DOCSLIB.ORG

Liver X-Receptors Alpha, Beta (Lxrs Α , Β) Level in Psoriasis

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Liver X-Receptors Alpha, Beta (Lxrs Α , Β) Level in Psoriasis Liver X-receptors alpha, beta (LXRs α , β) level in psoriasis Thesis Submitted for the fulfillment of Master Degree in Dermatology and Venereology BY Mohammad AbdAllah Ibrahim Awad (M.B., B.Ch., Faculty of Medicine, Cairo University) Supervisors Prof. Randa Mohammad Ahmad Youssef Professor of Dermatology, Faculty of Medicine Cairo University Prof. Laila Ahmed Rashed Professor of Biochemistry, Faculty of Medicine Cairo University Dr. Ghada Mohamed EL-hanafi Lecturer of Dermatology, Faculty of Medicine Cairo University Faculty of Medicine Cairo University 2011 ﺑﺴﻢ اﷲ اﻟﺮﺣﻤﻦ اﻟﺮﺣﻴﻢ "وﻣﺎ ﺗﻮﻓﻴﻘﻲ إﻻ ﺑﺎﷲ ﻋﻠﻴﻪ ﺗﻮآﻠﺖ وإﻟﻴﻪ أﻧﻴﺐ" (هﻮد، ٨٨) Acknowledgement Acknowledgement First and foremost, I am thankful to God, for without his grace, this work would never have been accomplished. I am honored to have Prof.Dr. Randa Mohammad Ahmad Youssef, Professor of Dermatology, Faculty of Medicine, Cairo University, as a supervisor of this work. I am so grateful and most appreciative to her efforts. No words can express what I owe her for hers endless patience and continuous advice and support. My sincere appreciation goes to Dr. Ghada Mohamed EL-hanafi, Lecturer of Dermatology, Faculty of Medicine, Cairo University, for her advice, support and supervision during the course of this study. I am deeply thankful to Dr. Laila Ahmed Rashed, Assistant professor of biochemistry, Faculty of Medicine, Cairo University, for her immense help, continuous support and encouragement. Furthermore, I wish to express my thanks to all my professors, my senior staff members, my wonderful friends and colleagues for their guidance and cooperation throughout the conduction of this work. Finally, I would like to thank my father who was very supportive and encouraging. No words can make a dedication to match what he deserves. I am deeply thankful to my mother, for her love and support. I am indebted to my brother for his continuous care, advice and support. Abstract ABSTRACT Psoriasis has been recognized as a chronic inflammatory disease of the skin characterized by: an accelerated rate of keratinocyte proliferation, abnormal differentiation of epidermal keratinocytes, alteration in dermal angiogenesis and increased production of proinflammatory cytokines. Activation of LXRs stimulates keratinocyte differentiation, has an antiproliferative effect on keratinocyte and has an inhibitory effect on epidermal and TH 1 cytokines. The aim of this study was to to detect if there is a change in the expression of LXRs α and β in psoriatic skin or not, and if this change (if present) is related to severity of psoriasis or not. The levels of LXR α and β were measured in the lesional skin of psoriatic patients and in the control skin by PCR technique from 25 patients with plaque-type psoriasis as well as from 25age and sex matched controls. PASI score was assessed in the 25 psoriatic patients. The mean values of LXR α and β in the lesional skin of psoriatic patients were significantly lower than that in the control group (P Values for both LXR α and β were < 0.001). Correlating levels of LXR α and LXR β in the lesional skin of psoriatic patients of the studied cases to their PASI score showed a statistically significant inverse correlation i.e. the greater the PASI score is, the lower the level of LXR α and LXR β in the lesional skin of psoriatic patients. In conclusion, levels of LXR α and LXR β in the lesional skin of psoriatic patients were lower than controls and these low levels correlate inversely with the severity of psoriasis. Keywords: Psoriasis – Liver x receptors. Contents CONTENTS Page • List of Abbreviations ……………….……………………..…. I • List of Tables ………………………………………………… VIII • List of Figures …….………………………………………… IX • Introduction and aim of the work …………………….……………………………. 1 • Chapter 1: Psoriasis………………………………..…………………. 5 • Chapter 2: Liver x receptors…………………………….. 42 • Subjects and methods…….. 73 • Results………..…………..………..…………..………..………….. 83 • Discussion ………..…………..………..…………..………..………….. 107 • Conclusion and Recommendations………..………….. 111 • Summary ……………………….……….... 112 • References ………………………………………………..…. 114 • Arabic Summary ……………………………………….…… 129 LIST OF ABBREVIATIONS LIST OF ABBREVIATIONS ABC : ATP-binding cassette transporters. ACC : Acetyl CoA carboxylase. ACE : Angiotensin-converting enzyme inhibitors. AF : Activation function. AMPs : Antimicrobial peptides. AP-1 : Activator protein 1. APC : Antigen presenting cell. ApoE : Apolipoprotein E. AR : Androgen receptor. BMP-6 : Bone morphogenetic protein-6. CAR : Constitutive androstane receptor. CCHCR1 : Coiled-coil alpha-helical rod protein 1. CD4 : Cluster of differentiation 4. CD8 : Cluster of differentiation 8. cDNA : Complementary deoxyribonucleic acid. CDSM : Corneodesmosin. CGRP : Calcitonin gene related peptide. CLA : Cutaneous lymphocyte-associated antigen. COUP-TF : Chicken ovalbumin upstream promoter-transcription Factor. I LIST OF ABBREVIATIONS COX-2 : Cyclooxygenase-2. CRGP : Calcitonin gene related peptide. CTE : Carboxy-terminal extention. CYP51A1 : Cytochrome P450, family 51, subfamily A, polypeptide 1. CYP7A1 : Cholesterol 7 α hydroxylase or cytochrome P450 7A1. DAX-1 : Dosage-sensitive sex reversal, adrenal hypoplasia critical region, on chromosome X, gene 1. DBD : DNA binding domain. DC : Dendriric cells. DC-LAMP : Dendritic cell lysosome associated membrane protein. DNA : Deoxyribonucleic acid. EcR : Ecdysone receptor. EGF : Epidermal growth factor. EGF-R : Epidermal growth factor receptor. ER : Estrogen receptor. ERR : Estrogen-related receptor. ET-1 : Endothelin -1. FA : Fatty acid . FAS : Fatty acid synthase. FDFT1 : Farnesyl-diphosphate farnesyl transferase 1. FXR : Farnesoid X receptor. GC : Glucocorticoid. GCNF : Germ cell nuclear factor. II LIST OF ABBREVIATIONS GM-CSF : Granulocyte-macrophage colony stimulating factor. GR : Glucocorticoid receptor. HAT : Histone acetyltransferase. HDAC : Histone deacetylase. HDL : High-density lipoprotein. HDL-C : High-density lipoprotein cholesterol. HEV : High endothelial venule. HLA : Human leukocyte antigen. HLX : Homologue of the Drosophila tailless gene. HNF : Hepatocyte nuclear factor-4. HNF4α : Hepatocyte nuclear factor 4 alpha. HRE : Hormone response element. HSP : Heat shock protein. ICAM : Intercellular adhesion molecule. IFN-γ : Interferon gamma. IL : Interleukin. iNOS : Inducible nitric oxide synthase. IP-10 : IFN-γ-inducible protein 10. KGF : Keratinocyte growth factor . LBD : Ligand binding domain. LC : Langerhans cell . LDL : Low density lipoprotein. III LIST OF ABBREVIATIONS LFA : Leukocyte function associated antigen. LPL : Lipoprotein lipase. LRH-1 : Liver receptor homolog-1. LXR : Liver X receptor. MCP-1 : Monocyte chemotactic protein-1. MDC : Macrophage-derived chemokine. MHC : Major histocompatibility complex. MIG : Monokine induced by IFN-γ. MIP-1 : Macrophage inflammatory protein-1. MIP-1β : Macrophage inflammatory protein-1β MMP : Matrix metalloproteinase. MR : Mineralocorticoid receptor. MTX : Methotrexate. LXREs : LXR DNA response elements NCoR : Nuclear receptor corepressor. NF-1 : Nuclear factor 1. NFkappa B : Nuclear factor kappa-B (nuclear factor kappa-light-chain- enhancer of activated B cells). NGF : Nerve growth factor. NGFIB : Nerve Growth Factor IB-like. NK : Natural killer. NLS : Nuclear localisation signals. NOR1 : Neuron-derived orphan receptor-1. IV LIST OF ABBREVIATIONS NPC1L1 : Niemann-Pick C1-like 1. NPY : NeuropeptideY. NR : Nuclear receptor. NSAID : Non-steroidal anti-inflammatory drugs. NT : Neurotensin. Nur77 : Nerve growth factor-induced clone B. Nurr1 : Nuclear receptor related-1. PACAP : Pituitary adenylate cyclase-activating polypeptide. PASI : Psoriasis Area Severity Index. PCR : Polymerase chain reaction . PLTP : Phospholipid transfer protein. POMC : Proopiomelanocortin. PPAR : Peroxisome proliferators-activated receptor. PPP : Palmoplantar pustular psoriasis. PR : Progesterone receptor. PSORS : Psoriasis susceptibility locus. PSORS1 : psoriasis susceptibility locud 1. PXR : pregnane X receptor. RANTES : Regulated upon expression, normal T cell expressed and secreted. RAR : Retinoic acid receptor. RCT : Reverse cholesterol transport. RE : Response element. V LIST OF ABBREVIATIONS ROR : RAR-related orphan receptor. RT-PCR : Reverse transcriptase polymerase chain reaction. RXR : Retinoic x receptor. SCD-1 : Stearoyl CoA desaturase-1. SCF : Stem-cell factor. SF-1 : Steroidogenic Factor-like. SHP : Small heterodimer partner Germ. SKALP : Skin-derived antileukoproteinase. SMRT : Silencing mediator of retinoid acid and thyroid hormone. SP : Substance P. SREBP-1 : Sterol Regulatory Element-Binding Protein1. TARC : Thymus and activation regulated chemokine. Tc1 : Type 1 cytotoxic T cell. TCR : T-cell receptor. TF : Transcription factor. TG : Triglyceride. TGase K : keratinocyte transglutaminase type I. TGF-α : Transforming growth factor α. TGF-β : Transforming growth factor β. Th1 : T helper 1. TLRs : Toll like receptors. TNF-α : Tumour necrosis factor- α. VI LIST OF ABBREVIATIONS TR : Thyroid receptor. UGT1A3 : UDP glucuronosyltransferase1 family, polypeptide A3. VCAM : Vascular cell adhesion molecule. VDR : Vitamin D receptor. VEGF : Vascular endothelial growth factor. VIP : Vaso intestinal peptide. VLA-4 : Very late antigen 4. VPF : Vascular permeability factor. VII List of tables List of tables Table Title Page number number Table (1) : Calculation of PASI Score. 17 Table (2) : Cytokines and chemokines proposed to play a role in the 35 immunologic cascade of psoriasis. Table (3) : Key neuropeptides in the response
Load more

Recommended publications
  • Screening and Identification of Key Biomarkers in Clear Cell Renal Cell Carcinoma Based on Bioinformatics Analysis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Screening and identification of key biomarkers in clear cell renal cell carcinoma based on bioinformatics analysis Basavaraj Vastrad1, Chanabasayya Vastrad*2 , Iranna Kotturshetti 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. 3. Department of Ayurveda, Rajiv Gandhi Education Society`s Ayurvedic Medical College, Ron, Karnataka 562209, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.21.423889; this version posted December 23, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Clear cell renal cell carcinoma (ccRCC) is one of the most common types of malignancy of the urinary system. The pathogenesis and effective diagnosis of ccRCC have become popular topics for research in the previous decade. In the current study, an integrated bioinformatics analysis was performed to identify core genes associated in ccRCC. An expression dataset (GSE105261) was downloaded from the Gene Expression Omnibus database, and included 26 ccRCC and 9 normal kideny samples. Assessment of the microarray dataset led to the recognition of differentially expressed genes (DEGs), which was subsequently used for pathway and gene ontology (GO) enrichment analysis.
    [Show full text]
  • 1 Evidence for Gliadin Antibodies As Causative Agents in Schizophrenia
    1 Evidence for gliadin antibodies as causative agents in schizophrenia. C.J.Carter PolygenicPathways, 20 Upper Maze Hill, Saint-Leonard’s on Sea, East Sussex, TN37 0LG [email protected] Tel: 0044 (0)1424 422201 I have no fax Abstract Antibodies to gliadin, a component of gluten, have frequently been reported in schizophrenia patients, and in some cases remission has been noted following the instigation of a gluten free diet. Gliadin is a highly immunogenic protein, and B cell epitopes along its entire immunogenic length are homologous to the products of numerous proteins relevant to schizophrenia (p = 0.012 to 3e-25). These include members of the DISC1 interactome, of glutamate, dopamine and neuregulin signalling networks, and of pathways involved in plasticity, dendritic growth or myelination. Antibodies to gliadin are likely to cross react with these key proteins, as has already been observed with synapsin 1 and calreticulin. Gliadin may thus be a causative agent in schizophrenia, under certain genetic and immunological conditions, producing its effects via antibody mediated knockdown of multiple proteins relevant to the disease process. Because of such homology, an autoimmune response may be sustained by the human antigens that resemble gliadin itself, a scenario supported by many reports of immune activation both in the brain and in lymphocytes in schizophrenia. Gluten free diets and removal of such antibodies may be of therapeutic benefit in certain cases of schizophrenia. 2 Introduction A number of studies from China, Norway, and the USA have reported the presence of gliadin antibodies in schizophrenia 1-5. Gliadin is a component of gluten, intolerance to which is implicated in coeliac disease 6.
    [Show full text]
  • Ligands of Therapeutic Utility for the Liver X Receptors
    molecules Review Ligands of Therapeutic Utility for the Liver X Receptors Rajesh Komati, Dominick Spadoni, Shilong Zheng, Jayalakshmi Sridhar, Kevin E. Riley and Guangdi Wang * Department of Chemistry and RCMI Cancer Research Center, Xavier University of Louisiana, New Orleans, LA 70125, USA; [email protected] (R.K.); [email protected] (D.S.); [email protected] (S.Z.); [email protected] (J.S.); [email protected] (K.E.R.) * Correspondence: [email protected] Academic Editor: Derek J. McPhee Received: 31 October 2016; Accepted: 30 December 2016; Published: 5 January 2017 Abstract: Liver X receptors (LXRs) have been increasingly recognized as a potential therapeutic target to treat pathological conditions ranging from vascular and metabolic diseases, neurological degeneration, to cancers that are driven by lipid metabolism. Amidst intensifying efforts to discover ligands that act through LXRs to achieve the sought-after pharmacological outcomes, several lead compounds are already being tested in clinical trials for a variety of disease interventions. While more potent and selective LXR ligands continue to emerge from screening of small molecule libraries, rational design, and empirical medicinal chemistry approaches, challenges remain in minimizing undesirable effects of LXR activation on lipid metabolism. This review provides a summary of known endogenous, naturally occurring, and synthetic ligands. The review also offers considerations from a molecular modeling perspective with which to design more specific LXRβ ligands based on the interaction energies of ligands and the important amino acid residues in the LXRβ ligand binding domain. Keywords: liver X receptors; LXRα; LXRβ specific ligands; atherosclerosis; diabetes; Alzheimer’s disease; cancer; lipid metabolism; molecular modeling; interaction energy 1.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • The Anti-Inflammatory Role of Nuclear Receptors in Dendritic Cells
    The Anti-Inflammatory Role of Nuclear Receptors in Dendritic Cells A thesis submitted for the degree of Ph.D. By Mary Canavan B.Sc. (Hons), March 2012. Based on research carried out at School of Biotechnology, Dublin City University, Dublin 9, Ireland. Under the supervision of Dr. Christine Loscher. Declaration I hereby certify that this material, which I now submit for assessment on the programme of study leading to the award of Doctor of Philosophy is entirely my own work, that I have exercised reasonable care to ensure that the work is original, and does not to the best of my knowledge breach any law of copyright, and has not been taken from the work of others and to the extent that such work has been cited and acknowledged within the text of my work. Signed: ____________________ ID No.:__54351789__ Date: ______________ ACKNOWLEDGEMENTS There are so many people that I would like to thank and definitely not enough space to say exactly how grateful I am to you all. I have been lucky enough to work with an amazing group of people over the past few years. Firstly I would like to thank Christine for all your help, support, enthusiasm and patience – and for telling me not to do anymore of those p50 blots! I have thoroughly enjoyed working with you and learning from you over the last few years. To everyone in the Lab – you are the reason why I have such great memories when I look back at my time in DCU. Whenever I think of failed experiments, tough days and tears, there is always a great memory of you guys that goes along with it.
    [Show full text]
  • Liver X Receptor &Beta
    Cell Death and Differentiation (2014) 21, 1914–1924 & 2014 Macmillan Publishers Limited All rights reserved 1350-9047/14 www.nature.com/cdd Liver X receptor b activation induces pyroptosis of human and murine colon cancer cells V Derange`re1,2,3, A Chevriaux1,2, F Courtaut1,3, M Bruchard1,3, H Berger1,3, F Chalmin1,3, SZ Causse1, E Limagne1,3,FVe´gran1,3, S Ladoire1,2,3, B Simon4, W Boireau4, A Hichami1,3, L Apetoh1,2,3, G Mignot1, F Ghiringhelli1,2,3,5 and C Re´be´*,1,2,5 Liver X receptors (LXRs) have been proposed to have some anticancer properties, through molecular mechanisms that remain elusive. Here we report for the first time that LXR ligands induce caspase-1-dependent cell death of colon cancer cells. Caspase- 1 activation requires Nod-like-receptor pyrin domain containing 3 (NLRP3) inflammasome and ATP-mediated P2 Â 7 receptor activation. Surprisingly, LXRb is mainly located in the cytoplasm and has a non-genomic role by interacting with pannexin 1 leading to ATP secretion. Finally, LXR ligands have an antitumoral effect in a mouse colon cancer model, dependent on the presence of LXRb, pannexin 1, NLRP3 and caspase-1 within the tumor cells. Our results demonstrate that LXRb, through pannexin 1 interaction, can specifically induce caspase-1-dependent colon cancer cell death by pyroptosis. Cell Death and Differentiation (2014) 21, 1914–1924; doi:10.1038/cdd.2014.117; published online 15 August 2014 Liver X receptor a (LXRa) and b belong to the nuclear receptor However, a common feature of these reports is that all family.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Liver X Receptor Β Protects Dopaminergic Neurons in a Mouse Model of Parkinson Disease
    Liver X receptor β protects dopaminergic neurons in a mouse model of Parkinson disease Yu-bing Daia, Xin-jie Tana, Wan-fu Wua, Margaret Warnera, and Jan-Åke Gustafssona,b,1 aCenter for Nuclear Receptors and Cell Signaling, University of Houston, Houston, TX 77204; and bCenter for Biosciences, Department of Biosciences and Nutrition, Novum, 14186 Stockholm, Sweden Contributed by Jan-Åke Gustafsson, June 26, 2012 (sent for review April 13, 2012) Parkinson disease (PD) is a progressive neurodegenerative disease Liver X receptors (LXRα and LXRβ) are members of the nu- whose progression may be slowed, but at present there is no clear receptor superfamily of ligand-activated transcription factors. pharmacological intervention that would stop or reverse the These receptors are activated by naturally occurring oxysterols (14, disease. Liver X receptor β (LXRβ) is a member of the nuclear re- 15). There are two synthetic LXR agonists, T0901317 and GW3965. ceptor super gene family expressed in the central nervous system, T0901317 has been demonstrated to have agonistic effects on where it is important for cortical layering during development and receptors other than LXR, such as the Farnesoid X receptor and survival of dopaminergic neurons throughout life. In the present the Pregnane X receptor (16). However, GW3965 has an agonistic study we have used the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyr- effect specifically on LXR. Activation of LXRs leads to release of idine (MPTP) model of PD to investigate the possible use of LXRβ associated corepressor proteins and interaction with coactivators, as a target for prevention or treatment of PD.
    [Show full text]
  • Cloud-Clone 16-17
    Cloud-Clone - 2016-17 Catalog Description Pack Size Supplier Rupee(RS) ACB028Hu CLIA Kit for Anti-Albumin Antibody (AAA) 96T Cloud-Clone 74750 AEA044Hu ELISA Kit for Anti-Growth Hormone Antibody (Anti-GHAb) 96T Cloud-Clone 74750 AEA255Hu ELISA Kit for Anti-Apolipoprotein Antibodies (AAHA) 96T Cloud-Clone 74750 AEA417Hu ELISA Kit for Anti-Proteolipid Protein 1, Myelin Antibody (Anti-PLP1) 96T Cloud-Clone 74750 AEA421Hu ELISA Kit for Anti-Myelin Oligodendrocyte Glycoprotein Antibody (Anti- 96T Cloud-Clone 74750 MOG) AEA465Hu ELISA Kit for Anti-Sperm Antibody (AsAb) 96T Cloud-Clone 74750 AEA539Hu ELISA Kit for Anti-Myelin Basic Protein Antibody (Anti-MBP) 96T Cloud-Clone 71250 AEA546Hu ELISA Kit for Anti-IgA Antibody 96T Cloud-Clone 71250 AEA601Hu ELISA Kit for Anti-Myeloperoxidase Antibody (Anti-MPO) 96T Cloud-Clone 71250 AEA747Hu ELISA Kit for Anti-Complement 1q Antibody (Anti-C1q) 96T Cloud-Clone 74750 AEA821Hu ELISA Kit for Anti-C Reactive Protein Antibody (Anti-CRP) 96T Cloud-Clone 74750 AEA895Hu ELISA Kit for Anti-Insulin Receptor Antibody (AIRA) 96T Cloud-Clone 74750 AEB028Hu ELISA Kit for Anti-Albumin Antibody (AAA) 96T Cloud-Clone 71250 AEB264Hu ELISA Kit for Insulin Autoantibody (IAA) 96T Cloud-Clone 74750 AEB480Hu ELISA Kit for Anti-Mannose Binding Lectin Antibody (Anti-MBL) 96T Cloud-Clone 88575 AED245Hu ELISA Kit for Anti-Glutamic Acid Decarboxylase Antibodies (Anti-GAD) 96T Cloud-Clone 71250 AEK505Hu ELISA Kit for Anti-Heparin/Platelet Factor 4 Antibodies (Anti-HPF4) 96T Cloud-Clone 71250 CCA005Hu CLIA Kit for Angiotensin II
    [Show full text]
  • 2 to Modulate Hepatic Lipolysis and Fatty Acid Metabolism
    Original article Bioenergetic cues shift FXR splicing towards FXRa2 to modulate hepatic lipolysis and fatty acid metabolism Jorge C. Correia 1,2, Julie Massart 3, Jan Freark de Boer 4, Margareta Porsmyr-Palmertz 1, Vicente Martínez-Redondo 1, Leandro Z. Agudelo 1, Indranil Sinha 5, David Meierhofer 6, Vera Ribeiro 2, Marie Björnholm 3, Sascha Sauer 6, Karin Dahlman-Wright 5, Juleen R. Zierath 3, Albert K. Groen 4, Jorge L. Ruas 1,* ABSTRACT Objective: Farnesoid X receptor (FXR) plays a prominent role in hepatic lipid metabolism. The FXR gene encodes four proteins with structural differences suggestive of discrete biological functions about which little is known. Methods: We expressed each FXR variant in primary hepatocytes and evaluated global gene expression, lipid profile, and metabolic fluxes. Gene À À delivery of FXR variants to Fxr / mouse liver was performed to evaluate their role in vivo. The effects of fasting and physical exercise on hepatic Fxr splicing were determined. Results: We show that FXR splice isoforms regulate largely different gene sets and have specific effects on hepatic metabolism. FXRa2 (but not a1) activates a broad transcriptional program in hepatocytes conducive to lipolysis, fatty acid oxidation, and ketogenesis. Consequently, FXRa2 À À decreases cellular lipid accumulation and improves cellular insulin signaling to AKT. FXRa2 expression in Fxr / mouse liver activates a similar gene program and robustly decreases hepatic triglyceride levels. On the other hand, FXRa1 reduces hepatic triglyceride content to a lesser extent and does so through regulation of lipogenic gene expression. Bioenergetic cues, such as fasting and exercise, dynamically regulate Fxr splicing in mouse liver to increase Fxra2 expression.
    [Show full text]
  • Regulation of Thyroid Hormone Activation Via the Liver X-Receptor/Retinoid X-Receptor Pathway
    179 Regulation of thyroid hormone activation via the liver X-receptor/retinoid X-receptor pathway Marcelo A Christoffolete*, Ma´rton Doleschall1,*, Pe´ter Egri1, Zsolt Liposits1, Ann Marie Zavacki2, Antonio C Bianco3 and Bala´zs Gereben1 Human and Natural Sciences Center, Federal University of ABC, Santo Andre-SP 09210-370, Brazil 1Laboratory of Endocrine Neurobiology, Institute of Experimental Medicine, Hungarian Academy of Sciences, Szigony u. 43, Budapest H-1083, Hungary 2Division of Endocrinology, Diabetes, and Hypertension, Thyroid Section, Brigham and Women’s Hospital, Boston, Massachusetts MA 02115, USA 3Division of Endocrinology, Diabetes and Metabolism, Miller School of Medicine, University of Miami, Miami, Florida FL 33136, USA (Correspondence should be addressed to B Gereben; Email: [email protected]) *(M A Christoffolete and M Doleschall contributed equally to this work) (M Doleschall is now at Inflammation Biology and Immungenomics Research Group, Hungarian Academy of Sciences, Semmelweis University, Budapest, Hungary) Abstract Thyroid hormone receptor (TR) and liver X-receptor (LXR) investigated if 9-cis retinoic acid (9-cis RA), the ligand for are the master regulators of lipid metabolism. Remarkably, a the heterodimeric partner of TR and LXR, RXR, could mouse with a targeted deletion of both LXRa and LXRb is regulate the hDIO2 promoter. Notably, 9-cis RA repressed resistant to western diet-induced obesity, and exhibits ectopic the hDIO2 luciferase reporter (1 mM, approximately four- liver expression of the thyroid hormone activating type 2 fold) in a dose-dependent manner, while coexpression of an deiodinase (D2). We hypothesized that LXR/retinoid inactive mutant RXR abolished this effect. However, it is X-receptor (RXR) signaling inhibits hepatic D2 expression, unlikely that RXR homodimers mediate the repression of and studied this using a luciferase reporter containing the hDIO2 since mutagenesis of a DR-1 at K506 bp did not human DIO2 (hDIO2) promoter in HepG2 cells.
    [Show full text]