DOCSLIB.ORG

Transcriptomic Approaches to Study the Effects of Xenobiotics in Ruminants

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Transcriptomic Approaches to Study the Effects of Xenobiotics in Ruminants UNIVERSITÀ DEGLI STUDI DI PADOVA Dipartimento di BIOMEDICINA COMPARATA E ALIMENTAZIONE Corso di dottorato di ricerca in SCIENZE VETERINARIE Ciclo XXIX TRANSCRIPTOMIC APPROACHES TO STUDY THE EFFECTS OF XENOBIOTICS IN RUMINANTS Tesi redatta con il contributo finanziario della Commissione Europea – Programma europeo ERASMUS MUNDUS Action 2 (AL FIHRI) Coordinatore: Ch.mo Prof. (Alessandro ZOTTI) Supervisore: Ch.mo Prof. (Mauro DACASTO) Dottorando: RAMY ELGENDY 2017 To my parents, sister and brother.. Even if you don’t fully understand what I am doing, and probably won’t read this thesis ever, Thank you for being always proud of me. شكر ًا لكل ما فعلتموه من أجلي To all the obstacles and hardships.. You have made me stronger Acknowledgements ACKNOWLEDGEMENTS Firstly, I would like to express my sincere gratitude to my advisor – and friend – Prof. Mauro Dacasto for the continuous support of my PhD study and related research, for his guidance and motivation. His encouragement and oppeness allowed me to grow both scientifically and professionally. I couldn’t have imagined having a better advisor. Besides my advisor, I would like to thank Dr. Mery Giantin who taught me many things from the scratch. Without her knowledge and precious support it would not be possible to conduct this research. She has been a caring and supportive big sister to me. I would also like to thank both Prof. Juan Loor and Dr. Massimo Bionaz for acting as external evaluators of my thesis and for providing me with valuable comments and observations. This thesis represents not only my work in the lab or at the computer’s keyboard, it is a collective representation of more than three years of team work at the Pharmacogenetics and Toxicogenomics laboratory of Prof Dacasto. That’s why I want to thank my fellow labmates for everything we encountered together. Thanks to Vanessa who helped me in the lab during my first year of the PhD. Thanks to Rosa, Eleonora, Roberta, and Silvia for the long days (and evenings) we were working together, and for all the fun we have had in the last three years. Also, I thank all my friends here in Agripolis. Thanks to Federico, Marianna, Maria Elena, Max, Enrico, Rosella, Davide,Valentina, Alessandro, Lisa, Cincia, Giulia, Roberta, Jessica, Maria Laura, Massimo, Serena, Matteo, and Morgan for all the smiles and coffees we shared together. Thanks to Francesco - my friend, flatmate and colleague - for all the days and nights we cycled together to and from work, and for all the nice adventures we encountered together. I would like to thank my friends Joy, Ibrahim, Eslam, and Basma for accepting nothing less than excellence from me. Thanks to Biljana for believing in me and for being supportive and caring – definitely life is more colorful now. Last but not the least, I would like to thank my Family; my parents, my brother and sister for supporting me spiritually throughout my life. Table of contents TABLE OF CONTENTS LIST OF ABBREVIATIONS ........................................................................................................................................ iii SUMMARY ................................................................................................................................................................... iv 1. BACKGROUND ....................................................................................................................................................... 1 1.1. Growth promoters in food-producing animals .................................................................................................. 3 1.2. Transcriptomics ................................................................................................................................................. 7 1.3. Nutrigenomics ................................................................................................................................................. 10 2. AIMS ........................................................................................................................................................................ 13 3. REFERENCES ....................................................................................................................................................... 14 I. Transcriptomic analysis of skeletal muscle from beef cattle exposed to illicit schedules containing dexamethasone ................................................................................................................................................................ 22 Abstract ......................................................................................................................................................................... 23 Introduction .................................................................................................................................................................. 23 Materials and methods .................................................................................................................................................. 25 Animals and experimental design ............................................................................................................................. 25 Sample collection and RNA extraction ..................................................................................................................... 26 RNA amplification, labeling and hybridization ........................................................................................................ 27 Normalization of the microarray data ....................................................................................................................... 28 Quantitative Real time PCR ...................................................................................................................................... 29 Statistics and Principal Component Analysis (PCA) ................................................................................................ 32 Results .......................................................................................................................................................................... 33 Animal health status and growth performance ......................................................................................................... 33 Confirmatory qPCR analysis .................................................................................................................................... 35 Clustering and principal component analyses ........................................................................................................... 38 Discussion ..................................................................................................................................................................... 42 Conclusions .................................................................................................................................................................. 47 Supplementary materials............................................................................................................................................... 47 References .................................................................................................................................................................... 48 II. The transcriptome of muscle and liver is responding differently to a combined trenbolone acetate and estradiol implant in cattle............................................................................................................................................... 55 Abstract ......................................................................................................................................................................... 56 Introduction .................................................................................................................................................................. 56 Materials and methods .................................................................................................................................................. 58 Animals and experimental design ............................................................................................................................. 58 Sample collection and RNA extraction ..................................................................................................................... 59 RNA amplification, labeling and hybridization ........................................................................................................ 59 Normalization of microarray data and identification of DE genes ........................................................................... 60 Functional enrichment analysis................................................................................................................................. 60 Quantitative Real time RT-PCR (qPCR) validation ................................................................................................. 60 Statistics and Principal Component Analysis (PCA) ................................................................................................ 62 Results .......................................................................................................................................................................... 63 Phenotypic measures ...............................................................................................................................................
Load more

Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
    [Show full text]
  • 1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia
    1 Evidence for gliadin antibodies as causative agents in schizophrenia. C.J.Carter PolygenicPathways, 20 Upper Maze Hill, Saint-Leonard’s on Sea, East Sussex, TN37 0LG [email protected] Tel: 0044 (0)1424 422201 I have no fax Abstract Antibodies to gliadin, a component of gluten, have frequently been reported in schizophrenia patients, and in some cases remission has been noted following the instigation of a gluten free diet. Gliadin is a highly immunogenic protein, and B cell epitopes along its entire immunogenic length are homologous to the products of numerous proteins relevant to schizophrenia (p = 0.012 to 3e-25). These include members of the DISC1 interactome, of glutamate, dopamine and neuregulin signalling networks, and of pathways involved in plasticity, dendritic growth or myelination. Antibodies to gliadin are likely to cross react with these key proteins, as has already been observed with synapsin 1 and calreticulin. Gliadin may thus be a causative agent in schizophrenia, under certain genetic and immunological conditions, producing its effects via antibody mediated knockdown of multiple proteins relevant to the disease process. Because of such homology, an autoimmune response may be sustained by the human antigens that resemble gliadin itself, a scenario supported by many reports of immune activation both in the brain and in lymphocytes in schizophrenia. Gluten free diets and removal of such antibodies may be of therapeutic benefit in certain cases of schizophrenia. 2 Introduction A number of studies from China, Norway, and the USA have reported the presence of gliadin antibodies in schizophrenia 1-5. Gliadin is a component of gluten, intolerance to which is implicated in coeliac disease 6.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • 1 Supporting Information for a Microrna Network Regulates
    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • A Bootstrap-Based Regression Method for Comprehensive Discovery of Differential Gene Expressions: an Application to the Osteoporosis Study
    A bootstrap-based regression method for comprehensive discovery of differential gene expressions: an application to the osteoporosis study Yan Lu1,2, Yao-Zhong Liu3, Peng–Yuan Liu2, Volodymyr Dvornyk4, and Hong–Wen Deng1,3 1. College of Life Sciences and Bioengineering, Beijing Jiaotong University, Beijing 100044, P. R. China 2. Department of Physiology and the Cancer Center, Medical College of Wisconsin, Milwaukee, WI 53226, USA 3. Department of Biostatistics and Bioinformatics & Center for Bioinformatics and Genomics, Tulane University School of Public Health, New Orleans, LA 70112, USA 4. School of Biological Sciences, University of Hong Kong, Pokfulam Rd., Pokfulam, Hong Kong, P.R. China Running title: Bootstrap-based regression method for microarray analysis Key words: microarray, bootstrap, regression, osteoporosis Corresponding author: Hong–Wen Deng, Ph. D. Department of Biostatistics and Bioinformatics & Center for Bioinformatics and Genomics, Tulane University School of Public Health, 1440 Canal Street, Suite 2001, New Orleans, LA 70112 Tel: 504-988-1310 Email: [email protected] 1 Abstract A common purpose of microarray experiments is to study the variation in gene expression across the categories of an experimental factor such as tissue types and drug treatments. However, it is not uncommon that the studied experimental factor is a quantitative variable rather than categorical variable. Loss of information would occur by comparing gene-expression levels between groups that are factitiously defined according to the quantitative threshold values of an experimental factor. Additionally, lack of control for some sensitive clinical factors may bring serious false positive or negative findings. In the present study, we described a bootstrap-based regression method for analyzing gene expression data from the non-categorical microarray experiments.
    [Show full text]
  • “The Impact of ART on Genome‐Wide Oxidation of 5‐Methylcytosine and the Transcriptome During Early Mouse Development”
    “The impact of ART on genome‐wide oxidation of 5‐methylcytosine and the transcriptome during early mouse development” Dissertation zur Erlangung des Grades “Doktor der Naturwissenschaften” am Fachbereich Biologie der Johannes Gutenberg-Universität Mainz Elif Diken geb. Söğütcü geb. am 22.07.1987 in Giresun-TURKEY Mainz 2016 Dekan: 1. Berichterstatter: 2. Berichterstatter: Tag der mündlichen Prüfung: Summary Summary The use of assisted reproductive technologies (ART) has been increasing over the past three decades due to the elevated frequency of infertility problems. Other factors such as easier access to medical aid than in the past and its coverage by health insurance companies in many developed countries also contributed to this growing interest. Nevertheless, a negative impact of ART on transcriptome and methylation reprogramming is heavily discussed. Methylation reprogramming directly after fertilization manifests itself as genome-wide DNA demethylation associated with the oxidation of 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC) in the pronuclei of mouse zygotes. To investigate the possible impact of ART particularly on this process and the transcriptome in general, pronuclear stage mouse embryos obtained upon spontaneous ovulation or superovulation through hormone stimulation representing ART were subjected to various epigenetic analyses. A whole- transcriptome RNA-Seq analysis of pronuclear stage embryos from spontaneous and superovulated matings demonstrated altered expression of the Bbs12 gene known to be linked to Bardet-Biedl syndrome (BBS) as well as the Dhx16 gene whose zebrafish ortholog was reported to be a maternal effect gene. Immunofluorescence staining with antibodies against 5mC and 5hmC showed that pronuclear stage embryos obtained by superovulation have an increased incidence of abnormal methylation and hydroxymethylation patterns in both maternal and paternal pronuclear DNA compared to their spontaneously ovulated counterparts.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • DEAD-Box Helicase 27 Enhances Stem Cell-Like Properties with Poor Prognosis in Breast Cancer
    DEAD-Box Helicase 27 Enhances Stem Cell-Like Properties With Poor Prognosis in Breast Cancer Shan Li The First Aliated Hospital of China Medical University Jinfei Ma The First Aliated Hospital of China Medical University Ang Zheng The First Aliated Hospital of China Medical University Xinyue Song China Medical University Si Chen China Medical University Feng Jin ( [email protected] ) The First Aliated Hospital of China Medical University https://orcid.org/0000-0002-0325-5362 Research Article Keywords: DEAD-box helicase 27 (DDX27), Breast cancer, Stem cell-like properties, Prognosis Posted Date: June 7th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-521379/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published at Journal of Translational Medicine on August 6th, 2021. See the published version at https://doi.org/10.1186/s12967-021-03011-0. Page 1/22 Abstract Background Although the rapid development of diagnosis and treatment has improved prognosis in early breast cancer, challenges from different therapy response remain due to breast cancer heterogeneity. DEAD-box helicase 27 (DDX27) had been proved to inuence ribosome biogenesis and identied as a promoter in gastric and colorectal cancer associated with stem cell-like properties, while the impact of DDX27 on breast cancer prognosis and biological functions is unclear. We aimed to explore the inuence of DDX27 on stem cell-like properties and prognosis in breast cancer. Methods The expression of DDX27 was evaluated in 24 pairs of fresh breast cancer and normal tissue by western blot.
    [Show full text]
  • Literature Mining Sustains and Enhances Knowledge Discovery from Omic Studies
    LITERATURE MINING SUSTAINS AND ENHANCES KNOWLEDGE DISCOVERY FROM OMIC STUDIES by Rick Matthew Jordan B.S. Biology, University of Pittsburgh, 1996 M.S. Molecular Biology/Biotechnology, East Carolina University, 2001 M.S. Biomedical Informatics, University of Pittsburgh, 2005 Submitted to the Graduate Faculty of School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2016 UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE This dissertation was presented by Rick Matthew Jordan It was defended on December 2, 2015 and approved by Shyam Visweswaran, M.D., Ph.D., Associate Professor Rebecca Jacobson, M.D., M.S., Professor Songjian Lu, Ph.D., Assistant Professor Dissertation Advisor: Vanathi Gopalakrishnan, Ph.D., Associate Professor ii Copyright © by Rick Matthew Jordan 2016 iii LITERATURE MINING SUSTAINS AND ENHANCES KNOWLEDGE DISCOVERY FROM OMIC STUDIES Rick Matthew Jordan, M.S. University of Pittsburgh, 2016 Genomic, proteomic and other experimentally generated data from studies of biological systems aiming to discover disease biomarkers are currently analyzed without sufficient supporting evidence from the literature due to complexities associated with automated processing. Extracting prior knowledge about markers associated with biological sample types and disease states from the literature is tedious, and little research has been performed to understand how to use this knowledge to inform the generation of classification models from ‘omic’ data. Using pathway analysis methods to better understand the underlying biology of complex diseases such as breast and lung cancers is state-of-the-art. However, the problem of how to combine literature- mining evidence with pathway analysis evidence is an open problem in biomedical informatics research.
    [Show full text]
  • Dissertation
    Regulation of gene silencing: From microRNA biogenesis to post-translational modifications of TNRC6 complexes DISSERTATION zur Erlangung des DOKTORGRADES DER NATURWISSENSCHAFTEN (Dr. rer. nat.) der Fakultät Biologie und Vorklinische Medizin der Universität Regensburg vorgelegt von Johannes Danner aus Eggenfelden im Jahr 2017 Das Promotionsgesuch wurde eingereicht am: 12.09.2017 Die Arbeit wurde angeleitet von: Prof. Dr. Gunter Meister Johannes Danner Summary ‘From microRNA biogenesis to post-translational modifications of TNRC6 complexes’ summarizes the two main projects, beginning with the influence of specific RNA binding proteins on miRNA biogenesis processes. The fate of the mature miRNA is determined by the incorporation into Argonaute proteins followed by a complex formation with TNRC6 proteins as core molecules of gene silencing complexes. miRNAs are transcribed as stem-loop structured primary transcripts (pri-miRNA) by Pol II. The further nuclear processing is carried out by the microprocessor complex containing the RNase III enzyme Drosha, which cleaves the pri-miRNA to precursor-miRNA (pre-miRNA). After Exportin-5 mediated transport of the pre-miRNA to the cytoplasm, the RNase III enzyme Dicer cleaves off the terminal loop resulting in a 21-24 nt long double-stranded RNA. One of the strands is incorporated in the RNA-induced silencing complex (RISC), where it directly interacts with a member of the Argonaute protein family. The miRNA guides the mature RISC complex to partially complementary target sites on mRNAs leading to gene silencing. During this process TNRC6 proteins interact with Argonaute and recruit additional factors to mediate translational repression and target mRNA destabilization through deadenylation and decapping leading to mRNA decay.
    [Show full text]
  • Liver X-Receptors Alpha, Beta (Lxrs Α , Β) Level in Psoriasis
    Liver X-receptors alpha, beta (LXRs α , β) level in psoriasis Thesis Submitted for the fulfillment of Master Degree in Dermatology and Venereology BY Mohammad AbdAllah Ibrahim Awad (M.B., B.Ch., Faculty of Medicine, Cairo University) Supervisors Prof. Randa Mohammad Ahmad Youssef Professor of Dermatology, Faculty of Medicine Cairo University Prof. Laila Ahmed Rashed Professor of Biochemistry, Faculty of Medicine Cairo University Dr. Ghada Mohamed EL-hanafi Lecturer of Dermatology, Faculty of Medicine Cairo University Faculty of Medicine Cairo University 2011 ﺑﺴﻢ اﷲ اﻟﺮﺣﻤﻦ اﻟﺮﺣﻴﻢ "وﻣﺎ ﺗﻮﻓﻴﻘﻲ إﻻ ﺑﺎﷲ ﻋﻠﻴﻪ ﺗﻮآﻠﺖ وإﻟﻴﻪ أﻧﻴﺐ" (هﻮد، ٨٨) Acknowledgement Acknowledgement First and foremost, I am thankful to God, for without his grace, this work would never have been accomplished. I am honored to have Prof.Dr. Randa Mohammad Ahmad Youssef, Professor of Dermatology, Faculty of Medicine, Cairo University, as a supervisor of this work. I am so grateful and most appreciative to her efforts. No words can express what I owe her for hers endless patience and continuous advice and support. My sincere appreciation goes to Dr. Ghada Mohamed EL-hanafi, Lecturer of Dermatology, Faculty of Medicine, Cairo University, for her advice, support and supervision during the course of this study. I am deeply thankful to Dr. Laila Ahmed Rashed, Assistant professor of biochemistry, Faculty of Medicine, Cairo University, for her immense help, continuous support and encouragement. Furthermore, I wish to express my thanks to all my professors, my senior staff members, my wonderful friends and colleagues for their guidance and cooperation throughout the conduction of this work. Finally, I would like to thank my father who was very supportive and encouraging.
    [Show full text]