Molecular Human Reproduction Vol.7, No.6 pp. 513–520, 2001

Teratozoospermia in mice lacking the transition 2 (Tnp2)

Ibrahim M.Adham1, Karim Nayernia1, Elke Burkhardt-Go¨ttges1,O¨ zlem Topaloglu1, Christa Dixkens1, Adolf F.Holstein2 and Wolfgang Engel1,3

1Institute of Human Genetics, University of Go¨ttingen, D-37073 Go¨ttingen and 2Department of Anatomy, Eppendorf University Hospital, D-20251 Hamburg, Germany 3To whom correspondence should be addressed at: Institute of Human Genetics, University of Go¨ttingen D-37073 Go¨ttingen, Germany. E-mail: [email protected]

It is believed that the transition (Tnp1 and Tnp2) participate in the removal of the nucleohistones and in the initial condensation of the spermatid nucleus. Later in spermatogenesis, Tnp1 and Tnp2 are replaced by the protamines 1 and 2. In an effort to elucidate the physiological role of Tnp2, we have disrupted its locus by homologous recombination. Breeding of the Tnp2–/– males on different genetic backgrounds revealed normal fertility on the mixed background C57BL/6J⍥129/Sv, but total infertility on the inbred 129/Sv background. Light and electron microscopy showed that the germ cells were capable of undergoing condensation, although many spermatozoa exhibited head abnormalities with acrosomes not attached to the . Furthermore, migration of Tnp2–/– spermatozoa from the uterus into the oviduct was reduced. These results suggest that male infertility of the Tnp2–/– mice is a result of sperm head abnormalities and reduced sperm motility. The increased level of the Tnp1 transcript in testes of the Tnp2-deficient mice raises the possibility that a deficiency created through the disruption of the Tnp2 can be compensated for by recruitment of the Tnp1.

Key words: acrosome/chromatin condensation/genetic background/teratozoospermia/Tnp2

Introduction maximum concentration. Ultrastructural studies have shown After the meiotic division, the germ cells enter spermio- that chromatin condensation occurs between steps 12 and 14, genesis, the haploid phase of spermatogenesis, where round starting at the anterior portion of the nucleus and then spreading spermatids differentiate into elongated spermatids and ulti- gradually towards the posterior region (Dooher and Bennett, mately spermatozoa. One of the morphological changes that 1973). Thus, the first reactivity of Tnp2 appears at that time accompany spermatid differentiation is the nuclear organization when the chromatin still has a fibrillar and lightly stained of the male germ cell (Fawcett et al., 1971; Dooher and structure at steps 10–11 (Kistler et al., 1996). Bennett, 1973). During this process, various modifications The nucleoprotein Tnp2, Prm1 and Prm2 are closely occur in the nature of proteins associated with the DNA and linked in a stretch of DNA, 13-15 kb long, on human the result is the progressive condensation of the chromatin. 16p13.3 and on mouse (Schlu¨ter This morphological transformation induces the gradual dis- et al., 1992; Nelson and Krawetz, 1994). In this cluster, a new placement of testis-specific and remaining somatic histones by member of the protamine family (Prm3) has been identified transition proteins 1 and 2 (Tnp1 and Tnp2) which are thought and characterized (Schlu¨ter and Engel, 1995; Schlu¨ter et al., to participate in the initial condensation of the spermatid 1996). Tnp1 is the only gene encoding germ cell-specific nucleus. Shortly thereafter, the transition proteins are replaced nucleoproteins which is localized on a separate chromosome. by the protamines Prm1 and Prm2, which are characteristic The Tnp2 protein, a 117 amino acid long molecule, contains for the mature sperm nucleus (Balhorn et al., 1984). Immuno- a basic domain and two proposed zinc finger motifs at the staining of rat testis with Tnp1, Tnp2 and Prm1 antisera has amino and carboxyl regions, respectively (Baskaran and Rao, shown that the appearance of the Tnp2 in the spermatid nucleus 1991). These two domains may be responsible for the inter- precedes that of Tnp1 and Prm1. Tnp2 is found diffusely action of the Tnp2 with the DNA. The considerable sequence distributed over the anterior tip of the nuclei in step 10 variation in the primary structure of Tnp2 between species spermatids and remains localized over the more anterior portion leads one to believe that Tnp2 is involved in the establishment of the nucleus even in step 13 spermatids where it is at its of species-specific sperm nucleus morphology (Fawcett et al.,

© European Society of Human Reproduction and Embryology 513 I.M.Adham et al.

1971; Kleene and Flynn, 1987; Luerssen et al., 1989; Reinhardt formed according to standard protocols to discriminate wild-type and et al, 1991; Keime et al., 1992; Alfons and Kistler, 1993). mutant alleles in the DNA from mouse tails. Primer sequences were However, the first appearance of Tnp2 in nuclei of elongated as follows: 1 (Tpn2 sense), 5Ј- AACCAGTGCAATCAGTGCACC; Ј spermatids which have essentially completed the morphological 2(Tpn2 antisense), 5 - ATGGACACAGGAACATCCTGG; 3 (Pgk Ј changes of the nuclear shaping and which are undergoing antisense), 5 - TCTGAGCCCAGAAAGCGAAGG. Thermal cycling was carried out for 35 cycles, denaturation at chromosomal condensation rules out the role of Tnp2 in 94°C for 30 s, annealing at 58°C for 30 min, and extension at 72°C determination of the nuclear morphology (Fawcett et al., 1971; for 1 min. One-fifth of each reaction mixture was electrophoresed on Dooher and Bennett, 1973; Alfons and Kistler, 1993; Oko 2% agarose gels and stained with ethidium bromide. Primer pair 1/2 et al., 1996). amplified a 353 bp fragment in the heterozygous and wild-type To investigate the role of Tnp2 in the differentiation and samples, whereas the primer pair 1/3 amplified a 616 bp fragment function of the male germ cell, we have generated mice with the DNA of both heterozygous and homozygous animals. containing a targeted disruption of the Tnp2 gene. Male infertility was associated with the homozygous mutation on RNA blot hybridization an inbred (129/Sv) genetic background, but fertility was not Total RNA was extracted from tissues using the RNA Now Kit (ITC affected in Tnp2-deficient mice on a mixed (C57 BL/6Jϫ129/ Biotechnologies, Heidelberg, Germany) according to the manufac- Sv) genetic background. To determine the underlying cause turer’s recommendation. The RNA was size fractionated by electro- phoresis on a 1% agarose gel containing formaldehyde, transferred for male infertility, we have examined several parameters of to a nylon membrane, and hybridized with a 32P-labelled cDNA sperm function. The cumulative results presented here showed fragment, under the same conditions as those used for Southern blot that the deficiency of Tnp2 leads to sperm head abnormalities hybridization. which are most probably due to malformations in the attachment of the acrosome to the nuclear involvement. The Extraction of basic nuclear proteins and Western blot acrosomal defects appeared to influence the acrosome reaction Basic nuclear extracts were prepared from mouse testis as described and the ability of the spermatozoa to penetrate the zona (Alfonso and Kistler, 1993). Aliquots (10 µg of protein) of nuclear pellucida of the oocyte. In addition, the migration of the extract fractions were subjected to 20% polyacrylamide gels con- spermatozoa through the female genital tract was found to be taining 0.9 mol/l acidic acid and 6 mol/l urea (Panyim and Chalkley, impaired. 1969) and the gels were blotted onto nitrocellulose filters. Membranes were then incubated with rabbit Tnp2 antiserum or rabbit H.1.1 antiserum as described (Alfonso and Kistler, 1993; Franke et al., 1998).

Materials and methods Electron microscopy Generation of the Tnp2-mutant mice Testes and epididymides were fixed with 5% glutaraldehyde in A P2 clone carrying the mouse Tnp2 gene was isolated from 0.2 mol/l phosphate buffer, postfixed with 2% osmium tetroxide, and the C129/ES cell library (Genome Systems, Cambridge, UK) by embedded in epoxy (Epon) resin. Sections at 70 nm were stained polymerase chain reaction (PCR) screening (Schlu¨ter et al., 1996). A with 1% Toluidine Blue/pyronine. 6.3 kb EcoRI fragment and a 3.6 kb EcoRI/XbaI fragment, together containing the closely linked Prm2, Prm3 and Tnp2 genes, were Analysis of fertility subcloned into pBluescript vector (Stratagene, La Jolla, USA) and To assay the fertility of Tnp2–/– males on a mixed (C57BL/6Jϫ126/ mapped with restriction enzymes (Figure 1A). A targeting vector was Sv) and on an inbred (129/Sv) genetic background, sets of 10 Tnp2–/– ϩ ϩ designed for insertion of a neomycin-resistance gene driven by a and Tnp2 / males of each genetic background from the F2 littermates PGK promoter (pgk-neo) into the SstII site of exon1. A herpes were mated, each with two CD1 females for 3 months. Females were simplex virus thymidine kinase gene (tk) cassette was attached to the checked for the presence of vaginal plug and/or pregnancy. Pregnant 3Ј end for negative selection (Figure 1A). Linearized plasmid DNA females were removed to holding cages to allow them to give birth. (30 µg) was electroporated into R ES cells (Joyner, 1993). Colonies We counted the number of litters sired from each group of males in resistant to G418 (400 µg/ml) and gancyclovir (GANC) (2 µmol/l) the 3-month mating period and the size of the litters was determined. were selected. Furthermore, 8 week old CD1 females were superovulated by i.p. Genomic DNA was extracted from ES cells, digested with EcoRI, injections of 5 IU pregnant mare serum gonadotrophin (PMSG) electrophoresed and blotted onto Hybond N membranes (Amersham, (Intergonan 5 IU; Intervet, To¨nisvorst, Germany) followed by 5 IU Braunshweig, Germany). The blots were hybridized with a 32P- human chorionic gonadotrophin (HCG) (Predalon; 5 IU, Organon, ϩ ϩ labelled 1.8 kb XbaI/EcoRI fragment (Figure 1B) at 65°C overnight Oberschleißheim, Germany) 46–48 h later, and mated with Tnp2 / and washed twice at 65°Ctofinal stringency at 0.2ϫstandard saline or Tnp2–/– males of 129/Sv genetic background. Oocytes from females citrate/0.1% sodium dodecyl sulphate (SDS). To confirm a correct with a vaginal plug were isolated. The oviducts were dissected out homologous recombination event of the targeted Tnp2 gene and the and flushed in M2 medium (Sigma). The oocytes were treated with absence of additional random integration of the targeting construct, M2 containing hyaluronidase (300 ng/ml) to remove the cumulus, a neomycin fragment was used to rehybridize the Southern blots. washed in M2 and then maintained in M16 (Sigma, Taufkirchen, Among the G418 and GANC resistance colonies, four independent Germany) for 2–8 h for assessment of the presence of male and ES clones were selected and then injected into C57BL/6J blastocysts female pronuclei. The oocytes were then cultured for a further 48 h to produce chimeric animals (Joyner, 1993). One line yielded germ- in M16 covered with mineral oil to check for progressive development. line transmitting chimeras. The chimeric male was mated to C57BL/ 6J and 129/Sv females, respectively, and F1 offspring were genotyped Sperm analysis by PCR analyses. Heterozygous animals were crossed to obtain Epididymides were collected from 3 month old Tnp2ϩ/ϩ and Tnp2–/– homozygous mice, which were genotyped by PCR. PCR was per- males of 129/Sv genetic background and dissected in Tyrode’s 514 Teratozoospermia in Tnp2-deficient mice

Figure 1. Targeted disruption of the Tnp2 gene. (A) Restriction map of the genomic fragment containing the closely linked Prm2, Prm3, Tnp2 and Socs-1 genes, the targeted vector and the predicted restriction map after the homologous recombination. The probe used and the predicted length of restriction fragments in the Southern blot analysis are shown. Primers 1, 2 and 3 used to amplify the wild-type and mutant alleles by polymerase chain reaction are indicated. A pgk-neo cassette was inserted in exon 1 of the Tnp2 gene. TK, Thymidine kinase cassette, E, EcoRI; S, SstII; S*, disturbed SstII; X, XbaI. (B) Southern blot analysis of the transfected ES clones. Genomic DNA extracted from ES clones was digested with EcoRI and probed with the 3Ј probe indicated in (A). The wild-type Tnp2 allele generates a 5.4 kb EcoRI fragment, whereas the targeted allele yieldsa7kbEcoRI fragment, as indicated in (A) and (B). (C) Testicular RNA of the three genotypes was analysed using the Tnp2 cDNA and the neomycin gene as probes. (D) Western blot analysis of basic nuclear proteins from wild-type (ϩ/ϩ), heterozygous (ϩ/-) and knockout (–/–) mice were incubated with an anti-Tnp2 and anti-histone H1.1 antiserum. The immunoreactive Tnp2 protein was detectable in wild-type and heterozygous, but not in knockout, mouse samples. medium. Sperm number and motility were determined by light hyaluronidase. To remove the zona pellucida, oocytes were treated microscopy. To examine sperm transport in the female reproductive with acidic Tyrode and washed three times with phosphate-buffered tract, males were mated with mature CD1 females. Six hours after saline as described (Hogan et al., 1986). Spermatozoa were isolated mating, uteri and oviducts from females with a vaginal plug were from the vas deferens and the cauda epididymis of each male group flushed with M2 medium, and sperm numbers were counted. To and capacitated in Tyrode’s medium at 37°C for 1.5 h. Spermatozoa determine the replacement of the somatic histones by protamines (105–106) were added to the oocytes in 400 µl drops of fertilization in the sperm nucleus, spermatozoa were recovered from cauda medium and incubated for 6 h at 37°Cin5%CO2. Using a large epididymidis, centrifuged at 250 g for 5 min, fixed in 3:1 (vol:vol) bore micropipette, oocytes were washed in M16 and the oocytes were methanol:acetic acid and stained with Aniline Blue (Dadoune et al., then cultured in M16 as described. 1988). At least 200 spermatozoa from each male were assayed for staining. To examine the acrosome reaction, epididymal spermatozoa were capacitated for 15 h in Tyrode’s medium and then incubated Results for 5 min at 37°Cin5%CO2 in Tyrode’s medium plus the calcium ionophore A23187 (20 µmol/l; Sigma). To determine the percentage Targeted disruption of the Tnp2 gene in mice of spermatozoa that had undergone acrosome reaction, spermatozoa Two genomic fragments, 6.3 and 3.5 kb, containing the closely were fixed and stained with Coomassie Brilliant Blue R250 as linked Prm2, Prm3 and Tnp2 genes, were used to construct previously described (Thaler and Cardullo, 1995). At least 200 the Tnp2 targeting vector. A replacement-targeting vector was spermatozoa from each male were examined for the presence or designed for insertion of the Pgk-neo cassette into exon 1 absence of the characteristic dark blue acrosomal crescent. upstream of the sequence coding for the arginine- and lysine- IVF assays rich domain of the Tnp2. The Herpes simplex virus thymidine ϩ ϩ Ј Sexually mature Tnp2 / and Tnp2–/– males of 129/Sv genetic kinase (tk) gene, at the 3 -end of the construct, enabled us to background were used for the experiments. Female CD1 mice use positive and negative selection (Figure 1A) (Mansour were superovulated. Oocytes were collected 10–12 h after HCG et al., 1988). R1 ES cells (Joyner, 1993) were transfected with administration and cumulus cells were removed by treatment with the targeting vector and selected for homologous recombination 515 I.M.Adham et al. events. Drug resistance clones were selected and DNA was isolated and screened by Southern blot analysis using an external probe. A probe upstream of the targeting construct detected a 5.4 kb EcoRI wild-type fragment and a 7 kb EcoRI recombinant fragment (Figure 1A, B). One of four Tnp2ϩ/– ES clones injected into C57BL/6J blastocystes gave rise to chimeric mice that transmitted the Tnp2 mutation into germ- line. Chimeric mice were intercrossed to C57BL/6J and 129/ Sv females, respectively, to establish the Tnp2-disrupted allele on a C57BL/6Jϫ129/Sv hybrid and on a 129/Sv inbred genetic background. In both backgrounds, male and female mice heterozygous for the Tnp2 mutation appeared normal and fertile. Heterozygous animals were mated, and ~25% (56 of 218) of the offspring were homozygous for the mutant allele.

Increased level of Tnp1 expression in Tnp2–/– testis To confirm that the engineered disruption of Tnp2 by insertion of the Pgk-neo cassette had generated a null mutation, we Figure 2. Expression of the Prm3, Socs-1 and Tnp1 gene in testis examined the expression of Tnp2 at the mRNA and the protein of the Tnp2–/– mice. (A, B) Northern blots with testicular RNA level by Northern blot and immunoblot analysis, respectively. isolated from the three genotypes were hybridized with the Prm3 and Socs-1 cDNA probes respectively (C). Total testicular RNA Northern blot analysis of RNA derived from testes of different isolated from 23, 24, 27 and 30 day old Tnp2–/– and Tnp2ϩ/ϩ mice –/– genotypes revealed that the Tnp2 mice failed to produce a was hybridized with a Tnp1 cDNA fragment. Rehybridization was detectable 0.6 kb Tnp2 mRNA transcript (Figure 1C). We then performed with the human EF-2 cDNA. determined whether Tnp2 protein is synthesized in mutant mice. Basic nuclear proteins were prepared from testes and (Table I). In contrast, all Tnp2–/– males on 129/Sv background subjected to SDS/polyacrylamide gel electrophoresis and blot- were infertile despite normal sexual behaviour towards female ted onto nitrocellulose filter. Western blot analysis revealed mice and production of copulation plugs. To further evaluate that polyclonal anti-Tnp2 antibodies detected the protein in male fertility, wild-type females were mated with wild-type wild-type and heterozygous mice. In contrast, no band corres- and Tnp2–/– males, and oocytes were collected 12 h after ponding to Tnp2 was found in testes of homozygous Tnp2–/– mating and scored for fertilization. Eighty-one per cent of mice. Probing the Western blot with the polyclonal H1.1 oocytes harvested from females inseminated by wild-type antiserum revealed equal amounts of the loaded proteins males had male pronuclei, and 78% developed to the 4-cell (Figure 1D). stage after 48 h culture. In contrast, all 225 oocytes from The Prm3 and Socs-1 genes are located 1.8 kb upstream the Tnp2–/– matings lacked male pronuclei and failed to and 2.4 kb downstream of the Tnp2 locus respectively. To develop further. investigate whether the insertion of the Pgk-neo cassette To address the question of whether the infertility of the influenced the expression of these two genes, Northern blot Tnp2-deficient mice on the 129/Sv background is caused by hybridization was performed using Prm3 and Socs-1 cDNA failure of spermatozoa to penetrate the zona pellucida and probes. The results showed that the insertion of the Pgk-neo fertilize the oocyte, we have performed IVF assays. Spermato- cassette in the Tnp2 locus had no influence on the expression zoa were recovered from Tnp2–/– and wild-type animals and of the closely linked Prm3 and Socs-1 genes (Figure 2A, B). tested for their ability to fertilize in-vitro zona-intact and To verify the Tnp1 expression in testis of Tnp2–/– mice, a zona-free oocytes. Figure 3 summarizes the data of these Northern blot with RNA isolated from testes of different experiments. In in-vitro assays with zona-intact oocytes, only postnatal stages was hybridized with Tnp1 cDNA probes. The 18.5% of oocytes were fertilized with the spermatozoa of Tnp1 mRNA was first detectable in testis of wild-type and Tnp2–/– mice and 17% then developed to the 4-cell stage, Tnp2–/– day mice at day 23 of postnatal life. At subsequent whereas 79.5% of oocytes were fertilized with spermatozoa developmental stages, the level of Tnp1 mRNA was signific- of wild-type mice. In contrast, insemination of zona-free antly increased in testis of Tnp2 –/– mice compared to wild- oocytes by spermatozoa from Tnp2–/– and wild-type mice did type littermates (Figure 2C). not result in significant differences in the fertilization rates. Thus, the lack of Tnp2 prevents the spermatozoon from –/– Infertility of the Tnp2 males on the 129/Sv background penetrating the zona pellucida, but does not affect fertilization To investigate the consequences of the Tnp2 gene disruption once the oocyte is reached. on male fertility, we intercrossed 10 Tnp2–/– males on the –/– C57BL/6Jϫ129/Sv mixed and 129/Sv inbred background each Spermatozoa from Tnp2 show abnormal acrosomes and with two wild-type females for 3 months. All matings of defects in transport Tnp2–/– males on the hybrid background were productive and To study further the basis of the infertility of the Tnp2–/– the average litter size was not significantly altered as compared mice on the 129/Sv background, we investigated the sperm to the breeding of wild-type littermates with wild-type females morphology and the sperm transport through the female genital 516 Teratozoospermia in Tnp2-deficient mice

Table I. Fertility of Tnp2ϩ/ϩ, Tnp2ϩ/– and Tnp–/– mice on the genetic background C57BL/6Jϫ129/Sv and 129/Sv

Genotype of male

57BL/6Jϫ129/Sv 129/Sv

ϩ/ϩϩ/ϪϪ/Ϫϩ/ϩϩ/ϪϪ/Ϫ

No. of males mated 10 10 10 10 10 10 No. of females mated 20 20 20 20 20 20 No. of mice born 312 328 304 204 192 0 Average litter size 7.8 8.2 7.6 5.1 4.8 0 Fertility ratea 100.0 105.0 97.0 100.0 94.1 0

aDetermined as the percentage of average litter size in ϩ/ϩ mice.

Figure 3. Analysis of IVF experiments. (A, B). IVF and early development of zona-intact (A) and zona-free (B) oocytes incubated with spermatozoa of Tnp2ϩ/ϩ and Tnp2–/– mice on the 129/Sv background. The percentage of oocytes (no) incubated with spermatozoa is given as 100%. The percentage reaching the pronucleus stage (pn) or 4-cell embryo stage (4c) is shown. The numbers in each category appear above the columns. The results of IVF assay reveal that spermatozoa from Tnp2–/– are generally unable to penetrate the zona pellucida.

Table II. Sperm analysis in Tnp2ϩ/ϩ and Tnp2–/– mice (background 129/Sv)

Parameter Genotype

ϩ/ϩϪ/Ϫ

No. of spermatozoa in cauda epididymis (ϫ107) 2.1 Ϯ 0.5 (5) 1.8 Ϯ 0.6 (5) No. of spermatozoa in uterus (ϫ103) 0.8 Ϯ 0.2 (5) 0.6 Ϯ 0.3 (5) No. of spermatozoa in oviduct 301 Ϯ 15 (5) 16a Ϯ 5 (5) Spermatozoa with head abnormalities (%) 6 Ϯ 2 (4) 23a Ϯ 3 (4) Aniline Blue staining of sperm head (%) 3 Ϯ 1 (4) 44a Ϯ 3 (4) Spermatozoa undergoing acrosome reaction (%) 76 Ϯ 7 (4) 31a Ϯ 7 (4)

Data from sperm analysis represent the mean Ϯ SEM of the number of individual measurements indicated in parentheses. aValues for these paramenters in Tnp2–/– mice are significantly different from those in Tnp2ϩ/ϩ mice (P Ͻ 0.01, Student’s t-test). tract. Although there were no significant differences in the lysine-rich histones by cystein- and arginin-rich protamines mean number of spermatozoa collected either from the cauda during nuclear condensation, we stained spermatozoa collected epididymis of Tnp2–/– and wild-type males or from the uterus from the cauda epididymis by Aniline Blue, which is known of wild-type females inseminated by spermatozoa of both to specifically stain lysine residues of histones in nuclei of genotypes, the mean number of Tnp2–/– spermatozoa counted early spermatid stages but not in nuclei of normal mature in oviducts of inseminated females was found to be much spermatozoa where the protamines are the prominent proteins lower than the mean number of spermatozoa from wild-type in the condensed chromatin (Dadoune and Alfonsi, 1986). The males in the oviducts (Table II). percentage of stained heads was much higher in epididymal Examination of spermatozoa by light microscopy revealed spermatozoa of Tnp2–/– than in that of wild-type mice (Table II). that 24% of the Tnp2–/– cauda epididymis spermatozoa exhib- The sperm head abnormalities were also observed by ited abnormal sperm head morphology, an abnormality that electron-microscopical examination of Tnp2–/– epididymal was only seen in 6% of wild-type spermatozoa (Figure 4A). spermatozoa. However, the abnormal sperm head was not To determine whether the gross abnormality associated with caused by the disruption of the chromatin condensation in the the sperm head was due to aberrant disposition of somatic sperm nucleus but due to malformations of the acrosomes. 517 I.M.Adham et al.

Figure 4. Morphological analysis of germ cells from Tnp2ϩ/ϩ and Tnp2–/– males. (A) Light microscopy of spermatozoa from Tnp2–/– cauda epididymis showed normal spermatozoa (w) and spermatozoa with abnormal heads (b). (B–E) Thin section illustrating the ultrastructure of mature spermatids in testis of wild-type (B) and Tnp2–/– (C), and spermatozoa in cauda epididymis of wild-type (D) and Tnp2–/– mice (E). The chromatin condensation proceeds as the germ cells mature, but the acrosome has become detached from the nucleus of the Tnp2–/– spermatids (C) and spermatozoa (E) and is underlain by a large subacrosomal space. a ϭ acrosome; m ϭ mitochondrial sheath; n ϭ nucleus. Original magnification: (B–D) ϫ13 000; (E) ϫ22 000.

Many acrosomes (30%) appeared indented and/or partially Tnp2–/– and wild-type mice to the calcium ionophore A23187. detached from the nuclear envelope (Figure 4E). Indented As shown in Table II, spermatozoa of the Tnp2–/– mice differ acrosomes were also found in 4% of wild-type spermatozoa significantly in numbers undergoing acrosome reaction as (Figure 4D). This abnormal acrosome was also seen in compared to wild-type spermatozoa. spermatids within the testis (Figure 4C). Thus, the high These data indicate that teratozoospermia is responsible for frequency of the indented acrosomes strongly suggests that the infertility of the Tnp2–/– males of the 129/Sv background. the attachment of the acrosomal membrane to the nucleus is impaired in spermatozoa of Tnp2 null. In addition to the acrosomal defect, local presence of the sperm tail adjacent to Discussion the sperm head was found in epididymal spermatozoa of In this study, we have generated mice carrying a null mutation mutant mice. However, the axon of the spermatozoa were found in the Tnp2 locus and determined the effect of the Tnp2 to possess the normal 9ϩ2 arrangement of microtubule pairs. mutation on male fertility. Breeding of the Tnp2–/– animals To determine whether the acrosomal defect of the sperm- revealed that the loss of the Tnp2 gene in mice causes male atozoa of Tnp2–/– mice has an influence on the acrosomal infertility depending on the genetic background. Similar results exocytosis, we examined the response of spermatozoa from have been obtained in mice carrying targeted null mutations 518 Teratozoospermia in Tnp2-deficient mice for the Pou-homeodomain gene (Sprm-1), the transition spermatozoa with detached acrosome (Xu et al., 1999). Similar protein-1 gene (Tnp-1) and the desert hedgehog gene (Dhh). alterations have also been noted in retinoid X receptor β For these genes, highly variable penetrance of male infertility (RXRβ)-deficient mice and in mice carrying a T/t haplotype on different genetic backgrounds have been described (Bitgood (Dooher and Bennett, 1977; Kastner et al., 1996). It was found et al., 1996; Pearse et al., 1997; Yu et al., 2000). The full that the acrosome is not firmly attached to the nuclear envelope penetrance of the Tnp–/– phenotype on the isogenic 129 and that the spermatozoa of these genotypes also have background and the observation of normal fertility of the reduced motility. Tnp2–/– mice on the mixed background could indicate that There have been a number of gene disruption experiments the interaction of the Tnp2 mutation with the 129 genetic that have generated animals with more subtle abnormalities background involves modifier genes. Preliminary observations than might have been expected. The normal expression of the of a normal number of spermatozoa produced and of normal closely linked Prm3 and Socs-1 genes in the testis of the fertility in most Tnp–/– male mice were cited in one study (Yu Tnp2 –/– mice can rule out the possibility that the disrupted et al., 2000), but the genetic background of the studied Tnp–/– Tnp2 locus in some way influences these neighbouring genes. mice has not been mentioned. The phenotype of the Tnp2–/– mouse is clearly due to the Tnp2 In Tnp2-deficient mice, the sperm heads become severely gene deletion. deformed coincident with malformation of the acrosome. The misplacement of the acrosome in spermatozoa may likewise reflect disruption of the acrosomal reaction, as observed in Acknowledgements spermatozoa from the Tnp2 null mice. In addition, the inability We would like to thank M.Schindler and H.Riedesel for assistance of the spermatozoa from the Tnp2–/– mice to penetrate the with the generation of knock-out mice; C.Mu¨ller and S.Wolf for help zona pellucida in in-vitro assays is also a possible explanation with particular experiments; A.Winkler for secretarial help; and –/– W.S.Kistler and B.Drabent for providing anti-Tnp2 and anti-H1.1 for their infertility. Furthermore, Tnp2 spermatozoa in the antiserum, respectively. This work was supported by a grant from oviducts were found to be reduced in number, indicative of the Deutsche Forschungsgemeinschaft (through SFB 271) to W.E. poor motility. Taken together, our results suggest that the infertility of the Tnp2-deficient males is most likely a result of abnormal sperm head morphology and poor motility. References It is interesting that the reduced fertility of the Tnp1-deficient Alfonso, P.T. and Kistler, W.S. (1993) Immunohistochemical localization of males is also due to abnormalities of the sperm head and spermatid nuclear transition protein 2 in the testis of rats and mice. Biol. defects in sperm motility (Yu et al., 2000). The similarity of Reprod., 48, 522–529. Balhorn, R., Weston, S., Thomas, C. et al. (1984) DNA packaging in mouse the phenotypes of spermatozoa from Tnp1 and Tnp2-deficient spermatids. Synthesis of protamine variant and four transition proteins. mice, and the elevated level of Tnp1 and Tnp2 in testis of Exp. Cell. Res., 150, 298–308. Tnp2- and Tnp1-deficient mice, respectively (these results and Baskaran, R. and Rao, M.R.S. (1991) Mammalian spermatid specific protein, TP2, is a zinc metalloprotein with two finger motifs. Biochem. Biophys. Yu et al., 2000) raises the possibility that a deficiency created Res. Commun., 179, 1491–1499. through the disruption of the Tnp2 can be compensated for by Bitgood, M.L., Shen, L. and McMahon, A.P. (1996) Sertoli cell signaling by recruitment of Tnp1 and vice versa. Desert hedgehog regulates the male germline. Curr. Biol., 6, 298–304. Our data concerning the pathology of the acrosomes of the Dadoune, J.P. and Alfonsi, M.F. (1986) Ultrastructural and cytochemical –/– changes of the head components of human spermatids and spermatozoa. Tnp2 mice are, for the moment, essentially descriptive. It Gamete Res., 14,33–46. has long been suggested that DNA binding properties of Tnp2 Dadoune, J.P., Mayaux, M.J. and Guihard-Moscato, M.L. (1988) Correlation serve specific loci for initiation of chromatin condensation between defects in chromatin condensation of human spermatozoa stained during the later stages of spermatogenesis (Kundu and Rao, by aniline blue and semen characteristics. Andrologia, 20,211–217. Dooher, G.B. and Bennett, D. (1973) Fine structural observations on the 1996). Immunocytochemical distribution of the Tnp2 has development of the sperm head in the mouse. Am. J. Anat., 136, 339–261. shown that the first immunoreaction is detected at the tip of Dooher, G.B. and Bennett, D. (1977) Spermiogenesis and spermatozoa in the nucleus of step 11 spermatids and this reaction remains sterile mice carrying different lethal T/t locus haplotypes: A transmission localized over the anterior tip of the nucleus even in step 13 and scanning electron microscopic study. Biol. Reprod., 17, 269–288. Fawcett, D.W., Anderson, W.A. and Phillips, D.M. (1971) Morphogenetic spermatids, in which chromatin condensation begins (Kistler factors influencing the shape of the sperm head. Dev. Biol., 26, 220–251. et al., 1996). The morphological changes of the acrosomal Franke, K., Drabent, B. and Doenecke, D. (1998) Testicular expression of the vesicle during spermatogenesis are concomitant with chromatin mouse histone H1.1 gene. Histochem. Cell Biol., 109, 383–390. condensation. During spermatid steps 11–13, the acrosomal Hogan, B., Costantini, F. and Lacy, E. (eds) (1986) Manipulating the Mouse Embryo. Cold Spring Harbor Laboratory Press, New York, 332 pp. cap is flattened, shifted caudally to the anterior tip of the Joyner A.L. (ed.) (1993) Gene Targeting: A Practical Approach. IRL Press, nucleus and attached finally to the nuclear involvement Oxford, 230 pp. (Oakberg, 1956). Therefore, it could be suggested that the Kastner, P., Mark, M., Leid, M. et al. (1996) Abnormal spermatogenesis in β failure of the initial chromatin condensation during spermato- RXR mutant mice. Genes Dev., 10,80–92. Keime, S., Heitland, K., Kumm, S. et al. (1992) Characterization of four genesis in Tnp2-deficient mice leads to impairment of acrosome genes encoding basic proteins of the porcine spermatid nucleus and close attachment to the nucleus involvement or to dehiscence of linkage of three of them. Biol. Chem. Hoppe-Seyler, 373, 261–270. acrosome from the nucleus. Kistler, W.S., Henriksen, K., Mali, P. et al. (1996) Sequential expression of Alterations in the fine structure of the acrosome have been nucleoproteins during rat spermatogenesis. Exp. Cell. Res., 225, 374–381. Kleene, K.C. and Flynn, J.F. (1987) Characterization of a cDNA clone noted in spermatozoa of casein kinase II (Ck2)-deficient encoding a basic protein, TP2, involved in chromatin condensation during mice, in which males are infertile and possess ‘round-head’ spermatogenesis in the mouse. J. Biol. Chem., 262, 17272–17277. 519 I.M.Adham et al.

Kundu, T.K. and Rao, M.R. (1996) Zinc dependent recognition of a human Reinhardt, N., Kremling, H., Luerssen, H. et al. (1991) Characterization of a CpG island sequence by the mammalian spermatidal protein TP2. gene encoding a basic protein of the spermatid nucleus, TNP2, and its Biochemistry, 35, 15626–15632. close linkage to the protamine gene in the bull. Biol. Chem. Hoppe-Seyler, Luerssen, H., Maier, W.M., Hoyer-Fender, S. et al. (1989) The nucleotide 372, 431–436. sequence of rat transition protein 2 (TP2) cDNA. Nucleic Acids Res., Schlu¨ter, G. and Engel, W. (1995) The rat Prm3 gene is an intronless member 17, 3585. of the protamine gene cluster and is expressed in haploid male germ cells. Mansour, S.L., Thomas, K.R. and Capecchi, M.R. (1988) Disruption of the Cytogenet. Cell Genet., 71, 352–355. proto-oncogene int-2 in mouse embryo-derived stem cells: a general strategy Schlu¨ter, G., Kremling, H. and Engel, W. (1992) The gene for human transition for targeting mutation to non-selectable gene. Nature, 336, 348–352. protein 2: Nucleotide sequence, assignment to the protamine gene cluster, Nelson, J.E. and Krawetz, S.A. (1994) Characterization of a human locus in an evidence for its low expression. Genomics, 14, 377–383. transition. J. Biol. Chem., 369, 31067–31073. Schlu¨ter, G., Celik, A., Obata, R. et al. (1996) Sequence analysis of concerved Oakberg, E.F. (1956) Duration of spermatogenesis in the mouse and timing protamine gene cluster shows that it contains a fourth expressed gene. Mol. of stages of the cycle of the seminiferous epithelium. Am. J. Anat., 99, Reprod. Dev., 43,1–6. 507–516. Thaler, C.D. and Cardullo, R.A. (1995) Biochemical characterization of Oko, R.J., Jando, V., Wagner, C.L. et al. (1996) Chromatin reorganization in a glycosyl-phosphatidylinositol-linked hyaluronidase on mouse sperm. rat spermatids during the disappearance of testis-specific histone, H1t, and Biochemistry, 34, 7788–7795. the appearance of transition proteins TP1 and TP2. Biol. Reprod., 54, Xu, X., Toselli, P.A., Russel, L.D. et al. (1999) Globozoospermia in mice 1141–1157. lacking the casein kinase IIα catalytic subunit. Nature Genet., 23, 118-121. Panyim, S. and Chalkley, R. (1969) High resolution acrylamide gel Yu, Y.E., Zhang, Y., Unni, E., et al. (2000) Abnormal spermatogenesis and electrophoresis of histones. Arch. Biochem. Biophys., 130, 337–346. reduced fertility in transition 1-deficient mice. Proc. Natl. Pearse, R.V., Drolet, D.W., Kalla, K.A. et al. (1997) Reduced fertility in mice Acad. Sci. USA, 79, 4683–4688. deficient for the POU protein sperm-1. Proc. Natl. Acad. Sci. USA, 94, 7555–7560. Received on December 20, 2000; accepted on March 28, 2001

520