DOCSLIB.ORG

Immune Gene Variation and Susceptibility to Upper Respiratory

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Immune Gene Variation and Susceptibility to Upper Respiratory Louisiana State University LSU Digital Commons LSU Doctoral Dissertations Graduate School 2016 Immune Gene Variation and Susceptibility to Upper Respiratory Tract Disease in Gopher Tortoises Jean Pierre Elbers Louisiana State University and Agricultural and Mechanical College, [email protected] Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_dissertations Part of the Environmental Sciences Commons Recommended Citation Elbers, Jean Pierre, "Immune Gene Variation and Susceptibility to Upper Respiratory Tract Disease in Gopher Tortoises" (2016). LSU Doctoral Dissertations. 4245. https://digitalcommons.lsu.edu/gradschool_dissertations/4245 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Doctoral Dissertations by an authorized graduate school editor of LSU Digital Commons. For more information, please [email protected]. IMMUNE GENE VARIATION AND SUSCEPTIBILTY TO UPPER RESPIRATORY TRACT DISEASE IN GOPHER TORTOISES A Dissertation Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy in The School of Renewable Natural Resources by Jean Pierre Elbers B.S., Southeastern Louisiana University, 2008 M.S., Missouri State University, 2010 December 2016 ACKNOWLEDGEMENTS Let me begin by first thanking my wonderful advisor, Sabrina Taylor. She has shown interest and care in not only my dissertation project but also my development as person, researcher, and scientist. I have been truly thankful to work under her tutelage and guidance: thank you so much Sabrina! Next I would like to thank the Lucius Wilmot Gilbert Foundation for Forestry Research, which provided funding for not only my research projects but also for my research assistantship at Louisiana State University. I am also thankful for financial and logistical support from the Louisiana State University AgCenter. My graduate committee has been especially helpful during my dissertation project; many thanks go Drs. Chris Austin, Javier Nevarez, and Phil Stouffer. I am especially grateful to Dr. Javier Nevarez who generously gave of his time to instruct me on drawing blood from gopher tortoises. Chapters 4 and 6 of this dissertation would not have been possible without the help of one my coauthors Dr. Rachel W. Clostio. She charitably donated hundreds of gopher tortoise DNA and blood samples that she collected as part of her dissertation research. For this I am truly grateful and appreciative. I am thankful to Richard Carmouche of Pennington Biomedical Research Center’s Genomics Core who performed next-generation sequencing lab work for Chapters 6 and 7. Another one of my coauthors, Dr. Mary Brown, provided blood samples from clinical and non-clinical gopher tortoises for chapter seven for which I am very grateful. The Louisiana State University community was instrumental in completing this dissertation project, especially students and faculty of the School of Renewable Natural Resources. I am very grateful to past and current members of the Taylor lab for their support and ii friendship: Andrea Bonisoli Alquati, Kristin Brzeski, Christy Bergeon Burns, Blain Cerame, Rob Ford, Anna Perez-Umphrey, Andrew Rodriguez, Amie Settlecowski, Kelcee Smith, Allie Snider, and Stef Woltmann. I am also grateful to Drs. Michael Kaller for advice on statistical analysis, Bret Collier for introducing me to R and LaTex, Maheshi Dassanayake and Brant Faircloth for advice on genomics and bioinformatics, and Eric Achberger for guidance on molecular cloning. I am very appreciative of the help received from the Louisiana Department of Wildlife and Fisheries, especially gopher tortoise biologists Keri Landry and Beau Gregory. I received assistance conducing field work on Chapter 3 from Christy Bergeon-Burns, Maria Bianco, Leah Delahoussaye, Anna Evans, Caitlin Glymph, Kaitlin Kuylen, Jaclyn Shanley, Charleston Shirley, and Bonnie Slaton. Charleston was especially helpful and served as an excellent field technician throughout the hot field season in summer and autumn of 2013. Last but not least, I wish to thank my family: my brother Don Paul Elbers, sister Heidi Elbers, aunt Brenda Lege, grandmother Mary Rose Elbers, mother Cheryl Elbers, and father Don Elbers. They have been with me the entire dissertation progress and have been supportive and understanding during this journey. I do not know if I would have been able to finish my dissertation without them by my side. iii TABLE OF CONTENTS ACKNOWLEDGEMENTS.................................................................................................ii ABSTRACT.......................................................................................................................vi CHAPTER 1: GENERAL INTRODUCTION....................................................................1 IMMUNE SYSTEM................................................................................................1 CONSERVATION GENETICS..............................................................................3 STUDY SYSTEM AND OBJECTIVES.................................................................4 LITERATURE CITED............................................................................................6 CHAPTER 2: MAJOR HISTOCOMPATIBILITY COMPLEX POLYMORPHISM IN REPTILE CONSERVATION...........................................................................................11 INTRODUCTION.................................................................................................11 MHC POLYMORPHISM, PARASITE RESISTANCE, AND MATE CHOICE IN REPTILE POPULATIONS..............................................................................14 DISCUSSION........................................................................................................22 CONCLUSIONS...................................................................................................27 LITERATURE CITED..........................................................................................27 CHAPTER 3: SEASONAL BUT NO SEX EFFECTS IN GOPHER TORTOISE (GOPHERUS POLYPHEMUS) INNATE IMMUNE RESPONSE...................................39 INTRODUCTION.................................................................................................39 METHODS............................................................................................................42 RESULTS..............................................................................................................46 DISCUSSION........................................................................................................49 LITERATURE CITED..........................................................................................54 CHAPTER 4: NEUTRAL GENETIC PROCESSES INFLUENCE MHC EVOLUTION IN A THREATENED TORTOISE (GOPHERUS POLYPHEMUS)................................59 INTRODUCTION.................................................................................................59 METHODS............................................................................................................62 RESULTS..............................................................................................................69 DISCUSSION........................................................................................................89 LITERATURE CITED..........................................................................................99 CHAPTER 5: GO2TR: A GENE ONTOLOGY-BASED WORKFLOW TO GENERATE TARGET REGIONS FOR TARGET ENRICHMENT EXPERIMENTS......................110 INTRODUCTION...............................................................................................110 GO2TR.................................................................................................................111 TO USE GO2TR..................................................................................................114 PROOF OF CONCEPT.......................................................................................114 iv RECOMMENDATIONS.....................................................................................123 OTHER USEFUL TOOLS TO USE IN CONJUNCTION WITH GO2TR.......124 LITERATURE CITED........................................................................................125 CHAPTER 6: POPULATION GENETIC INFERENCES USING IMMUNE GENE SNPS MIRROR PATTERNS INFERRED BY MICROSATELLITES.........................130 INTRODUCTION...............................................................................................130 METHODS..........................................................................................................133 RESULTS............................................................................................................140 DISCUSSION......................................................................................................153 CONCLUSION…................................................................................................157 LITERATURE CITED........................................................................................158 CHAPTER 7: TORTOISE IMMUNOMES SHED LIGHT ON GENETIC VARIATION UNDERLYING INFECTIOUS DISEASE.....................................................................166 INTRODUCTION...............................................................................................166 METHODS..........................................................................................................168
Load more

Recommended publications
  • PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41
    American Society of Human Genetics 62nd Annual Meeting November 6–10, 2012 San Francisco, California PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41. Genes Underlying Neurological Disease Room 134 #196–#204 2. 4:30–6:30pm: Plenary Abstract 42. Cancer Genetics III: Common Presentations Hall D #1–#6 Variants Ballroom 104 #205–#213 43. Genetics of Craniofacial and Wednesday, November 7 Musculoskeletal Disorders Room 124 #214–#222 10:30am–12:45 pm: Concurrent Platform Session A (11–19): 44. Tools for Phenotype Analysis Room 132 #223–#231 11. Genetics of Autism Spectrum 45. Therapy of Genetic Disorders Room 130 #232–#240 Disorders Hall D #7–#15 46. Pharmacogenetics: From Discovery 12. New Methods for Big Data Ballroom 103 #16–#24 to Implementation Room 123 #241–#249 13. Cancer Genetics I: Rare Variants Room 135 #25–#33 14. Quantitation and Measurement of Friday, November 9 Regulatory Oversight by the Cell Room 134 #34–#42 8:00am–10:15am: Concurrent Platform Session D (47–55): 15. New Loci for Obesity, Diabetes, and 47. Structural and Regulatory Genomic Related Traits Ballroom 104 #43–#51 Variation Hall D #250–#258 16. Neuromuscular Disease and 48. Neuropsychiatric Disorders Ballroom 103 #259–#267 Deafness Room 124 #52–#60 49. Common Variants, Rare Variants, 17. Chromosomes and Disease Room 132 #61–#69 and Everything in-Between Room 135 #268–#276 18. Prenatal and Perinatal Genetics Room 130 #70–#78 50. Population Genetics Genome-Wide Room 134 #277–#285 19. Vascular and Congenital Heart 51. Endless Forms Most Beautiful: Disease Room 123 #79–#87 Variant Discovery in Genomic Data Ballroom 104 #286–#294 52.
    [Show full text]
  • Analysis of BMP4 and BMP7 Signaling in Breast Cancer Cells Unveils Time
    Rodriguez-Martinez et al. BMC Medical Genomics 2011, 4:80 http://www.biomedcentral.com/1755-8794/4/80 RESEARCHARTICLE Open Access Analysis of BMP4 and BMP7 signaling in breast cancer cells unveils time-dependent transcription patterns and highlights a common synexpression group of genes Alejandra Rodriguez-Martinez1†, Emma-Leena Alarmo1†, Lilli Saarinen2, Johanna Ketolainen1, Kari Nousiainen2, Sampsa Hautaniemi2 and Anne Kallioniemi1* Abstract Background: Bone morphogenetic proteins (BMPs) are members of the TGF-beta superfamily of growth factors. They are known for their roles in regulation of osteogenesis and developmental processes and, in recent years, evidence has accumulated of their crucial functions in tumor biology. BMP4 and BMP7, in particular, have been implicated in breast cancer. However, little is known about BMP target genes in the context of tumor. We explored the effects of BMP4 and BMP7 treatment on global gene transcription in seven breast cancer cell lines during a 6- point time series, using a whole-genome oligo microarray. Data analysis included hierarchical clustering of differentially expressed genes, gene ontology enrichment analyses and model based clustering of temporal data. Results: Both ligands had a strong effect on gene expression, although the response to BMP4 treatment was more pronounced. The cellular functions most strongly affected by BMP signaling were regulation of transcription and development. The observed transcriptional response, as well as its functional outcome, followed a temporal sequence, with regulation of gene expression and signal transduction leading to changes in metabolism and cell proliferation. Hierarchical clustering revealed distinct differences in the response of individual cell lines to BMPs, but also highlighted a synexpression group of genes for both ligands.
    [Show full text]
  • Supplementary Materials
    Lists of figures Figure S1: A-B: Principal Component Analysis (PCA) was applied to 3 pairs of SCEC tissues (red) and matched adjacent normal tissues (blue) that were characterized by the gene expression of all probes on Affymetrix HG U133 Plus 2.0 Array. C: Box plot of SCEC group. D: Pearson’s correlation matrix of SCEC group. 17 / 25 Figure S2: MvA plot of SCEC group. Figure S3: Volcano plots of probe sets differing between SCEC and matched normal tissues. Fold change (X axis) is plotted against statistical significance (Y axis) for each probe sets. Genes altered with a fold change ≥2 and FDR <0.01 are depicted in red. Grey represents genes in the arrays that were not found to differ significantly between cancerous samples and matched normal samples. Figure S4: Gene regulatory network plotted by the top 120 DEGs (ranked by FDR) of SCEC groups. 18 / 25 Figure S5: DNA copy number change profiles in 3 pairs of SCEC samples. The CNVs frequency of the whole genome was analyzed by aCGH. Gains were marked in red and losses in bule. Lists of tables Table S1. Primers used in qRT-PCR for microarray gene expression validation Gene Forward Primer (5’-3’) Reverse Primer (5’-3’) Product β-actin AAGGTGACAGCAGTCGGTT TGTGTGGACTTGGGAGAGG 195bp INSM1 GTATTCGCTGTGTTCATGGTC CGCTACATACATAGAGAGCAGAG 79bp ASCL1 AACTCCCATCACCTCTAACA TGAGACGAAAGACACCAACT 120bp NRCAM GATGGCGAAGAATGAAGTT ACAGTGAGGGATAAGGTGTG 141bp NUF2 ATGATGCCAGTGAACTCTGAA GACTTGTCCGTTTTGCTTTTG 160bp 19 / 25 SNAP25 CCTGGATATGGGCAATGAGAT ACACGGGTGGGCACACTTA 146bp PTP4A3 GCTTCCTCATCACCCACAA CCGTACTTCTTCAGGTCCTCA
    [Show full text]
  • 1 Supporting Information for a Microrna Network Regulates
    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
    [Show full text]
  • Epidermal Growth Factor Receptor (EGFR) Mutation Analysis, Gene
    Peraldo-Neia et al. BMC Cancer 2011, 11:31 http://www.biomedcentral.com/1471-2407/11/31 RESEARCHARTICLE Open Access Epidermal Growth Factor Receptor (EGFR) mutation analysis, gene expression profiling and EGFR protein expression in primary prostate cancer Caterina Peraldo-Neia1,2*, Giorgia Migliardi1, Maurizia Mello-Grand2, Filippo Montemurro3, Raffaella Segir2, Ymera Pignochino1, Giuliana Cavalloni1, Bruno Torchio4, Luciano Mosso4, Giovanna Chiorino2, Massimo Aglietta1,3 Abstract Background: Activating mutations of the epidermal growth factor receptor (EGFR) confer sensitivity to the tyrosine kinase inhibitors (TKi), gefitinib and erlotinib. We analysed EGFR expression, EGFR mutation status and gene expression profiles of prostate cancer (PC) to supply a rationale for EGFR targeted therapies in this disease. Methods: Mutational analysis of EGFR TK domain (exons from 18 to 21) and immunohistochemistry for EGFR were performed on tumour tissues derived from radical prostatectomy from 100 PC patients. Gene expression profiling using oligo-microarrays was also carried out in 51 of the PC samples. Results: EGFR protein overexpression (EGFRhigh) was found in 36% of the tumour samples, and mutations were found in 13% of samples. Patients with EGFRhigh tumours experienced a significantly increased risk of biochemical relapse (hazard ratio-HR 2.52, p=0.02) compared with patients with tumours expressing low levels of EGFR (EGFRlow). Microarray analysis did not reveal any differences in gene expression between EGFRhigh and EGFRlow tumours. Conversely, in EGFRhigh tumours, we were able to identify a 79 gene signature distinguishing mutated from non-mutated tumours. Additionally, 29 genes were found to be differentially expressed between mutated/ EGFRhigh (n=3) and mutated/EGFRlow tumours (n=5).
    [Show full text]
  • Interpreting Human Genetic Variation with in Vivo Zebrafish Assays Erica E
    Interpreting Human Genetic Variation With In Vivo Zebrafish Assays Erica E. Davis, PhD, Stephan Frangakis, BS, and Nicholas Katsanis, PhD Center for Human Disease Modeling Duke University Medical Center Durham, North Carolina © 20132015 Katsanis Interpreting Human Genetic Variation With In Vivo Zebrafish Assays 11 Introduction bona fide pathogenic mutations alone in the average NOTES Rapid advances and cost erosion in exome and human exome, studies have reported a median of 50– genome analysis of patients with both rare and 150 nonsense mutations, several in homozygosity, common genetic disorders have accelerated gene while the abundance of unique single nucleotide discovery and illuminated fundamental biological variants (SNVs) can be in the low-to-mid 100s mechanisms. The thrill of discovery has been (1000 Genomes Project Consortium et al., 2010). accompanied, however, by the sobering appreciation Importantly, the number of rare and ultra-rare SNVs that human genomes are burdened with a large has continued to increase proportionately to the number of rare and ultra-rare variants, thereby posing number of available exomes and genomes (Tennessen a significant challenge in dissecting both the effect of et al., 2012), indicating that we are unlikely to reach such alleles on protein function and the biological saturation of such alleles soon. These observations relevance of these events to patient pathology. In have generated a significant interpretive problem an effort to develop model systems that are able to for disease gene discovery and for clinical genomics, generate surrogates of human pathologies, a powerful as population-based arguments alone have been suite of tools has been developed in zebrafish, unable to dissect the contribution of the majority of taking advantage of the relatively small (compared these alleles to clinical phenotypes.
    [Show full text]
  • Accurate Characterization of the IFITM Locus Using Miseq and Pacbio Sequencing Shows Genetic Variation in Galliformes
    Bassano et al. BMC Genomics (2017) 18:419 DOI 10.1186/s12864-017-3801-8 RESEARCH ARTICLE Open Access Accurate characterization of the IFITM locus using MiSeq and PacBio sequencing shows genetic variation in Galliformes Irene Bassano1,2, Swee Hoe Ong1, Nathan Lawless3, Thomas Whitehead3, Mark Fife3 and Paul Kellam1,2* Abstract Background: Interferon inducible transmembrane (IFITM) proteins are effectors of the immune system widely characterized for their role in restricting infection by diverse enveloped and non-enveloped viruses. The chicken IFITM (chIFITM)genesareclusteredonchromosome5andtodate four genes have been annotated, namely chIFITM1, chIFITM3, chIFITM5 and chIFITM10. However, due to poor assembly of this locus in the Gallus Gallus v4 genome, accurate characterization has so far proven problematic. Recently, a new chicken reference genome assembly Gallus Gallus v5 was generated using Sanger, 454, Illumina and PacBio sequencing technologies identifying considerable differences in the chIFITM locus over the previous genome releases. Methods: We re-sequenced the locus using both Illumina MiSeq and PacBio RS II sequencing technologies and we mapped RNA-seq data from the European Nucleotide Archive (ENA) to this finalized chIFITM locus. Using SureSelect probes capture probes designed to the finalized chIFITM locus, we sequenced the locus of a different chicken breed, namely a White Leghorn, and a turkey. Results: We confirmed the Gallus Gallus v5 consensus except for two insertions of 5 and 1 base pair within the chIFITM3 and B4GALNT4 genes, respectively, and a single base pair deletion within the B4GALNT4 gene. The pull down revealed a singleaminoacidsubstitutionofA63VintheCILdomainofIFITM2comparedtoRedJunglefowland13,13and11 differences between IFITM1, 2 and 3 of chickens and turkeys, respectively.
    [Show full text]
  • “The Impact of ART on Genome‐Wide Oxidation of 5‐Methylcytosine and the Transcriptome During Early Mouse Development”
    “The impact of ART on genome‐wide oxidation of 5‐methylcytosine and the transcriptome during early mouse development” Dissertation zur Erlangung des Grades “Doktor der Naturwissenschaften” am Fachbereich Biologie der Johannes Gutenberg-Universität Mainz Elif Diken geb. Söğütcü geb. am 22.07.1987 in Giresun-TURKEY Mainz 2016 Dekan: 1. Berichterstatter: 2. Berichterstatter: Tag der mündlichen Prüfung: Summary Summary The use of assisted reproductive technologies (ART) has been increasing over the past three decades due to the elevated frequency of infertility problems. Other factors such as easier access to medical aid than in the past and its coverage by health insurance companies in many developed countries also contributed to this growing interest. Nevertheless, a negative impact of ART on transcriptome and methylation reprogramming is heavily discussed. Methylation reprogramming directly after fertilization manifests itself as genome-wide DNA demethylation associated with the oxidation of 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC) in the pronuclei of mouse zygotes. To investigate the possible impact of ART particularly on this process and the transcriptome in general, pronuclear stage mouse embryos obtained upon spontaneous ovulation or superovulation through hormone stimulation representing ART were subjected to various epigenetic analyses. A whole- transcriptome RNA-Seq analysis of pronuclear stage embryos from spontaneous and superovulated matings demonstrated altered expression of the Bbs12 gene known to be linked to Bardet-Biedl syndrome (BBS) as well as the Dhx16 gene whose zebrafish ortholog was reported to be a maternal effect gene. Immunofluorescence staining with antibodies against 5mC and 5hmC showed that pronuclear stage embryos obtained by superovulation have an increased incidence of abnormal methylation and hydroxymethylation patterns in both maternal and paternal pronuclear DNA compared to their spontaneously ovulated counterparts.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Extracellular Vesicles from Human Cardiac Cells As Future Allogenic Therapeutic Tool for Heart Diseases
    Dissertation EXTRACELLULAR VESICLES FROM HUMAN CARDIAC CELLS AS FUTURE ALLOGENIC THERAPEUTIC TOOL FOR HEART DISEASES. zur Erlangung des akademischen Grades Doctor rerum naturalium (Dr. rer. nat.) im Fach Biologie eingereicht an der Lebenswissenschaftlichen Fakultät der Humboldt-Universität zu Berlin von Dipl. Biochemikerin Christien M. Beez Präsidentin der Humboldt-Universität zu Berlin Prof. Dr.-Ing. Dr. Sabine Kunst Dekan der Lebenswissenschaftlichen Fakultät Prof. Dr. Bernhard Grimm GutachterInnen: 1. Prof. Dr. Martina Seifert 2. Prof. Dr. Hans-Dieter Volk 3. PD Dr. Irina Nazarenko Tag der mündlichen Verteidigung: 23.Februar.2021 The thesis was performed during July 2015 till December 2019 under the supervision of Prof. Dr. Martina Seifert at the Institute of Medical Immunology and the Berlin Institute of Health (BIH) Centre for Regenerative Therapies (BCRT), Charité-Universitätsmedizin Berlin, as graduate student of the Berlin-Brandenburg School for Regenerative Therapies (BSRT, DFG- Graduiertenschule 203). The work was funded by the Friede-Springer-Herz-Stiftung and the Einstein Foundation. „Ein Ei ist ein Ei“, sagte jener und nahm das größere. K. Tucholsky Abstract Extracellular vesicles (EVs) facilitate intercellular communication by transferring molecules from a donor to a recipient cell. It is proposed that EVs from regenerative cells as a therapeutic tool can help to overcome the leading role of cardiovascular diseases as cause of death. Accordingly, this thesis aimed to evaluate the suitability of EVs from regenerative human cardiac-derived adherent proliferating (CardAP) cells as an allogenic cell-free approach to treat heart diseases. For that purpose, we isolated EVs by differential centrifugation from the conditioned medium that was derived either in the presence or absence of a pro-inflammatory cytokine cocktail (IFNγ, TNFα, and IL-1β).
    [Show full text]
  • The Fission Yeast Non-Coding Transcriptome
    The Fission Yeast Non-Coding Transcriptome Sophie Radha Atkinson A thesis submitted for the degree of Doctor of Philosophy University College London September 2014 1 Declaration I, Sophie Radha Atkinson, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. 2 Abstract Long non-coding RNAs (lncRNAs) are emerging as important regulators of gene expression, although it remains unclear to what extent they contribute overall to the information flow from genotype to phenotype. Using strand-specific RNA- sequencing, I identify thousands of novel unstable, or cryptic, lncRNAs in Schizosaccharomyces pombe. The nuclear exosome, the RNAi pathway and the cytoplasmic exonuclease Exo2 represent three key pathways regulating lncRNAs in S. pombe, defining the overlapping classes of CUTs, RUTs and XUTs, respectively. The nuclear exosome and the RNAi pathway act cooperatively to control nuclear lncRNA expression, while the cytoplasmic Exo2 pathway is more distinct. Impairing both the nuclear exosome and the cytoplasmic exonuclease Exo2 is lethal in S. pombe. Importantly, I show that CUTs, RUTs and XUTs are stabilised under physiologically relevant growth conditions, with three key groups emerging: late meiotic RUTs/XUTs, early meiotic CUTs and quiescent CUTs. Late meiotic RUTs/XUTs tend to be antisense to protein-coding genes, and anti-correlate in expression with their sense loci. In contrast, early meiotic and quiescent CUTs tend to be transcribed divergently from protein-coding genes and positively correlate in expression with their mRNA partners. The current study provides an in-depth survey of the lncRNA repertoire of S.
    [Show full text]
  • Biocuration 2016 - Posters
    Biocuration 2016 - Posters Source: http://www.sib.swiss/events/biocuration2016/posters 1 RAM: A standards-based database for extracting and analyzing disease-specified concepts from the multitude of biomedical resources Jinmeng Jia and Tieliu Shi Each year, millions of people around world suffer from the consequence of the misdiagnosis and ineffective treatment of various disease, especially those intractable diseases and rare diseases. Integration of various data related to human diseases help us not only for identifying drug targets, connecting genetic variations of phenotypes and understanding molecular pathways relevant to novel treatment, but also for coupling clinical care and biomedical researches. To this end, we built the Rare disease Annotation & Medicine (RAM) standards-based database which can provide reference to map and extract disease-specified information from multitude of biomedical resources such as free text articles in MEDLINE and Electronic Medical Records (EMRs). RAM integrates disease-specified concepts from ICD-9, ICD-10, SNOMED-CT and MeSH (http://www.nlm.nih.gov/mesh/MBrowser.html) extracted from the Unified Medical Language System (UMLS) based on the UMLS Concept Unique Identifiers for each Disease Term. We also integrated phenotypes from OMIM for each disease term, which link underlying mechanisms and clinical observation. Moreover, we used disease-manifestation (D-M) pairs from existing biomedical ontologies as prior knowledge to automatically recognize D-M-specific syntactic patterns from full text articles in MEDLINE. Considering that most of the record-based disease information in public databases are textual format, we extracted disease terms and their related biomedical descriptive phrases from Online Mendelian Inheritance in Man (OMIM), National Organization for Rare Disorders (NORD) and Orphanet using UMLS Thesaurus.
    [Show full text]