DOCSLIB.ORG

Generation DNA Sequencing to the Identification of Rare Variants in Congenital Disorders

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Generation DNA Sequencing to the Identification of Rare Variants in Congenital Disorders UNIVERSITY OF CALIFORNIA Los Angeles Applications of Next-Generation DNA Sequencing to the Identification of Rare Variants in Congenital DisorDers of the Intestine anD Brain A Dissertation submitteD in partial satisfaction of the requirements for the Degree of Doctor of Philosophy in Human Genetics by Michael Yourshaw 2014 © Copyright by Michael Yourshaw 2014 ABSTRACT OF THE DISSERTATION Applications of Next-Generation DNA Sequencing to the Identification of Rare Variants in Congenital DisorDers of the Intestine anD Brain by Michael Yourshaw Doctor of Philosophy in Human Genetics University of California, Los Angeles, 2014 Professor Stanley F. Nelson, Chair High throughput, massively parallel DNA sequencing proviDes a powerful technology to stuDy the human genome anD to iDentify variations in DNA that cause disease. Sequencing the protein coDing region of the genome (‘whole-exome sequencing’) is a cost effective methoD to search the part of the genome that is most likely to harbor Disease relateD mutations. We DevelopeD software methoDs to process sequencing data and to annotate variants with Data on genes, function, conservation, expression, Diseases, pathways, anD protein structure. We applieD whole-exome sequencing to search for the molecular basis of Disease in three projects: 1) a cohort of patients with congenital diarrheal disorders (CDDs); 2) a cohort of patients with congenital chronic intestinal pseuDo-obstruction (CIPO) or the relateD Disease, megacystis-microcolon-intestinal hypoperistalsis syndrome (MMIH); anD 3) four siblings with infantile pontocerebellar hypoplasia and spinal motor neuron Degeneration. ii We sequenceD 45 probanDs from Diverse ethnic backgrounDs who were DiagnoseD with a variety of CDDs of probable, but unknown genetic cause. Patients had been diagnosed with generalizeD malabsorptive Diarrhea, selective nutrient malabsorption, secretory diarrhea, anD infantile IBD. We founD homozygous or compound heterozygous mutations, 25 of them novel, in genes known to be associated with CDDs in 27 cases (60%). The genes implicateD were ADAM17, DGAT1, EPCAM, IL10RA, MALT1, MYO5B, NEUROG3, PCSK1, SI, SKIV2L, SLC26A3, anD SLC5A. With whole-exome sequencing in a cohort of 20 patients with congenital CIPO or MMIH, we iDentifieD a subset of 10 cases with potentially Damaging De-novo dominant acting mutations at highly conserveD loci in the ACTG2 gene, encoding actin, gamma-enteric smooth muscle precursor, a protein essential to the functioning of muscle cells in the intestinal wall. By exome sequencing, we Discovered rare recessive mutations in EXOSC3 (encoDing exosome component 3) that were responsible for pontocerebellar hypoplasia and spinal motor neuron degeneration in the four probanDs, anD identifieD identical anD aDDitional novel mutations in a large percentage of other chilDren with the same DisorDer. In conclusion, we DemonstrateD that whole-exome sequencing is an effective approach for the identification of casual mutations in that may escape Detection with stanDarD practice involving a complex Diagnostic workup and targeted gene sequencing. iii The Dissertation of Michael Yourshaw is approveD. Rita M. Cantor Lars Dreier J. AlDons Lusis Stanley F. Nelson, Committee Chair University of California, Los Angeles 2014 iv Dedicated to my parents Mike and Elizabeth my children Ivan, Erik, Alexis, Amanda, and Christopher and my grandchildren Sarah, Thunder, Steel, Heaven, Jewel, Love, and Mercy v TABLE OF CONTENTS ABSTRACT OF THE DISSERTATION ......................................................................................................................... ii LIST OF FIGURES .......................................................................................................................................................... viii LIST OF TABLES ................................................................................................................................................................ x ACKNOWLEDGMENTS .................................................................................................................................................. xi Curriculum Vitae ........................................................................................................................................................... xiv CHAPTER ONE IntroDuction ............................................................................................................................................ 1 References ................................................................................................................................................................... 22 CHAPTER TWO Rich annotation of DNA sequencing variants by leveraging the Ensembl Variant Effect PreDictor with plugins .................................................................................................................................... 37 References ................................................................................................................................................................... 58 CHAPTER THREE Whole-exome sequencing for the iDentification of casual mutations in congenital Diarrheal DisorDers ................................................................................................................................ 61 References ................................................................................................................................................................... 82 CHAPTER FOUR Exome sequencing finds a novel PCSK1 mutation in a chilD with generalizeD malabsorptive Diarrhea anD Diabetes insipiDus .............................................................................................. 88 CHAPTER FIVE Functional consequences of a novel variant of PCSK1 ...................................................... 99 CHAPTER SIX Mutations in ACTG2 are associateD with sporadic congenital chronic intestinal pseudo-obstruction anD megacystis-microcolon-intestinal hypoperistalsis syndrome ............. 108 References ................................................................................................................................................................ 121 vi CHAPTER SEVEN Mutations in the RNA exosome component gene EXOSC3 cause pontocerebellar hypoplasia and spinal motor neuron degeneration .................................................................................... 128 CHAPTER EIGHT Conclusions .................................................................................................................................... 149 References ................................................................................................................................................................ 157 vii LIST OF FIGURES Chapter 2 Figure 1. Overview of DNA sequencing and annotation .................................................................................. 53 Text box 1. ProteinSeq plugin ..................................................................................................................................... 54 Text box 2. Mito plugin ................................................................................................................................................... 55 Chapter4 Figure 1. Exome sequencing results ......................................................................................................................... 93 Figure 2. Functional characterization and visualization of wilD-type (WT) prohormone convertase 1/3 (PC1/3) complementary DNA anD PC1/3 containing the Y343X nonsense mutation ............................................................................................................................................................................... 94 Figure 3. Absence of prohormone convertase 1/3 (PC1/3)-positive enteroendocrine cells in small bowel mucosa ........................................................................................................................................................ 95 Table S1. Potentially harmful mutations in PCSK1 found in public Datasets ......................................... 98 Chapter 5 Figure 1. Domain structure and SNP locations within preproPC1/3 ..................................................... 101 Figure 2. Direct Sanger sequencing of genomic DNA from a subject bearing the Arg80Gln variant ................................................................................................................................................................................ 103 Figure 3. Western blotting of wilD-type anD variant PC1/3 proteins expresseD in HEK cells ..... 104 Figure 4. Specific activities of wilD-type anD variant PC1/3 proteins, expresseD in HEK cells ... 104 Figure 5. Western blotting of wilD-type anD novel R80Q (rs1799904) variant PC1/3s, expressed in Neuro-2A cells ..................................................................................................................................... 105 Chapter 7 Figure 1. Neuroimaging, neuromuscular anD pathological features in family 1 ................................ 130 Figure 2. EXOSC3 mutations in PCH1 .................................................................................................................... 131 Figure 3 KnockDown of exosc3 in zebrafish embryos Disrupts normal Development ..................... 132 Supplementary Figure 1. Genome-wiDe SNP Genotyping & Linkage Analysis ................................... 143 Supplementary
Load more

Recommended publications
  • TSEN54 Rabbit Pab Antibody
    TSEN54 rabbit pAb antibody Catalog No : Source: Concentration : Mol.Wt. (Da): A22945 Rabbit 1 mg/ml 58819 Applications WB,IHC,ELISA Reactivity Human Dilution WB: 1:500 - 1:2000. IHC: 1:100 - 1:300. ELISA: 1:20000. Not yet tested in other applications. Storage -20°C/1 year Specificity TSEN54 Polyclonal Antibody detects endogenous levels of TSEN54 protein. Source / Purification The antibody was affinity-purified from rabbit antiserum by affinity- chromatography using epitope-specific immunogen. Immunogen The antiserum was produced against synthesized peptide derived from human TSEN54. AA range:261-310 Uniprot No Q7Z6J9 Alternative names TSEN54; SEN54; tRNA-splicing endonuclease subunit Sen54; SEN54 homolog; HsSEN54; tRNA-intron endonuclease Sen54 Form Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. Clonality Polyclonal Isotype IgG Conjugation Background tRNA splicing endonuclease subunit 54(TSEN54) Homo sapiens This gene encodes a subunit of the tRNA splicing endonuclease complex, which catalyzes the removal of introns from precursor tRNAs. The complex is also implicated in pre-mRNA 3-prime end processing. Mutations in this gene result in pontocerebellar hypoplasia type 2.[provided by RefSeq, Oct 2009], Other TSEN54, tRNA-splicing endonuclease subunit Sen54 Produtc Images： Application Key: WB-Western IP-Immunoprecipitation IHC-Immunohistochemistry ChIP-Chromatin Immunoprecipitation A AAB Biosciences Products www.aabsci.cn FOR RESEARCH USE ONLY. NOT FOR HUMAN OR DIAGNOSTIC USE. IF-Immunofluorescence F-Flow Cytometry E-P-ELISA-Peptide Species Cross-Reactivity Key: H-Human M-Mouse R-Rat Hm-Hamster Mk-Monkey Vir-Virus Mi-Mink C-Chicken Dm-D. melanogaster X-Xenopus Z-Zebrafish B-Bovine Dg-Dog Pg-Pig Sc-S.
    [Show full text]
  • PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41
    American Society of Human Genetics 62nd Annual Meeting November 6–10, 2012 San Francisco, California PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41. Genes Underlying Neurological Disease Room 134 #196–#204 2. 4:30–6:30pm: Plenary Abstract 42. Cancer Genetics III: Common Presentations Hall D #1–#6 Variants Ballroom 104 #205–#213 43. Genetics of Craniofacial and Wednesday, November 7 Musculoskeletal Disorders Room 124 #214–#222 10:30am–12:45 pm: Concurrent Platform Session A (11–19): 44. Tools for Phenotype Analysis Room 132 #223–#231 11. Genetics of Autism Spectrum 45. Therapy of Genetic Disorders Room 130 #232–#240 Disorders Hall D #7–#15 46. Pharmacogenetics: From Discovery 12. New Methods for Big Data Ballroom 103 #16–#24 to Implementation Room 123 #241–#249 13. Cancer Genetics I: Rare Variants Room 135 #25–#33 14. Quantitation and Measurement of Friday, November 9 Regulatory Oversight by the Cell Room 134 #34–#42 8:00am–10:15am: Concurrent Platform Session D (47–55): 15. New Loci for Obesity, Diabetes, and 47. Structural and Regulatory Genomic Related Traits Ballroom 104 #43–#51 Variation Hall D #250–#258 16. Neuromuscular Disease and 48. Neuropsychiatric Disorders Ballroom 103 #259–#267 Deafness Room 124 #52–#60 49. Common Variants, Rare Variants, 17. Chromosomes and Disease Room 132 #61–#69 and Everything in-Between Room 135 #268–#276 18. Prenatal and Perinatal Genetics Room 130 #70–#78 50. Population Genetics Genome-Wide Room 134 #277–#285 19. Vascular and Congenital Heart 51. Endless Forms Most Beautiful: Disease Room 123 #79–#87 Variant Discovery in Genomic Data Ballroom 104 #286–#294 52.
    [Show full text]
  • A Molecular and Genetic Analysis of Otosclerosis
    A molecular and genetic analysis of otosclerosis Joanna Lauren Ziff Submitted for the degree of PhD University College London January 2014 1 Declaration I, Joanna Ziff, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. Where work has been conducted by other members of our laboratory, this has been indicated by an appropriate reference. 2 Abstract Otosclerosis is a common form of conductive hearing loss. It is characterised by abnormal bone remodelling within the otic capsule, leading to formation of sclerotic lesions of the temporal bone. Encroachment of these lesions on to the footplate of the stapes in the middle ear leads to stapes fixation and subsequent conductive hearing loss. The hereditary nature of otosclerosis has long been recognised due to its recurrence within families, but its genetic aetiology is yet to be characterised. Although many familial linkage studies and candidate gene association studies to investigate the genetic nature of otosclerosis have been performed in recent years, progress in identifying disease causing genes has been slow. This is largely due to the highly heterogeneous nature of this condition. The research presented in this thesis examines the molecular and genetic basis of otosclerosis using two next generation sequencing technologies; RNA-sequencing and Whole Exome Sequencing. RNA–sequencing has provided human stapes transcriptomes for healthy and diseased stapes, and in combination with pathway analysis has helped identify genes and molecular processes dysregulated in otosclerotic tissue. Whole Exome Sequencing has been employed to investigate rare variants that segregate with otosclerosis in affected families, and has been followed by a variant filtering strategy, which has prioritised genes found to be dysregulated during RNA-sequencing.
    [Show full text]
  • Supplementary Materials
    Lists of figures Figure S1: A-B: Principal Component Analysis (PCA) was applied to 3 pairs of SCEC tissues (red) and matched adjacent normal tissues (blue) that were characterized by the gene expression of all probes on Affymetrix HG U133 Plus 2.0 Array. C: Box plot of SCEC group. D: Pearson’s correlation matrix of SCEC group. 17 / 25 Figure S2: MvA plot of SCEC group. Figure S3: Volcano plots of probe sets differing between SCEC and matched normal tissues. Fold change (X axis) is plotted against statistical significance (Y axis) for each probe sets. Genes altered with a fold change ≥2 and FDR <0.01 are depicted in red. Grey represents genes in the arrays that were not found to differ significantly between cancerous samples and matched normal samples. Figure S4: Gene regulatory network plotted by the top 120 DEGs (ranked by FDR) of SCEC groups. 18 / 25 Figure S5: DNA copy number change profiles in 3 pairs of SCEC samples. The CNVs frequency of the whole genome was analyzed by aCGH. Gains were marked in red and losses in bule. Lists of tables Table S1. Primers used in qRT-PCR for microarray gene expression validation Gene Forward Primer (5’-3’) Reverse Primer (5’-3’) Product β-actin AAGGTGACAGCAGTCGGTT TGTGTGGACTTGGGAGAGG 195bp INSM1 GTATTCGCTGTGTTCATGGTC CGCTACATACATAGAGAGCAGAG 79bp ASCL1 AACTCCCATCACCTCTAACA TGAGACGAAAGACACCAACT 120bp NRCAM GATGGCGAAGAATGAAGTT ACAGTGAGGGATAAGGTGTG 141bp NUF2 ATGATGCCAGTGAACTCTGAA GACTTGTCCGTTTTGCTTTTG 160bp 19 / 25 SNAP25 CCTGGATATGGGCAATGAGAT ACACGGGTGGGCACACTTA 146bp PTP4A3 GCTTCCTCATCACCCACAA CCGTACTTCTTCAGGTCCTCA
    [Show full text]
  • Interpreting Human Genetic Variation with in Vivo Zebrafish Assays Erica E
    Interpreting Human Genetic Variation With In Vivo Zebrafish Assays Erica E. Davis, PhD, Stephan Frangakis, BS, and Nicholas Katsanis, PhD Center for Human Disease Modeling Duke University Medical Center Durham, North Carolina © 20132015 Katsanis Interpreting Human Genetic Variation With In Vivo Zebrafish Assays 11 Introduction bona fide pathogenic mutations alone in the average NOTES Rapid advances and cost erosion in exome and human exome, studies have reported a median of 50– genome analysis of patients with both rare and 150 nonsense mutations, several in homozygosity, common genetic disorders have accelerated gene while the abundance of unique single nucleotide discovery and illuminated fundamental biological variants (SNVs) can be in the low-to-mid 100s mechanisms. The thrill of discovery has been (1000 Genomes Project Consortium et al., 2010). accompanied, however, by the sobering appreciation Importantly, the number of rare and ultra-rare SNVs that human genomes are burdened with a large has continued to increase proportionately to the number of rare and ultra-rare variants, thereby posing number of available exomes and genomes (Tennessen a significant challenge in dissecting both the effect of et al., 2012), indicating that we are unlikely to reach such alleles on protein function and the biological saturation of such alleles soon. These observations relevance of these events to patient pathology. In have generated a significant interpretive problem an effort to develop model systems that are able to for disease gene discovery and for clinical genomics, generate surrogates of human pathologies, a powerful as population-based arguments alone have been suite of tools has been developed in zebrafish, unable to dissect the contribution of the majority of taking advantage of the relatively small (compared these alleles to clinical phenotypes.
    [Show full text]
  • “The Impact of ART on Genome‐Wide Oxidation of 5‐Methylcytosine and the Transcriptome During Early Mouse Development”
    “The impact of ART on genome‐wide oxidation of 5‐methylcytosine and the transcriptome during early mouse development” Dissertation zur Erlangung des Grades “Doktor der Naturwissenschaften” am Fachbereich Biologie der Johannes Gutenberg-Universität Mainz Elif Diken geb. Söğütcü geb. am 22.07.1987 in Giresun-TURKEY Mainz 2016 Dekan: 1. Berichterstatter: 2. Berichterstatter: Tag der mündlichen Prüfung: Summary Summary The use of assisted reproductive technologies (ART) has been increasing over the past three decades due to the elevated frequency of infertility problems. Other factors such as easier access to medical aid than in the past and its coverage by health insurance companies in many developed countries also contributed to this growing interest. Nevertheless, a negative impact of ART on transcriptome and methylation reprogramming is heavily discussed. Methylation reprogramming directly after fertilization manifests itself as genome-wide DNA demethylation associated with the oxidation of 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC) in the pronuclei of mouse zygotes. To investigate the possible impact of ART particularly on this process and the transcriptome in general, pronuclear stage mouse embryos obtained upon spontaneous ovulation or superovulation through hormone stimulation representing ART were subjected to various epigenetic analyses. A whole- transcriptome RNA-Seq analysis of pronuclear stage embryos from spontaneous and superovulated matings demonstrated altered expression of the Bbs12 gene known to be linked to Bardet-Biedl syndrome (BBS) as well as the Dhx16 gene whose zebrafish ortholog was reported to be a maternal effect gene. Immunofluorescence staining with antibodies against 5mC and 5hmC showed that pronuclear stage embryos obtained by superovulation have an increased incidence of abnormal methylation and hydroxymethylation patterns in both maternal and paternal pronuclear DNA compared to their spontaneously ovulated counterparts.
    [Show full text]
  • The Function and Evolution of C2H2 Zinc Finger Proteins and Transposons
    The function and evolution of C2H2 zinc finger proteins and transposons by Laura Francesca Campitelli A thesis submitted in conformity with the requirements for the degree of Doctor of Philosophy Department of Molecular Genetics University of Toronto © Copyright by Laura Francesca Campitelli 2020 The function and evolution of C2H2 zinc finger proteins and transposons Laura Francesca Campitelli Doctor of Philosophy Department of Molecular Genetics University of Toronto 2020 Abstract Transcription factors (TFs) confer specificity to transcriptional regulation by binding specific DNA sequences and ultimately affecting the ability of RNA polymerase to transcribe a locus. The C2H2 zinc finger proteins (C2H2 ZFPs) are a TF class with the unique ability to diversify their DNA-binding specificities in a short evolutionary time. C2H2 ZFPs comprise the largest class of TFs in Mammalian genomes, including nearly half of all Human TFs (747/1,639). Positive selection on the DNA-binding specificities of C2H2 ZFPs is explained by an evolutionary arms race with endogenous retroelements (EREs; copy-and-paste transposable elements), where the C2H2 ZFPs containing a KRAB repressor domain (KZFPs; 344/747 Human C2H2 ZFPs) are thought to diversify to bind new EREs and repress deleterious transposition events. However, evidence of the gain and loss of KZFP binding sites on the ERE sequence is sparse due to poor resolution of ERE sequence evolution, despite the recent publication of binding preferences for 242/344 Human KZFPs. The goal of my doctoral work has been to characterize the Human C2H2 ZFPs, with specific interest in their evolutionary history, functional diversity, and coevolution with LINE EREs.
    [Show full text]
  • The Fission Yeast Non-Coding Transcriptome
    The Fission Yeast Non-Coding Transcriptome Sophie Radha Atkinson A thesis submitted for the degree of Doctor of Philosophy University College London September 2014 1 Declaration I, Sophie Radha Atkinson, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. 2 Abstract Long non-coding RNAs (lncRNAs) are emerging as important regulators of gene expression, although it remains unclear to what extent they contribute overall to the information flow from genotype to phenotype. Using strand-specific RNA- sequencing, I identify thousands of novel unstable, or cryptic, lncRNAs in Schizosaccharomyces pombe. The nuclear exosome, the RNAi pathway and the cytoplasmic exonuclease Exo2 represent three key pathways regulating lncRNAs in S. pombe, defining the overlapping classes of CUTs, RUTs and XUTs, respectively. The nuclear exosome and the RNAi pathway act cooperatively to control nuclear lncRNA expression, while the cytoplasmic Exo2 pathway is more distinct. Impairing both the nuclear exosome and the cytoplasmic exonuclease Exo2 is lethal in S. pombe. Importantly, I show that CUTs, RUTs and XUTs are stabilised under physiologically relevant growth conditions, with three key groups emerging: late meiotic RUTs/XUTs, early meiotic CUTs and quiescent CUTs. Late meiotic RUTs/XUTs tend to be antisense to protein-coding genes, and anti-correlate in expression with their sense loci. In contrast, early meiotic and quiescent CUTs tend to be transcribed divergently from protein-coding genes and positively correlate in expression with their mRNA partners. The current study provides an in-depth survey of the lncRNA repertoire of S.
    [Show full text]
  • Biocuration 2016 - Posters
    Biocuration 2016 - Posters Source: http://www.sib.swiss/events/biocuration2016/posters 1 RAM: A standards-based database for extracting and analyzing disease-specified concepts from the multitude of biomedical resources Jinmeng Jia and Tieliu Shi Each year, millions of people around world suffer from the consequence of the misdiagnosis and ineffective treatment of various disease, especially those intractable diseases and rare diseases. Integration of various data related to human diseases help us not only for identifying drug targets, connecting genetic variations of phenotypes and understanding molecular pathways relevant to novel treatment, but also for coupling clinical care and biomedical researches. To this end, we built the Rare disease Annotation & Medicine (RAM) standards-based database which can provide reference to map and extract disease-specified information from multitude of biomedical resources such as free text articles in MEDLINE and Electronic Medical Records (EMRs). RAM integrates disease-specified concepts from ICD-9, ICD-10, SNOMED-CT and MeSH (http://www.nlm.nih.gov/mesh/MBrowser.html) extracted from the Unified Medical Language System (UMLS) based on the UMLS Concept Unique Identifiers for each Disease Term. We also integrated phenotypes from OMIM for each disease term, which link underlying mechanisms and clinical observation. Moreover, we used disease-manifestation (D-M) pairs from existing biomedical ontologies as prior knowledge to automatically recognize D-M-specific syntactic patterns from full text articles in MEDLINE. Considering that most of the record-based disease information in public databases are textual format, we extracted disease terms and their related biomedical descriptive phrases from Online Mendelian Inheritance in Man (OMIM), National Organization for Rare Disorders (NORD) and Orphanet using UMLS Thesaurus.
    [Show full text]
  • Whole Genome Sequencing of Familial Non-Medullary Thyroid Cancer Identifies Germline Alterations in MAPK/ERK and PI3K/AKT Signaling Pathways
    biomolecules Article Whole Genome Sequencing of Familial Non-Medullary Thyroid Cancer Identifies Germline Alterations in MAPK/ERK and PI3K/AKT Signaling Pathways Aayushi Srivastava 1,2,3,4 , Abhishek Kumar 1,5,6 , Sara Giangiobbe 1, Elena Bonora 7, Kari Hemminki 1, Asta Försti 1,2,3 and Obul Reddy Bandapalli 1,2,3,* 1 Division of Molecular Genetic Epidemiology, German Cancer Research Center (DKFZ), D-69120 Heidelberg, Germany; [email protected] (A.S.); [email protected] (A.K.); [email protected] (S.G.); [email protected] (K.H.); [email protected] (A.F.) 2 Hopp Children’s Cancer Center (KiTZ), D-69120 Heidelberg, Germany 3 Division of Pediatric Neurooncology, German Cancer Research Center (DKFZ), German Cancer Consortium (DKTK), D-69120 Heidelberg, Germany 4 Medical Faculty, Heidelberg University, D-69120 Heidelberg, Germany 5 Institute of Bioinformatics, International Technology Park, Bangalore 560066, India 6 Manipal Academy of Higher Education (MAHE), Manipal, Karnataka 576104, India 7 S.Orsola-Malphigi Hospital, Unit of Medical Genetics, 40138 Bologna, Italy; [email protected] * Correspondence: [email protected]; Tel.: +49-6221-42-1709 Received: 29 August 2019; Accepted: 10 October 2019; Published: 13 October 2019 Abstract: Evidence of familial inheritance in non-medullary thyroid cancer (NMTC) has accumulated over the last few decades. However, known variants account for a very small percentage of the genetic burden. Here, we focused on the identification of common pathways and networks enriched in NMTC families to better understand its pathogenesis with the final aim of identifying one novel high/moderate-penetrance germline predisposition variant segregating with the disease in each studied family.
    [Show full text]
  • The Human SKI Complex Prevents DNA-RNA Hybrid-Associated Telomere Instability
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.20.107144; this version posted January 28, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. The human SKI complex prevents DNA-RNA hybrid-associated telomere instability Emilia Herrera-Moyano1,2, Rosa Maria Porreca*1,2, Lepakshi Ranjha*1,2, Eleni Skourti*1,2, Roser Gonzalez-Franco1,2, Ying Sun1,2, Emmanouil Stylianakis1,2, Alex Montoya3, Holger Kramer3 and Jean-Baptiste Vannier1,2# 1: Telomere Replication & Stability group, Medical Research Council London Institute of Medical Sciences, London, United Kingdom. 2: Institute of Clinical Sciences, Faculty of Medicine, Imperial College London, London, United Kingdom. 3: Biological Mass Spectrometry & Proteomics, MRC-LMS, Hammersmith Hospital Campus, London W12 0NN, UK *: equal contribution #: correspondence, requests for materials and Lead Author: [email protected] Short title: hSKI in telomere maintenance Keywords: Telomere, DNA-RNA hybrids, SKIV2L, DNA damage, Genome instability. Abstract Super killer (SKI) complex is a well-known cytoplasmic 3′ to 5′ mRNA decay complex that functions with the exosome to degrade excessive and aberrant mRNAs. Recently, SKIV2L, the 3′ to 5′ RNA helicase of the human SKI (hSKI) complex has been implicated in the degradation of nuclear non-coding RNAs escaping to the cytoplasm. Here, we show that hSKI is present in the nucleus, on chromatin and in particular at telomeres during the G2 cell cycle phase. In cells, SKIV2L prevents telomeric loss, and DNA damage response activation, and its absence leads to DNA-RNA hybrid- mediated telomere fragility.
    [Show full text]
  • Mrna Editing, Processing and Quality Control in Caenorhabditis Elegans
    | WORMBOOK mRNA Editing, Processing and Quality Control in Caenorhabditis elegans Joshua A. Arribere,*,1 Hidehito Kuroyanagi,†,1 and Heather A. Hundley‡,1 *Department of MCD Biology, UC Santa Cruz, California 95064, †Laboratory of Gene Expression, Medical Research Institute, Tokyo Medical and Dental University, Tokyo 113-8510, Japan, and ‡Medical Sciences Program, Indiana University School of Medicine-Bloomington, Indiana 47405 ABSTRACT While DNA serves as the blueprint of life, the distinct functions of each cell are determined by the dynamic expression of genes from the static genome. The amount and specific sequences of RNAs expressed in a given cell involves a number of regulated processes including RNA synthesis (transcription), processing, splicing, modification, polyadenylation, stability, translation, and degradation. As errors during mRNA production can create gene products that are deleterious to the organism, quality control mechanisms exist to survey and remove errors in mRNA expression and processing. Here, we will provide an overview of mRNA processing and quality control mechanisms that occur in Caenorhabditis elegans, with a focus on those that occur on protein-coding genes after transcription initiation. In addition, we will describe the genetic and technical approaches that have allowed studies in C. elegans to reveal important mechanistic insight into these processes. KEYWORDS Caenorhabditis elegans; splicing; RNA editing; RNA modification; polyadenylation; quality control; WormBook TABLE OF CONTENTS Abstract 531 RNA Editing and Modification 533 Adenosine-to-inosine RNA editing 533 The C. elegans A-to-I editing machinery 534 RNA editing in space and time 535 ADARs regulate the levels and fates of endogenous dsRNA 537 Are other modifications present in C.
    [Show full text]