DOCSLIB.ORG

The Fission Yeast Non-Coding Transcriptome

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Fission Yeast Non-Coding Transcriptome The Fission Yeast Non-Coding Transcriptome Sophie Radha Atkinson A thesis submitted for the degree of Doctor of Philosophy University College London September 2014 1 Declaration I, Sophie Radha Atkinson, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. 2 Abstract Long non-coding RNAs (lncRNAs) are emerging as important regulators of gene expression, although it remains unclear to what extent they contribute overall to the information flow from genotype to phenotype. Using strand-specific RNA- sequencing, I identify thousands of novel unstable, or cryptic, lncRNAs in Schizosaccharomyces pombe. The nuclear exosome, the RNAi pathway and the cytoplasmic exonuclease Exo2 represent three key pathways regulating lncRNAs in S. pombe, defining the overlapping classes of CUTs, RUTs and XUTs, respectively. The nuclear exosome and the RNAi pathway act cooperatively to control nuclear lncRNA expression, while the cytoplasmic Exo2 pathway is more distinct. Impairing both the nuclear exosome and the cytoplasmic exonuclease Exo2 is lethal in S. pombe. Importantly, I show that CUTs, RUTs and XUTs are stabilised under physiologically relevant growth conditions, with three key groups emerging: late meiotic RUTs/XUTs, early meiotic CUTs and quiescent CUTs. Late meiotic RUTs/XUTs tend to be antisense to protein-coding genes, and anti-correlate in expression with their sense loci. In contrast, early meiotic and quiescent CUTs tend to be transcribed divergently from protein-coding genes and positively correlate in expression with their mRNA partners. The current study provides an in-depth survey of the lncRNA repertoire of S. pombe, and the pathways that regulate their expression. It seems likely that any regulatory functions mediated by most of these lncRNAs are in cis, nuclear and co- transcriptional. The current study provides a rich and comprehensive resource for future studies of lncRNA function. 3 Acknowledgements I would like to thank Jürg Bähler for being an excellent supervisor and for giving me the opportunity to work in his lab. I have greatly benefited from his vision and insight, and constant willingness to offer his time and support throughout my PhD. I would also like to thank Samuel Marguerat for his invaluable input and guidance, especially during the initial stages of my PhD, and for teaching me everything I need to know about R. Thank you to all past and present members of the Bähler group for all their help and advice. I’m grateful to Xavi for his patience in teaching me how to do tetrad dissections, and to Babis, Maria and Michal for always being so willing to help me troubleshoot wet-lab experiments. Thank you to Danny for providing countless discussions on the intricacies of analysing RNA-seq data, and to Sandra for managing the smooth running of the lab. In particular, I’d like to thank Maria, Michal, Danny and Dave for their friendship and support – I hope the climbing and pub trips will continue. Thank you to all my friends for keeping me sane throughout this whole process, providing valuable distractions when necessary, and helping me keep my eye on the bigger picture. Thank you to my brother and sister-in-law, Stephen and Karen, and my beautiful niece, India, for always being there. Most importantly, thank you to my Mum and Dad for their constant love and support. 4 Publications arising from work done in this thesis Atkinson SR, Marguerat S, Bähler J. 2012. Exploring long non-coding RNAs through sequencing. Semin Cell Dev Biol 23: 200-205. Atkinson SR, Marguerat S, Lemay JF, Bachand F, Bähler J (manuscript in preparation). The fission yeast non-coding transcriptome. Bitton DA, Atkinson SR, Rallis C, Smith GC, Ellis DA, Jeffares DC et al. (manuscript in preparation). Skip and bin: pervasive alternative splicing is degraded by nuclear RNA surveillance in fission yeast. Lemay JF, Larochelle M, Marguerat S, Atkinson SR, Bähler J, Bachand F. 2014 (in press). The RNA exosome promotes transcription termination of backtracked RNA polymerase II. Nat Struct Mol Biol. 5 Abbreviations AS Antisense bp Base-pair CAGE Cap analysis of gene expression CC Correlation coefficient cds Coding sequence cDTA Comparative dynamic transcriptome analysis ceRNAs Competitive endogenous RNAs CESR Core environmental stress response CFU Colony forming units ChIP-seq Chromatin immunoprecipitation with sequencing ChIRP-seq Chromatin isolation by RNA purification circRNAs Circular RNA CUT Cryptic unstable transcript dChIRP Domain specific chromatin isolation by RNA purification DE Differentially expressed DSR Determinant of selective removal 6 eCUT Elongated CUT EMM Edinburgh minimal media eRNA Enhancer RNA GO Gene ontology GRO-seq Global run-on sequencing GTF General transcription factor GWAS Genome-wide association studies lincRNA Long intergenic non-coding RNA lncRNA Long non-coding RNA MEA Malt extract agar miRNA MicroRNA mRNA Messenger RNA mRNP Messenger ribonucleoprotein particle ncRNA Non-coding RNA NFR Nucleosome free region NGD No-go decay NGS Next-generation sequencing 7 NH4Cl Ammonium chloride NMD Nonsense mediated decay NNS Nrd1-Nab3-Sen1 NPD Non parental ditype NSD Non-stop decay nt Nucleotide NUT Nrd1-unterminated transcript OD Optical density ORF Open reading frame PD Parental ditype PIC Pre-initiation complex piRNA Piwi interacting RNA Pol II RNA polymerase II rDNA Ribosomal DNA RIP RNA immunoprecipitation RNA-seq RNA sequencing RNAi Interference RNA RPKM Reads per kilobase per million 8 rpm Revolutions per minute siRNA Small-interfering RNA snoRNA Small nucleolar RNA snRNA Small nuclear RNA snRNP Small nuclear ribonucleoprotein SUT Stable unannotated transcript T Tetratype ts Temperature sensitive TSS Transcription start site TTS Transcription termination site UTR Untranslated region WT Wild-type XUT Xrn1-dependent unstable transcript YES Rich media 9 Table of Contents Declaration .................................................................................................................. 2! Abstract .................................................................................................................. 3! Acknowledgements ..................................................................................................... 4! Publications arising from work done in this thesis ................................................. 5! Abbreviations .............................................................................................................. 6! Table of Contents ..................................................................................................... 10! Table of Figures ........................................................................................................ 16! Table of Tables ......................................................................................................... 18! Chapter 1! Introduction .......................................................................................... 19! 1.1! Overview ....................................................................................................... 19! 1.2! Genomes are pervasively transcribed ............................................................ 19! 1.2.1! Transcriptomics reveals pervasive lncRNA transcripts ......................... 19! 1.2.2! General features of lncRNAs ................................................................. 20! 1.3! Genomic origins of lncRNA transcription .................................................... 22! 1.3.1! Antisense lncRNAs ................................................................................ 22! 1.3.2! Bidirectional lncRNAs ........................................................................... 24! 1.3.3! Enhancer associated lncRNAs ............................................................... 26! 10 1.3.4! Long intergenic ncRNAs (lincRNAs) .................................................... 27! 1.3.5! Repetitive element-associated lncRNAs ................................................ 28! 1.4! Regulation of pervasive transcription by RNA degradation ......................... 29! 1.4.1! Overview of RNA degradation pathways .............................................. 29! 1.4.2! Themes of RNA degradation pathways ................................................. 33! 1.4.3! RNA degradation pathways regulating lncRNAs .................................. 34! 1.5! Emerging themes of lncRNA functional mechanisms .................................. 37! 1.5.1! Guides for chromatin modifying complexes .......................................... 38! 1.5.2! Evictors .................................................................................................. 39! 1.5.3! Sponges and decoys ............................................................................... 40! 1.5.4! Co-transcriptional functions ................................................................... 41! 1.6! Aims of this thesis ......................................................................................... 43! Chapter 2! Materials and Methods ........................................................................ 45! 2.1! S. pombe strains and growth conditions ........................................................ 45! 2.2! Transcriptomics ............................................................................................. 57! 2.3! Segmentation of sequencing data .................................................................. 58! 2.4!
Load more

Recommended publications
  • PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41
    American Society of Human Genetics 62nd Annual Meeting November 6–10, 2012 San Francisco, California PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41. Genes Underlying Neurological Disease Room 134 #196–#204 2. 4:30–6:30pm: Plenary Abstract 42. Cancer Genetics III: Common Presentations Hall D #1–#6 Variants Ballroom 104 #205–#213 43. Genetics of Craniofacial and Wednesday, November 7 Musculoskeletal Disorders Room 124 #214–#222 10:30am–12:45 pm: Concurrent Platform Session A (11–19): 44. Tools for Phenotype Analysis Room 132 #223–#231 11. Genetics of Autism Spectrum 45. Therapy of Genetic Disorders Room 130 #232–#240 Disorders Hall D #7–#15 46. Pharmacogenetics: From Discovery 12. New Methods for Big Data Ballroom 103 #16–#24 to Implementation Room 123 #241–#249 13. Cancer Genetics I: Rare Variants Room 135 #25–#33 14. Quantitation and Measurement of Friday, November 9 Regulatory Oversight by the Cell Room 134 #34–#42 8:00am–10:15am: Concurrent Platform Session D (47–55): 15. New Loci for Obesity, Diabetes, and 47. Structural and Regulatory Genomic Related Traits Ballroom 104 #43–#51 Variation Hall D #250–#258 16. Neuromuscular Disease and 48. Neuropsychiatric Disorders Ballroom 103 #259–#267 Deafness Room 124 #52–#60 49. Common Variants, Rare Variants, 17. Chromosomes and Disease Room 132 #61–#69 and Everything in-Between Room 135 #268–#276 18. Prenatal and Perinatal Genetics Room 130 #70–#78 50. Population Genetics Genome-Wide Room 134 #277–#285 19. Vascular and Congenital Heart 51. Endless Forms Most Beautiful: Disease Room 123 #79–#87 Variant Discovery in Genomic Data Ballroom 104 #286–#294 52.
    [Show full text]
  • Supplementary Materials
    Lists of figures Figure S1: A-B: Principal Component Analysis (PCA) was applied to 3 pairs of SCEC tissues (red) and matched adjacent normal tissues (blue) that were characterized by the gene expression of all probes on Affymetrix HG U133 Plus 2.0 Array. C: Box plot of SCEC group. D: Pearson’s correlation matrix of SCEC group. 17 / 25 Figure S2: MvA plot of SCEC group. Figure S3: Volcano plots of probe sets differing between SCEC and matched normal tissues. Fold change (X axis) is plotted against statistical significance (Y axis) for each probe sets. Genes altered with a fold change ≥2 and FDR <0.01 are depicted in red. Grey represents genes in the arrays that were not found to differ significantly between cancerous samples and matched normal samples. Figure S4: Gene regulatory network plotted by the top 120 DEGs (ranked by FDR) of SCEC groups. 18 / 25 Figure S5: DNA copy number change profiles in 3 pairs of SCEC samples. The CNVs frequency of the whole genome was analyzed by aCGH. Gains were marked in red and losses in bule. Lists of tables Table S1. Primers used in qRT-PCR for microarray gene expression validation Gene Forward Primer (5’-3’) Reverse Primer (5’-3’) Product β-actin AAGGTGACAGCAGTCGGTT TGTGTGGACTTGGGAGAGG 195bp INSM1 GTATTCGCTGTGTTCATGGTC CGCTACATACATAGAGAGCAGAG 79bp ASCL1 AACTCCCATCACCTCTAACA TGAGACGAAAGACACCAACT 120bp NRCAM GATGGCGAAGAATGAAGTT ACAGTGAGGGATAAGGTGTG 141bp NUF2 ATGATGCCAGTGAACTCTGAA GACTTGTCCGTTTTGCTTTTG 160bp 19 / 25 SNAP25 CCTGGATATGGGCAATGAGAT ACACGGGTGGGCACACTTA 146bp PTP4A3 GCTTCCTCATCACCCACAA CCGTACTTCTTCAGGTCCTCA
    [Show full text]
  • Interpreting Human Genetic Variation with in Vivo Zebrafish Assays Erica E
    Interpreting Human Genetic Variation With In Vivo Zebrafish Assays Erica E. Davis, PhD, Stephan Frangakis, BS, and Nicholas Katsanis, PhD Center for Human Disease Modeling Duke University Medical Center Durham, North Carolina © 20132015 Katsanis Interpreting Human Genetic Variation With In Vivo Zebrafish Assays 11 Introduction bona fide pathogenic mutations alone in the average NOTES Rapid advances and cost erosion in exome and human exome, studies have reported a median of 50– genome analysis of patients with both rare and 150 nonsense mutations, several in homozygosity, common genetic disorders have accelerated gene while the abundance of unique single nucleotide discovery and illuminated fundamental biological variants (SNVs) can be in the low-to-mid 100s mechanisms. The thrill of discovery has been (1000 Genomes Project Consortium et al., 2010). accompanied, however, by the sobering appreciation Importantly, the number of rare and ultra-rare SNVs that human genomes are burdened with a large has continued to increase proportionately to the number of rare and ultra-rare variants, thereby posing number of available exomes and genomes (Tennessen a significant challenge in dissecting both the effect of et al., 2012), indicating that we are unlikely to reach such alleles on protein function and the biological saturation of such alleles soon. These observations relevance of these events to patient pathology. In have generated a significant interpretive problem an effort to develop model systems that are able to for disease gene discovery and for clinical genomics, generate surrogates of human pathologies, a powerful as population-based arguments alone have been suite of tools has been developed in zebrafish, unable to dissect the contribution of the majority of taking advantage of the relatively small (compared these alleles to clinical phenotypes.
    [Show full text]
  • Biocuration 2016 - Posters
    Biocuration 2016 - Posters Source: http://www.sib.swiss/events/biocuration2016/posters 1 RAM: A standards-based database for extracting and analyzing disease-specified concepts from the multitude of biomedical resources Jinmeng Jia and Tieliu Shi Each year, millions of people around world suffer from the consequence of the misdiagnosis and ineffective treatment of various disease, especially those intractable diseases and rare diseases. Integration of various data related to human diseases help us not only for identifying drug targets, connecting genetic variations of phenotypes and understanding molecular pathways relevant to novel treatment, but also for coupling clinical care and biomedical researches. To this end, we built the Rare disease Annotation & Medicine (RAM) standards-based database which can provide reference to map and extract disease-specified information from multitude of biomedical resources such as free text articles in MEDLINE and Electronic Medical Records (EMRs). RAM integrates disease-specified concepts from ICD-9, ICD-10, SNOMED-CT and MeSH (http://www.nlm.nih.gov/mesh/MBrowser.html) extracted from the Unified Medical Language System (UMLS) based on the UMLS Concept Unique Identifiers for each Disease Term. We also integrated phenotypes from OMIM for each disease term, which link underlying mechanisms and clinical observation. Moreover, we used disease-manifestation (D-M) pairs from existing biomedical ontologies as prior knowledge to automatically recognize D-M-specific syntactic patterns from full text articles in MEDLINE. Considering that most of the record-based disease information in public databases are textual format, we extracted disease terms and their related biomedical descriptive phrases from Online Mendelian Inheritance in Man (OMIM), National Organization for Rare Disorders (NORD) and Orphanet using UMLS Thesaurus.
    [Show full text]
  • From Genome to Phenome
    Dutch Society of Human Genetics (www.nvhg-nav.nl) From Genome to Phenome Two-Day Autumn Symposium 3 & 4 October 2013 Wij zijn bijzonder erkentelijk voor de financiële steun van Stichting Simonsfonds Logo’s: Tom de Vries Lentsch 2 Dear colleagues, Welcome to the joint autumn symposium of the NVHG (Dutch Society for Human Genetics). This meeting is organized together with the VKGL (Vereniging Klinisch Genetische Laboratoriumdiagnostiek), the VKGN (Vereniging Klinische Genetica Nederland) and the NACGG (Nederlandse Associatie voor Community Genetics en Public Health Genomics ) We live in an exciting time. Developments in genetics are going very fast. New technologies have advanced research and these findings are rapidly translated to diagnostics. Even non-invasive prenatal tests are now possible. Single gene tests with long turn-around times are being replaced by rapid analysis of gene panels and the genetic basis of multifactorial diseases is being resolved. This has great impact on the way we perform our research, diagnostics and counseling. Furthermore, we seriously have to reckon with the impact on society as illustrated by the recent publicity on the introduction of non-invasive prenatal testing. The scope of our profession is changing, interaction between the different professionals in genetics is increasingly important. This meeting is the perfect place to discuss the new developments and stimulate discussion of the possibilities and their implications. Thursday afternoon’s forum discussion on prenatal testing is a good example. This year we focus on the translation of the genetic findings to the patient. How do we interpret the sequence variants detected by the new technologies, which functional assays are available and how much functional evidence do we need before we start offering new tests? The scientific program covers basic research, disease models and implications for diagnostics.
    [Show full text]
  • The 2014 Version of the Gene Table of Monogenic Neuromuscular Disorders (Nuclear Genome)
    Available online at www.sciencedirect.com Neuromuscular Disorders 23 (2013) 1081–1111 www.elsevier.com/locate/nmd The 2014 version of the gene table of monogenic neuromuscular disorders (nuclear genome) Jean-Claude Kaplan a,⇑, Dalil Hamroun b a Institut Cochin, Universite´ Paris Descartes, 27 Rue du Faubourg Saint Jacques, 75014 Paris, France b Centre Hospitalo-Universitaire de Montpellier, Ho^pital Arnaud de Villeneuve, 34000 Montpellier, France General features as in LMNA defects) . In some diseases both kinds of heterogeneity may occur. As a consequence a gene or a This table is published annually in the December issue. Its disease may be cited in several places of the table. purpose is to provide the reader of Neuromuscular Disorders with an updated list of monogenic muscle diseases due to a The two versions of the gene table3 primary defect residing in the nuclear genome. It comprises diseases in which the causative gene is known or at least The annual printed version below is abridged and does localized on a chromosome, if not yet identified. Diseases not contain the Arrythmogenic Hereditary Cardiomyopa- for which the locus has not been mapped or which are due thies (Group 10-B), Hereditary Ataxias (Group 13), and to defects involving mitochondrial genes are not included.1 Hereditary Paraplegias (Group 15). The list of references is restricted to new key references corresponding to the As in past years the diseases are classified into 16 groups: items added or implemented since the preceding year. The full online version contains the complete data of the 1. Muscular dystrophies; 2. Congenital muscular dystro- 16 groups and the cumulative list of key references since 1991.
    [Show full text]
  • How Abnormal RNA Metabolism Results in Childhood-Onset Neurological Diseases
    Exosomal Protein Deficiencies: How Abnormal RNA Metabolism Results in Childhood-Onset Neurological Diseases A thesis submitted for the degree of Doctor of Philosophy at Newcastle University October 2016 Michele Giunta Institute of Genetic Medicine ii Author’s declaration This thesis is submitted for the degree of Doctor of Philosophy at Newcastle University. I, Michele Giunta, declare that the work described here is my own, unless where clearly acknowledged and stated otherwise. I certify that I have not submitted any of the material in this thesis for a degree qualification at this or any other university. iii Abstract RNA metabolism is of critical importance for normal cellular functions and needs to be finely tuned in order to maintain stable conditions within the cell. The exosome complex is the most important RNA processing machinery, responsible for the correct processing of many different types of RNAs and interacting with different co-factors which bind and carry specific subtypes of RNA for degradation to the complex. Mutations in exosome complex subunits (EXOSC3, EXOSC8) were reported to cause severe childhood onset complex neurological disorders presenting with pontocerebellar hypoplasia type 1 (PCH1), spinal muscular atrophy (SMA) and central nervous system hypomyelination. We have recently identified a homozygous pathogenic mutation in RNA Binding Motif Protein 7 RBM7, a subunit of the nuclear exosome targeting (NEXT) complex in a single patient with SMA-like phenotype and proved that RBM7 is a novel human disease gene related to the exosome complex. In order to understand the disease mechanism in RBM7 deficiency and to explore the role of exosome complex in neurodevelopment, we performed gene expression studies (RT-PCR, RNA sequencing) in human cells of patients carrying mutations in EXOSC8 and RBM7.
    [Show full text]
  • Immune Gene Variation and Susceptibility to Upper Respiratory
    Louisiana State University LSU Digital Commons LSU Doctoral Dissertations Graduate School 2016 Immune Gene Variation and Susceptibility to Upper Respiratory Tract Disease in Gopher Tortoises Jean Pierre Elbers Louisiana State University and Agricultural and Mechanical College, [email protected] Follow this and additional works at: https://digitalcommons.lsu.edu/gradschool_dissertations Part of the Environmental Sciences Commons Recommended Citation Elbers, Jean Pierre, "Immune Gene Variation and Susceptibility to Upper Respiratory Tract Disease in Gopher Tortoises" (2016). LSU Doctoral Dissertations. 4245. https://digitalcommons.lsu.edu/gradschool_dissertations/4245 This Dissertation is brought to you for free and open access by the Graduate School at LSU Digital Commons. It has been accepted for inclusion in LSU Doctoral Dissertations by an authorized graduate school editor of LSU Digital Commons. For more information, please [email protected]. IMMUNE GENE VARIATION AND SUSCEPTIBILTY TO UPPER RESPIRATORY TRACT DISEASE IN GOPHER TORTOISES A Dissertation Submitted to the Graduate Faculty of the Louisiana State University and Agricultural and Mechanical College in partial fulfillment of the requirements for the degree of Doctor of Philosophy in The School of Renewable Natural Resources by Jean Pierre Elbers B.S., Southeastern Louisiana University, 2008 M.S., Missouri State University, 2010 December 2016 ACKNOWLEDGEMENTS Let me begin by first thanking my wonderful advisor, Sabrina Taylor. She has shown interest and care in not only my dissertation project but also my development as person, researcher, and scientist. I have been truly thankful to work under her tutelage and guidance: thank you so much Sabrina! Next I would like to thank the Lucius Wilmot Gilbert Foundation for Forestry Research, which provided funding for not only my research projects but also for my research assistantship at Louisiana State University.
    [Show full text]
  • Identification and Functional Characterization of Novel Genes Implicated in Congenital Myopathies Xavière Lornage
    Identification and functional characterization of novel genes implicated in congenital myopathies Xavière Lornage To cite this version: Xavière Lornage. Identification and functional characterization of novel genes implicated in congenital myopathies. Rhumatology and musculoskeletal system. Université de Strasbourg, 2019. English. NNT : 2019STRAJ067. tel-02900858 HAL Id: tel-02900858 https://tel.archives-ouvertes.fr/tel-02900858 Submitted on 16 Jul 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. UNIVERSITÉ DE STRASBOURG ÉCOLE DOCTORALE DES SCIENCES DE LA VIE ET DE LA SANTE (ED 414) IGBMC, INSERM, UNIVERSITE DE STRASBOURG THÈSE Présentée par : Xavière LORNAGE Soutenue le 13 Septembre 2019 En vue d’obtenir le grade de : Docteur de l’Université de Strasbourg Discipline : Aspects moléculaires et cellulaires de la biologie Identification and functional characterization of novel genes implicated in congenital myopathies THÈSE dirigée par : Mme Valérie BIANCALANA MCU-PH, Université de Strasbourg, IGBMC RAPPORTEURS : M. Helge AMTHOR PU-PH, Université Versailles Saint-Quentin-en-Yvelines Mme Catherine COIRAULT DR INSERM, Institut de Myologie AUTRES MEMBRES DU JURY : Mme Amélie PITON MCU-PH, Université de Strasbourg, IGBMC MEMBRES INVITES : M. Jocelyn Laporte DR INSERM, Université de Strasbourg, IGBMC M.
    [Show full text]
  • Prediction of Four Novel Snps V17M, R11H, A66T, and F57S in the SBDS
    bioRxiv preprint doi: https://doi.org/10.1101/542654; this version posted February 6, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Prediction of Four Novel SNPs V17M, R11H, A66T, and F57S in the SBDS Gene Possibly Associated with Formation of Shwachman- Diamond Syndrome, using an Insilico Approach Anfal Osama Mohamed Sati*1, Sara Ali Abdalla Ali1, Rouaa Babikir Ahmed Abduallah1, Manal Satti Awad Elsied1, Mohamed A. Hassan1 1 Department of Applied Bioinformatics - Africa City of Technology, Biotechnology Park, Khartoum- Sudan *corresponding author: Anfal Osama Mohamed Sati E-mail: [email protected] Abstract: Shwachman-Diamond syndrome SDS (MIM 260400) is an autosomal recessive disorder. Characterized by exocrine insufficiency of the pancreas, bone marrow hypoplasia resulting in cytopenias, especially neutropenia, variable degree of skeletal abnormalities, failure to thrive, and increasing risk of developing myelodysplasia or transformation to leukemia. SDS is mainly caused by Shwachman Bodian Diamond Syndrome gene (MIM ID 607444). SBDS gene is 14899 bp in length, located in chromosome seven in the eleventh region of the long arm, and is composed of five exons. It’s a ribosomal maturation factor which encodes a highly conservative protein that has widely unknown functions despite of its abundance in the nucleolus A total number of 53 SNPs of homo sapiens SBDS gene were obtained from the national center for biotechnology information (NCBI) analyzed using translational tools, 7 of which were deleterious according to SIFT server and were further analyzed using several software’s (Polyhen-2, SNPs&Go, I-Mutant 2.0, Mutpred2, structural analysis software’s and multiple sequence alignment software).
    [Show full text]
  • Molecular Insights to Crustacean Phylogeny
    MOLECULAR INSIGHTS TO CRUSTACEAN PHYLOGENY DISSERTATION zur Erlangung des Doktorgrades (Dr. rer. nat.) an der Mathematisch-Naturwissenschaftlichen Fakultät der Rheinischen Friedrich-Wilhelms-Universität Bonn vorgelegt von BJOERN MARCUS VON REUMONT Bonn – Oktober 2009 Angefertigt mit der Genehmigung der Mathematisch-Naturwissenschaftlichen Fakultät der Rheinischen Friedrich-Wilhelms-Universität Bonn. Diese Dissertation wurden am Zoologischen Forschungsmuseum Alexander Koenig in Bonn durchgeführt. Tag der mündlichen Prüfung 29.01.2010 Erscheinungsjahr 2010 Betreuer Prof. Dr. Johann-Wolfgang Waegele Prof. Dr. Bernhard Y. Misof […] Make up your mind, plan before and follow that plan. […] An unforgivenable sin is quitting. Never give up and keep on going. The only struggle should be to solve the problem or survive. […] Focus on the task and on the moment. […] Excerpts of a cave diving manual This basic philosophy for cave diving is not only useful in cave diving but also generally in live and was indeed helping not only once conducting this thesis. And while diving… Dedicated to my family and all good friends – a permanent, safe mainline Contents Molecular insights to crustacean phylogeny CONTENTS SUMMARY / ZUSAMMENFASSUNG 1. INTRODUCTION 1 1.1 CRUSTACEANS AND THEIR CONTROVERSIAL PHYLOGENY – A SHORT OVERVIEW 2 1.2 CONTRADICTING PHYLOGENY HYPOTHESES OF MAJOR CRUSTACEAN GROUPS 6 1.3 EARLY CONCEPTS OF ARTHROPODS AND MAJOR CLADES IN A MODERN BACKGROUND 8 1.4 QUINTESSENCE OF RECENT ARTHROPOD STUDIES 11 1.5 METHODOLOGICAL BACKGORUND 13 1.5.1 THE FUNDAMENT OF ALL MOLECULAR ANALYSES – TAXON CHOICE & 14 ALIGNMENT RECONSTRCUTION 1.5.2 SINGLE GENE DATA – INCORPORATING BACKGROUND KNOWLEDGE TO rRNA ANALYSES 15 1.5.3 PHYLOGENOMIC DATA – A GENERAL OVERVIEW 16 1.6 AIMS OF THE THESIS 19 1.7 SHORT INTRODUCTION AND OVERVIEW OF ANALYSES [A-C] 20 2.
    [Show full text]
  • GENS DIANA DE LES PROANTOCIANIDINES Sabina Diaz Martinez
    GENS DIANA DE LES PROANTOCIANIDINES Sabina Diaz Martinez ISBN: 978-84-694-0330-3 Dipòsit Legal: T-209-2011 ADVERTIMENT. La consulta d’aquesta tesi queda condicionada a l’acceptació de les següents condicions d'ús: La difusió d’aquesta tesi per mitjà del servei TDX (www.tesisenxarxa.net) ha estat autoritzada pels titulars dels drets de propietat intel·lectual únicament per a usos privats emmarcats en activitats d’investigació i docència. No s’autoritza la seva reproducció amb finalitats de lucre ni la seva difusió i posada a disposició des d’un lloc aliè al servei TDX. No s’autoritza la presentació del seu contingut en una finestra o marc aliè a TDX (framing). Aquesta reserva de drets afecta tant al resum de presentació de la tesi com als seus continguts. En la utilització o cita de parts de la tesi és obligat indicar el nom de la persona autora. ADVERTENCIA. La consulta de esta tesis queda condicionada a la aceptación de las siguientes condiciones de uso: La difusión de esta tesis por medio del servicio TDR (www.tesisenred.net) ha sido autorizada por los titulares de los derechos de propiedad intelectual únicamente para usos privados enmarcados en actividades de investigación y docencia. No se autoriza su reproducción con finalidades de lucro ni su difusión y puesta a disposición desde un sitio ajeno al servicio TDR. No se autoriza la presentación de su contenido en una ventana o marco ajeno a TDR (framing). Esta reserva de derechos afecta tanto al resumen de presentación de la tesis como a sus contenidos.
    [Show full text]