MRG15 Is Required for Pre-Mrna Splicing and Spermatogenesis
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Ptbp2 Represses Adult-Specific Splicing to Regulate the Generation of Neuronal Precursors in the Embryonic Brain
Downloaded from genesdev.cshlp.org on October 4, 2021 - Published by Cold Spring Harbor Laboratory Press Ptbp2 represses adult-specific splicing to regulate the generation of neuronal precursors in the embryonic brain Donny D. Licatalosi,1,4 Masato Yano,1,5 John J. Fak,1 Aldo Mele,1 Sarah E. Grabinski,2 Chaolin Zhang,1 and Robert B. Darnell1,3,6 1Laboratory of Molecular Neuro-Oncology, The Rockefeller University, New York, New York 10065, USA; 2Center for RNA Molecular Biology, Case Western Reserve University, Cleveland, Ohio 44106, USA; 3Howard Hughes Medical Institute, The Rockefeller University, New York, New York 10065, USA Two polypyrimidine tract RNA-binding proteins (PTBs), one near-ubiquitously expressed (Ptbp1) and another highly tissue-restricted (Ptbp2), regulate RNA in interrelated but incompletely understood ways. Ptbp1, a splicing regulator, is replaced in the brain and differentiated neuronal cell lines by Ptbp2. To define the roles of Ptbp2 in the nervous system, we generated two independent Ptbp2-null strains, unexpectedly revealing that Ptbp2 is expressed in neuronal progenitors and is essential for postnatal survival. A HITS-CLIP (high-throughput sequencing cross- linking immunoprecipitation)-generated map of reproducible Ptbp2–RNA interactions in the developing mouse neocortex, combined with results from splicing-sensitive microarrays, demonstrated that the major action of Ptbp2 is to inhibit adult-specific alternative exons by binding pyrimidine-rich sequences upstream of and/or within them. These regulated exons are present in mRNAs encoding proteins associated with control of cell fate, proliferation, and the actin cytoskeleton, suggesting a role for Ptbp2 in neurogenesis. Indeed, neuronal progenitors in the Ptbp2-null brain exhibited an aberrant polarity and were associated with regions of premature neurogenesis and reduced progenitor pools. -
Supplementary File 2A Revised
Supplementary file 2A. Differentially expressed genes in aldosteronomas compared to all other samples, ranked according to statistical significance. Missing values were not allowed in aldosteronomas, but to a maximum of five in the other samples. Acc UGCluster Name Symbol log Fold Change P - Value Adj. P-Value B R99527 Hs.8162 Hypothetical protein MGC39372 MGC39372 2,17 6,3E-09 5,1E-05 10,2 AA398335 Hs.10414 Kelch domain containing 8A KLHDC8A 2,26 1,2E-08 5,1E-05 9,56 AA441933 Hs.519075 Leiomodin 1 (smooth muscle) LMOD1 2,33 1,3E-08 5,1E-05 9,54 AA630120 Hs.78781 Vascular endothelial growth factor B VEGFB 1,24 1,1E-07 2,9E-04 7,59 R07846 Data not found 3,71 1,2E-07 2,9E-04 7,49 W92795 Hs.434386 Hypothetical protein LOC201229 LOC201229 1,55 2,0E-07 4,0E-04 7,03 AA454564 Hs.323396 Family with sequence similarity 54, member B FAM54B 1,25 3,0E-07 5,2E-04 6,65 AA775249 Hs.513633 G protein-coupled receptor 56 GPR56 -1,63 4,3E-07 6,4E-04 6,33 AA012822 Hs.713814 Oxysterol bining protein OSBP 1,35 5,3E-07 7,1E-04 6,14 R45592 Hs.655271 Regulating synaptic membrane exocytosis 2 RIMS2 2,51 5,9E-07 7,1E-04 6,04 AA282936 Hs.240 M-phase phosphoprotein 1 MPHOSPH -1,40 8,1E-07 8,9E-04 5,74 N34945 Hs.234898 Acetyl-Coenzyme A carboxylase beta ACACB 0,87 9,7E-07 9,8E-04 5,58 R07322 Hs.464137 Acyl-Coenzyme A oxidase 1, palmitoyl ACOX1 0,82 1,3E-06 1,2E-03 5,35 R77144 Hs.488835 Transmembrane protein 120A TMEM120A 1,55 1,7E-06 1,4E-03 5,07 H68542 Hs.420009 Transcribed locus 1,07 1,7E-06 1,4E-03 5,06 AA410184 Hs.696454 PBX/knotted 1 homeobox 2 PKNOX2 1,78 2,0E-06 -
Lineage-Specific Programming Target Genes Defines Potential for Th1 Temporal Induction Pattern of STAT4
Downloaded from http://www.jimmunol.org/ by guest on October 1, 2021 is online at: average * The Journal of Immunology published online 26 August 2009 from submission to initial decision 4 weeks from acceptance to publication J Immunol http://www.jimmunol.org/content/early/2009/08/26/jimmuno l.0901411 Temporal Induction Pattern of STAT4 Target Genes Defines Potential for Th1 Lineage-Specific Programming Seth R. Good, Vivian T. Thieu, Anubhav N. Mathur, Qing Yu, Gretta L. Stritesky, Norman Yeh, John T. O'Malley, Narayanan B. Perumal and Mark H. Kaplan Submit online. Every submission reviewed by practicing scientists ? is published twice each month by http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://www.jimmunol.org/content/suppl/2009/08/26/jimmunol.090141 1.DC1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* • Why • • Material Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2009 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of October 1, 2021. Published August 26, 2009, doi:10.4049/jimmunol.0901411 The Journal of Immunology Temporal Induction Pattern of STAT4 Target Genes Defines Potential for Th1 Lineage-Specific Programming1 Seth R. Good,2* Vivian T. Thieu,2† Anubhav N. Mathur,† Qing Yu,† Gretta L. -
Convergent Functional Genomics of Schizophrenia: from Comprehensive Understanding to Genetic Risk Prediction
Molecular Psychiatry (2012) 17, 887 -- 905 & 2012 Macmillan Publishers Limited All rights reserved 1359-4184/12 www.nature.com/mp IMMEDIATE COMMUNICATION Convergent functional genomics of schizophrenia: from comprehensive understanding to genetic risk prediction M Ayalew1,2,9, H Le-Niculescu1,9, DF Levey1, N Jain1, B Changala1, SD Patel1, E Winiger1, A Breier1, A Shekhar1, R Amdur3, D Koller4, JI Nurnberger1, A Corvin5, M Geyer6, MT Tsuang6, D Salomon7, NJ Schork7, AH Fanous3, MC O’Donovan8 and AB Niculescu1,2 We have used a translational convergent functional genomics (CFG) approach to identify and prioritize genes involved in schizophrenia, by gene-level integration of genome-wide association study data with other genetic and gene expression studies in humans and animal models. Using this polyevidence scoring and pathway analyses, we identify top genes (DISC1, TCF4, MBP, MOBP, NCAM1, NRCAM, NDUFV2, RAB18, as well as ADCYAP1, BDNF, CNR1, COMT, DRD2, DTNBP1, GAD1, GRIA1, GRIN2B, HTR2A, NRG1, RELN, SNAP-25, TNIK), brain development, myelination, cell adhesion, glutamate receptor signaling, G-protein-- coupled receptor signaling and cAMP-mediated signaling as key to pathophysiology and as targets for therapeutic intervention. Overall, the data are consistent with a model of disrupted connectivity in schizophrenia, resulting from the effects of neurodevelopmental environmental stress on a background of genetic vulnerability. In addition, we show how the top candidate genes identified by CFG can be used to generate a genetic risk prediction score (GRPS) to aid schizophrenia diagnostics, with predictive ability in independent cohorts. The GRPS also differentiates classic age of onset schizophrenia from early onset and late-onset disease. -
Abnormal Spermatogenesis and Reduced Fertility in Transition Nuclear Protein 1-Deficient Mice
Abnormal spermatogenesis and reduced fertility in transition nuclear protein 1-deficient mice Y. Eugene Yu*†,Yun Zhang*, Emmanual Unni*‡, Cynthia R. Shirley*, Jian M. Deng§, Lonnie D. Russell¶, Michael M. Weil*, Richard R. Behringer§, and Marvin L. Meistrich*ʈ Departments of *Experimental Radiation Oncology, and §Molecular Genetics, University of Texas M. D. Anderson Cancer Center, Houston, TX 77030-4095; and ¶Department of Physiology, Southern Illinois University, School of Medicine, Carbondale, IL 62901 Edited by Richard D. Palmiter, University of Washington School of Medicine, Seattle, WA, and approved February 22, 2000 (received for review May 3, 1999) Transition nuclear proteins (TPs), the major proteins found in (15), suggesting some functional relationship between the three chromatin of condensing spermatids, are believed to be important proteins exists. Tnp1, however, is on a separate chromosome and for histone displacement and chromatin condensation during is not clearly related to the other three proteins. mammalian spermatogenesis. We generated mice lacking the ma- In vitro, TP1 decreases the melting temperature of DNA (16) jor TP, TP1, by targeted deletion of the Tnp1 gene in mouse and relaxes the DNA in nucleosomal core particles (17), which embryonic stem cells. Surprisingly, testis weights and sperm pro- led to the proposal that TP1 reduces the interaction of DNA duction were normal in the mutant mice, and only subtle abnor- with the nucleosome core. In contrast, TP2 increases the malities were observed in sperm morphology. Electron microscopy melting temperature of DNA and compacts the DNA in revealed large rod-like structures in the chromatin of mutant step nucleosomal cores, suggesting that it is a DNA-condensing 13 spermatids, in contrast to the fine chromatin fibrils observed in protein (18). -
Viewed and Published Immediately Upon Acceptance Cited in Pubmed and Archived on Pubmed Central Yours — You Keep the Copyright
BMC Genomics BioMed Central Research article Open Access Differential gene expression in ADAM10 and mutant ADAM10 transgenic mice Claudia Prinzen1, Dietrich Trümbach2, Wolfgang Wurst2, Kristina Endres1, Rolf Postina1 and Falk Fahrenholz*1 Address: 1Johannes Gutenberg-University, Institute of Biochemistry, Mainz, Johann-Joachim-Becherweg 30, 55128 Mainz, Germany and 2Helmholtz Zentrum München – German Research Center for Environmental Health, Institute for Developmental Genetics, Ingolstädter Landstraße 1, 85764 Neuherberg, Germany Email: Claudia Prinzen - [email protected]; Dietrich Trümbach - [email protected]; Wolfgang Wurst - [email protected]; Kristina Endres - [email protected]; Rolf Postina - [email protected]; Falk Fahrenholz* - [email protected] * Corresponding author Published: 5 February 2009 Received: 19 June 2008 Accepted: 5 February 2009 BMC Genomics 2009, 10:66 doi:10.1186/1471-2164-10-66 This article is available from: http://www.biomedcentral.com/1471-2164/10/66 © 2009 Prinzen et al; licensee BioMed Central Ltd. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Abstract Background: In a transgenic mouse model of Alzheimer disease (AD), cleavage of the amyloid precursor protein (APP) by the α-secretase ADAM10 prevented amyloid plaque formation, and alleviated cognitive deficits. Furthermore, ADAM10 overexpression increased the cortical synaptogenesis. These results suggest that upregulation of ADAM10 in the brain has beneficial effects on AD pathology. Results: To assess the influence of ADAM10 on the gene expression profile in the brain, we performed a microarray analysis using RNA isolated from brains of five months old mice overexpressing either the α-secretase ADAM10, or a dominant-negative mutant (dn) of this enzyme. -
Dixdc1 Is a Critical Regulator of DISC1 and Embryonic Cortical Development
Dixdc1 Is a Critical Regulator of DISC1 and Embryonic Cortical Development The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Singh, Karun K., Xuecai Ge, Yingwei Mao, Laurel Drane, Konstantinos Meletis, Benjamin A. Samuels, and Li-Huei Tsai. “Dixdc1 Is a Critical Regulator of DISC1 and Embryonic Cortical Development.” Neuron 67, no. 1 (July 15, 2010): 33–48. © 2010 Elsevier Inc. As Published http://dx.doi.org/10.1016/j.neuron.2010.06.002 Publisher Elsevier Version Final published version Citable link http://hdl.handle.net/1721.1/96067 Terms of Use Article is made available in accordance with the publisher's policy and may be subject to US copyright law. Please refer to the publisher's site for terms of use. Neuron Article Dixdc1 Is a Critical Regulator of DISC1 and Embryonic Cortical Development Karun K. Singh,1,2,3 Xuecai Ge,1,2 Yingwei Mao,1,2,3 Laurel Drane,1,2,3 Konstantinos Meletis,1,2,3 Benjamin A. Samuels,1,2,4 and Li-Huei Tsai1,2,3,* 1Howard Hughes Medical Institute 2Picower Institute for Learning and Memory, Department of Brain and Cognitive Sciences Massachusetts Institute of Technology, Cambridge, MA 02139, USA 3Stanley Center for Psychiatric Research, Broad Institute, Cambridge, MA 02139, USA 4Department of Psychiatry and Neuroscience, Columbia University, New York, NY 10032, USA *Correspondence: [email protected] DOI 10.1016/j.neuron.2010.06.002 SUMMARY mechanisms by which it contributes to risk for psychiatric disor- ders. Studies have demonstrated that DISC1 regulates embry- The psychiatric illness risk gene Disrupted in Schizo- onic neurogenesis, neuronal migration, axon differentiation, phrenia-1 (DISC1) plays an important role in brain and synapse formation, while in the adult brain, DISC1 modu- development; however, it is unclear how DISC1 is lates the genesis and circuit integration of new neurons (Brad- regulated during cortical development. -
Supplementary Table 1
Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7 -
Polypyrimidine Tract Binding Proteins Are Essential for B Cell Development
bioRxiv preprint doi: https://doi.org/10.1101/769141; this version posted September 14, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Polypyrimidine Tract Binding Proteins are essential for B cell development Authors: Elisa Monzón-Casanova1,2*, Louise S. Matheson1, Kristina Tabbada3, Kathi Zarnack4, Christopher W. J. Smith2 and Martin Turner1* Affiliations: 1Laboratory of Lymphocyte Signalling and Development, The Babraham Institute, Cambridge, UK; 2Department of Biochemistry, University of Cambridge, Cambridge, UK; 3Next Generation Sequencing Facility, The Babraham Institute, Cambridge, UK; 4Buchmann Institute for Molecular Life Sciences, Goethe University Frankfurt, Frankfurt am Main, Germany *Corresponding authors: Elisa Monzón-Casanova ([email protected]) and Martin Turner ([email protected]) 1 bioRxiv preprint doi: https://doi.org/10.1101/769141; this version posted September 14, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Abstract During B cell development, recombination of immunoglobulin loci is tightly coordinated with the cell cycle to avoid unwanted rearrangements of other genomic locations. Several factors have been identified that suppress proliferation in late-pre-B cells to allow light chain recombination. By comparison, our knowledge of factors limiting proliferation during heavy chain recombination at the pro-B cell stage is very limited. -
Epigenetic Mechanisms Are Involved in the Oncogenic Properties of ZNF518B in Colorectal Cancer
Epigenetic mechanisms are involved in the oncogenic properties of ZNF518B in colorectal cancer Francisco Gimeno-Valiente, Ángela L. Riffo-Campos, Luis Torres, Noelia Tarazona, Valentina Gambardella, Andrés Cervantes, Gerardo López-Rodas, Luis Franco and Josefa Castillo SUPPLEMENTARY METHODS 1. Selection of genomic sequences for ChIP analysis To select the sequences for ChIP analysis in the five putative target genes, namely, PADI3, ZDHHC2, RGS4, EFNA5 and KAT2B, the genomic region corresponding to the gene was downloaded from Ensembl. Then, zoom was applied to see in detail the promoter, enhancers and regulatory sequences. The details for HCT116 cells were then recovered and the target sequences for factor binding examined. Obviously, there are not data for ZNF518B, but special attention was paid to the target sequences of other zinc-finger containing factors. Finally, the regions that may putatively bind ZNF518B were selected and primers defining amplicons spanning such sequences were searched out. Supplementary Figure S3 gives the location of the amplicons used in each gene. 2. Obtaining the raw data and generating the BAM files for in silico analysis of the effects of EHMT2 and EZH2 silencing The data of siEZH2 (SRR6384524), siG9a (SRR6384526) and siNon-target (SRR6384521) in HCT116 cell line, were downloaded from SRA (Bioproject PRJNA422822, https://www.ncbi. nlm.nih.gov/bioproject/), using SRA-tolkit (https://ncbi.github.io/sra-tools/). All data correspond to RNAseq single end. doBasics = TRUE doAll = FALSE $ fastq-dump -I --split-files SRR6384524 Data quality was checked using the software fastqc (https://www.bioinformatics.babraham. ac.uk /projects/fastqc/). The first low quality removing nucleotides were removed using FASTX- Toolkit (http://hannonlab.cshl.edu/fastxtoolkit/). -
Supplementary Tables S1-S3
Supplementary Table S1: Real time RT-PCR primers COX-2 Forward 5’- CCACTTCAAGGGAGTCTGGA -3’ Reverse 5’- AAGGGCCCTGGTGTAGTAGG -3’ Wnt5a Forward 5’- TGAATAACCCTGTTCAGATGTCA -3’ Reverse 5’- TGTACTGCATGTGGTCCTGA -3’ Spp1 Forward 5'- GACCCATCTCAGAAGCAGAA -3' Reverse 5'- TTCGTCAGATTCATCCGAGT -3' CUGBP2 Forward 5’- ATGCAACAGCTCAACACTGC -3’ Reverse 5’- CAGCGTTGCCAGATTCTGTA -3’ Supplementary Table S2: Genes synergistically regulated by oncogenic Ras and TGF-β AU-rich probe_id Gene Name Gene Symbol element Fold change RasV12 + TGF-β RasV12 TGF-β 1368519_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 42.22 5.53 75.28 1373000_at sushi-repeat-containing protein, X-linked 2 (predicted) Srpx2 19.24 25.59 73.63 1383486_at Transcribed locus --- ARE 5.93 27.94 52.85 1367581_a_at secreted phosphoprotein 1 Spp1 2.46 19.28 49.76 1368359_a_at VGF nerve growth factor inducible Vgf 3.11 4.61 48.10 1392618_at Transcribed locus --- ARE 3.48 24.30 45.76 1398302_at prolactin-like protein F Prlpf ARE 1.39 3.29 45.23 1392264_s_at serine (or cysteine) peptidase inhibitor, clade E, member 1 Serpine1 ARE 24.92 3.67 40.09 1391022_at laminin, beta 3 Lamb3 2.13 3.31 38.15 1384605_at Transcribed locus --- 2.94 14.57 37.91 1367973_at chemokine (C-C motif) ligand 2 Ccl2 ARE 5.47 17.28 37.90 1369249_at progressive ankylosis homolog (mouse) Ank ARE 3.12 8.33 33.58 1398479_at ryanodine receptor 3 Ryr3 ARE 1.42 9.28 29.65 1371194_at tumor necrosis factor alpha induced protein 6 Tnfaip6 ARE 2.95 7.90 29.24 1386344_at Progressive ankylosis homolog (mouse) -
Machado Renatoassis M.Pdf
RENATO ASSIS MACHADO “ASSOCIAÇÃO DOS POLIMORFISMOS NOS GENES HOXD1, TNP1, MSX1, TCOF1, FGFR1, COL2A1, WNT3 E TIMP3 COM FISSURAS DE LÁBIO E/OU PALATO NÃO-SINDRÔMICA EM UMA POPULAÇÃO BRASILEIRA” PIRACICABA 2015 i ii UNIVERSIDADE ESTADUAL DE CAMPINAS FACULDADE DE ODONTOLOGIA DE PIRACICABA RENATO ASSIS MACHADO “ASSOCIAÇÃO DOS POLIMORFISMOS NOS GENES HOXD1, TNP1, MSX1, TCOF1, FGFR1, COL2A1, WNT3 E TIMP3 COM FISSURAS DE LÁBIO E/OU PALATO NÃO-SINDRÔMICA EM UMA POPULAÇÃO BRASILEIRA” Dissertação apresentada à Faculdade de Odontologia de Piracicaba da Universidade Estadual de Campinas para a obtenção do título de Mestre em Estomatopatologia, na Área de Patologia. Orientador: Prof. Dr. Ricardo Della Coletta Coorientador: Prof. Dr. Hercilio Martelli Junior Este exemplar corresponde a versão final da dissertação defendida por Renato Assis Machado e orientada pelo Prof. Dr. Ricardo Della Coletta. ____________________________________ Assinatura do orientador PIRACICABA 2015 iii Ficha catalográfica Universidade Estadual de Campinas Biblioteca da Faculdade de Odontologia de Piracicaba Marilene Girello - CRB 8/6159 Machado, Renato Assis, 1989- M18a MacAssociação dos polimorfismos nos genes HOXD1, TNP1, MSX1, TCOF1, FGFR1, COL2A1, WNT3 e TIMP3 com fissuras de lábio e/ou palato não- sindrômica em uma população brasileira / Renato Assis Machado. – Piracicaba, SP : [s.n.], 2015. MacOrientador: Ricardo Della Coletta. MacCoorientador: Hercilio Martelli Junior. MacDissertação (mestrado) – Universidade Estadual de Campinas, Faculdade de Odontologia de Piracicaba.