DOCSLIB.ORG

European Journal of Immunology

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
European Journal of Immunology European Journal of Immunology Supporting Information for Eur. J. Immunol. 10.1002/eji.200838136 Features of TAP-independent MHC class I ligands revealed by quantitative mass spectrometry Andreas O. Weinzierl, Despina Rudolf, Nina Hillen, Stefan Tenzer, Peter van Endert, Hansjörg Schild, Hans-Georg Rammensee and Stefan Stevanović © 2008 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim www.eji-journal.eu Supplementary tables Supplementary table 1 A quantitative analysis of protein and mRNA levels demonstrates partial deletion of chromosome 6p21.3. The analysis comprised constitutive proteasomal subunits (PSMB1, 2 and 5), immunoproteasomal subunits (LMP7, 2 and MECL1), subunits of the immunoproteasomal regulator PA28 (PSME1-3), proteins of the HLA peptide loading complex (TAP1 and 2, tapasin, calreticulin, calnexin and PDIA3), HLA class I and II (HLA-A, -B, -C, - DR, -DP and -DQ), the endoplasmic reticulum aminopeptidase associated with antigen processing (ERAAP) and proteins of the SEC61 translocon which can be involved in peptide export from the ER. Genes encoded in the deleted region of chromosome 6p21.3 in LCL721.174 cells are highlighted in bold. Gene 2log (LCL721.174 vs. LCL721.45) Gene Title Symbol protein mRNA PSMB1 proteasome subunit beta 1 -0.29 n.d. PSMB2 proteasome subunit beta 2 -0.54 n.d. PSMB5 proteasome subunit beta 3 LCL721.174 only 0.2 LMP7 proteasome subunit beta 8 721.45 only 721.45 only LMP2 proteasome subunit beta 9 721.45 only 721.45 only MECL1 proteasome subunit beta 10 721.45 only -1.4 PSME1 proteasome activator subunit 1 -0.82 -0.7 PSME2 proteasome activator subunit 2 -0.56 0.3 PSME3 proteasome activator subunit 3 721.45 only 0.9 CALR calreticulin n.a. 0.1 CANX calnexin n.a. -1.0 TAP1 transporter 1, ATP-binding cass. 721.45 only 721.45 only TAP2 transporter 2, ATP-binding cass. 721.45 only 721.45 only TAPBP Tapasin 721.45 only -1.7 HLA-A major histocomp. complex I A -2.78 -0.8 HLA-B major histocomp. complex I B n.s.d. -1.1 HLA-C major histocomp. complex I C -2.04 -1.0 HLA-DP major histocomp. complex II DP 721.45 only 721.45 only HLA-DQ major histocomp. complex II DQ 721.45 only 721.45 only HLA-DR major histocomp. complex II DR 721.45 only 721.45 only PDIA3 protein disulfide isomerase A3 n.a. -0.8 SEC61A1 Sec61 alpha 1 subunit 721.45 only -0.2 SEC61A2 Sec61 alpha 1 subunit n.d. -0.1 SEC61B Sec61 alpha 1 subunit 721.45 only -0.3 SEC61G Sec61 alpha 1 subunit n.d. -0.9 ERAP1 ER aminopep. assoc. w. antigen process. n.d. 0.7 n.d. not detected, n.s.d. no significant detection (n < 3) , n.a. no definite ratio available Supplementary table 2 HLA ligands identified from LCL721.174 and LCL721.45. HLA presentation ratios, protein and mRNA expression ratios were calculated betweenLCL721.174 and LCL721.45. Signal sequence prediction was performed using the SwissProt database or SignalP (http://www.cbs.dtu.dk/services/SignalP/). SYFPEITHI and BIMAS scores were calculated using web based software (http://www.syfpeithi.de, http://www- bimas.cit.nih.gov/molbio/hla_bind). Gene Symbol and Title can be found at http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?db=gene. HLA protein 2log mRNA 2log 2log SYFPEITHI Bimas Sequence Gene Symbol Gene Title Position Signal seq HLA (721.174 / (721.174 / (721.174 score score 721.45) 721.45) / 721.45) LLSAEPVPA CD79B CD79B antigen 20-28 28 | 29 A*0201 9.12 18 8 n.s.d. 0.30 LLGPRLVLA TMP21 transmembrane trafficking protein 22-31 31 | 32 A*0201 7.98 24 19 n.d. -0.80 SLWGQPAEA COL4A5 collagen, type IV, alpha 5 18-26 26 | 27 A*0201 6.96 23 41 n.a. -0.10 VLAPRVLRA RCN1 reticulocalbin 1 21-29 29 | 30 A*0201 6.91 24 19 -0.04 -0.40 ALVVQVAEA HEXB hexosaminidase B 34-42 42 | 43 A*0201 6.86 24 11 n.d. -0.70 HGVFLPLV KIAA*020147 KIAA*020147 21-28 39 | 40 B*5101 6.53 26 n.a. n.d. -0.10 LLAAWTARA APP amyloid beta A4 precursor protein 9-17 17 | 18 A*0201 6.52 22 8 n.d. 0.00 VLLKARLVPA KIAA1946 KIAA1946 19-28 28 | 29 or 33 | 34 A*0201 5.58 23 72 n.d. -1.10 KMDASLGNLFA FAM3C family with sequence similarity 3, member C 30-40 24 | 25 A*0201 5.19 23 6 n.d. 0.40 LLFSHVDHVIA SLC8A1 solute carrier family 8, member 1 25-35 35 | 36 A*0201 4.81 22 27 n.d. 721.174 only FLGPWPAAS LRPAP1 LDL receptor-rel. prot. assoc. prot. 1 22-30 28 | 29 or 32 | 33 A*0201 4.57 16 0 n.d. -0.40 SLYALHVKA VKORC1 vitamin K epoxide reductase complex 23-31 31 | 32 A*0201 4.53 16 16 n.d. n.d. LLLSAEPVPA CD79B CD79B antigen 19-28 28 | 29 A*0201 4.48 20 31 n.d. 0.30 AMAPPSHLLL PELP1 Pro-Glu-Leu-rich protein 1 473-482 21 | 22 A*0201 4.19 25 15 n.d. 721.174 only MAPLALHLL IL4I1 interleukin 4 induced 1 1-9 21 | 22 B*5101 4.17 21 n.a. n.s.d. n.d. FLLGPRLVLA TMP21 transmembrane trafficking protein 22-31 31 | 32 A*0201 4.16 27 149 n.s.d. -0.80 LLLDVPTAAV IFI30 interferon, gamma-inducible protein 30 15-24 26 | 27 A*0201 4.15 30 128 n.s.d. -0.20 LLLDVPTAAVQA IFI30 interferon, gamma-inducible protein 30 15-26 26 | 27 A*0201 3.89 20 128 n.s.d. -0.20 LLLDVPTAA IFI30 interferon, gamma-inducible protein 30 15-23 26 | 27 A*0201 3.88 20 128 n.s.d. -0.20 LLDVPTAAV IFI30 interferon, gamma-inducible protein 30 16-24 26 | 27 A*0201 3.85 28 47 n.s.d. -0.20 VLFRGGPRGLLAVA SSR1 signal sequence receptor, alpha 19-32 20 | 21 A*0201 3.68 23 0 n.s.d. -1.57 ALLSSLNDF NIF3L1 NIF3 NGG1 interacting factor 3-like 1 5-13 no A*0201 3.68 19 1 n.d. 0.10 IITKEVLAP EST Sequenz EST sequence frame 3 n.a. A*0201 3.68 15 0 n.d. n.d. QLQEGKNVIGL TAGLN2 transgelin 2 166-176 no A*0201 2.98 23 18 0.25 -0.10 ILAPAGSLPKI TERE1 transitional epithelia response protein 328-338 no n.a. 2.63 n.a. n.a. n.d. 0.60 MASRWGPLIG Cab45 calcium binding protein Cab45 precursor 8-17 36 | 37 B*5101 2.19 21 260 n.d. -0.10 AVLALVLAPAGA NRP1 neuropilin 1 10-21 21 | 22 A*0201 2.11 23 19 n.d. n.d. LAPRVLRA RCN1 reticulocalbin 1 22-29 29 | 30 A*0201 2.08 n.a. n.a. -0.04 -0.40 AALLDVRSVP GDF5 growth differentiation factor 5 275-284 27 | 28 A*0201 1.94 24 2 n.d. n.d. SLPKKLALL HSPC023 HSPC023 protein 72-80 no A*0201 1.70 29 49 n.d. 0.40 KAPVTKVAA PDLIM1 PDZ and LIM domain 1 241-249 no n.a. 0.81 n.a. n.a. 1.32 1.60 NPLPSKETI TMSB4X thymosin, beta 4, X-linked 27-35 no B*5101 0.29 26 586 -0.32 n.d. MFPLVKSAL COX7B cytochrome c oxidase subunit VIIb 1-9 no B*5101 -0.15 18 n.a. n.d. 0.00 MAPRTLVL HLA-A major histocompatibility complex, I-A 4-11 24 | 25 B*5101 -0.93 24 n.a. n.d. -0.80 TLLGHEFVL CDC27 cell division cycle 27 605-613 no A*0201 -1.29 24 188 n.d. 0.70 LPHVPLGVI AUP1 ancient ubiquitous protein 1 374-382 yes B*5101 -1.74 26 629 n.d. 0.50 YLTAEILEL HIST1H2AJ histone 1, H2aj 58-66 61 | 62 A*0201 -1.86 28 226 0.49 n.d. LPREILNLI LOC116064 hypothetical protein LOC116064 259-267 no B*5101 -1.87 26 692 n.d. 0.65 LLDRFLATV CCNI cyclin I 72-80 no A*0201 -2.25 31 413 n.d. 0.20 GSHSMRYF HLA-A, -B, -C, -G major histocompatibility complex I-A, -B, -C, -G 25-32 24 | 25 n.a. -2.34 n.a. n.a. n.d. n.d. HLINYIIFL TMEM41B transmembrane protein 41B 240-248 no A*0201 -2.54 27 9 n.d. n.d. YVPRAILV TUBB3 tubulin, beta 3 59-66 no B*5101 -2.81 14 n.a. n.a. n.d. TLAEIAKVEL NONO non-POU domain containing, octamer-binding 120-129 no A*0201 -2.86 28 88 0.41 0.70 RIIEETLAL ARPC2 actin related protein 2/3 complex, subunit 2 9-17 no A*0201 -3.04 26 12 -0.04 -0.15 DGLVVLKI EIF3S3 eukar. transl. initiation factor 3, subunit 3g 42-49 no B*5101 -3.07 27 n.a. n.s.d. 0.20 MAPRTLLL HLA-C major histocompatibility complex, I-C 4-11 24 | 25 B*5101 -3.12 22 n.a. n.d. -0.98 VMAPRTLVL HLA-A major histocompatibility complex, I-A 3-11 24 | 25 B*5101 -3.23 24 n.a. n.d. -0.80 IPPIQVTKV NCOR2 nuclear receptor co-repressor 2 973-981 no B*5101 -3.42 26 286 n.d. -0.20 KLWEMDNMLI PP784 PP784 protein 56-65 no A*0201 -3.49 25 2544 n.d. n.d. YAYDGKDYLAL HLA-A, -B, -C major histocompatibility complex, I-A, -B, -C 140-150 24 | 25 B*5101 -3.51 23 173 n.d.
Load more

Recommended publications
  • 1 Supporting Information for a Microrna Network Regulates
    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
    [Show full text]
  • “The Impact of ART on Genome‐Wide Oxidation of 5‐Methylcytosine and the Transcriptome During Early Mouse Development”
    “The impact of ART on genome‐wide oxidation of 5‐methylcytosine and the transcriptome during early mouse development” Dissertation zur Erlangung des Grades “Doktor der Naturwissenschaften” am Fachbereich Biologie der Johannes Gutenberg-Universität Mainz Elif Diken geb. Söğütcü geb. am 22.07.1987 in Giresun-TURKEY Mainz 2016 Dekan: 1. Berichterstatter: 2. Berichterstatter: Tag der mündlichen Prüfung: Summary Summary The use of assisted reproductive technologies (ART) has been increasing over the past three decades due to the elevated frequency of infertility problems. Other factors such as easier access to medical aid than in the past and its coverage by health insurance companies in many developed countries also contributed to this growing interest. Nevertheless, a negative impact of ART on transcriptome and methylation reprogramming is heavily discussed. Methylation reprogramming directly after fertilization manifests itself as genome-wide DNA demethylation associated with the oxidation of 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC) in the pronuclei of mouse zygotes. To investigate the possible impact of ART particularly on this process and the transcriptome in general, pronuclear stage mouse embryos obtained upon spontaneous ovulation or superovulation through hormone stimulation representing ART were subjected to various epigenetic analyses. A whole- transcriptome RNA-Seq analysis of pronuclear stage embryos from spontaneous and superovulated matings demonstrated altered expression of the Bbs12 gene known to be linked to Bardet-Biedl syndrome (BBS) as well as the Dhx16 gene whose zebrafish ortholog was reported to be a maternal effect gene. Immunofluorescence staining with antibodies against 5mC and 5hmC showed that pronuclear stage embryos obtained by superovulation have an increased incidence of abnormal methylation and hydroxymethylation patterns in both maternal and paternal pronuclear DNA compared to their spontaneously ovulated counterparts.
    [Show full text]
  • Role and Regulation of the P53-Homolog P73 in the Transformation of Normal Human Fibroblasts
    Role and regulation of the p53-homolog p73 in the transformation of normal human fibroblasts Dissertation zur Erlangung des naturwissenschaftlichen Doktorgrades der Bayerischen Julius-Maximilians-Universität Würzburg vorgelegt von Lars Hofmann aus Aschaffenburg Würzburg 2007 Eingereicht am Mitglieder der Promotionskommission: Vorsitzender: Prof. Dr. Dr. Martin J. Müller Gutachter: Prof. Dr. Michael P. Schön Gutachter : Prof. Dr. Georg Krohne Tag des Promotionskolloquiums: Doktorurkunde ausgehändigt am Erklärung Hiermit erkläre ich, dass ich die vorliegende Arbeit selbständig angefertigt und keine anderen als die angegebenen Hilfsmittel und Quellen verwendet habe. Diese Arbeit wurde weder in gleicher noch in ähnlicher Form in einem anderen Prüfungsverfahren vorgelegt. Ich habe früher, außer den mit dem Zulassungsgesuch urkundlichen Graden, keine weiteren akademischen Grade erworben und zu erwerben gesucht. Würzburg, Lars Hofmann Content SUMMARY ................................................................................................................ IV ZUSAMMENFASSUNG ............................................................................................. V 1. INTRODUCTION ................................................................................................. 1 1.1. Molecular basics of cancer .......................................................................................... 1 1.2. Early research on tumorigenesis ................................................................................. 3 1.3. Developing
    [Show full text]
  • Activation of NF-Κb Signaling Promotes Prostate Cancer Progression in the Mouse and Predicts Poor Progression and Death in Pati
    SUPPLEMENTARY DATA: Supplementary Figure 1. NF-B signaling is continuously activated in the prostate of - mouse. In order to determine the NF- '- mouse, we crossed the '- mice with NGL, a NF-B reporter mouse. NGL transgenic mice are engineered to express a GFP/luciferase fusion protein under the control of a promoter containing multiple NF-B consensus binding sites (1). Since the NF-'- NGL mouse is activated in the whole body, the relatively high level of background activation does not allow detection of NF- prostate. Therefore, in order to determine the NF-the '- mouse, we grafted the prostates from 'o the kidney capsule of male nude mice using a tissue rescue technique. NF-B activity was measured at 7 weeks after grafting. The bioluminescence imaging shows NF-B signaling is activated (green) in the kidney, where the grafted prostate from ' use resides (B). In panel (A), the control mouse (grafted with the prostate from NGL mouse) has no bioluminescence, illustrating that in the absence of '-, there is not activation of NF- B. The circles indicate kidney areas. 1 Supplementary Figure 2. NF-B signaling activated in the prostate of Myc/IB bigenic mouse. The prostates from Myc alone (Myc) and bigenic (Myc/IB) mice were harvested at 6 months of age. Activation of NF-B signaling in the prostate was determined by IHC staining of p65-pho antibody. 2 Supplementary Figure 3. Continuous activation of NF-B signaling promotes PCa progression in the Hi-Myc transgenic mouse. The prostates from Myc alone (Myc) and bigeneic (Myc/IB) mice were harvested at 6 months of age.
    [Show full text]
  • Differential Expression of Skin Cancer and Hair-Follicle Cycle Regulated Genes in Tumor Susceptible K14-Agouti Mice
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 8-2006 Differential Expression of Skin Cancer and Hair-Follicle Cycle Regulated Genes in Tumor Susceptible K14-Agouti Mice Yesim Aydin Son University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Son, Yesim Aydin, "Differential Expression of Skin Cancer and Hair-Follicle Cycle Regulated Genes in Tumor Susceptible K14-Agouti Mice. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1636 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yesim Aydin Son entitled "Differential Expression of Skin Cancer and Hair-Follicle Cycle Regulated Genes in Tumor Susceptible K14-Agouti Mice." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the equirr ements for the degree of Doctor of Philosophy, with a major in Life Sciences. Edward J. Michaud, Major Professor We have read this dissertation and recommend its acceptance: Cymbeline T. Culiat, Mitchel
    [Show full text]
  • ID AKI Vs Control Fold Change P Value Symbol Entrez Gene Name *In
    ID AKI vs control P value Symbol Entrez Gene Name *In case of multiple probesets per gene, one with the highest fold change was selected. Fold Change 208083_s_at 7.88 0.000932 ITGB6 integrin, beta 6 202376_at 6.12 0.000518 SERPINA3 serpin peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 3 1553575_at 5.62 0.0033 MT-ND6 NADH dehydrogenase, subunit 6 (complex I) 212768_s_at 5.50 0.000896 OLFM4 olfactomedin 4 206157_at 5.26 0.00177 PTX3 pentraxin 3, long 212531_at 4.26 0.00405 LCN2 lipocalin 2 215646_s_at 4.13 0.00408 VCAN versican 202018_s_at 4.12 0.0318 LTF lactotransferrin 203021_at 4.05 0.0129 SLPI secretory leukocyte peptidase inhibitor 222486_s_at 4.03 0.000329 ADAMTS1 ADAM metallopeptidase with thrombospondin type 1 motif, 1 1552439_s_at 3.82 0.000714 MEGF11 multiple EGF-like-domains 11 210602_s_at 3.74 0.000408 CDH6 cadherin 6, type 2, K-cadherin (fetal kidney) 229947_at 3.62 0.00843 PI15 peptidase inhibitor 15 204006_s_at 3.39 0.00241 FCGR3A Fc fragment of IgG, low affinity IIIa, receptor (CD16a) 202238_s_at 3.29 0.00492 NNMT nicotinamide N-methyltransferase 202917_s_at 3.20 0.00369 S100A8 S100 calcium binding protein A8 215223_s_at 3.17 0.000516 SOD2 superoxide dismutase 2, mitochondrial 204627_s_at 3.04 0.00619 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 223217_s_at 2.99 0.00397 NFKBIZ nuclear factor of kappa light polypeptide gene enhancer in B-cells inhibitor, zeta 231067_s_at 2.97 0.00681 AKAP12 A kinase (PRKA) anchor protein 12 224917_at 2.94 0.00256 VMP1/ mir-21likely ortholog
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 9,057,109 B2 Chang (45) Date of Patent: Jun
    US009057109B2 (12) United States Patent (10) Patent No.: US 9,057,109 B2 Chang (45) Date of Patent: Jun. 16, 2015 (54) DIAGNOSIS OF MELANOMA AND SOLAR 5,989,815 A 11/1999 Skolnicket al. LENTIGO BY NUCLEC ACID ANALYSIS 6,054,277 A 4/2000 Furcht et al. 6,056,859 A 5/2000 Ramsey et al. 6,129,983 A 10/2000 Schumann et al. (71) Applicant: DermTech International, La Jolla, CA 6,203,987 B1 3/2001 Friend et al. (US) 6,312.909 B1 1 1/2001 Shyjan 6,355.439 B1 3/2002 Chung et al. (72) Inventor: Sherman H. Chang, San Diego, CA 6.410,019 B1 6/2002 DeSimone et al. 6,410,240 B1 6/2002 Hodge et al. (US) 6,551,799 B2 4/2003 Gurney et al. 6,720,145 B2 4/2004 Rheins et al. (73) Assignee: DERMTECH INTERNATIONAL, La 6,726,971 B1 4/2004 Wong Jolla, CA (US) 6,891,022 B1 5/2005 Steward et al. 6,949,338 B2 9, 2005 Rheins et al. (*) Notice: Subject to any disclaimer, the term of this 7,183,057 B2 2/2007 Benson 7,247.426 B2 7/2007 Yakhini et al. patent is extended or adjusted under 35 7,267,951 B2 9, 2007 Alani et al. U.S.C. 154(b) by 0 days. 7,297,480 B2 11/2007 Vogt 7,615,349 B2 11/2009 Riker et al. (21) Appl. No.: 14/199,900 7,662,558 B2 2/2010 Liew 7.919,246 B2 * 4/2011 Lai et al.
    [Show full text]
  • Supplemental Figure 1. Protein-Protein Interaction Network with Increased Expression in Fteb During the Luteal Phase
    Supplemental Figure 1. Protein-protein interaction network with increased expression in FTEb during the luteal phase. Supplemental Figure 2. Protein-protein interaction network with decreased expression in FTEb during luteal phase. LEGENDS TO SUPPLEMENTAL FIGURES Supplemental Figure 1. Protein-protein interaction network with increased expression in FTEb during the luteal phase. Submission of probe sets differentially expressed in the FTEb specimens that clustered with SerCa as well as those specifically altered in FTEb luteal samples to the online I2D database revealed overlapping networks of proteins with increased expression in the four FTEb samples and/or FTEb luteal samples overall. Proteins are represented by nodes, and known and predicted first-degree interactions are represented by solid lines. Genes encoding proteins shown as large ovals highlighted in blue were exclusively found in the first comparison (Manuscript Figure 2), whereas those highlighted in red were only found in the second comparison (Manuscript Figure 3). Genes encoding proteins shown as large ovals highlighted in black were found in both comparisons. The color of each node indicates the ontology of the corresponding protein as determined by the Online Predicted Human Interaction Database (OPHID) link with the NAViGaTOR software. Supplemental Figure 2. Protein-protein interaction network with decreased expression in FTEb during the luteal phase. Submission of probe sets differentially expressed in the FTEb specimens that clustered with SerCa as well as those specifically altered in FTEb luteal samples to the online I2D database revealed overlapping networks of proteins with decreased expression in the four FTEb samples and/or FTEb luteal samples overall. Proteins are represented by nodes, and known and predicted first-degree interactions are represented by solid lines.
    [Show full text]
  • Transcriptomic Approaches to Study the Effects of Xenobiotics in Ruminants
    UNIVERSITÀ DEGLI STUDI DI PADOVA Dipartimento di BIOMEDICINA COMPARATA E ALIMENTAZIONE Corso di dottorato di ricerca in SCIENZE VETERINARIE Ciclo XXIX TRANSCRIPTOMIC APPROACHES TO STUDY THE EFFECTS OF XENOBIOTICS IN RUMINANTS Tesi redatta con il contributo finanziario della Commissione Europea – Programma europeo ERASMUS MUNDUS Action 2 (AL FIHRI) Coordinatore: Ch.mo Prof. (Alessandro ZOTTI) Supervisore: Ch.mo Prof. (Mauro DACASTO) Dottorando: RAMY ELGENDY 2017 To my parents, sister and brother.. Even if you don’t fully understand what I am doing, and probably won’t read this thesis ever, Thank you for being always proud of me. شكر ًا لكل ما فعلتموه من أجلي To all the obstacles and hardships.. You have made me stronger Acknowledgements ACKNOWLEDGEMENTS Firstly, I would like to express my sincere gratitude to my advisor – and friend – Prof. Mauro Dacasto for the continuous support of my PhD study and related research, for his guidance and motivation. His encouragement and oppeness allowed me to grow both scientifically and professionally. I couldn’t have imagined having a better advisor. Besides my advisor, I would like to thank Dr. Mery Giantin who taught me many things from the scratch. Without her knowledge and precious support it would not be possible to conduct this research. She has been a caring and supportive big sister to me. I would also like to thank both Prof. Juan Loor and Dr. Massimo Bionaz for acting as external evaluators of my thesis and for providing me with valuable comments and observations. This thesis represents not only my work in the lab or at the computer’s keyboard, it is a collective representation of more than three years of team work at the Pharmacogenetics and Toxicogenomics laboratory of Prof Dacasto.
    [Show full text]
  • Insights Dust Mite by Influenza a Infection
    Downloaded from http://www.jimmunol.org/ by guest on September 29, 2021 is online at: average * The Journal of Immunology , 10 of which you can access for free at: 2012; 188:832-843; Prepublished online 14 from submission to initial decision 4 weeks from acceptance to publication December 2011; doi: 10.4049/jimmunol.1102349 http://www.jimmunol.org/content/188/2/832 Shifting of Immune Responsiveness to House Dust Mite by Influenza A Infection: Genomic Insights Amal Al-Garawi, Mainul Husain, Dora Ilieva, Alison A. Humbles, Roland Kolbeck, Martin R. Stampfli, Paul M. O'Byrne, Anthony J. Coyle and Manel Jordana J Immunol cites 38 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription http://www.jimmunol.org/content/suppl/2011/12/14/jimmunol.110234 9.DC1 This article http://www.jimmunol.org/content/188/2/832.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2012 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 29, 2021. The Journal of Immunology Shifting of Immune Responsiveness to House Dust Mite by Influenza A Infection: Genomic Insights Amal Al-Garawi,*,†,1 Mainul Husain,*,†,1 Dora Ilieva,*,† Alison A.
    [Show full text]
  • Immune Gene Variation and Susceptibility to Upper Respiratory
    Louisiana State University LSU Digital Commons LSU Doctoral Dissertations Graduate School 2016 Immune Gene Variation and Susceptibility to Upper Respiratory Tract Disease in Gopher Tortoises Jean Pierre Elbers Louisiana State University and Agricultural and Mechanical College, [email protected] Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_dissertations Part of the Environmental Sciences Commons Recommended Citation Elbers, Jean Pierre, "Immune Gene Variation and Susceptibility to Upper Respiratory Tract Disease in Gopher Tortoises" (2016). LSU Doctoral Dissertations. 4245. https://digitalcommons.lsu.edu/gradschool_dissertations/4245 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Doctoral Dissertations by an authorized graduate school editor of LSU Digital Commons. For more information, please [email protected]. IMMUNE GENE VARIATION AND SUSCEPTIBILTY TO UPPER RESPIRATORY TRACT DISEASE IN GOPHER TORTOISES A Dissertation Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy in The School of Renewable Natural Resources by Jean Pierre Elbers B.S., Southeastern Louisiana University, 2008 M.S., Missouri State University, 2010 December 2016 ACKNOWLEDGEMENTS Let me begin by first thanking my wonderful advisor, Sabrina Taylor. She has shown interest and care in not only my dissertation project but also my development as person, researcher, and scientist. I have been truly thankful to work under her tutelage and guidance: thank you so much Sabrina! Next I would like to thank the Lucius Wilmot Gilbert Foundation for Forestry Research, which provided funding for not only my research projects but also for my research assistantship at Louisiana State University.
    [Show full text]
  • Table S2) Are Shown with the Promoter for CCL18 (Table 1 and Fig
    Supporting Information Canaan et al. 10.1073/pnas.0911676106 SI Text pooled scores from several arrays were averaged for each gene Tissue Culture. The human B cell lymphoma line, BJAB, and the and accepted if Ͼ2 for up-regulated genes or Ͻ0.5 for down- ϩ BJAB/EBNA1 cell lines, were kindly provided by the lab of Elliott regulated genes, because the scores of EBNA1 samples were Kieff (Harvard University). EBNA1 expression phenotype was superimposed on their cell line counterpart. verified by Western blot analysis before these studies and was reconfirmed by QRT-PCR while confirming microarray data. Quantitative Real-Time PCR (QRT-PCR). To verify and evaluate the Excluding the expression of EBNA1 gene, the cell lines in this study cDNA microarray data, samples were run using two independent are EBV-negative cell lines. The human epithelial cell line 293 and RNA preparations for BJAB and one RNA preparation for 293. the 293/EBNA1 were originated at the laboratory of Lawrence S. These samples were then reverse transcribed in triplicate, while Young (Institute for Cancer Studies, University of Birmingham each cDNA was analyzed in a single QRT-PCR. QRT-PCR Medical School, U.K.). reactions were run in ABI PRISM 7000 Sequence Detection System. The following oligo sequence pairs were used in the cDNA-Microarray Slides. The Peter MacCallum Cancer Institute QRT-PCR assays, sequences shown from 5Ј to 3Ј ends: Hs.833: (PMCI) microarrays used in this report contain approximately CAGCTCCATGTCGGTGTCAG and CCAATCTTCTGGGT- 10,500 cDNA clones representing 9,389 unique clones (UniGene GATCTGC; Hs.82396: CTATGCTTGGGAGCGAGGG and build 144) (25).
    [Show full text]