Primate Specific Retrotransposons, Svas, in the Evolution of Networks That Alter Brain Function
Total Page:16
File Type:pdf, Size:1020Kb
Load more
										Recommended publications
									
								- 
												
												A Novel Approach to Identify Driver Genes Involved in Androgen-Independent Prostate Cancer
Schinke et al. Molecular Cancer 2014, 13:120 http://www.molecular-cancer.com/content/13/1/120 RESEARCH Open Access A novel approach to identify driver genes involved in androgen-independent prostate cancer Ellyn N Schinke1, Victor Bii1, Arun Nalla1, Dustin T Rae1, Laura Tedrick1, Gary G Meadows1 and Grant D Trobridge1,2* Abstract Background: Insertional mutagenesis screens have been used with great success to identify oncogenes and tumor suppressor genes. Typically, these screens use gammaretroviruses (γRV) or transposons as insertional mutagens. However, insertional mutations from replication-competent γRVs or transposons that occur later during oncogenesis can produce passenger mutations that do not drive cancer progression. Here, we utilized a replication-incompetent lentiviral vector (LV) to perform an insertional mutagenesis screen to identify genes in the progression to androgen-independent prostate cancer (AIPC). Methods: Prostate cancer cells were mutagenized with a LV to enrich for clones with a selective advantage in an androgen-deficient environment provided by a dysregulated gene(s) near the vector integration site. We performed our screen using an in vitro AIPC model and also an in vivo xenotransplant model for AIPC. Our approach identified proviral integration sites utilizing a shuttle vector that allows for rapid rescue of plasmids in E. coli that contain LV long terminal repeat (LTR)-chromosome junctions. This shuttle vector approach does not require PCR amplification and has several advantages over PCR-based techniques. Results: Proviral integrations were enriched near prostate cancer susceptibility loci in cells grown in androgen- deficient medium (p < 0.001), and five candidate genes that influence AIPC were identified; ATPAF1, GCOM1, MEX3D, PTRF, and TRPM4. - 
												
												Viewed Under 23 (B) Or 203 (C) fi M M Male Cko Mice, and Largely Unaffected Magni Cation; Scale Bars, 500 M (B) and 50 M (C)
BRIEF COMMUNICATION www.jasn.org Renal Fanconi Syndrome and Hypophosphatemic Rickets in the Absence of Xenotropic and Polytropic Retroviral Receptor in the Nephron Camille Ansermet,* Matthias B. Moor,* Gabriel Centeno,* Muriel Auberson,* † † ‡ Dorothy Zhang Hu, Roland Baron, Svetlana Nikolaeva,* Barbara Haenzi,* | Natalya Katanaeva,* Ivan Gautschi,* Vladimir Katanaev,*§ Samuel Rotman, Robert Koesters,¶ †† Laurent Schild,* Sylvain Pradervand,** Olivier Bonny,* and Dmitri Firsov* BRIEF COMMUNICATION *Department of Pharmacology and Toxicology and **Genomic Technologies Facility, University of Lausanne, Lausanne, Switzerland; †Department of Oral Medicine, Infection, and Immunity, Harvard School of Dental Medicine, Boston, Massachusetts; ‡Institute of Evolutionary Physiology and Biochemistry, St. Petersburg, Russia; §School of Biomedicine, Far Eastern Federal University, Vladivostok, Russia; |Services of Pathology and ††Nephrology, Department of Medicine, University Hospital of Lausanne, Lausanne, Switzerland; and ¶Université Pierre et Marie Curie, Paris, France ABSTRACT Tight control of extracellular and intracellular inorganic phosphate (Pi) levels is crit- leaves.4 Most recently, Legati et al. have ical to most biochemical and physiologic processes. Urinary Pi is freely filtered at the shown an association between genetic kidney glomerulus and is reabsorbed in the renal tubule by the action of the apical polymorphisms in Xpr1 and primary fa- sodium-dependent phosphate transporters, NaPi-IIa/NaPi-IIc/Pit2. However, the milial brain calcification disorder.5 How- molecular identity of the protein(s) participating in the basolateral Pi efflux remains ever, the role of XPR1 in the maintenance unknown. Evidence has suggested that xenotropic and polytropic retroviral recep- of Pi homeostasis remains unknown. Here, tor 1 (XPR1) might be involved in this process. Here, we show that conditional in- we addressed this issue in mice deficient for activation of Xpr1 in the renal tubule in mice resulted in impaired renal Pi Xpr1 in the nephron. - 
												
												CCDC109B (MCUB) (NM 017918) Human Untagged Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC327798 CCDC109B (MCUB) (NM_017918) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: CCDC109B (MCUB) (NM_017918) Human Untagged Clone Tag: Tag Free Symbol: MCUB Synonyms: CCDC109B Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin Fully Sequenced ORF: >OriGene SC327798 ORF sequence for NM_017918, the custom clone sequence may differ by one or more nucleotides ATGTTGTCAACAGTTGGTTCATTCCTTCAGGACCTACAAAATGAAGATAAGGGTATCAAAACTGCAGCCA TCTTCACAGCAGATGGCAACATGATTTCAGCTTCTACCTTGATGGATATTTTGCTAATGAATGATTTTAA ACTTGTCATTAATAAAATAGCATATGATGTGCAGTGTCCAAAGAGAGAAAAACCAAGTAATGAGCACACT GCTGAGATGGAACACATGAAATCCTTGGTTCACAGACTATTTACAATCTTGCATTTAGAAGAGTCTCAGA AAAAGAGAGAGCACCATTTACTGGAGAAAATTGACCACCTGAAGGAACAGCTGCAGCCCCTTGAACAGGT GAAAGCTGGAATAGAAGCTCATTCGGAAGCCAAAACCAGTGGACTCCTGTGGGCTGGATTGGCACTGCTG TCCATTCAGGGTGGGGCACTGGCCTGGCTCACGTGGTGGGTGTACTCCTGGGATATCATGGAGCCAGTTA CATACTTCATCACATTTGCAAATTCTATGGTCTTTTTTGCATACTTTATAGTCACTCGACAGGATTATAC TTACTCAGCTGTTAAGAGTAGGCAATTTCTTCAGTTCTTCCACAAGAAATCAAAGCAACAGCACTTTGAT GTGCAGCAATACAACAAGTTAAAAGAAGACCTTGCTAAGGCTAAAGAATCCCTGAAACAGGCGCGTCATT CTCTCTGTTTGCAAATGCAAGTAGAAGAACTCAATGAAAAGAATTAA Restriction Sites: SgfI-MluI ACCN: NM_017918 OTI Disclaimer: Our molecular clone sequence data has been matched to the reference identifier above as a point - 
												
												No Evidence of Association Between Complement Factor I Genetic Variant
European Journal of Human Genetics (2012) 20, 1–3 & 2012 Macmillan Publishers Limited All rights reserved 1018-4813/12 www.nature.com/ejhg LETTERS US-based sample of around 1200 cases with advanced AMD and No evidence of association 800 controls. The association signal extended over a region of about 175 kb, the most associated variant (Po10À7)beingtheSNP rs10033900 near the complement factor I (CFI) gene. Two replication between complement studies2,3 published also in this journal provided some additional support for an AMD susceptibility locus in this region. In the course factor I genetic variant of candidate gene studies of AMD, we had previously investigated SNPs spanning CFI including rs10033900 in a UK case–control rs10033900 and sample, which shows the expected associations with the well- established AMD-susceptibility loci CFH, ARMS2, CFB and C3.No age-related macular evidence of association with the CFI variants was observed. Following publication of the reports cited above we have typed rs10033900 degeneration in additional cases and controls in two independent samples from England and Scotland to investigate this further. Full details of the phenotyping criteria have been reported pre- viously.4 The English sample comprised of 859 cases with predomi- European Journal of Human Genetics (2012) 20, 1–2; nantly advanced AMD, either geographic atrophy (GA) or choroidal doi:10.1038/ejhg.2011.118; published online 12 October 2011 neovascularisation (CNV) and 423 examined controls. The Scottish sample consisted of 505 cases with either intermediate disease (age-related maculopathy, ARM) or advanced AMD, and 351 exam- In 2008, an association between age-related macular degeneration ined controls. - 
												
												Constitutive Activation of RAS/MAPK Pathway Cooperates with Trisomy 21 and Is Therapeutically Exploitable in Down Syndrome B-Cell Leukemia
Author Manuscript Published OnlineFirst on March 27, 2020; DOI: 10.1158/1078-0432.CCR-19-3519 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited. Constitutive activation of RAS/MAPK pathway cooperates with trisomy 21 and is therapeutically exploitable in Down syndrome B-cell Leukemia Anouchka P. Laurent1,2, Aurélie Siret1, Cathy Ignacimouttou1, Kunjal Panchal3, M’Boyba K. Diop4, Silvia Jenny5, Yi-Chien Tsai5, Damien Ross-Weil1, Zakia Aid1, Naïs Prade6, Stéphanie Lagarde6, Damien Plassard7, Gaelle Pierron8, Estelle Daudigeos-Dubus4, Yann Lecluse4, Nathalie Droin1, Beat Bornhauser5, Laurence C. Cheung3,9, John D. Crispino10, Muriel Gaudry1, Olivier A. Bernard1, Elizabeth Macintyre11, Carole Barin Bonnigal12, Rishi S. Kotecha3,9,13, Birgit Geoerger4, Paola Ballerini14, Jean-Pierre Bourquin5, Eric Delabesse6, Thomas Mercher1,15 and Sébastien Malinge1,3 1INSERM U1170, Gustave Roussy Institute, Université Paris Saclay, Villejuif, France 2Université Paris Diderot, Paris, France 3Telethon Kids Cancer Centre, Telethon Kids Institute, University of Western Australia, Perth, Australia 4Gustave Roussy Institute Cancer Campus, Department of Pediatric and Adolescent Oncology, INSERM U1015, Equipe Labellisée Ligue Nationale contre le Cancer, Université Paris-Saclay, Villejuif, France 5Department of Pediatric Oncology, Children’s Research Centre, University Children’s Hospital Zurich, Zurich, Switzerland 6Centre of Research on Cancer of Toulouse (CRCT), CHU Toulouse, Université Toulouse III, Toulouse, France 7IGBMC, Plateforme GenomEast, UMR7104 CNRS, Ilkirch, France 8Service de Génétique, Institut Curie, Paris, France 9School of Pharmacy and Biomedical Sciences, Curtin University, Bentley, Australia 10Division of Hematology/Oncology, Northwestern University, Chicago, USA 11Hematology, Université de Paris, Institut Necker-Enfants Malades and Assistance Publique – Hopitaux de Paris, Paris, France 12Centre Hospitalier Universitaire de Tours, Tours, France 1 Downloaded from clincancerres.aacrjournals.org on September 30, 2021. - 
												
												Aquaporin Channels in the Heart—Physiology and Pathophysiology
International Journal of Molecular Sciences Review Aquaporin Channels in the Heart—Physiology and Pathophysiology Arie O. Verkerk 1,2,* , Elisabeth M. Lodder 2 and Ronald Wilders 1 1 Department of Medical Biology, Amsterdam University Medical Centers, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; [email protected] 2 Department of Experimental Cardiology, Amsterdam University Medical Centers, University of Amsterdam, 1105 AZ Amsterdam, The Netherlands; [email protected] * Correspondence: [email protected]; Tel.: +31-20-5664670 Received: 29 March 2019; Accepted: 23 April 2019; Published: 25 April 2019 Abstract: Mammalian aquaporins (AQPs) are transmembrane channels expressed in a large variety of cells and tissues throughout the body. They are known as water channels, but they also facilitate the transport of small solutes, gasses, and monovalent cations. To date, 13 different AQPs, encoded by the genes AQP0–AQP12, have been identified in mammals, which regulate various important biological functions in kidney, brain, lung, digestive system, eye, and skin. Consequently, dysfunction of AQPs is involved in a wide variety of disorders. AQPs are also present in the heart, even with a specific distribution pattern in cardiomyocytes, but whether their presence is essential for proper (electro)physiological cardiac function has not intensively been studied. This review summarizes recent findings and highlights the involvement of AQPs in normal and pathological cardiac function. We conclude that AQPs are at least implicated in proper cardiac water homeostasis and energy balance as well as heart failure and arsenic cardiotoxicity. However, this review also demonstrates that many effects of cardiac AQPs, especially on excitation-contraction coupling processes, are virtually unexplored. - 
												
												Novel Gene Fusions in Glioblastoma Tumor Tissue and Matched Patient Plasma
cancers Article Novel Gene Fusions in Glioblastoma Tumor Tissue and Matched Patient Plasma 1, 1, 1 1 1 Lan Wang y, Anudeep Yekula y, Koushik Muralidharan , Julia L. Small , Zachary S. Rosh , Keiko M. Kang 1,2, Bob S. Carter 1,* and Leonora Balaj 1,* 1 Department of Neurosurgery, Massachusetts General Hospital and Harvard Medical School, Boston, MA 02115, USA; [email protected] (L.W.); [email protected] (A.Y.); [email protected] (K.M.); [email protected] (J.L.S.); [email protected] (Z.S.R.); [email protected] (K.M.K.) 2 School of Medicine, University of California San Diego, San Diego, CA 92092, USA * Correspondence: [email protected] (B.S.C.); [email protected] (L.B.) These authors contributed equally. y Received: 11 March 2020; Accepted: 7 May 2020; Published: 13 May 2020 Abstract: Sequencing studies have provided novel insights into the heterogeneous molecular landscape of glioblastoma (GBM), unveiling a subset of patients with gene fusions. Tissue biopsy is highly invasive, limited by sampling frequency and incompletely representative of intra-tumor heterogeneity. Extracellular vesicle-based liquid biopsy provides a minimally invasive alternative to diagnose and monitor tumor-specific molecular aberrations in patient biofluids. Here, we used targeted RNA sequencing to screen GBM tissue and the matched plasma of patients (n = 9) for RNA fusion transcripts. We identified two novel fusion transcripts in GBM tissue and five novel fusions in the matched plasma of GBM patients. The fusion transcripts FGFR3-TACC3 and VTI1A-TCF7L2 were detected in both tissue and matched plasma. - 
												
												Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897 - 
												
												A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. - 
												
												A Multi-Omics Interpretable Machine Learning Model Reveals Modes of Action of Small Molecules Natasha L
www.nature.com/scientificreports OPEN A Multi-Omics Interpretable Machine Learning Model Reveals Modes of Action of Small Molecules Natasha L. Patel-Murray1, Miriam Adam2, Nhan Huynh2, Brook T. Wassie2, Pamela Milani2 & Ernest Fraenkel 2,3* High-throughput screening and gene signature analyses frequently identify lead therapeutic compounds with unknown modes of action (MoAs), and the resulting uncertainties can lead to the failure of clinical trials. We developed an approach for uncovering MoAs through an interpretable machine learning model of transcriptomics, epigenomics, metabolomics, and proteomics. Examining compounds with benefcial efects in models of Huntington’s Disease, we found common MoAs for compounds with unrelated structures, connectivity scores, and binding targets. The approach also predicted highly divergent MoAs for two FDA-approved antihistamines. We experimentally validated these efects, demonstrating that one antihistamine activates autophagy, while the other targets bioenergetics. The use of multiple omics was essential, as some MoAs were virtually undetectable in specifc assays. Our approach does not require reference compounds or large databases of experimental data in related systems and thus can be applied to the study of agents with uncharacterized MoAs and to rare or understudied diseases. Unknown modes of action of drug candidates can lead to unpredicted consequences on efectiveness and safety. Computational methods, such as the analysis of gene signatures, and high-throughput experimental methods have accelerated the discovery of lead compounds that afect a specifc target or phenotype1–3. However, these advances have not dramatically changed the rate of drug approvals. Between 2000 and 2015, 86% of drug can- didates failed to earn FDA approval, with toxicity or a lack of efcacy being common reasons for their clinical trial termination4,5. - 
												
												Multiple Myeloma Risk Variant at 7P15.3 Creates an IRF4-Binding Site and Interferes with CDCA7L Expression
ARTICLE Received 7 Jul 2016 | Accepted 19 Oct 2016 | Published 24 Nov 2016 DOI: 10.1038/ncomms13656 OPEN Multiple myeloma risk variant at 7p15.3 creates an IRF4-binding site and interferes with CDCA7L expression Ni Li1,2, David C. Johnson2, Niels Weinhold3,4, James B. Studd1, Giulia Orlando1, Fabio Mirabella2, Jonathan S. Mitchell1, Tobias Meissner5, Martin Kaiser2, Hartmut Goldschmidt4,6, Kari Hemminki7,8, Gareth J. Morgan3 & Richard S. Houlston1,2 Genome-wide association studies have identified several risk loci for multiple myeloma (MM); however, the mechanisms by which they influence MM are unknown. Here by using genetic association data and functional characterization, we demonstrate that rs4487645 G4T, the most highly associated variant (P ¼ 5.30 Â 10 À 25), resides in an enhancer element 47 kb upstream of the transcription start site of c-Myc-interacting CDCA7L. The G-risk allele, associated with increased CDCA7L expression (P ¼ 1.95 Â 10 À 36), increases IRF4 binding and the enhancer interacts with the CDCA7L promoter. We show that suppression of CDCA7L limits MM proliferation through apoptosis, and increased CDCA7L expression is associated with adverse patient survival. These findings implicate IRF4-mediated CDCA7L expression in MM biology and indicate how germline variation might confer susceptibility to MM. 1 Division of Genetics and Epidemiology, The Institute of Cancer Research, Surrey SM2 5NG, UK. 2 Division of Molecular Pathology, The Institute of Cancer Research, Surrey SM2 5NG, UK. 3 Myeloma Institute for Research and Therapy, University of Arkansas for Medical Sciences, Little Rock, Arkansas 72205, USA. 4 Department of Internal Medicine V, University of Heidelberg, 69117 Heidelberg, Germany. - 
												
												1 UST College of Science Department of Biological Sciences
UST College of Science Department of Biological Sciences 1 Pharmacogenomics of Myofascial Pain Syndrome An Undergraduate Thesis Submitted to the Department of Biological Sciences College of Science University of Santo Tomas In Partial Fulfillment of the Requirements for the Degree of Bachelor of Science in Biology Jose Marie V. Lazaga Marc Llandro C. Fernandez May 2021 UST College of Science Department of Biological Sciences 2 PANEL APPROVAL SHEET This undergraduate research manuscript entitled: Pharmacogenomics of Myofascial Pain Syndrome prepared and submitted by Jose Marie V. Lazaga and Marc Llandro C. Fernandez, was checked and has complied with the revisions and suggestions requested by panel members after thorough evaluation. This final version of the manuscript is hereby approved and accepted for submission in partial fulfillment of the requirements for the degree of Bachelor of Science in Biology. Noted by: Asst. Prof. Marilyn G. Rimando, PhD Research adviser, Bio/MicroSem 602-603 Approved by: Bio/MicroSem 603 panel member Bio/MicroSem 603 panel member Date: Date: UST College of Science Department of Biological Sciences 3 DECLARATION OF ORIGINALITY We hereby affirm that this submission is our own work and that, to the best of our knowledge and belief, it contains no material previously published or written by another person nor material to which a substantial extent has been accepted for award of any other degree or diploma of a university or other institute of higher learning, except where due acknowledgement is made in the text. We also declare that the intellectual content of this undergraduate research is the product of our work, even though we may have received assistance from others on style, presentation, and language expression.