DOCSLIB.ORG

(12) United States Patent (10) Patent No.: US 7.873,482 B2 Stefanon Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) United States Patent (10) Patent No.: US 7.873,482 B2 Stefanon Et Al US007873482B2 (12) United States Patent (10) Patent No.: US 7.873,482 B2 Stefanon et al. (45) Date of Patent: Jan. 18, 2011 (54) DIAGNOSTIC SYSTEM FOR SELECTING 6,358,546 B1 3/2002 Bebiak et al. NUTRITION AND PHARMACOLOGICAL 6,493,641 B1 12/2002 Singh et al. PRODUCTS FOR ANIMALS 6,537,213 B2 3/2003 Dodds (76) Inventors: Bruno Stefanon, via Zilli, 51/A/3, Martignacco (IT) 33035: W. Jean Dodds, 938 Stanford St., Santa Monica, (Continued) CA (US) 90403 FOREIGN PATENT DOCUMENTS (*) Notice: Subject to any disclaimer, the term of this patent is extended or adjusted under 35 WO WO99-67642 A2 12/1999 U.S.C. 154(b) by 158 days. (21)21) Appl. NoNo.: 12/316,8249 (Continued) (65) Prior Publication Data Swanson, et al., “Nutritional Genomics: Implication for Companion Animals'. The American Society for Nutritional Sciences, (2003).J. US 2010/O15301.6 A1 Jun. 17, 2010 Nutr. 133:3033-3040 (18 pages). (51) Int. Cl. (Continued) G06F 9/00 (2006.01) (52) U.S. Cl. ........................................................ 702/19 Primary Examiner—Edward Raymond (58) Field of Classification Search ................... 702/19 (74) Attorney, Agent, or Firm Greenberg Traurig, LLP 702/23, 182–185 See application file for complete search history. (57) ABSTRACT (56) References Cited An analysis of the profile of a non-human animal comprises: U.S. PATENT DOCUMENTS a) providing a genotypic database to the species of the non 3,995,019 A 1 1/1976 Jerome human animal Subject or a selected group of the species; b) 5,691,157 A 1 1/1997 Gong et al. obtaining animal data; c) correlating the database of a) with 5,817,025 A 10/1998 Alekseev et al. the data ofb) to determine a relationship between the database 5,830,709 A 1 1/1998 Benson et al. of a) and the data of b); c) determining the profile of the 5,911,687 A 6, 1999 Sato et al. animal based on the correlating step; and d) determining a 5,954,640 A 9, 1999 Szabo genetic profile based on the molecular dietary signature, the 6,018,786 A 2000 Kricket al. molecular dietary signature being a variation of expression of 6,063,028 A 5, 2000 Luciano a set of genes which may differ for the genotype of each 6,081,786 A 6/2000 Barry et al. animal or a group of animals Nutrition and pharmalogical 6,135,055 A 10, 2000 Pratt assessments are made. Reporting the determination is by the 6,136,055 A 10, 2000 Stanek Internet, and pavment for the report is obtained through the 6,156,355. A 12/2000 Shields, Jr. et al. Internet. pay p 9. 6,218,122 B1 4/2001 Friend et al. 6,232,522 B1 5/2001 Harley et al. 6,287.254 B1 9, 2001 Dodds 24 Claims, 23 Drawing Sheets gere registics, SN's transcrities racartrial "irras iteractical res transcriptions satra pracessing, stility Omwonom MO transport of RNA Nutrient -se E. t Compounds rroris T earn an * reparisteractise. production * is ca, satrastairs engine regatists isgraisits tastart ragiair chaare arterg interatist EAEE cereafteices US 7,873.482 B2 Page 2 U.S. PATENT DOCUMENTS Spielbauer, et al., “Impact of Microarray Technology in Nutrition and Food Research”. (2005) Mol. Nutr. Food Res., 49, 908-917 (10 6,730,023 B1 5, 2004 Dodds pages). 7,029.441 B2 4/2006 Dodds Swanson, et al., “Canine Nutritional Model: Influence of Age, Diet, 7,134,995 B2 11/2006 Dodds and Genetics on Health and Well-Being'. Current Nutrition & Food 7,296,537 B2 11/2007 Burghardi et al. Science, vol. 2, No. 2, May 2006, pp. 115-126(12) (1 page). 2002/0022772 A1 2/2002 Dodds M.F. Bottcher, M.F. et al., “Total and allergen-specific 2003. O135096 A1 7, 2003 Dodds immunoglobulin A levels in saliva in relation to the development of 2003/0233984 A1 12/2003 van de Ligt et al. allergy in infants up to 2 years of age” Clin. Exp. Allergy Sep. 2002, 2005/0090718 A1* 4/2005 Dodds .............. - - - - - - - 600/300 vol. 32, No. 9, pp. 1293-1298. 2006, OO45909 A1 3, 2006 Friesen et al. A.P. Foster et al., "Serum IgE and IgG responses to food antigens in 2006, OO64250 A1 3, 2006 Goldstein normal and atopic dogs, and dogs with gastrointestinal disease' Vet. 2006/0200320 A1 9, 2006 Al-Murrani Immunol. Immunopathol. May 2003, vol. 92, pp. 113-124. 2007/0118295 A1 5, 2007 Al-Murrani M.J. Day et al. “The Canine Model of Dietary Hypersensitivity” Proc. Nutr. Soc. Nov. 2005, vol. 64, No. 4, pp. 458-464. FOREIGN PATENT DOCUMENTS Dodds (Veterinary Practice, 1992, vol. 4. No. 2, p. 25-31). WO WOO1,28415 A1 4/2001 Hetzel et al. (The Journal of Nutrition, 1989, vol. 119, p. 145-151). WO WOO1,69487 A1 9, 2001 Williams et al. (Nucleic Acids Research, 1990, vol. 18, No. 22, p. WO WO 2004f1 1357O A2 12/2004 6531-6535). Dodds (Advances in Veterinary Science and Comparative Medicine, OTHER PUBLICATIONS 1995, vol.39, p. 29-95). R. Wolter “La nutrition de l'animalde sport” Laboratoire de Nutrition Swanson, et al., “Diet Affects Nutrient Digestibility, Hematology, sportive (INRA) Ecole Nationale Veterinaire d'Alfort, Science & and Serum Chemistry of Senior and Weanling Dogs”, Journal of Sports 2, (1987) p. 63-93. American Science, (2004) J. Anim. Sci. 2004. 82:1713-1724 (19 Harrison et al. The Journal of Nutrition, 1987, vol. 117, p. 376-382. pages). K. McNutt, PhD., J.D., “The Individualized Prescriptive Foods Era Kato, et al., “A Perspective on DNA Microarray Technology in Food Has Dawned'. Nutrition Today, May/Jun. 1993, p. 43-47, USA. and Nutritional Science'. Current Opinion in Clinical Nutrition and Metabolic Care, (2005) 8:516-522 (7 pages). * cited by examiner U.S. Patent Jan. 18, 2011 Sheet 1 of 23 US 7.873.482 B2 A. gene regulation, SNP's transcriptional cartrial histore interactic -NU RNA 9 transcriptional cartrial * processing, stability transpart of RNA Nutrient Nu- Effect on health and Compounds FROTEN s gee contral, signal transductin erryrie regulatian inhibition ridificating transpart regulatian chartre arpump interaction U.S. Patent Jan. 18, 2011 Sheet 2 of 23 US 7.873.482 B2 Nutritias feet Biological effective dose series Genetic variability NTRENOCS NUTRENETICS N ... 1 FIG. 2 Retrospective: • Aggie Science * Indivitial Resperse is tiei GENES w -, * is every Science / \ \ . Nutriticial systeres Molecular Signature FIG. 3 U.S. Patent Jan. 18, 2011 Sheet 3 of 23 US 7.873.482 B2 FUNCTIONAL GENOMC PROFILE OF AN ANIMAL OR A GROUP OF ANMALS REFERENCE DATASE TARGE DATASET GENOTYPE GENOTYPE AND FUNCTIONAL AND FUNCTIONAL GENOMIC GENOMIC PROFE OF PROFLE OF ABNORMA NORMAL (HEALTHY) ANIMALS (UNHEALTHY) ANIMALS NUTRENT DATASET NUTRONAL FORMULA FIG. 4A U.S. Patent Jan. 18, 2011 Sheet 4 of 23 US 7.873.482 B2 ANMAL FORWC NURENT NEEDSO BE DEERVNE DETERMINE FUNCIONAL GENOMIC PROFILE BY DNA, RNA ANALYSIS (e.g., MICROARRAY) REFERENCE DATASE ARGE DATASET CONTAINS FUNCIONAL CONTAINS FUNCTONA GENOMIC PROFES GENOMIC PROFILE FOR (NORMALIHEALTHY) (ABNORMAL/UNHEALTHY) NUTRENT DATASET CONTAINS VARABE EFFECTS OF NUTRENT OBAN FUNCTIONAL COMPONENTS IN GENOMIC PROFES OF GENOYE ANMAS WITH OFFERENT GENOTYPES. IDENTFY THE NORMA PAHOLOGY OF THE ANVA GENOYPE OBTAN HE NURENT EFFECT ON THE UNCONA. GENOVC PROFLE OF THE NURENT ANMA DATASE OEN FY DES RED NUTRENT DESRED FIG. 4B NUTRENT U.S. Patent Jan. 18, 2011 Sheet 5 of 23 US 7.873.482 B2 FG Animal A Artical E. F.8 BC. A. FK. supplemented "m Matched utrient. NBC-A f 3. food C. COX- 3. lutrient dats hittierit cata trientists FF set BC-A set C. set EC-C TF. -1 -2 F. -l II-2 -2 -2 Reference IL -2 -2 FGF data set C. -2 Fa COX -1 -2 NFE L CO. COX-2 Matched pathology. P-A Target data set. Target data set-Target data set FP P.A. - P.C. IF. Normal animal Affected animal - FE 2. 5 4. C. Regular food COX-2 2 6 FIG. 5A U.S. Patent Jan. 18, 2011 Sheet 6 of 23 US 7.873.482 B2 Geotype A Fictional Genemie Reference Target data Test animal - Nutrient data Nutrient data data set set hot normal set. CA. set. CP & Fls 2 2 - -l Biological Active FK 2 -1 triett-A IL2 3. -2 - supplemented L 4. 2. -3 -4 formula COX- - COX- 2 - Genotype B Factional Genomic Reference Target data Test animal - Nutrient data Nutrient data e data set se hot normal set - CA set - CE, Biological Active s 2 2 -2 - Nutrient-B NFK 3 -2 s I 5 s .3 supplemented Li 3. -3 2 formula CO 3 3. -1 COX- 3. 3 - -2 FIG. 5B U.S. Patent Jan. 18, 2011 Sheet 7 of 23 US 7.873.482 B2 U.S. Patent Jan. 18, 2011 Sheet 8 of 23 US 7.873.482 B2 REFERENCE SAMPLE OF TEST SAMPLE OF AN ANMAL NORMAL ANIMALS OR A GROUP OF ANMALS DFFERENT DISPLAY ANALYSS OF FUNCTIONAL GENOMC PROFILE NORMAL (HEALTHY) ABNORMAL (UNHEALTHY) FUNCTIONAL GENOMC FUNCTIONAL GENOMC PROFILE PROFILE NUTRENT DATASET NUTRITONAL FORMULA FIG. 6A U.S. Patent Jan. 18, 2011 Sheet 9 of 23 US 7.873.482 B2 SAMPLES; FUNCTIONAL NDIVIDUAL TARGET SAMPLE GENOMIC PROFILE OF OF AN ANMAL OF KNOWN DFFERENT GENOTYPES GENOTYPE TEST DFFERENTAL FUNCTIONAL GENOMIC PROFILE NORMA LIBRARY OF PATHOLOGICAL NUTRENT SOLUTIONS/ FOODS NORMAL FOOD TEST CELLS WITH DFFERENT NUTRENTS SELECT NUTRENT SOLUTION FIG. 6B U.S. Patent Jan. 18, 2011 Sheet 10 of 23 US 7.873.482 B2 & 8.8x8:88: 8:::: Barakick spor U.S.
Load more

Recommended publications
  • Deregulated Gene Expression Pathways in Myelodysplastic Syndrome Hematopoietic Stem Cells
    Leukemia (2010) 24, 756–764 & 2010 Macmillan Publishers Limited All rights reserved 0887-6924/10 $32.00 www.nature.com/leu ORIGINAL ARTICLE Deregulated gene expression pathways in myelodysplastic syndrome hematopoietic stem cells A Pellagatti1, M Cazzola2, A Giagounidis3, J Perry1, L Malcovati2, MG Della Porta2,MJa¨dersten4, S Killick5, A Verma6, CJ Norbury7, E Hellstro¨m-Lindberg4, JS Wainscoat1 and J Boultwood1 1LRF Molecular Haematology Unit, NDCLS, John Radcliffe Hospital, Oxford, UK; 2Department of Hematology Oncology, University of Pavia Medical School, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; 3Medizinische Klinik II, St Johannes Hospital, Duisburg, Germany; 4Division of Hematology, Department of Medicine, Karolinska Institutet, Stockholm, Sweden; 5Department of Haematology, Royal Bournemouth Hospital, Bournemouth, UK; 6Albert Einstein College of Medicine, Bronx, NY, USA and 7Sir William Dunn School of Pathology, University of Oxford, Oxford, UK To gain insight into the molecular pathogenesis of the the World Health Organization.6,7 Patients with refractory myelodysplastic syndromes (MDS), we performed global gene anemia (RA) with or without ringed sideroblasts, according to expression profiling and pathway analysis on the hemato- poietic stem cells (HSC) of 183 MDS patients as compared with the the French–American–British classification, were subdivided HSC of 17 healthy controls. The most significantly deregulated based on the presence or absence of multilineage dysplasia. In pathways in MDS include interferon signaling, thrombopoietin addition, patients with RA with excess blasts (RAEB) were signaling and the Wnt pathways. Among the most signifi- subdivided into two categories, RAEB1 and RAEB2, based on the cantly deregulated gene pathways in early MDS are immuno- percentage of bone marrow blasts.
    [Show full text]
  • The Rise and Fall of the Bovine Corpus Luteum
    University of Nebraska Medical Center DigitalCommons@UNMC Theses & Dissertations Graduate Studies Spring 5-6-2017 The Rise and Fall of the Bovine Corpus Luteum Heather Talbott University of Nebraska Medical Center Follow this and additional works at: https://digitalcommons.unmc.edu/etd Part of the Biochemistry Commons, Molecular Biology Commons, and the Obstetrics and Gynecology Commons Recommended Citation Talbott, Heather, "The Rise and Fall of the Bovine Corpus Luteum" (2017). Theses & Dissertations. 207. https://digitalcommons.unmc.edu/etd/207 This Dissertation is brought to you for free and open access by the Graduate Studies at DigitalCommons@UNMC. It has been accepted for inclusion in Theses & Dissertations by an authorized administrator of DigitalCommons@UNMC. For more information, please contact [email protected]. THE RISE AND FALL OF THE BOVINE CORPUS LUTEUM by Heather Talbott A DISSERTATION Presented to the Faculty of the University of Nebraska Graduate College in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy Biochemistry and Molecular Biology Graduate Program Under the Supervision of Professor John S. Davis University of Nebraska Medical Center Omaha, Nebraska May, 2017 Supervisory Committee: Carol A. Casey, Ph.D. Andrea S. Cupp, Ph.D. Parmender P. Mehta, Ph.D. Justin L. Mott, Ph.D. i ACKNOWLEDGEMENTS This dissertation was supported by the Agriculture and Food Research Initiative from the USDA National Institute of Food and Agriculture (NIFA) Pre-doctoral award; University of Nebraska Medical Center Graduate Student Assistantship; University of Nebraska Medical Center Exceptional Incoming Graduate Student Award; the VA Nebraska-Western Iowa Health Care System Department of Veterans Affairs; and The Olson Center for Women’s Health, Department of Obstetrics and Gynecology, Nebraska Medical Center.
    [Show full text]
  • Wo 2010/075007 A2
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date 1 July 2010 (01.07.2010) WO 2010/075007 A2 (51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every C12Q 1/68 (2006.01) G06F 19/00 (2006.01) kind of national protection available): AE, AG, AL, AM, C12N 15/12 (2006.01) AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, (21) International Application Number: DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, PCT/US2009/067757 HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, (22) International Filing Date: KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, 11 December 2009 ( 11.12.2009) ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PE, PG, PH, PL, PT, RO, RS, RU, SC, SD, (25) Filing Language: English SE, SG, SK, SL, SM, ST, SV, SY, TJ, TM, TN, TR, TT, (26) Publication Language: English TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (30) Priority Data: (84) Designated States (unless otherwise indicated, for every 12/3 16,877 16 December 2008 (16.12.2008) US kind of regional protection available): ARIPO (BW, GH, GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM, (71) Applicant (for all designated States except US): DODDS, ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, W., Jean [US/US]; 938 Stanford Street, Santa Monica, TM), European (AT, BE, BG, CH, CY, CZ, DE, DK, EE, CA 90403 (US).
    [Show full text]
  • Prioritization and Evaluation of Depression Candidate Genes by Combining Multidimensional Data Resources
    Prioritization and Evaluation of Depression Candidate Genes by Combining Multidimensional Data Resources Chung-Feng Kao1, Yu-Sheng Fang2, Zhongming Zhao3, Po-Hsiu Kuo1,2,4* 1 Department of Public Health and Institute of Epidemiology and Preventive Medicine, College of Public Health, National Taiwan University, Taipei, Taiwan, 2 Institute of Clinical Medicine, School of Medicine, National Cheng-Kung University, Tainan, Taiwan, 3 Departments of Biomedical Informatics and Psychiatry, Vanderbilt University School of Medicine, Nashville, Tennessee, United States of America, 4 Research Center for Genes, Environment and Human Health, National Taiwan University, Taipei, Taiwan Abstract Background: Large scale and individual genetic studies have suggested numerous susceptible genes for depression in the past decade without conclusive results. There is a strong need to review and integrate multi-dimensional data for follow up validation. The present study aimed to apply prioritization procedures to build-up an evidence-based candidate genes dataset for depression. Methods: Depression candidate genes were collected in human and animal studies across various data resources. Each gene was scored according to its magnitude of evidence related to depression and was multiplied by a source-specific weight to form a combined score measure. All genes were evaluated through a prioritization system to obtain an optimal weight matrix to rank their relative importance with depression using the combined scores. The resulting candidate gene list for depression (DEPgenes) was further evaluated by a genome-wide association (GWA) dataset and microarray gene expression in human tissues. Results: A total of 5,055 candidate genes (4,850 genes from human and 387 genes from animal studies with 182 being overlapped) were included from seven data sources.
    [Show full text]
  • Identification of the Binding Partners for Hspb2 and Cryab Reveals
    Brigham Young University BYU ScholarsArchive Theses and Dissertations 2013-12-12 Identification of the Binding arP tners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non- Redundant Roles for Small Heat Shock Proteins Kelsey Murphey Langston Brigham Young University - Provo Follow this and additional works at: https://scholarsarchive.byu.edu/etd Part of the Microbiology Commons BYU ScholarsArchive Citation Langston, Kelsey Murphey, "Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins" (2013). Theses and Dissertations. 3822. https://scholarsarchive.byu.edu/etd/3822 This Thesis is brought to you for free and open access by BYU ScholarsArchive. It has been accepted for inclusion in Theses and Dissertations by an authorized administrator of BYU ScholarsArchive. For more information, please contact [email protected], [email protected]. Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactions and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston A thesis submitted to the faculty of Brigham Young University in partial fulfillment of the requirements for the degree of Master of Science Julianne H. Grose, Chair William R. McCleary Brian Poole Department of Microbiology and Molecular Biology Brigham Young University December 2013 Copyright © 2013 Kelsey Langston All Rights Reserved ABSTRACT Identification of the Binding Partners for HspB2 and CryAB Reveals Myofibril and Mitochondrial Protein Interactors and Non-Redundant Roles for Small Heat Shock Proteins Kelsey Langston Department of Microbiology and Molecular Biology, BYU Master of Science Small Heat Shock Proteins (sHSP) are molecular chaperones that play protective roles in cell survival and have been shown to possess chaperone activity.
    [Show full text]
  • Allele-Specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish
    Allele-specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish by Ailu Chen A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama August 1, 2015 Keywords: catfish, interspecific hybrids, allele-specific expression, ribosomal protein Copyright 2015 by Ailu Chen Approved by Zhanjiang Liu, Chair, Professor, School of Fisheries, Aquaculture and Aquatic Sciences Nannan Liu, Professor, Entomology and Plant Pathology Eric Peatman, Associate Professor, School of Fisheries, Aquaculture and Aquatic Sciences Aaron M. Rashotte, Associate Professor, Biological Sciences Abstract Interspecific hybridization results in a vast reservoir of allelic variations, which may potentially contribute to phenotypical enhancement in the hybrids. Whether the allelic variations are related to the downstream phenotypic differences of interspecific hybrid is still an open question. The recently developed genome-wide allele-specific approaches that harness high- throughput sequencing technology allow direct quantification of allelic variations and gene expression patterns. In this work, I investigated allele-specific expression (ASE) pattern using RNA-Seq datasets generated from interspecific catfish hybrids. The objective of the study is to determine the ASE genes and pathways in which they are involved. Specifically, my study investigated ASE-SNPs, ASE-genes, parent-of-origins of ASE allele and how ASE would possibly contribute to heterosis. My data showed that ASE was operating in the interspecific catfish system. Of the 66,251 and 177,841 SNPs identified from the datasets of the liver and gill, 5,420 (8.2%) and 13,390 (7.5%) SNPs were identified as significant ASE-SNPs, respectively.
    [Show full text]
  • Transcriptomic Analysis of the Aquaporin (AQP) Gene Family
    Pancreatology 19 (2019) 436e442 Contents lists available at ScienceDirect Pancreatology journal homepage: www.elsevier.com/locate/pan Transcriptomic analysis of the Aquaporin (AQP) gene family interactome identifies a molecular panel of four prognostic markers in patients with pancreatic ductal adenocarcinoma Dimitrios E. Magouliotis a, b, Vasiliki S. Tasiopoulou c, Konstantinos Dimas d, * Nikos Sakellaridis d, Konstantina A. Svokos e, Alexis A. Svokos f, Dimitris Zacharoulis b, a Division of Surgery and Interventional Science, Faculty of Medical Sciences, UCL, London, UK b Department of Surgery, University of Thessaly, Biopolis, Larissa, Greece c Faculty of Medicine, School of Health Sciences, University of Thessaly, Biopolis, Larissa, Greece d Department of Pharmacology, Faculty of Medicine, School of Health Sciences, University of Thessaly, Biopolis, Larissa, Greece e The Warren Alpert Medical School of Brown University, Providence, RI, USA f Riverside Regional Medical Center, Newport News, VA, USA article info abstract Article history: Background: This study aimed to assess the differential gene expression of aquaporin (AQP) gene family Received 14 October 2018 interactome in pancreatic ductal adenocarcinoma (PDAC) using data mining techniques to identify novel Received in revised form candidate genes intervening in the pathogenicity of PDAC. 29 January 2019 Method: Transcriptome data mining techniques were used in order to construct the interactome of the Accepted 9 February 2019 AQP gene family and to determine which genes members are differentially expressed in PDAC as Available online 11 February 2019 compared to controls. The same techniques were used in order to evaluate the potential prognostic role of the differentially expressed genes. Keywords: PDAC Results: Transcriptome microarray data of four GEO datasets were incorporated, including 142 primary Aquaporin tumor samples and 104 normal pancreatic tissue samples.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name epithelial membrane protein 2 Gene Symbol Emp2 Organism Rat Gene Summary Description Not Available Gene Aliases Not Available RefSeq Accession No. Not Available UniGene ID Rn.21730 Ensembl Gene ID ENSRNOG00000002664 Entrez Gene ID 360468 Assay Information Unique Assay ID qRnoCIP0024746 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENSRNOT00000003615 Amplicon Context Sequence CCTGCTGCCTTCGCTGCCCTGTGAACATGTTGGTGATTCTTGCCTTCATCATCGT CTTCCACATCGTGTCTACGGCACTCTTGTTCATTTCAACCATTGACAATGCCTGG TGGGTAGGAGATGGCTTCTCAGCT Amplicon Length (bp) 104 Chromosome Location 10:4276703-4281842 Assay Design Intron-spanning Purification Desalted Validation Results Efficiency (%) 99 R2 0.9989 cDNA Cq 20.98 cDNA Tm (Celsius) 82.5 gDNA Cq Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report Emp2, Rat Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • Arcn1 (NM 145985) Mouse Recombinant Protein Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for TP508216 Arcn1 (NM_145985) Mouse Recombinant Protein Product data: Product Type: Recombinant Proteins Description: Purified recombinant protein of Mouse archain 1 (Arcn1), with C-terminal MYC/DDK tag, expressed in HEK293T cells, 20ug Species: Mouse Expression Host: HEK293T Tag: C-MYC/DDK Predicted MW: 57.7 kDa Concentration: >50 ug/mL as determined by microplate BCA method Purity: > 80% as determined by SDS-PAGE and Coomassie blue staining Buffer: 25 mM Tris.HCl, pH 7.3, 100 mM glycine, 10% glycerol. Storage: Store at -80°C after receiving vials. Stability: Stable for 12 months from the date of receipt of the product under proper storage and handling conditions. Avoid repeated freeze-thaw cycles. RefSeq: NP_666097 Locus ID: 213827 UniProt ID: Q5XJY5 RefSeq Size: 3470 Cytogenetics: 9 A5.2 RefSeq ORF: 1536 Synonyms: 4632432M07Rik; nur17 This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 2 Arcn1 (NM_145985) Mouse Recombinant Protein – TP508216 Summary: The coatomer is a cytosolic protein complex that binds to dilysine motifs and reversibly associates with Golgi non-clathrin-coated vesicles, which further mediate biosynthetic protein transport from the ER, via the Golgi up to the trans Golgi network. Coatomer complex is required for budding from Golgi membranes, and is essential for the retrograde Golgi-to-ER transport of dilysine-tagged proteins.
    [Show full text]
  • Genome Analysis and Knowledge
    Dahary et al. BMC Medical Genomics (2019) 12:200 https://doi.org/10.1186/s12920-019-0647-8 SOFTWARE Open Access Genome analysis and knowledge-driven variant interpretation with TGex Dvir Dahary1*, Yaron Golan1, Yaron Mazor1, Ofer Zelig1, Ruth Barshir2, Michal Twik2, Tsippi Iny Stein2, Guy Rosner3,4, Revital Kariv3,4, Fei Chen5, Qiang Zhang5, Yiping Shen5,6,7, Marilyn Safran2, Doron Lancet2* and Simon Fishilevich2* Abstract Background: The clinical genetics revolution ushers in great opportunities, accompanied by significant challenges. The fundamental mission in clinical genetics is to analyze genomes, and to identify the most relevant genetic variations underlying a patient’s phenotypes and symptoms. The adoption of Whole Genome Sequencing requires novel capacities for interpretation of non-coding variants. Results: We present TGex, the Translational Genomics expert, a novel genome variation analysis and interpretation platform, with remarkable exome analysis capacities and a pioneering approach of non-coding variants interpretation. TGex’s main strength is combining state-of-the-art variant filtering with knowledge-driven analysis made possible by VarElect, our highly effective gene-phenotype interpretation tool. VarElect leverages the widely used GeneCards knowledgebase, which integrates information from > 150 automatically-mined data sources. Access to such a comprehensive data compendium also facilitates TGex’s broad variant annotation, supporting evidence exploration, and decision making. TGex has an interactive, user-friendly, and easy adaptive interface, ACMG compliance, and an automated reporting system. Beyond comprehensive whole exome sequence capabilities, TGex encompasses innovative non-coding variants interpretation, towards the goal of maximal exploitation of whole genome sequence analyses in the clinical genetics practice. This is enabled by GeneCards’ recently developed GeneHancer, a novel integrative and fully annotated database of human enhancers and promoters.
    [Show full text]
  • Evidence for Differential Alternative Splicing in Blood of Young Boys With
    Stamova et al. Molecular Autism 2013, 4:30 http://www.molecularautism.com/content/4/1/30 RESEARCH Open Access Evidence for differential alternative splicing in blood of young boys with autism spectrum disorders Boryana S Stamova1,2,5*, Yingfang Tian1,2,4, Christine W Nordahl1,3, Mark D Shen1,3, Sally Rogers1,3, David G Amaral1,3 and Frank R Sharp1,2 Abstract Background: Since RNA expression differences have been reported in autism spectrum disorder (ASD) for blood and brain, and differential alternative splicing (DAS) has been reported in ASD brains, we determined if there was DAS in blood mRNA of ASD subjects compared to typically developing (TD) controls, as well as in ASD subgroups related to cerebral volume. Methods: RNA from blood was processed on whole genome exon arrays for 2-4–year-old ASD and TD boys. An ANCOVA with age and batch as covariates was used to predict DAS for ALL ASD (n=30), ASD with normal total cerebral volumes (NTCV), and ASD with large total cerebral volumes (LTCV) compared to TD controls (n=20). Results: A total of 53 genes were predicted to have DAS for ALL ASD versus TD, 169 genes for ASD_NTCV versus TD, 1 gene for ASD_LTCV versus TD, and 27 genes for ASD_LTCV versus ASD_NTCV. These differences were significant at P <0.05 after false discovery rate corrections for multiple comparisons (FDR <5% false positives). A number of the genes predicted to have DAS in ASD are known to regulate DAS (SFPQ, SRPK1, SRSF11, SRSF2IP, FUS, LSM14A). In addition, a number of genes with predicted DAS are involved in pathways implicated in previous ASD studies, such as ROS monocyte/macrophage, Natural Killer Cell, mTOR, and NGF signaling.
    [Show full text]
  • Ageing-Associated Changes in DNA Methylation in X and Y Chromosomes
    Kananen and Marttila Epigenetics & Chromatin (2021) 14:33 Epigenetics & Chromatin https://doi.org/10.1186/s13072-021-00407-6 RESEARCH Open Access Ageing-associated changes in DNA methylation in X and Y chromosomes Laura Kananen1,2,3,4* and Saara Marttila4,5* Abstract Background: Ageing displays clear sexual dimorphism, evident in both morbidity and mortality. Ageing is also asso- ciated with changes in DNA methylation, but very little focus has been on the sex chromosomes, potential biological contributors to the observed sexual dimorphism. Here, we sought to identify DNA methylation changes associated with ageing in the Y and X chromosomes, by utilizing datasets available in data repositories, comprising in total of 1240 males and 1191 females, aged 14–92 years. Results: In total, we identifed 46 age-associated CpG sites in the male Y, 1327 age-associated CpG sites in the male X, and 325 age-associated CpG sites in the female X. The X chromosomal age-associated CpGs showed signifcant overlap between females and males, with 122 CpGs identifed as age-associated in both sexes. Age-associated X chro- mosomal CpGs in both sexes were enriched in CpG islands and depleted from gene bodies and showed no strong trend towards hypermethylation nor hypomethylation. In contrast, the Y chromosomal age-associated CpGs were enriched in gene bodies, and showed a clear trend towards hypermethylation with age. Conclusions: Signifcant overlap in X chromosomal age-associated CpGs identifed in males and females and their shared features suggest that despite the uneven chromosomal dosage, diferences in ageing-associated DNA methylation changes in the X chromosome are unlikely to be a major contributor of sex dimorphism in ageing.
    [Show full text]