DOCSLIB.ORG

6-Phosphofructo-2-Kinase/Fructose-2,6-Bisphosphatase (Dual Promoters/Fructose 2,6-Bisphosphate/Glycolysis/Isozymes/X Chromosome) MARTINE I

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
6-Phosphofructo-2-Kinase/Fructose-2,6-Bisphosphatase (Dual Promoters/Fructose 2,6-Bisphosphate/Glycolysis/Isozymes/X Chromosome) MARTINE I Proc. Natl. Acad. Sci. USA Vol. 86, pp. 6543-6547, September 1989 Biochemistry 5' flanking sequence and structure of a gene encoding rat 6-phosphofructo-2-kinase/fructose-2,6-bisphosphatase (dual promoters/fructose 2,6-bisphosphate/glycolysis/isozymes/X chromosome) MARTINE I. DARVILLE, KARINE M. CREPIN, LouIs HUE, AND GuY G. ROUSSEAU* Hormone and Metabolic Research Unit, International Institute of Cellular and Molecular Pathology, and University of Louvain Medical School, 75 avenue Hippocrate, B-1200 Brussels, Belgium Communicated by Christian de Duve, June 2, 1989 (received for review April 25, 1989) ABSTRACT The synthesis and degradation of fructose An analysis ofthe PFK-2 and FBPase-2 domains in relation 2,6-bisphosphate, a ubiquitous stimulator of glycolysis, are to the polypeptide sequence suggested that they originate catalyzed by 6-phosphofructo-2-kinase (EC 2.7.1.105) and from a gene fusion event (2). This bifunctional enzyme also fructose-2,6-bisphosphatase (EC 3.1.3.46), respectively. In exhibits intriguing similarities with phosphoglycerate mutase liver, these two activities belong to separate domains of the [PGAM; EC 5.4.2.1] and bisphosphoglycerate mutase same 470-residue polypeptide. Various mRNAs have been [BPGAM; EC 5.4.2.4] (8), serine proteases (8), and onco- described for this bifunctional enzyme, which is controlled by genic virus proteins. To gain insight into the origin and hormonal and metabolic signals. To understand the origin and regulation of the PFK-2/FBPase-2 gene(s) and isozymes, we regulation ofthese mRNAs, we have characterized rat genomic have analyzed rat genomic clones identified with our cDNA clones encoding the liver isozyme, which is regulated by probes.t We have characterized a gene that encodes the L cAMP-dependent protein kinase, and the muscle isozyme, and M isozymes by alternative use of different promoters. which is not. We describe here a 55-kilobase gene that encodes This gene is 55 kb long and contains 15 exons, 13 ofwhich are these isozymes by alternative splicing from two promoters. common to the two isozymes. Part of this work has been Each of the putative promoters was sequenced over about 3 presented in the form of an abstract (9). kilobases and found to include nucleotide motifs for binding regulatory factors. The two isozymes share the same 13 exons and differ only by the first exon that, in the liver but not in the MATERIALS AND METHODS muscle isozyme, contains the serine phosphorylated by cAMP- Screening of the Rat Genomic Library. The rat genomic dependent protein kinase. The gene was assigned to the X library, prepared from liver DNA in AEMBL 3 (10), was a gift chromosome. An analysis ofthe exon limits of6-phosphofructo- from W. Schmid and G. Schutz (Krebsforschungzentrum, 2-kinase/fructose-2,6-bisphosphatase in relation to its func- Heidelberg). Approximately 3 x 106 phages were screened by tional domains and to its similarity with other proteins plus its plaque hybridization. Replicas were made on nylon mem- G+C content at the third codon position suggests that this gene branes (Amersham) according to the supplier's instructions. originates from several fusion events. The membranes were prehybridized at 650C in 6x SSC (lx SSC = 0.15 M NaCl/0.015 M sodium citrate, pH 7)/lOX Fructose 2,6-bisphosphate is the most potent allosteric stim- Denhardt's solution (11). Hybridization with multiprime- ulator of 6-phosphofructo-1-kinase (EC 2.7.1.11), a key en- labeled (Amersham) cDNA probes was carried out for 16 hr zyme of glycolysis. The synthesis of fructose 2,6-bisphos- at 650C in 3.5x SSC/lx Denhardt's solution/25 mM sodium phate is catalyzed by 6-phosphofructo-2-kinase (PFK-2; EC phosphate, pH 7/2 mM EDTA/0.5% NaDodSO4/heat- 2.7.1.105) and its degradation is catalyzed by fructose-2,6- denatured salmon sperm DNA (100 jug/ml), using 5 x 105 bisphosphatase (FBPase-2; EC 3.1.3.46). In liver, these two cpm/ml (50 pL/cm2 of membrane). Washing was performed activities belong to separate domains of each subunit (470 at 500C in 0.2x SSC/0.1% NaDodSO4. Phage DNA was amino acids) of the same homodimeric protein. This bifunc- extracted by the plate lysate method (11). tional enzyme integrates a number ofhormonal and metabolic Restriction Mapping and Sequencing ofthe Clones. Mapping signals including cAMP. In fibroblasts, PFK-2 activity is of recombinant phages for the restriction endonucleases stimulated by growth factors, tumor promoters, and tyrosine- BamHI, Bgl II, EcoRI, and HindIII was performed by the specific oncogenic protein kinases (1, 2). Southern Cross Restriction Mapping System following the Biochemical and immunologic data suggest the existence of instructions of NEN. The order of some fragments was distinct PFK-2/FBPase-2 isozymes. Using PFK-2/ deduced from partial digestions. DNA fragments containing FBPase-2 cDNA probes from rat liver (4), we have identified exons were identified by Southern blot analysis (12) under the a 2.1-kilobase (kb) mRNA coding for the liver (L) isozyme, a same hybridization conditions used for the screening of the 1.9-kb mRNA coding for the skeletal muscle (M) isozyme, and library. These fragments were purified on agarose gels (13) a 6.8-kb mRNA presumably coding for the heart isozyme (5). and subcloned, some of them after digestion by another The L and M isozymes have a common sequence of438 amino restriction endonuclease, in the phages M13mp8 and/or -mp9 acids and differ only at the N terminus. In the L isozyme, the (14). The recombinant M13 clones were sequenced by the divergent sequence is 32 residues long and includes the serine dideoxynucleotide chain-termination method (15), using suc- (Ser-32) phosphorylated by cAMP-dependent protein kinase. cessive primers (Eurogentec, Liege, Belgium). Some clones, In the M isozyme, the N terminus is 10 residues long and is unrelated to the unique part of the L isozyme. Expression of Abbreviations: FBPase-2, fructose-2,6-bisphosphatase; PFK-2, 6- the L, but not the M, isozyme of PFK-2/FBPase-2 is con- phosphofructo-2-kinase; PGAM, phosphoglycerate mutase; BPGAM, trolled by diet and insulin (6, 7). bisphosphoglycerate mutase; L, liver; M, muscle. *To whom reprint requests should be addressed at: UCL-ICP, Box 7529, 75 avenue Hippocrate, B-1200 Brussels, Belgium. The publication costs of this article were defrayed in part by page charge tThe sequence reported in this paper has been deposited in the payment. This article must therefore be hereby marked "advertisement" GenBank data base (accession no. M26215, for the 2117-bp fragment in accordance with 18 U.S.C. §1734 solely to indicate this fact. of clone A20, and M26216, for the 3720-bp fragment of clone A20). 6543 Downloaded by guest on September 28, 2021 6544 Biochemistry: Darville et al. Proc. Natl. Acad. Sci. USA 86 (1989) including those containing the 5' end of the gene, were The genomic clones were hybridized with probe 5c2, which sequenced after progressive unidirectional deletions of the corresponds to the first 303 nucleotides of the M-type cDNA insert, generated by exonuclease III (16) according to the RL2K-Sc (5). This showed the occurrence, 4.3 kb upstream instructions of Promega. from exon 1', of another exon that encodes the unique 5' S1 Nuclease Mapping. This procedure was performed as sequence ofthe M-type mRNA (Fig. 1). Therefore, the L- and described (17). Synthetic oligonucleotides (Eurogentec) were M-type mRNAs arise by alternative splicing of either one of 5' labeled with T4 polynucleotide kinase. They were hybrid- the first two exons with the 13 other exons. The four ized to the appropriate recombinant M13 template and ex- cysteines that are essential for the kinase activity of the tended with unlabeled dNTPs and the Klenow fragment of enzyme (8) are contributed by exon 4 (Cys-107), exon 6 DNA polymerase I. The DNA was digested with a restriction (Cys-160), and exon 7 (Cys-183 and -198). The histidine enzyme and the single-stranded probes were isolated on (His-258) that is phosphorylated by fructose 2,6-bisphos- alkaline low-melting-point agarose gels. The probes (5 x 104 phate during the bisphosphatase reaction (8) is encoded by cpm) were hybridized with 50 pug of total rat liver or muscle exon 8. Exon 1' contains the amino acid consensus sequence RNA (5) at 30'C for 16 hr in 20 /ul of 80% (vol/vol) formam- for recognition ofthe L isozyme by cAMP-dependent protein ide/400 mM NaCl/1 mM EDTA/40 mM Pipes-NaOH, pH kinase, and the codon for the phosphorylated serine (Ser-32) 6.4. The S1 nuclease digestion was performed at 30°C for 1 hr results from the splicing of this exon with exon 2 (Table 1). in 300 u1l of S1 buffer (280 mM NaCl/4.5 mM ZnSO4/50 mM In agreement with the literature (19), all the introns have a GT sodium acetate, pH 4.5/20 ,ug of heat-denatured salmon at their 5' end and an AG at their 3' end. The origin of the sperm DNA per ml) containing 100-1000 units of enzyme. mRNA for the heart isozyme, which appears to share ho- The products were analyzed on 5% or 6% acrylamide se- mology with the 5' but not the 3' moiety ofthe L-type mRNA quencing gels, with a M13 sequencing product as marker. (5), remains unknown. Our identification (M.I.D., unpub- Chromosomal Assignment of the Gene. This procedure was lished data) of another rat gene that resembles the one performed by Southern blot analysis of DNA (generous gift described here might help to answer this question.
Load more

Recommended publications
  • A Mutation in DNA Polymerase Α Rescues WEE1KO Sensitivity to HU
    International Journal of Molecular Sciences Article A Mutation in DNA Polymerase α Rescues WEE1KO Sensitivity to HU Thomas Eekhout 1,2 , José Antonio Pedroza-Garcia 1,2 , Pooneh Kalhorzadeh 1,2, Geert De Jaeger 1,2 and Lieven De Veylder 1,2,* 1 Department of Plant Biotechnology and Bioinformatics, Ghent University, 9052 Gent, Belgium; [email protected] (T.E.); [email protected] (J.A.P.-G.); [email protected] (P.K.); [email protected] (G.D.J.) 2 Center for Plant Systems Biology, VIB, 9052 Gent, Belgium * Correspondence: [email protected] Abstract: During DNA replication, the WEE1 kinase is responsible for safeguarding genomic integrity by phosphorylating and thus inhibiting cyclin-dependent kinases (CDKs), which are the driving force of the cell cycle. Consequentially, wee1 mutant plants fail to respond properly to problems arising during DNA replication and are hypersensitive to replication stress. Here, we report the identification of the pola-2 mutant, mutated in the catalytic subunit of DNA polymerase α, as a suppressor mutant of wee1. The mutated protein appears to be less stable, causing a loss of interaction with its subunits and resulting in a prolonged S-phase. Keywords: replication stress; DNA damage; cell cycle checkpoint Citation: Eekhout, T.; Pedroza- 1. Introduction Garcia, J.A.; Kalhorzadeh, P.; De Jaeger, G.; De Veylder, L. A Mutation DNA replication is a highly complex process that ensures the chromosomes are in DNA Polymerase α Rescues correctly replicated to be passed onto the daughter cells during mitosis. Replication starts WEE1KO Sensitivity to HU. Int.
    [Show full text]
  • Table S1. List of Oligonucleotide Primers Used
    Table S1. List of oligonucleotide primers used. Cla4 LF-5' GTAGGATCCGCTCTGTCAAGCCTCCGACC M629Arev CCTCCCTCCATGTACTCcgcGATGACCCAgAGCTCGTTG M629Afwd CAACGAGCTcTGGGTCATCgcgGAGTACATGGAGGGAGG LF-3' GTAGGCCATCTAGGCCGCAATCTCGTCAAGTAAAGTCG RF-5' GTAGGCCTGAGTGGCCCGAGATTGCAACGTGTAACC RF-3' GTAGGATCCCGTACGCTGCGATCGCTTGC Ukc1 LF-5' GCAATATTATGTCTACTTTGAGCG M398Arev CCGCCGGGCAAgAAtTCcgcGAGAAGGTACAGATACGc M398Afwd gCGTATCTGTACCTTCTCgcgGAaTTcTTGCCCGGCGG LF-3' GAGGCCATCTAGGCCATTTACGATGGCAGACAAAGG RF-5' GTGGCCTGAGTGGCCATTGGTTTGGGCGAATGGC RF-3' GCAATATTCGTACGTCAACAGCGCG Nrc2 LF-5' GCAATATTTCGAAAAGGGTCGTTCC M454Grev GCCACCCATGCAGTAcTCgccGCAGAGGTAGAGGTAATC M454Gfwd GATTACCTCTACCTCTGCggcGAgTACTGCATGGGTGGC LF-3' GAGGCCATCTAGGCCGACGAGTGAAGCTTTCGAGCG RF-5' GAGGCCTGAGTGGCCTAAGCATCTTGGCTTCTGC RF-3' GCAATATTCGGTCAACGCTTTTCAGATACC Ipl1 LF-5' GTCAATATTCTACTTTGTGAAGACGCTGC M629Arev GCTCCCCACGACCAGCgAATTCGATagcGAGGAAGACTCGGCCCTCATC M629Afwd GATGAGGGCCGAGTCTTCCTCgctATCGAATTcGCTGGTCGTGGGGAGC LF-3' TGAGGCCATCTAGGCCGGTGCCTTAGATTCCGTATAGC RF-5' CATGGCCTGAGTGGCCGATTCTTCTTCTGTCATCGAC RF-3' GACAATATTGCTGACCTTGTCTACTTGG Ire1 LF-5' GCAATATTAAAGCACAACTCAACGC D1014Arev CCGTAGCCAAGCACCTCGgCCGAtATcGTGAGCGAAG D1014Afwd CTTCGCTCACgATaTCGGcCGAGGTGCTTGGCTACGG LF-3' GAGGCCATCTAGGCCAACTGGGCAAAGGAGATGGA RF-5' GAGGCCTGAGTGGCCGTGCGCCTGTGTATCTCTTTG RF-3' GCAATATTGGCCATCTGAGGGCTGAC Kin28 LF-5' GACAATATTCATCTTTCACCCTTCCAAAG L94Arev TGATGAGTGCTTCTAGATTGGTGTCggcGAAcTCgAGCACCAGGTTG L94Afwd CAACCTGGTGCTcGAgTTCgccGACACCAATCTAGAAGCACTCATCA LF-3' TGAGGCCATCTAGGCCCACAGAGATCCGCTTTAATGC RF-5' CATGGCCTGAGTGGCCAGGGCTAGTACGACCTCG
    [Show full text]
  • Human Glucokinase Gene
    Proc. Nati. Acad. Sci. USA Vol. 89, pp. 7698-7702, August 1992 Genetics Human glucokinase gene: Isolation, characterization, and identification of two missense mutations linked to early-onset non-insulin-dependent (type 2) diabetes mellitus (glucose/metabolism/phosphorylation/structure4unctlon/chromosome 7) M. STOFFEL*, PH. FROGUELt, J. TAKEDA*, H. ZOUALItt, N. VIONNET*, S. NISHI*§, I. T. WEBER¶, R. W. HARRISON¶, S. J. PILKISII, S. LESAGEtt, M. VAXILLAIREtt, G. VELHOtt, F. SUNtt, F. lIRSt, PH. PASSAt, D. COHENt, AND G. I. BELL*"** *Howard Hughes Medical Institute, and Departments of Biochemistry and Molecular Biology, and of Medicine, The University of Chicago, 5841 South Maryland Avenue, MC1028, Chicago, IL 60637; §Second Division of Internal Medicine, Hamamatsu University School of Medicine, Hamamatsu, Shizuoka 431-32, Japan; IDepartment of Pharmacology, Jefferson Cancer Institute, Thomas Jefferson University, Philadelphia, PA 19107; IlDepartment of Physiology and Biophysics, State University of New York, Stony Brook, NY 11794; tCentre d'Etude du Polymorphisme Humain, 27 rue Juliette Dodu, and Service d'Endocrinologie, H6pital Saint-Louis, 75010 Paris, France; and tG6ndthon, 1 rue de l'Internationale, 91000 Evry, France Communicated by Jean Dausset, May 28, 1992 ABSTRACT DNA polymorphisms in the glucokinase gene by maintaining a gradient for glucose transport into these cells have recently been shown to be tightly linked to early-onset thereby regulating hepatic glucose disposal. In (3 cells, glu- non-insulin-dependent diabetes mellitus in "80% of French cokinase is believed to be part of the glucose-sensing mech- families with this form of diabetes. We previously identified a anism and to be involved in the regulation ofinsulin secretion.
    [Show full text]
  • Arthur Kornberg Discovered (The First) DNA Polymerase Four
    Arthur Kornberg discovered (the first) DNA polymerase Using an “in vitro” system for DNA polymerase activity: 1. Grow E. coli 2. Break open cells 3. Prepare soluble extract 4. Fractionate extract to resolve different proteins from each other; repeat; repeat 5. Search for DNA polymerase activity using an biochemical assay: incorporate radioactive building blocks into DNA chains Four requirements of DNA-templated (DNA-dependent) DNA polymerases • single-stranded template • deoxyribonucleotides with 5’ triphosphate (dNTPs) • magnesium ions • annealed primer with 3’ OH Synthesis ONLY occurs in the 5’-3’ direction Fig 4-1 E. coli DNA polymerase I 5’-3’ polymerase activity Primer has a 3’-OH Incoming dNTP has a 5’ triphosphate Pyrophosphate (PP) is lost when dNMP adds to the chain E. coli DNA polymerase I: 3 separable enzyme activities in 3 protein domains 5’-3’ polymerase + 3’-5’ exonuclease = Klenow fragment N C 5’-3’ exonuclease Fig 4-3 E. coli DNA polymerase I 3’-5’ exonuclease Opposite polarity compared to polymerase: polymerase activity must stop to allow 3’-5’ exonuclease activity No dNTP can be re-made in reversed 3’-5’ direction: dNMP released by hydrolysis of phosphodiester backboneFig 4-4 Proof-reading (editing) of misincorporated 3’ dNMP by the 3’-5’ exonuclease Fidelity is accuracy of template-cognate dNTP selection. It depends on the polymerase active site structure and the balance of competing polymerase and exonuclease activities. A mismatch disfavors extension and favors the exonuclease.Fig 4-5 Superimposed structure of the Klenow fragment of DNA pol I with two different DNAs “Fingers” “Thumb” “Palm” red/orange helix: 3’ in red is elongating blue/cyan helix: 3’ in blue is getting edited Fig 4-6 E.
    [Show full text]
  • Taming the Wild Rubisco: Explorations in Functional Metagenomics
    Taming the Wild RubisCO: Explorations in Functional Metagenomics DISSERTATION Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University By Brian Hurin Witte, M.S. Graduate Program in Microbiology The Ohio State University 2012 Dissertation Committee : F. Robert Tabita, Advisor Joseph Krzycki Birgit E. Alber Paul Fuerst Copyright by Brian Hurin Witte 2012 Abstract Ribulose bisphosphate carboxylase/oxygenase (E.C. 4.1.1.39) (RubisCO) is the most abundant protein on Earth and the mechanism by which the vast majority of carbon enters the planet’s biosphere. Despite decades of study, many significant questions about this enzyme remain unanswered. As anthropogenic CO2 levels continue to rise, understanding this key component of the carbon cycle is crucial to forecasting feedback circuits, as well as to engineering food and fuel crops to produce more biomass with few inputs of increasingly scarce resources. This study demonstrates three means of investigating the natural diversity of RubisCO. Chapter 1 builds on existing DNA sequence-based techniques of gene discovery and shows that RubisCO from uncultured organisms can be used to complement growth in a RubisCO-deletion strain of autotrophic bacteria. In a few short steps, the time-consuming work of bringing an autotrophic organism in to pure culture can be circumvented. Chapter 2 details a means of entirely bypassing the bias inherent in sequence-based gene discovery by using selection of RubisCO genes from a metagenomic library. Chapter 3 provides a more in-depth study of the RubisCO from the methanogenic archaeon Methanococcoides burtonii.
    [Show full text]
  • Yeast As a Tool to Understand the Significance of Human Disease
    G C A T T A C G G C A T genes Review Yeast as a Tool to Understand the Significance of Human Disease-Associated Gene Variants Tiziana Cervelli and Alvaro Galli * Yeast Genetics and Genomics Group, Laboratory of Functional Genetics and Genomics, Institute of Clinical Physiology CNR, Via Moruzzi 1, 56125 Pisa, Italy; [email protected] * Correspondence: [email protected] Abstract: At present, the great challenge in human genetics is to provide significance to the growing amount of human disease-associated gene variants identified by next generation DNA sequencing technologies. Increasing evidences suggest that model organisms are of pivotal importance to addressing this issue. Due to its genetic tractability, the yeast Saccharomyces cerevisiae represents a valuable model organism for understanding human genetic variability. In the present review, we show how S. cerevisiae has been used to study variants of genes involved in different diseases and in different pathways, highlighting the versatility of this model organism. Keywords: yeast; Saccharomyces cerevisiae; functional assays; Mendelian disease; cancer; human gene variants 1. Introduction The advent of next generation DNA sequences technologies allows us to identify Citation: Cervelli, T.; Galli, A. Yeast individual genetic variants, and this revolutionized the strategy for discovering the cause as a Tool to Understand the of several genetic and multifactorial diseases. The association between genetic variants Significance of Human and disease risk can potentially overturn our understanding of common disease. The Disease-Associated Gene Variants. discovery of pathways and processes that are causally involved in a disease, so far not Genes 2021, 12, 1303. https:// linked, may open the way towards the development of targeted therapies and prevention doi.org/10.3390/genes12091303 strategies.
    [Show full text]
  • Multiple Elements in the Upstream Glucokinase Promoter Contribute to Transcription in Insulinoma Cells KATHY D
    MOLECULAR AND CELLULAR BIOLOGY, Oct. 1992, p. 4578-4589 Vol. 12, No. 10 0270-7306/92/104578-12$02.00/O Copyright X 1992, American Society for Microbiology Multiple Elements in the Upstream Glucokinase Promoter Contribute to Transcription in Insulinoma Cells KATHY D. SHELTON, ALAN J. FRANKLIN, ANDRAS KHOOR,t JOSEPH BEECHEM, AND MARK A. MAGNUSON* Departments ofMolecular Physiology and Biophysics and ofMedicine, Vanderbilt University Medical School, Nashville, Tennessee 37232 Received 28 February 1992/Returned for modification 31 March 1992/Accepted 23 July 1992 1-cell type-specific expression of the upstream glucokinase promoter was studied by transfection of fusion genes and analysis of DNA-protein interactions. A construct containing 1,000 bp of 5'-flanking DNA was efficiently expressed in HIT M2.2.2 cells, a ,8-cell-derived line that makes both insulin and glucokinase, but not in NIH 3T3 cells, a heterologous cell line. In a series of 5' deletion mutations between bases -1000 and -100 (relative to a base previously designated +1), efficient expression in HIlT cells was maintained until -280 bp, after which transcription decreased in a stepwise manner. The sequences between -280 and -1 bp con- tributing to transcriptional activity in HIT cells were identified by studying 28 block transversion mutants that spanned this region in 10-bp steps. Two mutations reduced transcription 10-fold or more, while six reduced transcription between 3- and 10-fold. Three mutationally sensitive regions of this promoter were found to bind to a factor that was expressed preferentially in pancreatic islet 13 cells. The binding sites, designated upstream promoter elements (UPEs), shared a consensus sequence of CAT(T/C)A(C/G).
    [Show full text]
  • 2 Points Chem 465 Biochemistry II Test 1 Spring 2017 Multiple Choice
    Name: 2 points Chem 465 Biochemistry II Test 1 Spring 2017 Multiple choice (4 points apiece): 1. Which of the following statements about the oxidative decarboxylation of pyruvate in aerobic conditions in animal cells is correct? A) One of the products of the reactions of the pyruvate dehydrogenase complex is a thioester of acetate. B) The methyl (-CH3) group is eliminated as CO2. C) The process occurs in the cytosolic compartment of the cell. D) The pyruvate dehydrogenase complex uses all of the following as cofactors: NAD+, lipoic acid, pyridoxal phosphate (PLP), and FAD. E) The reaction is so important to energy production that pyruvate dehydrogenase operates at full speed under all conditions. 2. In comparison with the resting state, actively contracting human muscle tissue has a: A) higher concentration of ATP. B) higher rate of lactate formation. C) lower consumption of glucose. D) lower rate of consumption of oxygen E) lower ratio of NADH to NAD+. 3.The metabolic function of the pentose phosphate pathway is: A) act as a source of ADP biosynthesis. B) generate NADPH and pentoses for the biosynthesis of fatty acids and nucleic acids. C) participate in oxidation-reduction reactions during the formation of H2O. D) provide intermediates for the citric acid cycle. E) synthesize phosphorus pentoxide. 4. Gluconeogenesis must use "bypass reactions" to circumvent three reactions in the glycolytic pathway that are highly exergonic and essentially irreversible. Reactions carried out by which three of the enzymes listed must be bypassed in the gluconeogenic pathway? 1) Hexokinase 2) Phosphoglycerate kinase 3) Phosphofructokinase-1 4) Pyruvate kinase 5) Triosephosphate isomerase A) 1, 2, 3 B) 1, 2, 4 C) 1, 4, 5 D) 1, 3, 4 E) 2, 3, 4 5.
    [Show full text]
  • Physiological and Proteomic Responses of Diploid and Tetraploid Black Locust (Robinia Pseudoacacia L.) Subjected to Salt Stress
    Int. J. Mol. Sci. 2013, 14, 20299-20325; doi:10.3390/ijms141020299 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Article Physiological and Proteomic Responses of Diploid and Tetraploid Black Locust (Robinia pseudoacacia L.) Subjected to Salt Stress Zhiming Wang 1,†, Mingyue Wang 1,†, Likun Liu2 and Fanjuan Meng 1,* 1 College of Life Science, Northeast Forestry University, Harbin 150040, China; E-Mails: [email protected] (Z.W.); [email protected] (M.W.) 2 Department of Medical Biotechnology, College of Biomedical Science, Kangwon National University, Chuncheon, Gangwon-do 200-701, Korea; E-Mail: [email protected] † These authors contributed equally to this work. * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +86-451-8219-2170; Fax: +86-451-8643-3905. Received: 17 June 2013; in revised form: 31 August 2013 / Accepted: 9 September 2013 / Published: 14 October 2013 Abstract: Tetraploid black locust (Robinia pseudoacacia L.) is adaptable to salt stress. Here, we compared morphological, physiological, ultrastructural, and proteomic traits of leaves in tetraploid black locust and its diploid relatives under salt stress. The results showed that diploid (2×) plants suffered from greater negative effects than those of tetraploid (4×) plants. After salt treatment, plant growth was inhibited, photosynthesis was reduced, reactive oxygen species, malondialdehyde content, and relative electrolyte leakage increased, and defense-related enzyme activities decreased in 2× compared to those in 4×. In addition, salt stress resulted in distorted chloroplasts, swollen thylakoid membranes, accumulation of plastoglobules, and increased starch grains in 2× compared to those in 4×.
    [Show full text]
  • DNA Polymerase I- Dependent Replication (Temperature-Sensitive Dna Mutants/Extragenic Suppression) OSAMI NIWA*, SHARON K
    Proc. Nati Acad. Sci. USA Vol. 78, No. 11, pp. 7024-7027, November 1981 Genetics Alternate pathways of DNA replication: DNA polymerase I- dependent replication (temperature-sensitive dna mutants/extragenic suppression) OSAMI NIWA*, SHARON K. BRYAN, AND ROBB E. MOSES Department ofCell Biology, Baylor College of Medicine, Houston, Texas 77030 Communicated by D. Nathans, July 10, 1981 ABSTRACT We have previously shown that someEscherichia proceed in the presence of a functional DNA polymerase I ac- coli [derivatives of strain HS432 (polAl, polB100, polC1026)] can tivity, despite a ts DNA polymerase III (6). replicate DNA at a restrictive temperature in the presence of a We report here that DNA replication in the parent strain polCts mutation and that such revertants contain apparent DNA becomes temperature-resistant with introduction ofDNA poly- polymerase I activity. We demonstrate here that this strain ofE. merase I activity but is ts in the absence of DNA polymerase colibecomes temperature-resistant upon the introduction ofa nor- I or presence of a ts DNA polymerase I activity. We conclude mal gene for DNA polymerase I or suppression of the polAl non- that this strain contains a sense mutation. Such temperature-resistant phenocopies become mutation (pcbA-) that allows repli- temperature-sensitive upon introduction of a temperature-sensi- cation to be dependent on DNA polymerase I polymerizing tive DNA polymerase I gene. Our results confirm that DNA rep- activity. This locus can be transduced to other E. coli strains and lication is DNA polymerase I-dependent in the temperature-re- again exerts phenotypic suppression of the polCts mutation in sistant revertants, indicating that an alternative pathway of the presence of DNA polymerase I.
    [Show full text]
  • DNA Polymerases at the Eukaryotic Replication Fork Thirty Years After: Connection to Cancer
    cancers Review DNA Polymerases at the Eukaryotic Replication Fork Thirty Years after: Connection to Cancer Youri I. Pavlov 1,2,* , Anna S. Zhuk 3 and Elena I. Stepchenkova 2,4 1 Eppley Institute for Research in Cancer and Allied Diseases and Buffett Cancer Center, University of Nebraska Medical Center, Omaha, NE 68198, USA 2 Department of Genetics and Biotechnology, Saint-Petersburg State University, 199034 Saint Petersburg, Russia; [email protected] 3 International Laboratory of Computer Technologies, ITMO University, 197101 Saint Petersburg, Russia; [email protected] 4 Laboratory of Mutagenesis and Genetic Toxicology, Vavilov Institute of General Genetics, Saint-Petersburg Branch, Russian Academy of Sciences, 199034 Saint Petersburg, Russia * Correspondence: [email protected] Received: 30 September 2020; Accepted: 13 November 2020; Published: 24 November 2020 Simple Summary: The etiology of cancer is linked to the occurrence of mutations during the reduplication of genetic material. Mutations leading to low replication fidelity are the culprits of many hereditary and sporadic cancers. The archetype of the current model of replication fork was proposed 30 years ago. In the sequel to our 2010 review with the words “years after” in the title inspired by A. Dumas’s novels, we go over new developments in the DNA replication field and analyze how they help elucidate the effects of the genetic variants of DNA polymerases on cancer. Abstract: Recent studies on tumor genomes revealed that mutations in genes of replicative DNA polymerases cause a predisposition for cancer by increasing genome instability. The past 10 years have uncovered exciting details about the structure and function of replicative DNA polymerases and the replication fork organization.
    [Show full text]
  • The Second Subunit of DNA Polymerase Delta Is Required for Genomic Stability and Epigenetic Regulation1[OPEN]
    The Second Subunit of DNA Polymerase Delta Is Required for Genomic Stability and Epigenetic Regulation1[OPEN] Jixiang Zhang, Shaojun Xie, Jinkui Cheng, Jinsheng Lai, Jian-Kang Zhu, and Zhizhong Gong* State Key Laboratory of Plant Physiology and Biochemistry, College of Biological Sciences, China Agricultural University, Beijing 100193, China (J.Z., J.C., Z.G.); Shanghai Center for Plant Stress Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200032, China (S.X., J.-K.Z.); Department of Horticulture and Landscape Architecture, Purdue University, West Lafayette, Indiana 47906 (S.X., J.-K.Z.); and State Key Laboratory of Agrobiotechnology, China National Maize Improvement Center, Department of Plant Genetics and Breeding, China Agricultural University, Beijing 100193, China (J.L.) ORCID IDs: 0000-0002-1641-8650 (J.Z.); 0000-0002-6719-9814 (S.X.); 0000-0001-5134-731X (J.-K.Z.). DNA polymerase d plays crucial roles in DNA repair and replication as well as maintaining genomic stability. However, the function of POLD2, the second small subunit of DNA polymerase d, has not been characterized yet in Arabidopsis (Arabidopsis thaliana). During a genetic screen for release of transcriptional gene silencing, we identified a mutation in POLD2. Whole-genome bisulfite sequencing indicated that POLD2 is not involved in the regulation of DNA methylation. POLD2 genetically interacts with Ataxia Telangiectasia-mutated and Rad3-related and DNA polymerase a. The pold2-1 mutant exhibits genomic instability with a high frequency of homologous recombination. It also exhibits hypersensitivity to DNA-damaging reagents and short telomere length. Whole-genome chromatin immunoprecipitation sequencing and RNA sequencing analyses suggest that pold2-1 changes H3K27me3 and H3K4me3 modifications, and these changes are correlated with the gene expression levels.
    [Show full text]