DOCSLIB.ORG

GENS DIANA DE LES PROANTOCIANIDINES Sabina Diaz Martinez

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
GENS DIANA DE LES PROANTOCIANIDINES Sabina Diaz Martinez GENS DIANA DE LES PROANTOCIANIDINES Sabina Diaz Martinez ISBN: 978-84-694-0330-3 Dipòsit Legal: T-209-2011 ADVERTIMENT. La consulta d’aquesta tesi queda condicionada a l’acceptació de les següents condicions d'ús: La difusió d’aquesta tesi per mitjà del servei TDX (www.tesisenxarxa.net) ha estat autoritzada pels titulars dels drets de propietat intel·lectual únicament per a usos privats emmarcats en activitats d’investigació i docència. No s’autoritza la seva reproducció amb finalitats de lucre ni la seva difusió i posada a disposició des d’un lloc aliè al servei TDX. No s’autoritza la presentació del seu contingut en una finestra o marc aliè a TDX (framing). Aquesta reserva de drets afecta tant al resum de presentació de la tesi com als seus continguts. En la utilització o cita de parts de la tesi és obligat indicar el nom de la persona autora. ADVERTENCIA. La consulta de esta tesis queda condicionada a la aceptación de las siguientes condiciones de uso: La difusión de esta tesis por medio del servicio TDR (www.tesisenred.net) ha sido autorizada por los titulares de los derechos de propiedad intelectual únicamente para usos privados enmarcados en actividades de investigación y docencia. No se autoriza su reproducción con finalidades de lucro ni su difusión y puesta a disposición desde un sitio ajeno al servicio TDR. No se autoriza la presentación de su contenido en una ventana o marco ajeno a TDR (framing). Esta reserva de derechos afecta tanto al resumen de presentación de la tesis como a sus contenidos. En la utilización o cita de partes de la tesis es obligado indicar el nombre de la persona autora. WARNING. On having consulted this thesis you’re accepting the following use conditions: Spreading this thesis by the TDX (www.tesisenxarxa.net) service has been authorized by the titular of the intellectual property rights only for private uses placed in investigation and teaching activities. Reproduction with lucrative aims is not authorized neither its spreading and availability from a site foreign to the TDX service. Introducing its content in a window or frame foreign to the TDX service is not authorized (framing). This rights affect to the presentation summary of the thesis as well as to its contents. In the using or citation of parts of the thesis it’s obliged to indicate the name of the author. UNIVERSITAT ROVIRA I VIRGILI GENS DIANA DE LES PROANTOCIANIDINES Sabina Diaz Martinez ISBN:978-84-694-0330-3/DL:T-209-2011 Sabina Díaz Martínez Gens diana de les Proantocianidines Tesi Doctoral Dirigida pel Prof. Lluís Arola Ferrer Departament de Bioquímica i Biotecnologia Tarragona 2010 UNIVERSITAT ROVIRA I VIRGILI GENS DIANA DE LES PROANTOCIANIDINES Sabina Diaz Martinez ISBN:978-84-694-0330-3/DL:T-209-2011 UNIVERSITAT ROVIRA I VIRGILI GENS DIANA DE LES PROANTOCIANIDINES Sabina Diaz Martinez ISBN:978-84-694-0330-3/DL:T-209-2011 Departament de Bioquímica i Biotecnologia Carrer Marcel·lí Domingo s/n Campus Sant Pere Sescelades 43007 Tarragona Telèfon: 977553521 Fax: 977558232 Lluís Arola Ferrer, Catedràtic d’Universitat del Departament de Bioquímica i Biotecnologia de la Universitat Rovira i Virgili, FAIG CONSTAR: Que aquest treball, titulat “Gens Diana de les Proantocianidines”, que presenta Sabina Díaz Martínez per a l’obtenció del títol de Doctor, ha estat realitzat sota la meva direcció al Departament de Bioquímica i Biotecnologia d’aquesta universitat i que acompleix els requeriments per poder optar a la Menció Europea. Tarragona, 5 octubre de 2010 Lluís Arola Ferrer UNIVERSITAT ROVIRA I VIRGILI GENS DIANA DE LES PROANTOCIANIDINES Sabina Diaz Martinez ISBN:978-84-694-0330-3/DL:T-209-2011 UNIVERSITAT ROVIRA I VIRGILI GENS DIANA DE LES PROANTOCIANIDINES Sabina Diaz Martinez ISBN:978-84-694-0330-3/DL:T-209-2011 Als meus pares, i al Jordi UNIVERSITAT ROVIRA I VIRGILI GENS DIANA DE LES PROANTOCIANIDINES Sabina Diaz Martinez ISBN:978-84-694-0330-3/DL:T-209-2011 UNIVERSITAT ROVIRA I VIRGILI GENS DIANA DE LES PROANTOCIANIDINES Sabina Diaz Martinez ISBN:978-84-694-0330-3/DL:T-209-2011 “No importa el cim, sinó el camí” (Catalans K2 Magic Line) És el moment de mirar enrere i analitzar els moments viscuts i compartits durant aquests quatre anys. Potser no he triat una frase gaire filosòfica, però crec que resumeix perfectament el que ha significat per mi fer la meva Tesi. Quan vaig començar ho veia tot massa lluny i complicat. Saps on està el cim però no saps si seràs capaç d’aconseguir-ho. Pel camí vas coneixent gent que et dóna ànims i forces per continuar, gent que acaba formant part de la teva vida i amb la que es crea un vincle molt especial. Escriure els agraïments és potser una de les parts més complicades de la tesi. S’ha de fer amb el cor i no vols deixar-te ningú, perquè tots i cadascú de vosaltres (els que ho esteu llegint ara mateix) heu contribuït a que hagi arribat al cim de la meva muntanya: la TESI. En primer lloc, voldria agrair al meu director de tesi, el Dr. Lluís Arola, per la confiança i el recolzament, així com la seva sinceritat en els moments bons i no tan bons. Gràcies per fer-me veure que les coses no són tan complicades com semblen i sempre hi ha una solució. També m’agradaria donar les gràcies a la resta de membres del grup de Nutrigenòmica, en especial a les Dres. Cinta Bladé i Pepa Salvadó (les reunions de minigrup no haguèssin estat el mateix sense vosaltres), així com als Dr/es Gerard Pujades, Santi García-Vallvé, Anna Ardèvol, Montse Pinent, Mayte Blay, Juan Fernández-Larrea i Miquel Mulero, gràcies pel vostre suport durant aquest temps. No vull oblidar-me d’agrair a la Dra. Isa Baiges, gràcies per contagiar-me la passió per la ciència. El doctorat no seria el mateix sense els companys de laboratori. En primer lloc m’agradaria agrair als que em van donar la benvinguda i em van fer sentir com una més del grup, al Josep, la Isa Quesada, al Mario, la Gemma, la Ximena, la Montse Vaqué, la Marina, al Pere, l’Albert i la Lídia. I també als que s’han anat incorporant Anna Castell, Lídia, Víctor, Neus, Noemí, Ester, Laura, Ligia, Cris, Toni, Anna C., Anna A. i Aleix. Tots heu fet que venir a la feina no sigui només per treballar, sinó per compartir bons moments. Vull agrair molt especialment a la Helena, per la seva energia i amistat, al David, per la seva alegria i constància i a l’Anabel, per la seva sinceritat i el seu somriure. Els moments que hem passat junts al laboratori i fora del laboratori no tenen preu. Ja sabeu que “con musiquilla y eso” els dies són més entretinguts. Sé que sóc molt afortunada d’haver-vos conegut i us trobaré molt a faltar. Moltes gràcies al minigrup de Bioinformàtica, l’Esther i la Laura, parlar UNIVERSITAT ROVIRA I VIRGILI GENS DIANA DE LES PROANTOCIANIDINES Sabina Diaz Martinez ISBN:978-84-694-0330-3/DL:T-209-2011 amb vosaltres fa que el dia sigui més divertit, no us oblidaré mai. També agrair als companys del grup d’Enologia, gràcies pel suport mostrat en aquests anys. I would also like to thank Dr. Jaap Keijer for giving me the opportunity to stay in his group Human and Animal Physiology in the Wageningen University of the Netherlands. Many thanks to Dr. Evert van Schothorst for your implication in this Project and your helpful scientific suggestions; to Annelies Bunschoten for the funny moments in the lab and all the members of the group to make me feel like in home. A les tècnics de laboratori Yaiza, Vanesa i Rosa per la seva ajuda en tot moment. Al Santiago, per la seva paciència quan hem necessitat alguna cosa en últim moment. I sobretot a la Niurka, sense tu moltes vegades ens haguèssim trobat perduts al laboratori, el teu saber fer fa que les coses semblin més senzilles. A Esther Palau per la seva organització i aconseguir que no perdem els “papers”. A la Marisol i la Montse per ajudar-nos a tenir-ho tot al dia i ordenat. I també a la Mari, sempre amb un somriure al la cara i desitjant-me un bon dia. Fer el doctorat no només es tancar-se al laboratori o al despatx, per això vull agrair a la Vanessa, la Idoia, la Miriam i la Irene pels bons moments compartits amb el nostre Recreativo de Juerga, mai el fútlbol havia estat tan apassionant. A la meva professora d’anglés Leticia, gràcies per aguantar els meus rotllos de ciència in english i ajudar-me a trobar les paraules per transmetre els meus coneixements. M’agradaria donar les gràcies als meus amics Ariadna, David, Blanca, Juanvi, Neus, Carles, Eli i Marc. Amb tots vosaltres he viscut moments inoblidables i espero que en vinguin molts més. Agrair també a les meves amigues de la facultat Raquel L., Laura, Raquel R., Meri, Aïda i Noe. Encara que les nostres vides segueixen camins diferents, sé que sempre hi sereu quan us necessiti. Als meus companys de capoeira Corao, Samambaia, Gato do mato, Cenoura, Android, Chaplin i Jujuba, gràcies per ajudar-me a desconnectar. Gracias a mi maestro Bacurau, admiro el entusiasmo que demuestras en tus clases y la fuerza que nos transmites. Vull donar les gràcies a tota la meva família i la família del Jordi, sempre pendents dels meus avenços en el món de la ciència i animant-me a continuar endavant.
Load more

Recommended publications
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • The Switch from Fermentation to Respiration in Saccharomyces Cerevisiae Is Regulated by the Ert1 Transcriptional Activator/Repressor
    INVESTIGATION The Switch from Fermentation to Respiration in Saccharomyces cerevisiae Is Regulated by the Ert1 Transcriptional Activator/Repressor Najla Gasmi,* Pierre-Etienne Jacques,† Natalia Klimova,† Xiao Guo,§ Alessandra Ricciardi,§ François Robert,†,** and Bernard Turcotte*,‡,§,1 ‡Department of Medicine, *Department of Biochemistry, and §Department of Microbiology and Immunology, McGill University Health Centre, McGill University, Montreal, QC, Canada H3A 1A1, †Institut de recherches cliniques de Montréal, Montréal, QC, Canada H2W 1R7, and **Département de Médecine, Faculté de Médecine, Université de Montréal, QC, Canada H3C 3J7 ABSTRACT In the yeast Saccharomyces cerevisiae, fermentation is the major pathway for energy production, even under aerobic conditions. However, when glucose becomes scarce, ethanol produced during fermentation is used as a carbon source, requiring a shift to respiration. This adaptation results in massive reprogramming of gene expression. Increased expression of genes for gluconeogenesis and the glyoxylate cycle is observed upon a shift to ethanol and, conversely, expression of some fermentation genes is reduced. The zinc cluster proteins Cat8, Sip4, and Rds2, as well as Adr1, have been shown to mediate this reprogramming of gene expression. In this study, we have characterized the gene YBR239C encoding a putative zinc cluster protein and it was named ERT1 (ethanol regulated transcription factor 1). ChIP-chip analysis showed that Ert1 binds to a limited number of targets in the presence of glucose. The strongest enrichment was observed at the promoter of PCK1 encoding an important gluconeogenic enzyme. With ethanol as the carbon source, enrichment was observed with many additional genes involved in gluconeogenesis and mitochondrial function. Use of lacZ reporters and quantitative RT-PCR analyses demonstrated that Ert1 regulates expression of its target genes in a manner that is highly redundant with other regulators of gluconeogenesis.
    [Show full text]
  • PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41
    American Society of Human Genetics 62nd Annual Meeting November 6–10, 2012 San Francisco, California PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41. Genes Underlying Neurological Disease Room 134 #196–#204 2. 4:30–6:30pm: Plenary Abstract 42. Cancer Genetics III: Common Presentations Hall D #1–#6 Variants Ballroom 104 #205–#213 43. Genetics of Craniofacial and Wednesday, November 7 Musculoskeletal Disorders Room 124 #214–#222 10:30am–12:45 pm: Concurrent Platform Session A (11–19): 44. Tools for Phenotype Analysis Room 132 #223–#231 11. Genetics of Autism Spectrum 45. Therapy of Genetic Disorders Room 130 #232–#240 Disorders Hall D #7–#15 46. Pharmacogenetics: From Discovery 12. New Methods for Big Data Ballroom 103 #16–#24 to Implementation Room 123 #241–#249 13. Cancer Genetics I: Rare Variants Room 135 #25–#33 14. Quantitation and Measurement of Friday, November 9 Regulatory Oversight by the Cell Room 134 #34–#42 8:00am–10:15am: Concurrent Platform Session D (47–55): 15. New Loci for Obesity, Diabetes, and 47. Structural and Regulatory Genomic Related Traits Ballroom 104 #43–#51 Variation Hall D #250–#258 16. Neuromuscular Disease and 48. Neuropsychiatric Disorders Ballroom 103 #259–#267 Deafness Room 124 #52–#60 49. Common Variants, Rare Variants, 17. Chromosomes and Disease Room 132 #61–#69 and Everything in-Between Room 135 #268–#276 18. Prenatal and Perinatal Genetics Room 130 #70–#78 50. Population Genetics Genome-Wide Room 134 #277–#285 19. Vascular and Congenital Heart 51. Endless Forms Most Beautiful: Disease Room 123 #79–#87 Variant Discovery in Genomic Data Ballroom 104 #286–#294 52.
    [Show full text]
  • Allele-Specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish
    Allele-specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish by Ailu Chen A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama August 1, 2015 Keywords: catfish, interspecific hybrids, allele-specific expression, ribosomal protein Copyright 2015 by Ailu Chen Approved by Zhanjiang Liu, Chair, Professor, School of Fisheries, Aquaculture and Aquatic Sciences Nannan Liu, Professor, Entomology and Plant Pathology Eric Peatman, Associate Professor, School of Fisheries, Aquaculture and Aquatic Sciences Aaron M. Rashotte, Associate Professor, Biological Sciences Abstract Interspecific hybridization results in a vast reservoir of allelic variations, which may potentially contribute to phenotypical enhancement in the hybrids. Whether the allelic variations are related to the downstream phenotypic differences of interspecific hybrid is still an open question. The recently developed genome-wide allele-specific approaches that harness high- throughput sequencing technology allow direct quantification of allelic variations and gene expression patterns. In this work, I investigated allele-specific expression (ASE) pattern using RNA-Seq datasets generated from interspecific catfish hybrids. The objective of the study is to determine the ASE genes and pathways in which they are involved. Specifically, my study investigated ASE-SNPs, ASE-genes, parent-of-origins of ASE allele and how ASE would possibly contribute to heterosis. My data showed that ASE was operating in the interspecific catfish system. Of the 66,251 and 177,841 SNPs identified from the datasets of the liver and gill, 5,420 (8.2%) and 13,390 (7.5%) SNPs were identified as significant ASE-SNPs, respectively.
    [Show full text]
  • Transcriptomic Analysis of the Aquaporin (AQP) Gene Family
    Pancreatology 19 (2019) 436e442 Contents lists available at ScienceDirect Pancreatology journal homepage: www.elsevier.com/locate/pan Transcriptomic analysis of the Aquaporin (AQP) gene family interactome identifies a molecular panel of four prognostic markers in patients with pancreatic ductal adenocarcinoma Dimitrios E. Magouliotis a, b, Vasiliki S. Tasiopoulou c, Konstantinos Dimas d, * Nikos Sakellaridis d, Konstantina A. Svokos e, Alexis A. Svokos f, Dimitris Zacharoulis b, a Division of Surgery and Interventional Science, Faculty of Medical Sciences, UCL, London, UK b Department of Surgery, University of Thessaly, Biopolis, Larissa, Greece c Faculty of Medicine, School of Health Sciences, University of Thessaly, Biopolis, Larissa, Greece d Department of Pharmacology, Faculty of Medicine, School of Health Sciences, University of Thessaly, Biopolis, Larissa, Greece e The Warren Alpert Medical School of Brown University, Providence, RI, USA f Riverside Regional Medical Center, Newport News, VA, USA article info abstract Article history: Background: This study aimed to assess the differential gene expression of aquaporin (AQP) gene family Received 14 October 2018 interactome in pancreatic ductal adenocarcinoma (PDAC) using data mining techniques to identify novel Received in revised form candidate genes intervening in the pathogenicity of PDAC. 29 January 2019 Method: Transcriptome data mining techniques were used in order to construct the interactome of the Accepted 9 February 2019 AQP gene family and to determine which genes members are differentially expressed in PDAC as Available online 11 February 2019 compared to controls. The same techniques were used in order to evaluate the potential prognostic role of the differentially expressed genes. Keywords: PDAC Results: Transcriptome microarray data of four GEO datasets were incorporated, including 142 primary Aquaporin tumor samples and 104 normal pancreatic tissue samples.
    [Show full text]
  • Arcn1 (NM 145985) Mouse Recombinant Protein Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP508216 Arcn1 (NM_145985) Mouse Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Purified recombinant protein of Mouse archain 1 (Arcn1), with C-terminal MYC/DDK tag, expressed in HEK293T cells, 20ug Species: Mouse Expression Host: HEK293T Tag: C-MYC/DDK Predicted MW: 57.7 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol. Storage: Store at -80°C after receiving vials. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_666097 Locus ID: 213827 UniProt ID: Q5XJY5 RefSeq Size: 3470 Cytogenetics: 9 A5.2 RefSeq ORF: 1536 Synonyms: 4632432M07Rik; nur17 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 Arcn1 (NM_145985) Mouse Recombinant Protein – TP508216 Summary: The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. Coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins.
    [Show full text]
  • Global Analysis of Methionine Oxidation Provides a Census Of
    bioRxiv preprint doi: https://doi.org/10.1101/467290; this version posted January 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Global analysis of methionine oxidation provides a census of folding stabilities for the human proteome Ethan J. Walker1,2, John Q. Bettinger1, Kevin A. Welle3, Jennifer R. Hryhorenko3, Sina Ghaemmaghami1,3* 1Department of Biology, University of Rochester, NY, 14627, USA 2Department of Biochemistry, University of Rochester Medical Center, NY, 14627, USA 3University of Rochester Mass Spectrometry Resource Laboratory, NY, 14627, USA *Correspondence: [email protected] (S.G.) 1 bioRxiv preprint doi: https://doi.org/10.1101/467290; this version posted January 10, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. ABSTRACT The stability of proteins influences their tendency to aggregate, undergo degradation or become modified in cells. Despite their significance to understanding protein folding and function, quantitative analyses of thermodynamic stabilities have been mostly limited to soluble proteins in purified systems. We have used a highly multiplexed proteomics approach, based on analyses of methionine oxidation rates, to quantify stabilities of ~10,000 unique regions within ~3,000 proteins in human cell extracts. The data identify lysosomal and extracellular proteins as the most stable ontological subsets of the proteome.
    [Show full text]
  • Supplementary Materials
    Lists of figures Figure S1: A-B: Principal Component Analysis (PCA) was applied to 3 pairs of SCEC tissues (red) and matched adjacent normal tissues (blue) that were characterized by the gene expression of all probes on Affymetrix HG U133 Plus 2.0 Array. C: Box plot of SCEC group. D: Pearson’s correlation matrix of SCEC group. 17 / 25 Figure S2: MvA plot of SCEC group. Figure S3: Volcano plots of probe sets differing between SCEC and matched normal tissues. Fold change (X axis) is plotted against statistical significance (Y axis) for each probe sets. Genes altered with a fold change ≥2 and FDR <0.01 are depicted in red. Grey represents genes in the arrays that were not found to differ significantly between cancerous samples and matched normal samples. Figure S4: Gene regulatory network plotted by the top 120 DEGs (ranked by FDR) of SCEC groups. 18 / 25 Figure S5: DNA copy number change profiles in 3 pairs of SCEC samples. The CNVs frequency of the whole genome was analyzed by aCGH. Gains were marked in red and losses in bule. Lists of tables Table S1. Primers used in qRT-PCR for microarray gene expression validation Gene Forward Primer (5’-3’) Reverse Primer (5’-3’) Product β-actin AAGGTGACAGCAGTCGGTT TGTGTGGACTTGGGAGAGG 195bp INSM1 GTATTCGCTGTGTTCATGGTC CGCTACATACATAGAGAGCAGAG 79bp ASCL1 AACTCCCATCACCTCTAACA TGAGACGAAAGACACCAACT 120bp NRCAM GATGGCGAAGAATGAAGTT ACAGTGAGGGATAAGGTGTG 141bp NUF2 ATGATGCCAGTGAACTCTGAA GACTTGTCCGTTTTGCTTTTG 160bp 19 / 25 SNAP25 CCTGGATATGGGCAATGAGAT ACACGGGTGGGCACACTTA 146bp PTP4A3 GCTTCCTCATCACCCACAA CCGTACTTCTTCAGGTCCTCA
    [Show full text]
  • Physical and Linkage Mapping of Mammary-Derived Expressed Sequence Tags in Cattle
    Genomics 83 (2004) 148–152 www.elsevier.com/locate/ygeno Physical and linkage mapping of mammary-derived expressed sequence tags in cattle E.E. Connor,a,* T.S. Sonstegard,a J.W. Keele,b G.L. Bennett,b J.L. Williams,c R. Papworth,c C.P. Van Tassell,a and M.S. Ashwella a U.S. Beltsville Agricultural Research Center, ARS, U.S. Department of Agriculture, 10300 Baltimore Avenue, Beltsville, MD 20705, USA b U.S. Meat Animal Research Center, ARS, U.S. Department of Agriculture, P.O. Box 166, Clay Center, NE 68933-0166, USA c Roslin Institute (Edinburgh), Roslin, Midlothian EH25 9PS, Scotland, United Kingdom Received 2 June 2003; accepted 5 July 2003 Abstract This study describes the physical and linkage mapping of 42 gene-associated markers developed from mammary gland-derived expressed sequence tags to the cattle genome. Of the markers, 25 were placed on the USDA reference linkage map and 37 were positioned on the Roslin 3000-rad radiation hybrid (RH) map, with 20 assignments shared between the maps. Although no novel regions of conserved synteny between the cattle and the human genomes were identified, the coverage was extended for bovine chromosomes 3, 7, 15, and 29 compared with previously published comparative maps between human and bovine genomes. Overall, these data improve the resolution of the human–bovine comparative maps and will assist future efforts to integrate bovine RH and linkage map data. Crown Copyright D 2003 Published by Elsevier Inc. All rights reserved. Keywords: RH mapping; Linkage mapping; SNP; Cattle; EST Selection of positional candidate genes controlling eco- pig [4,5], and cattle [6], and serve as a resource for nomically important traits in cattle requires a detailed candidate gene identification.
    [Show full text]
  • Interpreting Human Genetic Variation with in Vivo Zebrafish Assays Erica E
    Interpreting Human Genetic Variation With In Vivo Zebrafish Assays Erica E. Davis, PhD, Stephan Frangakis, BS, and Nicholas Katsanis, PhD Center for Human Disease Modeling Duke University Medical Center Durham, North Carolina © 20132015 Katsanis Interpreting Human Genetic Variation With In Vivo Zebrafish Assays 11 Introduction bona fide pathogenic mutations alone in the average NOTES Rapid advances and cost erosion in exome and human exome, studies have reported a median of 50– genome analysis of patients with both rare and 150 nonsense mutations, several in homozygosity, common genetic disorders have accelerated gene while the abundance of unique single nucleotide discovery and illuminated fundamental biological variants (SNVs) can be in the low-to-mid 100s mechanisms. The thrill of discovery has been (1000 Genomes Project Consortium et al., 2010). accompanied, however, by the sobering appreciation Importantly, the number of rare and ultra-rare SNVs that human genomes are burdened with a large has continued to increase proportionately to the number of rare and ultra-rare variants, thereby posing number of available exomes and genomes (Tennessen a significant challenge in dissecting both the effect of et al., 2012), indicating that we are unlikely to reach such alleles on protein function and the biological saturation of such alleles soon. These observations relevance of these events to patient pathology. In have generated a significant interpretive problem an effort to develop model systems that are able to for disease gene discovery and for clinical genomics, generate surrogates of human pathologies, a powerful as population-based arguments alone have been suite of tools has been developed in zebrafish, unable to dissect the contribution of the majority of taking advantage of the relatively small (compared these alleles to clinical phenotypes.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • New Targets of Urocortin-Mediated Cardioprotection
    69 New targets of urocortin-mediated cardioprotection Sea´n P Barry1, Kevin M Lawrence4, James McCormick1, Surinder M Soond5, Mike Hubank2, Simon Eaton3, Ahila Sivarajah6, Tiziano M Scarabelli7, Richard A Knight1, Christoph Thiemermann6, David S Latchman1, Paul A Townsend8 and Anastasis Stephanou1 1Medical Molecular Biology Unit, 2Department of Molecular Haematology and 3Department of Surgery, Institute of Child Health, University College London, 30 Guilford Street, London, WC1N 1EH, UK 4Department of Cellular Pathology, St George’s, University of London, Cranmer Terrace, Tooting, London, SW17 0RE, UK 5School of Biological Sciences, University of East Anglia, Norwich, NR4 7TJ, UK 6St Bartholomew’s and The Royal London School of Medicine and Dentistry, William Harvey Research Institute, Centre for Translational Medicine and Therapeutics, Queen Mary University of London, London, EC1M 7BQ, UK 7Center for Heart and Vessel Preclinical Studies, St John Hospital and Medical Center, Wayne State University School of Medicine, 22201 Moross Road, Detroit, Michigan 48336, USA 8Human Genetics Division, MP808, Southampton General Hospital, University of Southampton, Southampton SO16 6YD, UK (Correspondence should be addressed to S P Barry; Email: [email protected]) Abstract The urocortin (UCN) hormones UCN1 and UCN2 have been shown previously to confer significant protection against myocardial ischaemia/reperfusion (I/R) injury; however, the molecular mechanisms underlying their action are poorly understood. To further define the transcriptional effect of UCNs that underpins their cardioprotective activity, a microarray analysis was carried out using an in vivo rat coronary occlusion model of I/R injury. Infusion of UCN1 or UCN2 before the onset of reperfusion resulted in the differential regulation of 66 and 141 genes respectively, the majority of which have not been described previously.
    [Show full text]