Viewed and Published Immediately Upon Acceptance Cited in Pubmed and Archived on Pubmed Central Yours — You Keep the Copyright
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
A Comparative Analysis of Transcribed Genes in the Mouse Hypothalamus and Neocortex Reveals Chromosomal Clustering
A comparative analysis of transcribed genes in the mouse hypothalamus and neocortex reveals chromosomal clustering Wee-Ming Boon*, Tim Beissbarth†, Lavinia Hyde†, Gordon Smyth†, Jenny Gunnersen*, Derek A. Denton*‡, Hamish Scott†, and Seong-Seng Tan* *Howard Florey Institute, University of Melbourne, Parkville 3052, Australia; and †Genetics and Bioinfomatics Division, Walter and Eliza Hall Institute of Medical Research, Royal Parade, Parkville 3050, Australia Contributed by Derek A. Denton, August 26, 2004 The hypothalamus and neocortex are subdivisions of the mamma- representing all of the genes that are expressed (qualitative and lian forebrain, and yet, they have vastly different evolutionary quantitative) in the hypothalamus and neocortex under standard histories, cytoarchitecture, and biological functions. In an attempt conditions. to define these attributes in terms of their genetic activity, we have In the current study, we describe the use of the Serial Analysis compared their genetic repertoires by using the Serial Analysis of of Gene Expression (SAGE) database, which allows simulta- Gene Expression database. From a comparison of 78,784 hypothal- neous detection of the expression levels of the entire genome amus tags with 125,296 neocortical tags, we demonstrate that each without a priori knowledge of gene sequences (13). SAGE takes structure possesses a different transcriptional profile in terms of advantage of the fact that a small sequence tag taken from a gene ontological characteristics and expression levels. Despite its defined position within the transcript is sufficient to identify the more recent evolutionary history, the neocortex has a more com- gene (from known cDNA or EST sequences), and up to 40 tags plex pattern of gene activity. -
Multiple Activities of Arl1 Gtpase in the Trans-Golgi Network Chia-Jung Yu1,2 and Fang-Jen S
© 2017. Published by The Company of Biologists Ltd | Journal of Cell Science (2017) 130, 1691-1699 doi:10.1242/jcs.201319 COMMENTARY Multiple activities of Arl1 GTPase in the trans-Golgi network Chia-Jung Yu1,2 and Fang-Jen S. Lee3,4,* ABSTRACT typical features of an Arf-family GTPase, including an amphipathic ADP-ribosylation factors (Arfs) and ADP-ribosylation factor-like N-terminal helix and a consensus site for N-myristoylation (Lu et al., proteins (Arls) are highly conserved small GTPases that function 2001; Price et al., 2005). In yeast, recruitment of Arl1 to the Golgi as main regulators of vesicular trafficking and cytoskeletal complex requires a second Arf-like GTPase, Arl3 (Behnia et al., reorganization. Arl1, the first identified member of the large Arl family, 2004; Setty et al., 2003). Yeast Arl3 lacks a myristoylation site and is an important regulator of Golgi complex structure and function in is, instead, N-terminally acetylated; this modification is required for organisms ranging from yeast to mammals. Together with its effectors, its recruitment to the Golgi complex by Sys1. In mammalian cells, Arl1 has been shown to be involved in several cellular processes, ADP-ribosylation-factor-related protein 1 (Arfrp1), a mammalian including endosomal trans-Golgi network and secretory trafficking, lipid ortholog of yeast Arl3, plays a pivotal role in the recruitment of Arl1 droplet and salivary granule formation, innate immunity and neuronal to the trans-Golgi network (TGN) (Behnia et al., 2004; Panic et al., development, stress tolerance, as well as the response of the unfolded 2003b; Setty et al., 2003; Zahn et al., 2006). -
Supplemental Table S1
Entrez Gene Symbol Gene Name Affymetrix EST Glomchip SAGE Stanford Literature HPA confirmed Gene ID Profiling profiling Profiling Profiling array profiling confirmed 1 2 A2M alpha-2-macroglobulin 0 0 0 1 0 2 10347 ABCA7 ATP-binding cassette, sub-family A (ABC1), member 7 1 0 0 0 0 3 10350 ABCA9 ATP-binding cassette, sub-family A (ABC1), member 9 1 0 0 0 0 4 10057 ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1 0 0 0 0 5 10060 ABCC9 ATP-binding cassette, sub-family C (CFTR/MRP), member 9 1 0 0 0 0 6 79575 ABHD8 abhydrolase domain containing 8 1 0 0 0 0 7 51225 ABI3 ABI gene family, member 3 1 0 1 0 0 8 29 ABR active BCR-related gene 1 0 0 0 0 9 25841 ABTB2 ankyrin repeat and BTB (POZ) domain containing 2 1 0 1 0 0 10 30 ACAA1 acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl-Coenzyme A thiol 0 1 0 0 0 11 43 ACHE acetylcholinesterase (Yt blood group) 1 0 0 0 0 12 58 ACTA1 actin, alpha 1, skeletal muscle 0 1 0 0 0 13 60 ACTB actin, beta 01000 1 14 71 ACTG1 actin, gamma 1 0 1 0 0 0 15 81 ACTN4 actinin, alpha 4 0 0 1 1 1 10700177 16 10096 ACTR3 ARP3 actin-related protein 3 homolog (yeast) 0 1 0 0 0 17 94 ACVRL1 activin A receptor type II-like 1 1 0 1 0 0 18 8038 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 1 0 0 0 0 19 8751 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 1 0 0 0 0 20 8728 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 1 0 0 0 0 21 81792 ADAMTS12 ADAM metallopeptidase with thrombospondin type 1 motif, 12 1 0 0 0 0 22 9507 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1 -
Supporting Online Material
1 2 3 4 5 6 7 Supplementary Information for 8 9 Fractalkine-induced microglial vasoregulation occurs within the retina and is altered early in diabetic 10 retinopathy 11 12 *Samuel A. Mills, *Andrew I. Jobling, *Michael A. Dixon, Bang V. Bui, Kirstan A. Vessey, Joanna A. Phipps, 13 Ursula Greferath, Gene Venables, Vickie H.Y. Wong, Connie H.Y. Wong, Zheng He, Flora Hui, James C. 14 Young, Josh Tonc, Elena Ivanova, Botir T. Sagdullaev, Erica L. Fletcher 15 * Joint first authors 16 17 Corresponding author: 18 Prof. Erica L. Fletcher. Department of Anatomy & Neuroscience. The University of Melbourne, Grattan St, 19 Parkville 3010, Victoria, Australia. 20 Email: [email protected] ; Tel: +61-3-8344-3218; Fax: +61-3-9347-5219 21 22 This PDF file includes: 23 24 Supplementary text 25 Figures S1 to S10 26 Tables S1 to S7 27 Legends for Movies S1 to S2 28 SI References 29 30 Other supplementary materials for this manuscript include the following: 31 32 Movies S1 to S2 33 34 35 36 1 1 Supplementary Information Text 2 Materials and Methods 3 Microglial process movement on retinal vessels 4 Dark agouti rats were anaesthetized, injected intraperitoneally with rhodamine B (Sigma-Aldrich) to label blood 5 vessels and retinal explants established as described in the main text. Retinal microglia were labelled with Iba-1 6 and imaging performed on an inverted confocal microscope (Leica SP5). Baseline images were taken for 10 7 minutes, followed by the addition of PBS (10 minutes) and then either fractalkine or fractalkine + candesartan 8 (10 minutes) using concentrations outlined in the main text. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function
Title: Primate specific retrotransposons, SVAs, in the evolution of networks that alter brain function. Olga Vasieva1*, Sultan Cetiner1, Abigail Savage2, Gerald G. Schumann3, Vivien J Bubb2, John P Quinn2*, 1 Institute of Integrative Biology, University of Liverpool, Liverpool, L69 7ZB, U.K 2 Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK 3 Division of Medical Biotechnology, Paul-Ehrlich-Institut, Langen, D-63225 Germany *. Corresponding author Olga Vasieva: Institute of Integrative Biology, Department of Comparative genomics, University of Liverpool, Liverpool, L69 7ZB, [email protected] ; Tel: (+44) 151 795 4456; FAX:(+44) 151 795 4406 John Quinn: Department of Molecular and Clinical Pharmacology, Institute of Translational Medicine, The University of Liverpool, Liverpool L69 3BX, UK, [email protected]; Tel: (+44) 151 794 5498. Key words: SVA, trans-mobilisation, behaviour, brain, evolution, psychiatric disorders 1 Abstract The hominid-specific non-LTR retrotransposon termed SINE–VNTR–Alu (SVA) is the youngest of the transposable elements in the human genome. The propagation of the most ancient SVA type A took place about 13.5 Myrs ago, and the youngest SVA types appeared in the human genome after the chimpanzee divergence. Functional enrichment analysis of genes associated with SVA insertions demonstrated their strong link to multiple ontological categories attributed to brain function and the disorders. SVA types that expanded their presence in the human genome at different stages of hominoid life history were also associated with progressively evolving behavioural features that indicated a potential impact of SVA propagation on a cognitive ability of a modern human. -
Whole Exome Sequencing in ADHD Trios from Single and Multi-Incident Families Implicates New Candidate Genes and Highlights Polygenic Transmission
European Journal of Human Genetics (2020) 28:1098–1110 https://doi.org/10.1038/s41431-020-0619-7 ARTICLE Whole exome sequencing in ADHD trios from single and multi-incident families implicates new candidate genes and highlights polygenic transmission 1,2 1 1,2 1,3 1 Bashayer R. Al-Mubarak ● Aisha Omar ● Batoul Baz ● Basma Al-Abdulaziz ● Amna I. Magrashi ● 1,2 2 2,4 2,4,5 6 Eman Al-Yemni ● Amjad Jabaan ● Dorota Monies ● Mohamed Abouelhoda ● Dejene Abebe ● 7 1,2 Mohammad Ghaziuddin ● Nada A. Al-Tassan Received: 26 September 2019 / Revised: 26 February 2020 / Accepted: 10 March 2020 / Published online: 1 April 2020 © The Author(s) 2020. This article is published with open access Abstract Several types of genetic alterations occurring at numerous loci have been described in attention deficit hyperactivity disorder (ADHD). However, the role of rare single nucleotide variants (SNVs) remains under investigated. Here, we sought to identify rare SNVs with predicted deleterious effect that may contribute to ADHD risk. We chose to study ADHD families (including multi-incident) from a population with a high rate of consanguinity in which genetic risk factors tend to 1234567890();,: 1234567890();,: accumulate and therefore increasing the chance of detecting risk alleles. We employed whole exome sequencing (WES) to interrogate the entire coding region of 16 trios with ADHD. We also performed enrichment analysis on our final list of genes to identify the overrepresented biological processes. A total of 32 rare variants with predicted damaging effect were identified in 31 genes. At least two variants were detected per proband, most of which were not exclusive to the affected individuals. -
Plasma Omentin Levels Are Inversely Associated with Atherosclerosis In
Nishimura et al. Cardiovasc Diabetol (2019) 18:167 https://doi.org/10.1186/s12933-019-0973-3 Cardiovascular Diabetology ORIGINAL INVESTIGATION Open Access Plasma omentin levels are inversely associated with atherosclerosis in type 2 diabetes patients with increased plasma adiponectin levels: a cross-sectional study Masami Nishimura1, Tomoaki Morioka1* , Mariko Hayashi1, Yoshinori Kakutani1, Yuko Yamazaki1, Masafumi Kurajoh1, Katsuhito Mori2, Shinya Fukumoto3, Atsushi Shioi4,5, Tetsuo Shoji4,5, Masaaki Inaba1,5 and Masanori Emoto1 Abstract Background: Omentin and adiponectin are among the anti-infammatory and anti-atherogenic adipokines that have potentially benefcial efects on cardiovascular disorders. Recent studies indicate a paradoxical relationship between adiponectin and cardiovascular mortality across many clinical settings including type 2 diabetes. In this study, we characterized the clinical features of type 2 diabetes patients with increased adiponectin levels and exam- ined the association between omentin and atherosclerosis in those patients. Methods: The subjects were 413 patients with type 2 diabetes. Fasting plasma omentin and total adiponectin levels were measured by enzyme-linked immunosorbent assay. The intima-media thickness (IMT) of the common carotid artery was measured by ultrasonography. The subjects were stratifed according to the median value of plasma adiponectin. Results: In high-adiponectin group, omentin levels were higher, while IMT tended to be greater than those in low- adiponectin group. The high-adiponectin group also exhibited older age, higher systolic blood pressure, lower kidney function, body mass index, and insulin resistance index compared to the low-adiponectin group. Multivariate analysis revealed that omentin levels were independently and negatively associated with IMT in high-adiponectin group, but not in low-adiponectin group, after adjusting for adiponectin levels and traditional cardiovascular risk factors. -
Molecular and Cellular Mechanisms of the Angiogenic Effect of Poly(Methacrylic Acid-Co-Methyl Methacrylate) Beads
Molecular and Cellular Mechanisms of the Angiogenic Effect of Poly(methacrylic acid-co-methyl methacrylate) Beads by Lindsay Elizabeth Fitzpatrick A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Institute of Biomaterials and Biomedical Engineering University of Toronto © Copyright by Lindsay Elizabeth Fitzpatrick 2012 Molecular and Cellular Mechanisms of the Angiogenic Effect of Poly(methacrylic acid-co-methyl methacrylate) Beads Lindsay Elizabeth Fitzpatrick Doctorate of Philosophy Institute of Biomaterials and Biomedical Engineering University of Toronto 2012 Abstract Poly(methacrylic acid -co- methyl methacrylate) beads were previously shown to have a therapeutic effect on wound closure through the promotion of angiogenesis. However, it was unclear how this polymer elicited its beneficial properties. The goal of this thesis was to characterize the host response to MAA beads by identifying molecules of interest involved in MAA-mediated angiogenesis (in comparison to poly(methyl methacrylate) beads, PMMA). Using a model of diabetic wound healing and a macrophage-like cell line (dTHP-1), eight molecules of interest were identified in the host response to MAA beads. Gene and/or protein expression analysis showed that MAA beads increased the expression of Shh, IL-1β, IL-6, TNF- α and Spry2, but decreased the expression of CXCL10 and CXCL12, compared to PMMA and no beads. MAA beads also appeared to modulate the expression of OPN. In vivo, the global gene expression of OPN was increased in wounds treated with MAA beads, compared to PMMA and no beads. In contrast, dTHP-1 decreased OPN gene expression compared to PMMA and no beads, but expressed the same amount of secreted OPN, suggesting that the cells decreased the expression of the intracellular isoform of OPN. -
(Title of the Thesis)*
THE PHYSIOLOGICAL ACTIONS OF ADIPONECTIN IN CENTRAL AUTONOMIC NUCLEI: IMPLICATIONS FOR THE INTEGRATIVE CONTROL OF ENERGY HOMEOSTASIS by Ted Donald Hoyda A thesis submitted to the Department of Physiology In conformity with the requirements for the degree of Doctor of Philosophy Queen‟s University Kingston, Ontario, Canada (September, 2009) Copyright © Ted Donald Hoyda, 2009 ABSTRACT Adiponectin regulates feeding behavior, energy expenditure and autonomic function through the activation of two receptors present in nuclei throughout the central nervous system, however much remains unknown about the mechanisms mediating these effects. Here I investigate the actions of adiponectin in autonomic centers of the hypothalamus (the paraventricular nucleus) and brainstem (the nucleus of the solitary tract) through examining molecular, electrical, hormonal and physiological consequences of peptidergic signalling. RT-PCR and in situ hybridization experiments demonstrate the presence of AdipoR1 and AdipoR2 mRNA in the paraventricular nucleus. Investigation of the electrical consequences following receptor activation in the paraventricular nucleus indicates that magnocellular-oxytocin cells are homogeneously inhibited while magnocellular-vasopressin neurons display mixed responses. Single cell RT-PCR analysis shows oxytocin neurons express both receptors while vasopressin neurons express either both receptors or one receptor. Co-expressing oxytocin and vasopressin neurons express neither receptor and are not affected by adiponectin. Median eminence projecting corticotropin releasing hormone neurons, brainstem projecting oxytocin neurons, and thyrotropin releasing hormone neurons are all depolarized by adiponectin. Plasma adrenocorticotropin hormone concentration is increased following intracerebroventricular injections of adiponectin. I demonstrate that the nucleus of the solitary tract, the primary cardiovascular regulation site of the medulla, expresses mRNA for AdipoR1 and AdipoR2 and mediates adiponectin induced hypotension. -
Proteomic Analysis Uncovers Measles Virus Protein C Interaction with P65
bioRxiv preprint doi: https://doi.org/10.1101/2020.05.08.084418; this version posted May 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Proteomic Analysis Uncovers Measles Virus Protein C Interaction with p65/iASPP/p53 Protein Complex Alice Meignié1,2*, Chantal Combredet1*, Marc Santolini 3,4, István A. Kovács4,5,6, Thibaut Douché7, Quentin Giai Gianetto 7,8, Hyeju Eun9, Mariette Matondo7, Yves Jacob10, Regis Grailhe9, Frédéric Tangy1**, and Anastassia V. Komarova1, 10** 1 Viral Genomics and Vaccination Unit, Department of Virology, Institut Pasteur, CNRS UMR-3569, 75015 Paris, France 2 Université Paris Diderot, Sorbonne Paris Cité, Paris, France 3 Center for Research and Interdisciplinarity (CRI), Université de Paris, INSERM U1284 4 Network Science Institute and Department of Physics, Northeastern University, Boston, MA 02115, USA 5 Department of Physics and Astronomy, Northwestern University, Evanston, IL 60208-3109, USA 6 Department of Network and Data Science, Central European University, Budapest, H-1051, Hungary 7 Proteomics platform, Mass Spectrometry for Biology Unit (MSBio), Institut Pasteur, CNRS USR 2000, Paris, France. 8 Bioinformatics and Biostatistics Hub, Computational Biology Department, Institut Pasteur, CNRS USR3756, Paris, France 9 Technology Development Platform, Institut Pasteur Korea, Seongnam-si, Republic of Korea 10 Laboratory of Molecular Genetics of RNA Viruses, Institut Pasteur, CNRS UMR-3569,