Molecular Human Reproduction Vol.7, No.6 pp. 513–520, 2001 Teratozoospermia in mice lacking the transition protein 2 (Tnp2) Ibrahim M.Adham1, Karim Nayernia1, Elke Burkhardt-Go¨ttges1,O¨ zlem Topaloglu1, Christa Dixkens1, Adolf F.Holstein2 and Wolfgang Engel1,3 1Institute of Human Genetics, University of Go¨ttingen, D-37073 Go¨ttingen and 2Department of Anatomy, Eppendorf University Hospital, D-20251 Hamburg, Germany 3To whom correspondence should be addressed at: Institute of Human Genetics, University of Go¨ttingen D-37073 Go¨ttingen, Germany. E-mail: [email protected] It is believed that the transition proteins (Tnp1 and Tnp2) participate in the removal of the nucleohistones and in the initial condensation of the spermatid nucleus. Later in spermatogenesis, Tnp1 and Tnp2 are replaced by the protamines 1 and 2. In an effort to elucidate the physiological role of Tnp2, we have disrupted its locus by homologous recombination. Breeding of the Tnp2–/– males on different genetic backgrounds revealed normal fertility on the mixed background C57BL/6J⍥129/Sv, but total infertility on the inbred 129/Sv background. Light and electron microscopy showed that the germ cells were capable of undergoing chromatin condensation, although many spermatozoa exhibited head abnormalities with acrosomes not attached to the nuclear envelope. Furthermore, migration of Tnp2–/– spermatozoa from the uterus into the oviduct was reduced. These results suggest that male infertility of the Tnp2–/– mice is a result of sperm head abnormalities and reduced sperm motility. The increased level of the Tnp1 transcript in testes of the Tnp2-deficient mice raises the possibility that a deficiency created through the disruption of the Tnp2 gene can be compensated for by recruitment of the Tnp1. Key words: acrosome/chromatin condensation/genetic background/teratozoospermia/Tnp2 Introduction maximum concentration. Ultrastructural studies have shown After the meiotic division, the germ cells enter spermio- that chromatin condensation occurs between steps 12 and 14, genesis, the haploid phase of spermatogenesis, where round starting at the anterior portion of the nucleus and then spreading spermatids differentiate into elongated spermatids and ulti- gradually towards the posterior region (Dooher and Bennett, mately spermatozoa. One of the morphological changes that 1973). Thus, the first reactivity of Tnp2 appears at that time accompany spermatid differentiation is the nuclear organization when the chromatin still has a fibrillar and lightly stained of the male germ cell (Fawcett et al., 1971; Dooher and structure at steps 10–11 (Kistler et al., 1996). Bennett, 1973). During this process, various modifications The nucleoprotein genes Tnp2, Prm1 and Prm2 are closely occur in the nature of proteins associated with the DNA and linked in a stretch of DNA, 13-15 kb long, on human the result is the progressive condensation of the chromatin. chromosome 16p13.3 and on mouse chromosome 16 (Schlu¨ter This morphological transformation induces the gradual dis- et al., 1992; Nelson and Krawetz, 1994). In this cluster, a new placement of testis-specific and remaining somatic histones by member of the protamine family (Prm3) has been identified transition proteins 1 and 2 (Tnp1 and Tnp2) which are thought and characterized (Schlu¨ter and Engel, 1995; Schlu¨ter et al., to participate in the initial condensation of the spermatid 1996). Tnp1 is the only gene encoding germ cell-specific nucleus. Shortly thereafter, the transition proteins are replaced nucleoproteins which is localized on a separate chromosome. by the protamines Prm1 and Prm2, which are characteristic The Tnp2 protein, a 117 amino acid long molecule, contains for the mature sperm nucleus (Balhorn et al., 1984). Immuno- a basic domain and two proposed zinc finger motifs at the staining of rat testis with Tnp1, Tnp2 and Prm1 antisera has amino and carboxyl regions, respectively (Baskaran and Rao, shown that the appearance of the Tnp2 in the spermatid nucleus 1991). These two domains may be responsible for the inter- precedes that of Tnp1 and Prm1. Tnp2 is found diffusely action of the Tnp2 with the DNA. The considerable sequence distributed over the anterior tip of the nuclei in step 10 variation in the primary structure of Tnp2 between species spermatids and remains localized over the more anterior portion leads one to believe that Tnp2 is involved in the establishment of the nucleus even in step 13 spermatids where it is at its of species-specific sperm nucleus morphology (Fawcett et al., © European Society of Human Reproduction and Embryology 513 I.M.Adham et al. 1971; Kleene and Flynn, 1987; Luerssen et al., 1989; Reinhardt formed according to standard protocols to discriminate wild-type and et al, 1991; Keime et al., 1992; Alfons and Kistler, 1993). mutant alleles in the DNA from mouse tails. Primer sequences were However, the first appearance of Tnp2 in nuclei of elongated as follows: 1 (Tpn2 sense), 5Ј- AACCAGTGCAATCAGTGCACC; Ј spermatids which have essentially completed the morphological 2(Tpn2 antisense), 5 - ATGGACACAGGAACATCCTGG; 3 (Pgk Ј changes of the nuclear shaping and which are undergoing antisense), 5 - TCTGAGCCCAGAAAGCGAAGG. Thermal cycling was carried out for 35 cycles, denaturation at chromosomal condensation rules out the role of Tnp2 in 94°C for 30 s, annealing at 58°C for 30 min, and extension at 72°C determination of the nuclear morphology (Fawcett et al., 1971; for 1 min. One-fifth of each reaction mixture was electrophoresed on Dooher and Bennett, 1973; Alfons and Kistler, 1993; Oko 2% agarose gels and stained with ethidium bromide. Primer pair 1/2 et al., 1996). amplified a 353 bp fragment in the heterozygous and wild-type To investigate the role of Tnp2 in the differentiation and samples, whereas the primer pair 1/3 amplified a 616 bp fragment function of the male germ cell, we have generated mice with the DNA of both heterozygous and homozygous animals. containing a targeted disruption of the Tnp2 gene. Male infertility was associated with the homozygous mutation on RNA blot hybridization an inbred (129/Sv) genetic background, but fertility was not Total RNA was extracted from tissues using the RNA Now Kit (ITC affected in Tnp2-deficient mice on a mixed (C57 BL/6Jϫ129/ Biotechnologies, Heidelberg, Germany) according to the manufac- Sv) genetic background. To determine the underlying cause turer’s recommendation. The RNA was size fractionated by electro- phoresis on a 1% agarose gel containing formaldehyde, transferred for male infertility, we have examined several parameters of to a nylon membrane, and hybridized with a 32P-labelled cDNA sperm function. The cumulative results presented here showed fragment, under the same conditions as those used for Southern blot that the deficiency of Tnp2 leads to sperm head abnormalities hybridization. which are most probably due to malformations in the attachment of the acrosome to the nuclear involvement. The Extraction of basic nuclear proteins and Western blot acrosomal defects appeared to influence the acrosome reaction Basic nuclear extracts were prepared from mouse testis as described and the ability of the spermatozoa to penetrate the zona (Alfonso and Kistler, 1993). Aliquots (10 µg of protein) of nuclear pellucida of the oocyte. In addition, the migration of the extract fractions were subjected to 20% polyacrylamide gels con- spermatozoa through the female genital tract was found to be taining 0.9 mol/l acidic acid and 6 mol/l urea (Panyim and Chalkley, impaired. 1969) and the gels were blotted onto nitrocellulose filters. Membranes were then incubated with rabbit Tnp2 antiserum or rabbit H.1.1 antiserum as described (Alfonso and Kistler, 1993; Franke et al., 1998). Materials and methods Electron microscopy Generation of the Tnp2-mutant mice Testes and epididymides were fixed with 5% glutaraldehyde in A P2 clone carrying the mouse Tnp2 gene was isolated from 0.2 mol/l phosphate buffer, postfixed with 2% osmium tetroxide, and the C129/ES cell library (Genome Systems, Cambridge, UK) by embedded in epoxy (Epon) resin. Sections at 70 nm were stained polymerase chain reaction (PCR) screening (Schlu¨ter et al., 1996). A with 1% Toluidine Blue/pyronine. 6.3 kb EcoRI fragment and a 3.6 kb EcoRI/XbaI fragment, together containing the closely linked Prm2, Prm3 and Tnp2 genes, were Analysis of fertility subcloned into pBluescript vector (Stratagene, La Jolla, USA) and To assay the fertility of Tnp2–/– males on a mixed (C57BL/6Jϫ126/ mapped with restriction enzymes (Figure 1A). A targeting vector was Sv) and on an inbred (129/Sv) genetic background, sets of 10 Tnp2–/– ϩ ϩ designed for insertion of a neomycin-resistance gene driven by a and Tnp2 / males of each genetic background from the F2 littermates PGK promoter (pgk-neo) into the SstII site of exon1. A herpes were mated, each with two CD1 females for 3 months. Females were simplex virus thymidine kinase gene (tk) cassette was attached to the checked for the presence of vaginal plug and/or pregnancy. Pregnant 3Ј end for negative selection (Figure 1A). Linearized plasmid DNA females were removed to holding cages to allow them to give birth. (30 µg) was electroporated into R ES cells (Joyner, 1993). Colonies We counted the number of litters sired from each group of males in resistant to G418 (400 µg/ml) and gancyclovir (GANC) (2 µmol/l) the 3-month mating period and the size of the litters was determined. were selected. Furthermore, 8 week old CD1 females were superovulated by i.p. Genomic DNA was extracted from ES cells, digested with EcoRI, injections of 5 IU pregnant mare serum gonadotrophin (PMSG) electrophoresed and blotted onto Hybond N membranes (Amersham, (Intergonan 5 IU; Intervet, To¨nisvorst, Germany) followed by 5 IU Braunshweig, Germany). The blots were hybridized with a 32P- human chorionic gonadotrophin (HCG) (Predalon; 5 IU, Organon, ϩ ϩ labelled 1.8 kb XbaI/EcoRI fragment (Figure 1B) at 65°C overnight Oberschleißheim, Germany) 46–48 h later, and mated with Tnp2 / and washed twice at 65°Ctofinal stringency at 0.2ϫstandard saline or Tnp2–/– males of 129/Sv genetic background.