DOCSLIB.ORG

PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41 American Society of Human Genetics 62nd Annual Meeting November 6–10, 2012 San Francisco, California PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41. Genes Underlying Neurological Disease Room 134 #196–#204 2. 4:30–6:30pm: Plenary Abstract 42. Cancer Genetics III: Common Presentations Hall D #1–#6 Variants Ballroom 104 #205–#213 43. Genetics of Craniofacial and Wednesday, November 7 Musculoskeletal Disorders Room 124 #214–#222 10:30am–12:45 pm: Concurrent Platform Session A (11–19): 44. Tools for Phenotype Analysis Room 132 #223–#231 11. Genetics of Autism Spectrum 45. Therapy of Genetic Disorders Room 130 #232–#240 Disorders Hall D #7–#15 46. Pharmacogenetics: From Discovery 12. New Methods for Big Data Ballroom 103 #16–#24 to Implementation Room 123 #241–#249 13. Cancer Genetics I: Rare Variants Room 135 #25–#33 14. Quantitation and Measurement of Friday, November 9 Regulatory Oversight by the Cell Room 134 #34–#42 8:00am–10:15am: Concurrent Platform Session D (47–55): 15. New Loci for Obesity, Diabetes, and 47. Structural and Regulatory Genomic Related Traits Ballroom 104 #43–#51 Variation Hall D #250–#258 16. Neuromuscular Disease and 48. Neuropsychiatric Disorders Ballroom 103 #259–#267 Deafness Room 124 #52–#60 49. Common Variants, Rare Variants, 17. Chromosomes and Disease Room 132 #61–#69 and Everything in-Between Room 135 #268–#276 18. Prenatal and Perinatal Genetics Room 130 #70–#78 50. Population Genetics Genome-Wide Room 134 #277–#285 19. Vascular and Congenital Heart 51. Endless Forms Most Beautiful: Disease Room 123 #79–#87 Variant Discovery in Genomic Data Ballroom 104 #286–#294 52. Clinical Genetics: Complex Thursday, November 8 Mechanisms and Exome-Discovery Room 124 #295–#303 10:30am–12:45pm: Concurrent Platform Session B (29–37): 53. From SNP to Function in Complex 29. Next-Generation Sequencing: Traits Room 132 #304–#312 Methods and Applications Hall D #88–#96 54. Genetic Counseling and Clinical 30. Genetics and Intellectual Disability Ballroom 103 #97–#105 Testing Room 130 #313–#321 31. GWAS from Head to Toe Room 135 #106–#114 55. Mitochondrial Disorders and 32. Cardiovascular Genetics: GWAS Ciliopathies Room 123 #322–#330 and Beyond Room 134 #115–#123 33. Clinical Genetics: Mutations, Friday, November 9 Mutations and Syndromes Ballroom 104 #124–#132 4:30pm–6:45pm: Concurrent Platform Session E (59–67): 34. Cancer Genetics II: Clinical 59. Genome Structure and Variation Hall D #331–#339 Translation Room 124 #133–#141 60. Advances in Neurodegenerative 35. Ethical, Legal, Social and Policy Disease Ballroom 103 #340–#348 Issues Room 132 #142–#150 61. Missing Heritability, Interactions and 36. Chipping Away at Autoimmune Sequencing Room 135 #349–#357 Disease Room 130 #151–#159 62. Exome Sequencing Uncovers 37. Metabolic Disease Discoveries Room 123 #160–#168 Etiology of Mendelian Disease Room 134 #358–#366 63. Transcriptional Regulation, Variation Thursday, November 8 and Complexity Ballroom 104 #367–#375 4:30pm–6:45pm: Concurrent Platform Session C (38–46): 64. Epigenetics Room 124 #376–#384 38. A Sequencing Jamboree: Exomes to 65. Advances in Ocular Genetics Room 132 #385–#393 Genomes Hall D #169–#177 66. Cancer Genetics: Somatic Variants Room 130 #394–#402 39. Admixture and Demography Ballroom 103 #178–#186 67. Developmental Insights into Human 40. Analysis of Multilocus Systems Room 135 #187–#195 Malformations Room 123 #403–#411 Copyright © 2012 The American Society of Human Genetics. All rights reserved. T : 38731APLCV 10-09-12 04:54:25 Layout: 30917X : 2001 Page 1 – blank – no folio Plenary Abstracts 1 1 3 A novel molecular and functional mechanism predisposing to ototoxi- Multidisciplinary and Translational Task Force for Neonatal Genomics. city. B. Wollnik1, E. Pohl1, N. Offenhäuser2, A. Uzumcu3, F.J. Kersten4, E.E. Davis1,2, A. Sabo3, N.C. Oien1, S.H. Katsanis4, H. Cope5, K. Sheets6, A.K. Rzadzinska5, O. Uyguner3, B. Lorente5, G. Nürnberg6, M. Emiroglu7, A. Sadeghpour1, K. McDonald5, M. Kousi1, J.R. Willer1, J. Kim4, S. Dugan- H. Kayserili3, I. del Castillo8, P. Nürnberg6, T. Moser9, C. Kubisch10, K.P. Rocha3, D.M. Muzny3, A. Ashley-Koch5, E. Hauser5, M. Hauser5, J. Sun2, Steel5, P.P. Di Fiore2, H. Kremer4, Y. Li1. 1) Institute of Human Genetics, J. Kurtzberg2,7, A. Murtha8, B. Boyd8, W.B. Gallentine9, R. Goldberg2,10, University of Cologne, Cologne, Germany; 2) IFOM, Fondazione Istituto M.T. McDonald6, R.A. Gibbs3, M. Angrist4, C.M. Cotten2,10, N. Katsanis1,2. FIRC di Oncologia Molecolar, Milan, Italy; 3) Department of Medical 1) Center for Human Disease Modeling, Duke University Medical Center, Genetics, Istanbul Medical Faculty, Istanbul University, Istanbul, Turkey; 4) Durham, NC; 2) Department of Pediatrics, Duke University Medical Center, Department of Human Genetics, Radboud University Nijmegen Medical Durham, NC, USA; 3) Human Genome Sequencing Center, Baylor College Centre, Nijmegen, The Netherlands; 5) Welcome Trust Sanger Institute, of Medicine, Houston, TX, USA; 4) Institute for Genome Sciences & Policy, Cambridge, Hinxton, UK; 6) Cologne Centre for Genomics, University of Duke University, Durham, NC, USA; 5) Center for Human Genetics, Depart- Cologne, Cologne, Germany; 7) Department of Otolaryngology, Istanbul ment of Medicine, Duke University Medical Center, Durham, NC, USA; 6) Medical Faculty, Istanbul University, Istanbul, Turkey; 8) Unidad de Genética Division of Medical Genetics, Duke University Medical Center, Durham, NC, Molecular, Hospital Ramón y Cajal, Madrid, Spain; 9) InnerEarLab, Depart- USA; 7) Department of Pathology, Duke University Medical Center, Durham, ment of Otolaryngology, Göttingen University Medical School, Göttingen, NC, USA; 8) Department of Obstetrics and Gynecology, Duke University Germany; 10) Institute of Human Genetics, Ulm University, Ulm, Germany. Medical Center, Durham, NC, USA; 9) Division of Pediatric Neurology, Duke While our knowledge about molecular mechanisms underlying Mendelian University Medical Center, Durham, NC, USA; 10) Neonatal and Perinatal forms of hearing loss tremendously increased over the last years, the genetic Research Institute, Duke University Medical Center, Durham, NC, USA. basis and pathogenesis for drug induced hearing impairment remains The accelerated implementation of genome-wide sequencing data as a unclear. Aminoglycosides are the most commonly used antibiotics world- first-pass diagnostic test is emerging as a powerful tool to secure a molecular wide. Although highly effective, their use is restricted by side-effects such diagnosis in the clinic. This has heightened the need for interpretive assays as ototoxicity in a significant subset of patients. However, underlying patho- to determine the pathogenic potential of genetic variation. To address these genesis and pharmacogenetic risk variants are largely unknown. Here we challenges, and to capitalize on the opportunity to shorten the time to secure show that dysfunction of an actin remodeling protein (named here ARP) can molecular diagnoses, we have created the Task Force for Neonatal Geno- result in a drug-inducible disturbance of actin dynamics and an irreversible mics at Duke University. The Task Force targets a uniquely vulnerable hearing impairment in humans. By positional cloning, we identified a homozy- patient cohort: neonates, whose developmental anomalies are more likely gous missense variant, p.L329P, in ARP as a cause of aminoglycoside- to be within a timeframe for treatment. Anatomical defects are also amenable induced hearing impairment in a large consanguineous family from Turkey to functional analyses of multiple organ systems including central nervous with 4 affected individuals. Complete ARP loss in knock out mice leads to system, renal, cardiac, craniofacial, skeletal, vascular, and skeletal muscle hearing loss associated with shortened stereocilia. We demonstrate that abnormalities. Our efforts target patients either prenatally in the Duke Fetal the protein is a component of the tip complex that regulates stereocilia Diagnostic Center, or postnatally in the Duke Intensive Care Nursery and length and that it interacts with whirlin. The mutation severely impairs this Pediatric specialty clinics and harness the full spectrum of clinical, genetics interaction in vitro. Extensive biochemical studies showed that myosinXVa and cellular biology expertise, including the use of transient model organisms can stabilize the ARP-whirlin interaction complex, and we show for the first (primarily zebrafish). Here we report on 1) the interdisciplinary nature of our time that kanamycin has a negative effect on this complex formation, which efforts; 2) our methodology for recruitment, data generation and analysis, is even more pronounced in mutant complexes, thereby explaining the and communication strategies between researchers and clinicians; 3) our development of hearing loss in affected individuals after aminoglycoside analysis progress to date; and 4) our evolving approach to returning primary treatment. Taken together, we link ototoxicity after aminoglycoside treatment and secondary molecular findings to clinicians and family members. In our to actin dynamics and this finding will help in devising strategies to counteract first year, we have screened > 50 referrals, enrolled 20 families, and have this severe side-effect of aminoglycosides. developed the capacity to enroll 50–100 families per year. In phenotype- appropriate patients, we couple whole exome sequencing of trios, a multi- tiered bioinformatic prioritization strategy,
Load more

Recommended publications
  • Groom Your Man!
    GROOM YOUR MAN! When it comes to grooming, women have it down to a science. But what about the man in your life? Kyan Douglas, the grooming guru for "Queer Eye for the Straight Guy," stopped by The Early Show on Wednesday, April 8, 2009, to discuss how to have THE conversation with your man about grooming issues. He then addressed the key grooming tools every man should have!: DO YOU THINK MOST MEN ARE EVEN CONCERNED OR REALIZE THEY NEED TO TAKE CARE OF THESE GROOMING ISSUES? With women, they have a sense of their appearance, some guys are all over it....very metro men are all about products.....but we're in the middle of a transition of what is appropriate for men and they're grooming habits ...men do care, but it's still a mixed bag of how far they take it with products and grooming. I always tell men that they don't want to ever look like they are neglectful of their appearance. IS THERE EVER A GOOD TIME TO BROACH THE SUBJECT OF GROOMING WITH YOUR MAN? First of all, when you're in a relationship you have to remind yourself and your partner this is primarily coming from a place of loving your mate. No matter what, he has to feel there has to be unconditional acceptance and there has to be a tone of safety in your relationship before you can talk about something like this. HOW DO YOU TELL YOUR MAN THAT HE REALLY NEEDS TO DO SOMETHING ABOUT HIS 1.NOSE HAIR, 2.
    [Show full text]
  • An Alu Element-Based Model of Human Genome Instability George Wyndham Cook, Jr
    Louisiana State University LSU Digital Commons LSU Doctoral Dissertations Graduate School 2013 An Alu element-based model of human genome instability George Wyndham Cook, Jr. Louisiana State University and Agricultural and Mechanical College, [email protected] Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_dissertations Recommended Citation Cook, Jr., George Wyndham, "An Alu element-based model of human genome instability" (2013). LSU Doctoral Dissertations. 2090. https://digitalcommons.lsu.edu/gradschool_dissertations/2090 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Doctoral Dissertations by an authorized graduate school editor of LSU Digital Commons. For more information, please [email protected]. AN ALU ELEMENT-BASED MODEL OF HUMAN GENOME INSTABILITY A Dissertation Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy in The Department of Biological Sciences by George Wyndham Cook, Jr. B.S., University of Arkansas, 1975 May 2013 TABLE OF CONTENTS LIST OF TABLES ...................................................................................................... iii LIST OF FIGURES .................................................................................................... iv LIST OF ABBREVIATIONS ......................................................................................
    [Show full text]
  • Synergistic Genetic Interactions Between Pkhd1 and Pkd1 Result in an ARPKD-Like Phenotype in Murine Models
    BASIC RESEARCH www.jasn.org Synergistic Genetic Interactions between Pkhd1 and Pkd1 Result in an ARPKD-Like Phenotype in Murine Models Rory J. Olson,1 Katharina Hopp ,2 Harrison Wells,3 Jessica M. Smith,3 Jessica Furtado,1,4 Megan M. Constans,3 Diana L. Escobar,3 Aron M. Geurts,5 Vicente E. Torres,3 and Peter C. Harris 1,3 Due to the number of contributing authors, the affiliations are listed at the end of this article. ABSTRACT Background Autosomal recessive polycystic kidney disease (ARPKD) and autosomal dominant polycystic kidney disease (ADPKD) are genetically distinct, with ADPKD usually caused by the genes PKD1 or PKD2 (encoding polycystin-1 and polycystin-2, respectively) and ARPKD caused by PKHD1 (encoding fibrocys- tin/polyductin [FPC]). Primary cilia have been considered central to PKD pathogenesis due to protein localization and common cystic phenotypes in syndromic ciliopathies, but their relevance is questioned in the simple PKDs. ARPKD’s mild phenotype in murine models versus in humans has hampered investi- gating its pathogenesis. Methods To study the interaction between Pkhd1 and Pkd1, including dosage effects on the phenotype, we generated digenic mouse and rat models and characterized and compared digenic, monogenic, and wild-type phenotypes. Results The genetic interaction was synergistic in both species, with digenic animals exhibiting pheno- types of rapidly progressive PKD and early lethality resembling classic ARPKD. Genetic interaction be- tween Pkhd1 and Pkd1 depended on dosage in the digenic murine models, with no significant enhancement of the monogenic phenotype until a threshold of reduced expression at the second locus was breached.
    [Show full text]
  • Harnessing Low-Density Lipoprotein Receptor Protein 6 (LRP6) Genetic Variation and Wnt Signaling for Innovative Diagnostics in Complex Diseases
    OPEN The Pharmacogenomics Journal (2018) 18, 351–358 www.nature.com/tpj REVIEW Harnessing low-density lipoprotein receptor protein 6 (LRP6) genetic variation and Wnt signaling for innovative diagnostics in complex diseases Z-M Wang1,2, J-Q Luo1,2, L-Y Xu3, H-H Zhou1,2 and W Zhang1,2 Wnt signaling regulates a broad variety of processes in both embryonic development and various diseases. Recent studies indicated that some genetic variants in Wnt signaling pathway may serve as predictors of diseases. Low-density lipoprotein receptor protein 6 (LRP6) is a Wnt co-receptor with essential functions in the Wnt/β-catenin pathway, and mutations in LRP6 gene are linked to many complex human diseases, including metabolic syndrome, cancer, Alzheimer’s disease and osteoporosis. Therefore, we focus on the role of LRP6 genetic polymorphisms and Wnt signaling in complex diseases, and the mechanisms from mouse models and cell lines. It is also highly anticipated that LRP6 variants will be applied clinically in the future. The brief review provided here could be a useful resource for future research and may contribute to a more accurate diagnosis in complex diseases. The Pharmacogenomics Journal (2018) 18, 351–358; doi:10.1038/tpj.2017.28; published online 11 July 2017 INTRODUCTION signaling pathways and expressed in various target organs.1 LDLR- The Wnt1 gene was identified in 1982. Ensuing studies in related proteins 5/6 (LRP5/6) belong to this large family and Drosophila and Xenopus unveiled a highly conserved Wnt/ function as co-receptors of the Wnt/β-catenin pathway. These β-catenin pathway, namely, canonical Wnt signaling.
    [Show full text]
  • LRP5 Promotes Adipose Progenitor Cell Fitness and Adipocyte Insulin Sensitivity
    bioRxiv preprint doi: https://doi.org/10.1101/2020.03.04.976647; this version posted March 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. LRP5 promotes adipose progenitor cell fitness and adipocyte insulin sensitivity Short title: LRP5 and adipose tissue biology Authors: Nellie Y. Loh1, Senthil K. Vasan1, Manu Verma1, Agata Wesolowska-Andersen2, Matt J. Neville1,3, Clive Osmond4, Celia L. Gregson5, Fredrik Karpe1,3 and Constantinos Christodoulides1. Affiliations: 1 Oxford Centre for Diabetes, Endocrinology and Metabolism, Radcliffe Department of Medicine, University of Oxford, Oxford OX3 7LE, UK 2 Wellcome Trust Centre for Human Genetics, Nuffield Department of Medicine, University of Oxford, Oxford OX3 7BN, UK 3 NIHR Oxford Biomedical Research Centre, OUH Foundation Trust, Oxford OX3 7LE, UK 4 MRC Lifecourse Epidemiology Unit, Southampton General Hospital, University of Southampton, Tremona Road, Southampton SO17 1BJ, UK 5 Musculoskeletal Research Unit, Translational Health Sciences, University of Bristol, Southmead Hospital, Bristol BS10 5NB, UK Address for correspondence to: Dr Constantinos Christodoulides Oxford Centre for Diabetes, Endocrinology and Metabolism, Churchill Hospital, Oxford OX3 7LE, UK E-mail: [email protected] Phone: +44-1865-857111 Keywords: LRP5, adipose, adipogenesis, fat distribution, WNT, human. Word count: 3964 words, 4 figures, 2 tables 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.03.04.976647; this version posted March 5, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Noninvasive Sleep Monitoring in Large-Scale Screening of Knock-Out Mice
    bioRxiv preprint doi: https://doi.org/10.1101/517680; this version posted January 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Noninvasive sleep monitoring in large-scale screening of knock-out mice reveals novel sleep-related genes Shreyas S. Joshi1*, Mansi Sethi1*, Martin Striz1, Neil Cole2, James M. Denegre2, Jennifer Ryan2, Michael E. Lhamon3, Anuj Agarwal3, Steve Murray2, Robert E. Braun2, David W. Fardo4, Vivek Kumar2, Kevin D. Donohue3,5, Sridhar Sunderam6, Elissa J. Chesler2, Karen L. Svenson2, Bruce F. O'Hara1,3 1Dept. of Biology, University of Kentucky, Lexington, KY 40506, USA, 2The Jackson Laboratory, Bar Harbor, ME 04609, USA, 3Signal solutions, LLC, Lexington, KY 40503, USA, 4Dept. of Biostatistics, University of Kentucky, Lexington, KY 40536, USA, 5Dept. of Electrical and Computer Engineering, University of Kentucky, Lexington, KY 40506, USA. 6Dept. of Biomedical Engineering, University of Kentucky, Lexington, KY 40506, USA. *These authors contributed equally Address for correspondence and proofs: Shreyas S. Joshi, Ph.D. Dept. of Biology University of Kentucky 675 Rose Street 101 Morgan Building Lexington, KY 40506 U.S.A. Phone: (859) 257-2805 FAX: (859) 257-1717 Email: [email protected] Running title: Sleep changes in knockout mice bioRxiv preprint doi: https://doi.org/10.1101/517680; this version posted January 11, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Facial Image Comparison Feature List for Morphological Analysis
    Disclaimer: As a condition to the use of this document and the information contained herein, the Facial Identification Scientific Working Group (FISWG) requests notification by e-mail before or contemporaneously to the introduction of this document, or any portion thereof, as a marked exhibit offered for or moved into evidence in any judicial, administrative, legislative, or adjudicatory hearing or other proceeding (including discovery proceedings) in the United States or any foreign country. Such notification shall include: 1) the formal name of the proceeding, including docket number or similar identifier; 2) the name and location of the body conducting the hearing or proceeding; and 3) the name, mailing address (if available) and contact information of the party offering or moving the document into evidence. Subsequent to the use of this document in a formal proceeding, it is requested that FISWG be notified as to its use and the outcome of the proceeding. Notifications should be sent to: Redistribution Policy: FISWG grants permission for redistribution and use of all publicly posted documents created by FISWG, provided the following conditions are met: Redistributions of documents, or parts of documents, must retain the FISWG cover page containing the disclaimer. Neither the name of FISWG, nor the names of its contributors, may be used to endorse or promote products derived from its documents. Any reference or quote from a FISWG document must include the version number (or creation date) of the document and mention if the document is in a draft status. Version 2.0 2018.09.11 Facial Image Comparison Feature List for Morphological Analysis 1.
    [Show full text]
  • The Developmental and Behavioral Effects of Δ9-Tetrahydrocannabinol
    Kennesaw State University DigitalCommons@Kennesaw State University Department of Ecology, Evolution, and Organismal Master of Science in Integrative Biology Theses Biology Summer 6-26-2019 The evelopmeD ntal and Behavioral Effects of Δ9-Tetrahydrocannabinol on a Spastic Mutant Victoria Mendiola Follow this and additional works at: https://digitalcommons.kennesaw.edu/integrbiol_etd Part of the Integrative Biology Commons Recommended Citation Mendiola, Victoria, "The eD velopmental and Behavioral Effects of Δ9-Tetrahydrocannabinol on a Spastic Mutant" (2019). Master of Science in Integrative Biology Theses. 42. https://digitalcommons.kennesaw.edu/integrbiol_etd/42 This Thesis is brought to you for free and open access by the Department of Ecology, Evolution, and Organismal Biology at DigitalCommons@Kennesaw State University. It has been accepted for inclusion in Master of Science in Integrative Biology Theses by an authorized administrator of DigitalCommons@Kennesaw State University. For more information, please contact [email protected]. The Developmental and Behavioral Effects of �9-Tetrahydrocannabinol on a Spastic Mutant Kennesaw State University MSIB Thesis Summer 2019 Victoria Mendiola Dr. Lisa Ganser Dr. Martin Hudson Dr. Bill Ensign 2 Table of Contents ABSTRACT ............................................................................................................................................................ 3 CHAPTER ONE: INTRODUCTION ...........................................................................................................................
    [Show full text]
  • Supplementary Materials
    Lists of figures Figure S1: A-B: Principal Component Analysis (PCA) was applied to 3 pairs of SCEC tissues (red) and matched adjacent normal tissues (blue) that were characterized by the gene expression of all probes on Affymetrix HG U133 Plus 2.0 Array. C: Box plot of SCEC group. D: Pearson’s correlation matrix of SCEC group. 17 / 25 Figure S2: MvA plot of SCEC group. Figure S3: Volcano plots of probe sets differing between SCEC and matched normal tissues. Fold change (X axis) is plotted against statistical significance (Y axis) for each probe sets. Genes altered with a fold change ≥2 and FDR <0.01 are depicted in red. Grey represents genes in the arrays that were not found to differ significantly between cancerous samples and matched normal samples. Figure S4: Gene regulatory network plotted by the top 120 DEGs (ranked by FDR) of SCEC groups. 18 / 25 Figure S5: DNA copy number change profiles in 3 pairs of SCEC samples. The CNVs frequency of the whole genome was analyzed by aCGH. Gains were marked in red and losses in bule. Lists of tables Table S1. Primers used in qRT-PCR for microarray gene expression validation Gene Forward Primer (5’-3’) Reverse Primer (5’-3’) Product β-actin AAGGTGACAGCAGTCGGTT TGTGTGGACTTGGGAGAGG 195bp INSM1 GTATTCGCTGTGTTCATGGTC CGCTACATACATAGAGAGCAGAG 79bp ASCL1 AACTCCCATCACCTCTAACA TGAGACGAAAGACACCAACT 120bp NRCAM GATGGCGAAGAATGAAGTT ACAGTGAGGGATAAGGTGTG 141bp NUF2 ATGATGCCAGTGAACTCTGAA GACTTGTCCGTTTTGCTTTTG 160bp 19 / 25 SNAP25 CCTGGATATGGGCAATGAGAT ACACGGGTGGGCACACTTA 146bp PTP4A3 GCTTCCTCATCACCCACAA CCGTACTTCTTCAGGTCCTCA
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Evaluation of Variability in Human Kidney Organoids
    ARTICLES https://doi.org/10.1038/s41592-018-0253-2 Evaluation of variability in human kidney organoids Belinda Phipson 1, Pei X. Er1, Alexander N. Combes1,2, Thomas A. Forbes1,3,4, Sara E. Howden1,2, Luke Zappia1,5, Hsan-Jan Yen1, Kynan T. Lawlor1, Lorna J. Hale1,4, Jane Sun6, Ernst Wolvetang6, Minoru Takasato1,7, Alicia Oshlack1,5 and Melissa H. Little 1,2,4* The utility of human pluripotent stem cell–derived kidney organoids relies implicitly on the robustness and transferability of the protocol. Here we analyze the sources of transcriptional variation in a specific kidney organoid protocol. Although individ- ual organoids within a differentiation batch showed strong transcriptional correlation, we noted significant variation between experimental batches, particularly in genes associated with temporal maturation. Single-cell profiling revealed shifts in neph- ron patterning and proportions of component cells. Distinct induced pluripotent stem cell clones showed congruent transcrip- tional programs, with interexperimental and interclonal variation also strongly associated with nephron patterning. Epithelial cells isolated from organoids aligned with total organoids at the same day of differentiation, again implicating relative matura- tion as a confounder. This understanding of experimental variation facilitated an optimized analysis of organoid-based disease modeling, thereby increasing the utility of kidney organoids for personalized medicine and functional genomics. he ability to derive induced pluripotent stem cells (iPSCs) In this study, we provide a comprehensive transcriptional from the somatic cells of patients1, together with directed dif- and morphological evaluation of our kidney organoid protocol. Tferentiation protocols, provides a capacity to model the cell Applying RNA sequencing (RNA-seq) to 57 whole organoids and types affected by disease.
    [Show full text]