DOCSLIB.ORG

Teratozoospermia in Mice Lacking the Transition Protein 2 (Tnp2)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Teratozoospermia in Mice Lacking the Transition Protein 2 (Tnp2) Molecular Human Reproduction Vol.7, No.6 pp. 513–520, 2001 Teratozoospermia in mice lacking the transition protein 2 (Tnp2) Ibrahim M.Adham1, Karim Nayernia1, Elke Burkhardt-Go¨ttges1,O¨ zlem Topaloglu1, Christa Dixkens1, Adolf F.Holstein2 and Wolfgang Engel1,3 1Institute of Human Genetics, University of Go¨ttingen, D-37073 Go¨ttingen and 2Department of Anatomy, Eppendorf University Hospital, D-20251 Hamburg, Germany 3To whom correspondence should be addressed at: Institute of Human Genetics, University of Go¨ttingen D-37073 Go¨ttingen, Germany. E-mail: [email protected] It is believed that the transition proteins (Tnp1 and Tnp2) participate in the removal of the nucleohistones and in the initial condensation of the spermatid nucleus. Later in spermatogenesis, Tnp1 and Tnp2 are replaced by the protamines 1 and 2. In an effort to elucidate the physiological role of Tnp2, we have disrupted its locus by homologous recombination. Breeding of the Tnp2–/– males on different genetic backgrounds revealed normal fertility on the mixed background C57BL/6J⍥129/Sv, but total infertility on the inbred 129/Sv background. Light and electron microscopy showed that the germ cells were capable of undergoing chromatin condensation, although many spermatozoa exhibited head abnormalities with acrosomes not attached to the nuclear envelope. Furthermore, migration of Tnp2–/– spermatozoa from the uterus into the oviduct was reduced. These results suggest that male infertility of the Tnp2–/– mice is a result of sperm head abnormalities and reduced sperm motility. The increased level of the Tnp1 transcript in testes of the Tnp2-deficient mice raises the possibility that a deficiency created through the disruption of the Tnp2 gene can be compensated for by recruitment of the Tnp1. Key words: acrosome/chromatin condensation/genetic background/teratozoospermia/Tnp2 Introduction maximum concentration. Ultrastructural studies have shown After the meiotic division, the germ cells enter spermio- that chromatin condensation occurs between steps 12 and 14, genesis, the haploid phase of spermatogenesis, where round starting at the anterior portion of the nucleus and then spreading spermatids differentiate into elongated spermatids and ulti- gradually towards the posterior region (Dooher and Bennett, mately spermatozoa. One of the morphological changes that 1973). Thus, the first reactivity of Tnp2 appears at that time accompany spermatid differentiation is the nuclear organization when the chromatin still has a fibrillar and lightly stained of the male germ cell (Fawcett et al., 1971; Dooher and structure at steps 10–11 (Kistler et al., 1996). Bennett, 1973). During this process, various modifications The nucleoprotein genes Tnp2, Prm1 and Prm2 are closely occur in the nature of proteins associated with the DNA and linked in a stretch of DNA, 13-15 kb long, on human the result is the progressive condensation of the chromatin. chromosome 16p13.3 and on mouse chromosome 16 (Schlu¨ter This morphological transformation induces the gradual dis- et al., 1992; Nelson and Krawetz, 1994). In this cluster, a new placement of testis-specific and remaining somatic histones by member of the protamine family (Prm3) has been identified transition proteins 1 and 2 (Tnp1 and Tnp2) which are thought and characterized (Schlu¨ter and Engel, 1995; Schlu¨ter et al., to participate in the initial condensation of the spermatid 1996). Tnp1 is the only gene encoding germ cell-specific nucleus. Shortly thereafter, the transition proteins are replaced nucleoproteins which is localized on a separate chromosome. by the protamines Prm1 and Prm2, which are characteristic The Tnp2 protein, a 117 amino acid long molecule, contains for the mature sperm nucleus (Balhorn et al., 1984). Immuno- a basic domain and two proposed zinc finger motifs at the staining of rat testis with Tnp1, Tnp2 and Prm1 antisera has amino and carboxyl regions, respectively (Baskaran and Rao, shown that the appearance of the Tnp2 in the spermatid nucleus 1991). These two domains may be responsible for the inter- precedes that of Tnp1 and Prm1. Tnp2 is found diffusely action of the Tnp2 with the DNA. The considerable sequence distributed over the anterior tip of the nuclei in step 10 variation in the primary structure of Tnp2 between species spermatids and remains localized over the more anterior portion leads one to believe that Tnp2 is involved in the establishment of the nucleus even in step 13 spermatids where it is at its of species-specific sperm nucleus morphology (Fawcett et al., © European Society of Human Reproduction and Embryology 513 I.M.Adham et al. 1971; Kleene and Flynn, 1987; Luerssen et al., 1989; Reinhardt formed according to standard protocols to discriminate wild-type and et al, 1991; Keime et al., 1992; Alfons and Kistler, 1993). mutant alleles in the DNA from mouse tails. Primer sequences were However, the first appearance of Tnp2 in nuclei of elongated as follows: 1 (Tpn2 sense), 5Ј- AACCAGTGCAATCAGTGCACC; Ј spermatids which have essentially completed the morphological 2(Tpn2 antisense), 5 - ATGGACACAGGAACATCCTGG; 3 (Pgk Ј changes of the nuclear shaping and which are undergoing antisense), 5 - TCTGAGCCCAGAAAGCGAAGG. Thermal cycling was carried out for 35 cycles, denaturation at chromosomal condensation rules out the role of Tnp2 in 94°C for 30 s, annealing at 58°C for 30 min, and extension at 72°C determination of the nuclear morphology (Fawcett et al., 1971; for 1 min. One-fifth of each reaction mixture was electrophoresed on Dooher and Bennett, 1973; Alfons and Kistler, 1993; Oko 2% agarose gels and stained with ethidium bromide. Primer pair 1/2 et al., 1996). amplified a 353 bp fragment in the heterozygous and wild-type To investigate the role of Tnp2 in the differentiation and samples, whereas the primer pair 1/3 amplified a 616 bp fragment function of the male germ cell, we have generated mice with the DNA of both heterozygous and homozygous animals. containing a targeted disruption of the Tnp2 gene. Male infertility was associated with the homozygous mutation on RNA blot hybridization an inbred (129/Sv) genetic background, but fertility was not Total RNA was extracted from tissues using the RNA Now Kit (ITC affected in Tnp2-deficient mice on a mixed (C57 BL/6Jϫ129/ Biotechnologies, Heidelberg, Germany) according to the manufac- Sv) genetic background. To determine the underlying cause turer’s recommendation. The RNA was size fractionated by electro- phoresis on a 1% agarose gel containing formaldehyde, transferred for male infertility, we have examined several parameters of to a nylon membrane, and hybridized with a 32P-labelled cDNA sperm function. The cumulative results presented here showed fragment, under the same conditions as those used for Southern blot that the deficiency of Tnp2 leads to sperm head abnormalities hybridization. which are most probably due to malformations in the attachment of the acrosome to the nuclear involvement. The Extraction of basic nuclear proteins and Western blot acrosomal defects appeared to influence the acrosome reaction Basic nuclear extracts were prepared from mouse testis as described and the ability of the spermatozoa to penetrate the zona (Alfonso and Kistler, 1993). Aliquots (10 µg of protein) of nuclear pellucida of the oocyte. In addition, the migration of the extract fractions were subjected to 20% polyacrylamide gels con- spermatozoa through the female genital tract was found to be taining 0.9 mol/l acidic acid and 6 mol/l urea (Panyim and Chalkley, impaired. 1969) and the gels were blotted onto nitrocellulose filters. Membranes were then incubated with rabbit Tnp2 antiserum or rabbit H.1.1 antiserum as described (Alfonso and Kistler, 1993; Franke et al., 1998). Materials and methods Electron microscopy Generation of the Tnp2-mutant mice Testes and epididymides were fixed with 5% glutaraldehyde in A P2 clone carrying the mouse Tnp2 gene was isolated from 0.2 mol/l phosphate buffer, postfixed with 2% osmium tetroxide, and the C129/ES cell library (Genome Systems, Cambridge, UK) by embedded in epoxy (Epon) resin. Sections at 70 nm were stained polymerase chain reaction (PCR) screening (Schlu¨ter et al., 1996). A with 1% Toluidine Blue/pyronine. 6.3 kb EcoRI fragment and a 3.6 kb EcoRI/XbaI fragment, together containing the closely linked Prm2, Prm3 and Tnp2 genes, were Analysis of fertility subcloned into pBluescript vector (Stratagene, La Jolla, USA) and To assay the fertility of Tnp2–/– males on a mixed (C57BL/6Jϫ126/ mapped with restriction enzymes (Figure 1A). A targeting vector was Sv) and on an inbred (129/Sv) genetic background, sets of 10 Tnp2–/– ϩ ϩ designed for insertion of a neomycin-resistance gene driven by a and Tnp2 / males of each genetic background from the F2 littermates PGK promoter (pgk-neo) into the SstII site of exon1. A herpes were mated, each with two CD1 females for 3 months. Females were simplex virus thymidine kinase gene (tk) cassette was attached to the checked for the presence of vaginal plug and/or pregnancy. Pregnant 3Ј end for negative selection (Figure 1A). Linearized plasmid DNA females were removed to holding cages to allow them to give birth. (30 µg) was electroporated into R ES cells (Joyner, 1993). Colonies We counted the number of litters sired from each group of males in resistant to G418 (400 µg/ml) and gancyclovir (GANC) (2 µmol/l) the 3-month mating period and the size of the litters was determined. were selected. Furthermore, 8 week old CD1 females were superovulated by i.p. Genomic DNA was extracted from ES cells, digested with EcoRI, injections of 5 IU pregnant mare serum gonadotrophin (PMSG) electrophoresed and blotted onto Hybond N membranes (Amersham, (Intergonan 5 IU; Intervet, To¨nisvorst, Germany) followed by 5 IU Braunshweig, Germany). The blots were hybridized with a 32P- human chorionic gonadotrophin (HCG) (Predalon; 5 IU, Organon, ϩ ϩ labelled 1.8 kb XbaI/EcoRI fragment (Figure 1B) at 65°C overnight Oberschleißheim, Germany) 46–48 h later, and mated with Tnp2 / and washed twice at 65°Ctofinal stringency at 0.2ϫstandard saline or Tnp2–/– males of 129/Sv genetic background.
Load more

Recommended publications
  • Supplementary File 2A Revised
    Supplementary file 2A. Differentially expressed genes in aldosteronomas compared to all other samples, ranked according to statistical significance. Missing values were not allowed in aldosteronomas, but to a maximum of five in the other samples. Acc UGCluster Name Symbol log Fold Change P - Value Adj. P-Value B R99527 Hs.8162 Hypothetical protein MGC39372 MGC39372 2,17 6,3E-09 5,1E-05 10,2 AA398335 Hs.10414 Kelch domain containing 8A KLHDC8A 2,26 1,2E-08 5,1E-05 9,56 AA441933 Hs.519075 Leiomodin 1 (smooth muscle) LMOD1 2,33 1,3E-08 5,1E-05 9,54 AA630120 Hs.78781 Vascular endothelial growth factor B VEGFB 1,24 1,1E-07 2,9E-04 7,59 R07846 Data not found 3,71 1,2E-07 2,9E-04 7,49 W92795 Hs.434386 Hypothetical protein LOC201229 LOC201229 1,55 2,0E-07 4,0E-04 7,03 AA454564 Hs.323396 Family with sequence similarity 54, member B FAM54B 1,25 3,0E-07 5,2E-04 6,65 AA775249 Hs.513633 G protein-coupled receptor 56 GPR56 -1,63 4,3E-07 6,4E-04 6,33 AA012822 Hs.713814 Oxysterol bining protein OSBP 1,35 5,3E-07 7,1E-04 6,14 R45592 Hs.655271 Regulating synaptic membrane exocytosis 2 RIMS2 2,51 5,9E-07 7,1E-04 6,04 AA282936 Hs.240 M-phase phosphoprotein 1 MPHOSPH -1,40 8,1E-07 8,9E-04 5,74 N34945 Hs.234898 Acetyl-Coenzyme A carboxylase beta ACACB 0,87 9,7E-07 9,8E-04 5,58 R07322 Hs.464137 Acyl-Coenzyme A oxidase 1, palmitoyl ACOX1 0,82 1,3E-06 1,2E-03 5,35 R77144 Hs.488835 Transmembrane protein 120A TMEM120A 1,55 1,7E-06 1,4E-03 5,07 H68542 Hs.420009 Transcribed locus 1,07 1,7E-06 1,4E-03 5,06 AA410184 Hs.696454 PBX/knotted 1 homeobox 2 PKNOX2 1,78 2,0E-06
    [Show full text]
  • Lineage-Specific Programming Target Genes Defines Potential for Th1 Temporal Induction Pattern of STAT4
    Downloaded from http://www.jimmunol.org/ by guest on October 1, 2021 is online at: average * The Journal of Immunology published online 26 August 2009 from submission to initial decision 4 weeks from acceptance to publication J Immunol http://www.jimmunol.org/content/early/2009/08/26/jimmuno l.0901411 Temporal Induction Pattern of STAT4 Target Genes Defines Potential for Th1 Lineage-Specific Programming Seth R. Good, Vivian T. Thieu, Anubhav N. Mathur, Qing Yu, Gretta L. Stritesky, Norman Yeh, John T. O'Malley, Narayanan B. Perumal and Mark H. Kaplan Submit online. Every submission reviewed by practicing scientists ? is published twice each month by http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://www.jimmunol.org/content/suppl/2009/08/26/jimmunol.090141 1.DC1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* • Why • • Material Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of October 1, 2021. Published August 26, 2009, doi:10.4049/jimmunol.0901411 The Journal of Immunology Temporal Induction Pattern of STAT4 Target Genes Defines Potential for Th1 Lineage-Specific Programming1 Seth R. Good,2* Vivian T. Thieu,2† Anubhav N. Mathur,† Qing Yu,† Gretta L.
    [Show full text]
  • Abnormal Spermatogenesis and Reduced Fertility in Transition Nuclear Protein 1-Deficient Mice
    Abnormal spermatogenesis and reduced fertility in transition nuclear protein 1-deficient mice Y. Eugene Yu*†,Yun Zhang*, Emmanual Unni*‡, Cynthia R. Shirley*, Jian M. Deng§, Lonnie D. Russell¶, Michael M. Weil*, Richard R. Behringer§, and Marvin L. Meistrich*ʈ Departments of *Experimental Radiation Oncology, and §Molecular Genetics, University of Texas M. D. Anderson Cancer Center, Houston, TX 77030-4095; and ¶Department of Physiology, Southern Illinois University, School of Medicine, Carbondale, IL 62901 Edited by Richard D. Palmiter, University of Washington School of Medicine, Seattle, WA, and approved February 22, 2000 (received for review May 3, 1999) Transition nuclear proteins (TPs), the major proteins found in (15), suggesting some functional relationship between the three chromatin of condensing spermatids, are believed to be important proteins exists. Tnp1, however, is on a separate chromosome and for histone displacement and chromatin condensation during is not clearly related to the other three proteins. mammalian spermatogenesis. We generated mice lacking the ma- In vitro, TP1 decreases the melting temperature of DNA (16) jor TP, TP1, by targeted deletion of the Tnp1 gene in mouse and relaxes the DNA in nucleosomal core particles (17), which embryonic stem cells. Surprisingly, testis weights and sperm pro- led to the proposal that TP1 reduces the interaction of DNA duction were normal in the mutant mice, and only subtle abnor- with the nucleosome core. In contrast, TP2 increases the malities were observed in sperm morphology. Electron microscopy melting temperature of DNA and compacts the DNA in revealed large rod-like structures in the chromatin of mutant step nucleosomal cores, suggesting that it is a DNA-condensing 13 spermatids, in contrast to the fine chromatin fibrils observed in protein (18).
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • Epigenetic Mechanisms Are Involved in the Oncogenic Properties of ZNF518B in Colorectal Cancer
    Epigenetic mechanisms are involved in the oncogenic properties of ZNF518B in colorectal cancer Francisco Gimeno-Valiente, Ángela L. Riffo-Campos, Luis Torres, Noelia Tarazona, Valentina Gambardella, Andrés Cervantes, Gerardo López-Rodas, Luis Franco and Josefa Castillo SUPPLEMENTARY METHODS 1. Selection of genomic sequences for ChIP analysis To select the sequences for ChIP analysis in the five putative target genes, namely, PADI3, ZDHHC2, RGS4, EFNA5 and KAT2B, the genomic region corresponding to the gene was downloaded from Ensembl. Then, zoom was applied to see in detail the promoter, enhancers and regulatory sequences. The details for HCT116 cells were then recovered and the target sequences for factor binding examined. Obviously, there are not data for ZNF518B, but special attention was paid to the target sequences of other zinc-finger containing factors. Finally, the regions that may putatively bind ZNF518B were selected and primers defining amplicons spanning such sequences were searched out. Supplementary Figure S3 gives the location of the amplicons used in each gene. 2. Obtaining the raw data and generating the BAM files for in silico analysis of the effects of EHMT2 and EZH2 silencing The data of siEZH2 (SRR6384524), siG9a (SRR6384526) and siNon-target (SRR6384521) in HCT116 cell line, were downloaded from SRA (Bioproject PRJNA422822, https://www.ncbi. nlm.nih.gov/bioproject/), using SRA-tolkit (https://ncbi.github.io/sra-tools/). All data correspond to RNAseq single end. doBasics = TRUE doAll = FALSE $ fastq-dump -I --split-files SRR6384524 Data quality was checked using the software fastqc (https://www.bioinformatics.babraham. ac.uk /projects/fastqc/). The first low quality removing nucleotides were removed using FASTX- Toolkit (http://hannonlab.cshl.edu/fastxtoolkit/).
    [Show full text]
  • Machado Renatoassis M.Pdf
    RENATO ASSIS MACHADO “ASSOCIAÇÃO DOS POLIMORFISMOS NOS GENES HOXD1, TNP1, MSX1, TCOF1, FGFR1, COL2A1, WNT3 E TIMP3 COM FISSURAS DE LÁBIO E/OU PALATO NÃO-SINDRÔMICA EM UMA POPULAÇÃO BRASILEIRA” PIRACICABA 2015 i ii UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE ODONTOLOGIA DE PIRACICABA RENATO ASSIS MACHADO “ASSOCIAÇÃO DOS POLIMORFISMOS NOS GENES HOXD1, TNP1, MSX1, TCOF1, FGFR1, COL2A1, WNT3 E TIMP3 COM FISSURAS DE LÁBIO E/OU PALATO NÃO-SINDRÔMICA EM UMA POPULAÇÃO BRASILEIRA” Dissertação apresentada à Faculdade de Odontologia de Piracicaba da Universidade Estadual de Campinas para a obtenção do título de Mestre em Estomatopatologia, na Área de Patologia. Orientador: Prof. Dr. Ricardo Della Coletta Coorientador: Prof. Dr. Hercilio Martelli Junior Este exemplar corresponde a versão final da dissertação defendida por Renato Assis Machado e orientada pelo Prof. Dr. Ricardo Della Coletta. ____________________________________ Assinatura do orientador PIRACICABA 2015 iii Ficha catalográfica Universidade Estadual de Campinas Biblioteca da Faculdade de Odontologia de Piracicaba Marilene Girello - CRB 8/6159 Machado, Renato Assis, 1989- M18a MacAssociação dos polimorfismos nos genes HOXD1, TNP1, MSX1, TCOF1, FGFR1, COL2A1, WNT3 e TIMP3 com fissuras de lábio e/ou palato não- sindrômica em uma população brasileira / Renato Assis Machado. – Piracicaba, SP : [s.n.], 2015. MacOrientador: Ricardo Della Coletta. MacCoorientador: Hercilio Martelli Junior. MacDissertação (mestrado) – Universidade Estadual de Campinas, Faculdade de Odontologia de Piracicaba.
    [Show full text]
  • Induction of Therapeutic Tissue Tolerance Foxp3 Expression Is
    Downloaded from http://www.jimmunol.org/ by guest on October 2, 2021 is online at: average * The Journal of Immunology , 13 of which you can access for free at: 2012; 189:3947-3956; Prepublished online 17 from submission to initial decision 4 weeks from acceptance to publication September 2012; doi: 10.4049/jimmunol.1200449 http://www.jimmunol.org/content/189/8/3947 Foxp3 Expression Is Required for the Induction of Therapeutic Tissue Tolerance Frederico S. Regateiro, Ye Chen, Adrian R. Kendal, Robert Hilbrands, Elizabeth Adams, Stephen P. Cobbold, Jianbo Ma, Kristian G. Andersen, Alexander G. Betz, Mindy Zhang, Shruti Madhiwalla, Bruce Roberts, Herman Waldmann, Kathleen F. Nolan and Duncan Howie J Immunol cites 35 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription http://www.jimmunol.org/content/suppl/2012/09/17/jimmunol.120044 9.DC1 This article http://www.jimmunol.org/content/189/8/3947.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of October 2, 2021.
    [Show full text]
  • Lineage-Specific Effector Signatures of Invariant NKT Cells Are Shared Amongst Δγ T, Innate Lymphoid, and Th Cells
    Downloaded from http://www.jimmunol.org/ by guest on September 26, 2021 δγ is online at: average * The Journal of Immunology , 10 of which you can access for free at: 2016; 197:1460-1470; Prepublished online 6 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600643 http://www.jimmunol.org/content/197/4/1460 Lineage-Specific Effector Signatures of Invariant NKT Cells Are Shared amongst T, Innate Lymphoid, and Th Cells You Jeong Lee, Gabriel J. Starrett, Seungeun Thera Lee, Rendong Yang, Christine M. Henzler, Stephen C. Jameson and Kristin A. Hogquist J Immunol cites 41 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription http://www.jimmunol.org/content/suppl/2016/07/06/jimmunol.160064 3.DCSupplemental This article http://www.jimmunol.org/content/197/4/1460.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 26, 2021. The Journal of Immunology Lineage-Specific Effector Signatures of Invariant NKT Cells Are Shared amongst gd T, Innate Lymphoid, and Th Cells You Jeong Lee,* Gabriel J.
    [Show full text]
  • A Meta-Analysis of the Effects of High-LET Ionizing Radiations in Human Gene Expression
    Supplementary Materials A Meta-Analysis of the Effects of High-LET Ionizing Radiations in Human Gene Expression Table S1. Statistically significant DEGs (Adj. p-value < 0.01) derived from meta-analysis for samples irradiated with high doses of HZE particles, collected 6-24 h post-IR not common with any other meta- analysis group. This meta-analysis group consists of 3 DEG lists obtained from DGEA, using a total of 11 control and 11 irradiated samples [Data Series: E-MTAB-5761 and E-MTAB-5754]. Ensembl ID Gene Symbol Gene Description Up-Regulated Genes ↑ (2425) ENSG00000000938 FGR FGR proto-oncogene, Src family tyrosine kinase ENSG00000001036 FUCA2 alpha-L-fucosidase 2 ENSG00000001084 GCLC glutamate-cysteine ligase catalytic subunit ENSG00000001631 KRIT1 KRIT1 ankyrin repeat containing ENSG00000002079 MYH16 myosin heavy chain 16 pseudogene ENSG00000002587 HS3ST1 heparan sulfate-glucosamine 3-sulfotransferase 1 ENSG00000003056 M6PR mannose-6-phosphate receptor, cation dependent ENSG00000004059 ARF5 ADP ribosylation factor 5 ENSG00000004777 ARHGAP33 Rho GTPase activating protein 33 ENSG00000004799 PDK4 pyruvate dehydrogenase kinase 4 ENSG00000004848 ARX aristaless related homeobox ENSG00000005022 SLC25A5 solute carrier family 25 member 5 ENSG00000005108 THSD7A thrombospondin type 1 domain containing 7A ENSG00000005194 CIAPIN1 cytokine induced apoptosis inhibitor 1 ENSG00000005381 MPO myeloperoxidase ENSG00000005486 RHBDD2 rhomboid domain containing 2 ENSG00000005884 ITGA3 integrin subunit alpha 3 ENSG00000006016 CRLF1 cytokine receptor like
    [Show full text]
  • Gene Networks Constructed Through Simulated Treatment Learning Can Predict Proteasome Inhibitor Benefit in Multiple Myeloma
    Published OnlineFirst September 10, 2020; DOI: 10.1158/1078-0432.CCR-20-0742 CLINICAL CANCER RESEARCH | PRECISION MEDICINE AND IMAGING Gene Networks Constructed Through Simulated Treatment Learning can Predict Proteasome Inhibitor Benefit in Multiple Myeloma A C Joske Ubels1,2,3,4, Pieter Sonneveld3, Martin H. van Vliet4, and Jeroen de Ridder1,2 ABSTRACT ◥ Purpose: Proteasome inhibitors are widely used in treating we found an HR of 0.47 (P ¼ 0.04) in favor of bortezomib, while in multiple myeloma, but can cause serious side effects and response class “no benefit,” the HR was 0.91 (P ¼ 0.68). Importantly, we varies among patients. It is, therefore, important to gain more observed a similar performance (HR class benefit, 0.46; P ¼ 0.04) in insight into which patients will benefit from proteasome inhibitors. an independent patient cohort. Moreover, this signature also pre- Experimental Design: We introduce simulated treatment dicts benefit for the proteasome inhibitor, carfilzomib, indicating it learned signatures (STLsig), a machine learning method to identify is not specific to bortezomib. No equivalent signature can be found predictive gene expression signatures. STLsig uses genetically sim- when the genes in the signature are excluded from the analysis, ilar patients who have received an alternative treatment to model indicating that they are essential. Multiple genes in the signature are which patients will benefit more from proteasome inhibitors than linked to working mechanisms of proteasome inhibitors or multiple from an alternative treatment. STLsig constructs gene networks by myeloma disease progression. linking genes that are synergistic in their ability to predict benefit. Conclusions: STLsig can identify gene signatures that could aid Results: In a dataset of 910 patients with multiple myeloma, in treatment decisions for patients with multiple myeloma and STLsig identified two gene networks that together can predict provide insight into the biological mechanism behind treatment benefit to the proteasome inhibitor, bortezomib.
    [Show full text]
  • Targeted Deep Sequencing in Multiple-Affected Sibships of European Ancestry Identifies
    Page 1 of 47 Diabetes Targeted Deep Sequencing in Multiple-Affected Sibships of European Ancestry Identifies Rare Deleterious Variants in PTPN22 that Confer Risk for Type 1 Diabetes Short title: Rare PTPN22 Variants Contributing to T1D Yan Ge,1 Suna Onengut-Gumuscu,2,3 Aaron R. Quinlan,4,5 Aaron J. Mackey,2,3 Jocyndra A. Wright,1 Jane H. Buckner,6 Tania Habib,6 Stephen S. Rich,2,3 Patrick Concannon1,7 1Department of Pathology, Immunology, and Laboratory Medicine, University of Florida, Gainesville, FL 2Center for Public Health Genomics, University of Virginia, Charlottesville, VA 3Department of Public Health Sciences, University of Virginia, Charlottesville, VA 4Department of Human Genetics, University of Utah, Salt Lake City, UT 5Department of Biomedical Informatics, University of Utah, Salt Lake City, UT 6Translational Research Program, Benaroya Research Institute at Virginia Mason, Seattle, WA 7Genetics Institute, University of Florida, Gainesville, FL Corresponding author: Name: Patrick Concannon Address: University of Florida Genetics Institute, 2033 Mowry Road, CGRC Room 115, Box 103610, Gainesville, FL 32610 Tel: (352) 294-5735 Fax: (352) 273-8284 1 Diabetes Publish Ahead of Print, published online December 2, 2015 Diabetes Page 2 of 47 Email: [email protected] Word count: 3,932 2 tables, 4 figures, 3 supplementary tables, and 2 supplementary figures 2 Page 3 of 47 Diabetes ABSTRACT Despite the finding of over 40 risk loci for type 1 diabetes (T1D), the causative variants and genes remain largely unknown. Here, we sought to identify rare deleterious variants of moderate- to-large effects contributing to T1D. We deeply sequenced 301 protein-coding genes located in 49 previously reported T1D risk loci in 70 T1D cases of European ancestry.
    [Show full text]
  • Functional Analysis of Insl5 and Insl6 Genes and Verification of Interactions Between Pelota and Its Putative Interacting Proteins
    Functional Analysis of Insl5 and Insl6 Genes and Verification of Interactions between Pelota and its Putative Interacting Proteins Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultäten der Georg-August-Universität zu Göttingen vorgelegt von Ozanna Burnicka-Turek aus Bydgoszcz, Polen Göttingen, 2009 D7 Referent: Prof. Dr. W. Engel Korreferentin: Prof. Dr. S. Hoyer-Fender Tag der mündlichen Prüfung: To my husband, family and friends for their support, encouragement and love. The more you know, the harder it is to take decisive action. Once you become informed, you start seeing complexities and shades of gray. You realize that nothing is as clear and simple as it first appears. Ultimately, knowledge is paralyzing. Bill Watterson (1958 - ), Calvin & Hobbes (THERE'S TREASURE EVERYWHERE) CONTENTS TABLE OF CONTENTS page CONTENTS...............................................................................................................................I ABBREVIATIONS ............................................................................................................. VIII 1. INTRODUCTION................................................................................................................ 1 1.1. Expression and function of insulin-like genes .................................................................... 1 1.2. The pelota gene .................................................................................................................. 4 1.3. Objectives of this study......................................................................................................
    [Show full text]