo-Universitaire de Rangueil, Universite´ Paul Sabatier, Toulouse, France Keywords Searching the genome sequence of Streptococcus pneumoniae revealed the phosphoglucosamine mutase; presence of a single Ser ⁄ Thr protein kinase gene stkP linked to protein phosphoproteome; protein phosphatase; phosphatase phpP. Biochemical studies performed with recombinant StkP serine ⁄ threonine protein kinase; suggest that this protein is a functional eukaryotic-type Ser ⁄ Thr protein Streptococcus pneumoniae kinase. In vitro kinase assays and Western blots of S. pneumoniae subcellu- Correspondence lar fractions revealed that StkP is a membrane protein. PhpP is a soluble P. Branny, Cell and Molecular Microbiology protein with manganese-dependent phosphatase activity in vitro against a Division, Institute of Microbiology, Czech synthetic substrate RRA(pT)VA. Mutations in the invariant aspartate resi- Academy of Sciences, Vı´denˇ ska´ 1083, dues implicated in the metal binding completely abolished PhpP activity. 142 20 Prague 4, Czech Republic Autophosphorylated form of StkP was shown to be a substrate for PhpP. Fax: +420 2 41722257 These results suggest that StkP and PhpP could operate as a functional Tel: +420 2 41062658 E-mail: [email protected] pair in vivo.
  • Genetic Polymorphism of the Angiotensin-Converting Enzyme (ACE) in Asthmatic Patients

    Genetic Polymorphism of the Angiotensin-Converting Enzyme (ACE) in Asthmatic Patients

    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector RESPIRATORY MEDICINE (1998) 92, 1305-1310 Original Articles Genetic polymorphism of the angiotensin-converting enzyme (ACE) in asthmatic patients H. TOMITA, S. SATO, R. MATSUDA, N. OGISU, T. MORI, T. NIIMI AND S. SHIMIZU 2nd Department of Intemal Medicine, Nagoya City University Medical School, Nagoya, Japan Angiotensin-converting enzyme (ACE) inactivates bradykinin, substance P and neurokinin A, which are believed to play important roles in the pathogenesis of asthma, especially in neurogenic inflammation. It has recently been shown that an insertion (1)ldeletion (D) polymorphism in the ACE gene accounts for variation in serum ACE levels. There are thus three genotypes (insertion homozygote, II; deletion homozygote, DD; heterozygotes, DI). The serum ACE level with the DD type is reported to be about double that of the II type and intermediate in the DI case. In the present study, we examined whether asthma is linked with this ACE gene polymorphism. Seventy-one patients with asthma (27 males and 44 females) and 142 sex- and age-matched healthy controls were determined for their genotype by the polymerase chain reaction (PCR) method. Twenty-five asthmatics demonstrated the II type (352%) 37 the DI type (52.1%), and nine the DD type (12.7%). There were no significant differences in the distributions of genotypes and serum ACE levels between healthy controls and patients. No significant differences were evident in serum IgE levels, age at onset, proportion of atopic type patients and severity of asthma among the three genotypes.
  • B Number Gene Name Mrna Intensity Mrna

    B Number Gene Name Mrna Intensity Mrna

    sample) total list predicted B number Gene name assignment mRNA present mRNA intensity Gene description Protein detected - Membrane protein membrane sample detected (total list) Proteins detected - Functional category # of tryptic peptides # of tryptic peptides # of tryptic peptides detected (membrane b0002 thrA 13624 P 39 P 18 P(m) 2 aspartokinase I, homoserine dehydrogenase I Metabolism of small molecules b0003 thrB 6781 P 9 P 3 0 homoserine kinase Metabolism of small molecules b0004 thrC 15039 P 18 P 10 0 threonine synthase Metabolism of small molecules b0008 talB 20561 P 20 P 13 0 transaldolase B Metabolism of small molecules chaperone Hsp70; DNA biosynthesis; autoregulated heat shock b0014 dnaK 13283 P 32 P 23 0 proteins Cell processes b0015 dnaJ 4492 P 13 P 4 P(m) 1 chaperone with DnaK; heat shock protein Cell processes b0029 lytB 1331 P 16 P 2 0 control of stringent response; involved in penicillin tolerance Global functions b0032 carA 9312 P 14 P 8 0 carbamoyl-phosphate synthetase, glutamine (small) subunit Metabolism of small molecules b0033 carB 7656 P 48 P 17 0 carbamoyl-phosphate synthase large subunit Metabolism of small molecules b0048 folA 1588 P 7 P 1 0 dihydrofolate reductase type I; trimethoprim resistance Metabolism of small molecules peptidyl-prolyl cis-trans isomerase (PPIase), involved in maturation of b0053 surA 3825 P 19 P 4 P(m) 1 GenProt outer membrane proteins (1st module) Cell processes b0054 imp 2737 P 42 P 5 P(m) 5 GenProt organic solvent tolerance Cell processes b0071 leuD 4770 P 10 P 9 0 isopropylmalate