DOCSLIB.ORG

Identification and Functional Characterization of Novel Genes Implicated in Congenital Myopathies Xavière Lornage

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identification and Functional Characterization of Novel Genes Implicated in Congenital Myopathies Xavière Lornage Identification and functional characterization of novel genes implicated in congenital myopathies Xavière Lornage To cite this version: Xavière Lornage. Identification and functional characterization of novel genes implicated in congenital myopathies. Rhumatology and musculoskeletal system. Université de Strasbourg, 2019. English. NNT : 2019STRAJ067. tel-02900858 HAL Id: tel-02900858 https://tel.archives-ouvertes.fr/tel-02900858 Submitted on 16 Jul 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. UNIVERSITÉ DE STRASBOURG ÉCOLE DOCTORALE DES SCIENCES DE LA VIE ET DE LA SANTE (ED 414) IGBMC, INSERM, UNIVERSITE DE STRASBOURG THÈSE Présentée par : Xavière LORNAGE Soutenue le 13 Septembre 2019 En vue d’obtenir le grade de : Docteur de l’Université de Strasbourg Discipline : Aspects moléculaires et cellulaires de la biologie Identification and functional characterization of novel genes implicated in congenital myopathies THÈSE dirigée par : Mme Valérie BIANCALANA MCU-PH, Université de Strasbourg, IGBMC RAPPORTEURS : M. Helge AMTHOR PU-PH, Université Versailles Saint-Quentin-en-Yvelines Mme Catherine COIRAULT DR INSERM, Institut de Myologie AUTRES MEMBRES DU JURY : Mme Amélie PITON MCU-PH, Université de Strasbourg, IGBMC MEMBRES INVITES : M. Jocelyn Laporte DR INSERM, Université de Strasbourg, IGBMC M. Johann Böhm CR INSERM, Université de Strasbourg IGBMC ACKNOWLEDGEMENTS I would like to thank Catherine Coirault, Helge Amthor, and Amélie Piton for accepting to be part of the jury, and to read and evaluate my work. I am very grateful to Jocelyn Laporte, Johann Böhm, and Valérie Biancalana for giving me the chance to work in their team. By sharing your advice and knowledge, you helped me a lot to become closer to the scientist I want to be. I would like to express my gratitude to all the collaborators for this work, and especially to Norma Romero for sharing her very inspiring knowledge and her enthusiasm. I am also very grateful to all present and former MAD team members. Thanks a lot for the dynamic, friendly, and positive atmosphere, the discussions, the outings, and the friendships! Valentina, Raphaël, Kirsley, thanks a lot for your significant technical assistance. Special thanks to Elodie, Inès, Mégane and Laurine, it was a pleasure to supervise your work and discuss all your exciting results! Johann, danke für deinen Geduld, besonders bei den Korrekturen. Dank Dir habe ich viele Wissenschaftler, Ärzte, und auch Patienten kennengelernt! This work was made much easier thanks to all people from the molecular biology, microscopy, and antibody production platforms, and from the animal and cell culture facilities. Thanks to all of you! Papa et maman, merci beaucoup de m’avoir toujours encouragée à tenter ce que je considérais impossible. 1 TABLE OF CONTENT 1 INTRODUCTION ................................................................................................................... 6 1.1 The congenital myopathies ....................................................................................... 7 1.1.1 Normal and abnormal skeletal muscle function and structure .................................. 7 1.1.2 The classification of congenital myopathies ........................................................... 11 1.2 Diagnosis of congenital myopathies ....................................................................... 17 1.2.1 DNA sequencing in diagnostic laboratories ............................................................ 17 1.2.2 Rationale .................................................................................................................. 19 1.2.3 The MYOCAPTURE project .................................................................................. 19 1.2.4 Aims of the project .................................................................................................. 21 2 RESULTS .............................................................................................................................. 22 2.1 Mutations in known myopathy genes in patients with classical phenotypes ..... 22 2.1.1 Publication 1: Loss of sarcomeric scaffolding as a common baseline histopathologic lesion in titin-related myopathies (Avila-Polo et al. 2018) ................................................... 23 2.1.2 Publication 2: Common and variable clinical, histological, and imaging findings of recessive RYR1-related centronuclear myopathy patients (Abath Neto et al. 2017) ............. 25 2.2 Mutations in known myopathy genes with new phenotypes ............................... 27 2.2.1 Publication 3: Novel SPEG mutations in congenital myopathy without centralized nuclei (Lornage et al. 2018) .................................................................................................. 28 2.2.2 Publication 4: HSPB8 haploinsufficiency causes dominant adult-onset axial and distal myopathy (Echaniz-Laguna et al. 2017) ...................................................................... 30 2.2.3 Publication 5: Expanding the spectrum of congenital myopathy linked to recessive mutations in SCN4A (Mercier et al. 2017) ........................................................................... 32 2.2.4 Publication 6: CASQ1 mutations impair calsequestrin polymerization and cause tubular aggregate myopathy (Bohm et al. 2018) ................................................................... 33 2.2.5 Publication 7: HNRNPDL-related muscular dystrophy: expanding the clinical, morphological and MRI phenotypes (Berardo et al. 2019) ................................................... 35 2 2.2.6 Publication 8: Dihydropyridine receptor (DHPR, CACNA1S) congenital myopathy (Schartner et al. 2017) ........................................................................................................... 36 2.2.7 Publication 9: Affected female carriers of MTM1 mutations display a wide spectrum of clinical and pathological involvement: delineating diagnostic clues (Biancalana et al. 2017) 38 2.2.8 Publication 10: Sarcomeric disorganization and nemaline bodies in muscle biopsies of patients with EXOSC3-related type 1 pontocerebellar hypoplasia (Pinto et al. 2018) ..... 40 2.2.9 Publication 11: Discordant manifestations in Italian brothers with GNE myopathy (Dotti et al. 2018) .................................................................................................................. 41 2.3 Mutations in novel genes......................................................................................... 42 2.3.1 Publication 12: Recessive MYPN mutations cause cap myopathy with occasional nemaline rods (Lornage et al. 2017) ...................................................................................... 43 2.3.2 Publication 13: ACTN2 mutations cause “Multiple structured Core Disease” (MsCD) (Lornage et al. 2019) ............................................................................................... 45 2.3.3 Investigation of the pathogenicity of the ACTN2 c.302A>G p.(Asn101Ser) mutation 47 DISCUSSION ............................................................................................................................... 58 2.4 MYPN and ACTN2 – two novel congenital myopathy genes ............................... 58 2.4.1 MYPN mutations in human disease ......................................................................... 58 2.4.2 ACTN2 mutations in human disease ........................................................................ 63 2.4.3 ACTN2- and MYPN-related myopathies: conclusion .............................................. 69 2.5 MYOCAPTURE: contributions and future prospects ........................................ 70 2.5.1 Global analysis of the MYOCAPTURE project ..................................................... 70 2.5.2 Significance of the MYOCAPTURE project .......................................................... 72 2.5.3 Future prospects: identification of the missing myopathy genes ............................ 73 3 FRENCH SUMMARY ......................................................................................................... 81 4 REFERENCES ...................................................................................................................... 86 3 LIST OF FIGURES AND TABLES Table I1: Main clinical features of NMDs with primary muscle involvement ............................... 6 Fig I1: Overall skeletal muscle organization ................................................................................... 7 Fig I2: Overall sarcomere organization ........................................................................................... 8 Table I2: Properties of type 1 and type 2 muscle fibers ................................................................ 10 Fig I4: Type 1 fiber predominance in a patient with congenital myopathy .................................. 11 Fig I5: Histological anomalies of CNM patients .......................................................................... 12 Fig I6: Histological and ultrastructural characteristics of nemaline rods
Load more

Recommended publications
  • FLNC Missense Variants in Familial Noncompaction Cardiomyopathy
    Cardiogenetics 2019; volume 9:8181 FLNC missense variants than 2 according to current echocardio- in familial noncompaction graphic criteria, or 2.3 on CMR.1,2 Correspondence: Jaap I. van Waning, Approximately 10% of patients diagnosed Department of Clinical Genetics, EE 2038, cardiomyopathy with NCCM have concurrent congenital Erasmus MC, POB 2040, 3000CA Rotterdam, heart defects (CHD).3,4 the Netherlands. Tel.: +3107038388 - Fax: +3107043072. Jaap I. van Waning,1 In 30-40% of cases diagnosed with E-mail: [email protected] Yvonne M. Hoedemaekers,2 NCCM a pathogenic variant can be identi- 2,3 4 Wouter P. te Rijdt, Arne I. Jpma, fied. Around 80% of these pathogenic vari- Acknowledgements: JVW was supported by a Daphne Heijsman,4 Kadir Caliskan,5 ants involve the same sarcomere genes, that grant from the Jaap Schouten Foundation. Elke S. Hoendermis,6 are the major causes for hypertrophic car- WPTR was supported by a Young Talent Program (CVON PREDICT) grant 2017T001 Tineke P. Willems,7 diomyopathy (HCM) and dilated cardiomy- - Dutch Heart Foundation. 8 opathy (DCM), in particular MYH7, Arthur van den Wijngaard, 5,6 3 MYBPC3 and TTN. Filamin C (FLNC) Albert Suurmeijer, Conflict of interest: the authors declare no plays a central role in muscle functioning Marjon A. van Slegtenhorst,1 potential conflict of interest. by maintaining the structural integrity of the Jan D.H. Jongbloed,2 muscle fibers. Pathogenic variants in FLNC Received for publication: 20 March 2019. Danielle F. Majoor-Krakauer,1 2 were found to be associated with a wide Revision received: 29 July 2019. Paul A.
    [Show full text]
  • RNA Sequencing Reveals a Slow to Fast Muscle Fiber Type Transition After Olanzapine Infusion in Rats
    RESEARCH ARTICLE RNA Sequencing Reveals a Slow to Fast Muscle Fiber Type Transition after Olanzapine Infusion in Rats Christopher J. Lynch1*, Yuping Xu1, Andras Hajnal2, Anna C. Salzberg3, Yuka Imamura Kawasawa4,5,6 1 Department of Cellular and Molecular Physiology, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 2 Department of Neural and Behavioral Sciences, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 3 Department a11111 of Public Health Sciences, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 4 Department of Pharmacology, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 5 Department of Biochemistry and Molecular Biology, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 6 The Institute for Personalized Medicine, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America * [email protected] OPEN ACCESS Citation: Lynch CJ, Xu Y, Hajnal A, Salzberg AC, Kawasawa YI (2015) RNA Sequencing Reveals a Abstract Slow to Fast Muscle Fiber Type Transition after Olanzapine Infusion in Rats. PLoS ONE 10(4): Second generation antipsychotics (SGAs), like olanzapine, exhibit acute metabolic side ef- e0123966. doi:10.1371/journal.pone.0123966 fects leading to metabolic inflexibility, hyperglycemia, adiposity and diabetes. Understand- Academic Editor: Guillermo López Lluch, ing how SGAs affect the skeletal muscle transcriptome could elucidate approaches for Universidad Pablo de Olavide, Centro Andaluz de mitigating these side effects. Male Sprague-Dawley rats were infused intravenously with ve- Biología del Desarrollo-CSIC, SPAIN hicle or olanzapine for 24h using a dose leading to a mild hyperglycemia.
    [Show full text]
  • Diseasespecific and Inflammationindependent Stromal
    Full Length Arthritis & Rheumatism DOI 10.1002/art.37704 Disease-specific and inflammation-independent stromal alterations in spondyloarthritis synovitis Nataliya Yeremenko1,2, Troy Noordenbos1,2, Tineke Cantaert1,3, Melissa van Tok1,2, Marleen van de Sande1, Juan D. Cañete4, Paul P. Tak1,5*, Dominique Baeten1,2 1Department of Clinical Immunology and Rheumatology and 2Department of Experimental Immunology, Academic Medical Center/University of Amsterdam, the Netherlands. 3Department of Immunobiology, Yale University School of Medicine, New Haven, CT, USA. 4Department of Rheumatology, Hospital Clinic de Barcelona and IDIBAPS, Spain. 5Arthrogen B.V., Amsterdam, the Netherlands. *Currently also: GlaxoSmithKline, Stevenage, U.K. Corresponding author: Dominique Baeten, MD, PhD, Department of Clinical Immunology and Rheumatology, F4-105, Academic Medical Center/University of Amsterdam, Meibergdreef 9, 1105 AZ Amsterdam, The Netherlands. E-mail: [email protected] This article has been accepted for publication and undergone full peer review but has not been through the copyediting, typesetting, pagination and proofreading process which may lead to differences between this version and the Version of Record. Please cite this article as an ‘Accepted Article’, doi: 10.1002/art.37704 © 2012 American College of Rheumatology Received: Apr 11, 2012; Revised: Jul 25, 2012; Accepted: Sep 06, 2012 Arthritis & Rheumatism Page 2 of 36 Abstract Objective: The molecular processes driving the distinct patterns of synovial inflammation and tissue remodelling in spondyloarthritis (SpA) versus rheumatoid arthritis (RA) remain largely unknown. Therefore, we aimed to identify novel and unsuspected disease- specific pathways in SpA by a systematic and unbiased synovial gene expression analysis. Methods: Differentially expressed genes were identified by pan-genomic microarray and confirmed by quantitative PCR and immunohistochemistry using synovial tissue biopsies of SpA (n=63), RA (n=28) and gout (n=9) patients.
    [Show full text]
  • PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41
    American Society of Human Genetics 62nd Annual Meeting November 6–10, 2012 San Francisco, California PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41. Genes Underlying Neurological Disease Room 134 #196–#204 2. 4:30–6:30pm: Plenary Abstract 42. Cancer Genetics III: Common Presentations Hall D #1–#6 Variants Ballroom 104 #205–#213 43. Genetics of Craniofacial and Wednesday, November 7 Musculoskeletal Disorders Room 124 #214–#222 10:30am–12:45 pm: Concurrent Platform Session A (11–19): 44. Tools for Phenotype Analysis Room 132 #223–#231 11. Genetics of Autism Spectrum 45. Therapy of Genetic Disorders Room 130 #232–#240 Disorders Hall D #7–#15 46. Pharmacogenetics: From Discovery 12. New Methods for Big Data Ballroom 103 #16–#24 to Implementation Room 123 #241–#249 13. Cancer Genetics I: Rare Variants Room 135 #25–#33 14. Quantitation and Measurement of Friday, November 9 Regulatory Oversight by the Cell Room 134 #34–#42 8:00am–10:15am: Concurrent Platform Session D (47–55): 15. New Loci for Obesity, Diabetes, and 47. Structural and Regulatory Genomic Related Traits Ballroom 104 #43–#51 Variation Hall D #250–#258 16. Neuromuscular Disease and 48. Neuropsychiatric Disorders Ballroom 103 #259–#267 Deafness Room 124 #52–#60 49. Common Variants, Rare Variants, 17. Chromosomes and Disease Room 132 #61–#69 and Everything in-Between Room 135 #268–#276 18. Prenatal and Perinatal Genetics Room 130 #70–#78 50. Population Genetics Genome-Wide Room 134 #277–#285 19. Vascular and Congenital Heart 51. Endless Forms Most Beautiful: Disease Room 123 #79–#87 Variant Discovery in Genomic Data Ballroom 104 #286–#294 52.
    [Show full text]
  • The Role of Z-Disc Proteins in Myopathy and Cardiomyopathy
    International Journal of Molecular Sciences Review The Role of Z-disc Proteins in Myopathy and Cardiomyopathy Kirsty Wadmore 1,†, Amar J. Azad 1,† and Katja Gehmlich 1,2,* 1 Institute of Cardiovascular Sciences, College of Medical and Dental Sciences, University of Birmingham, Birmingham B15 2TT, UK; [email protected] (K.W.); [email protected] (A.J.A.) 2 Division of Cardiovascular Medicine, Radcliffe Department of Medicine and British Heart Foundation Centre of Research Excellence Oxford, University of Oxford, Oxford OX3 9DU, UK * Correspondence: [email protected]; Tel.: +44-121-414-8259 † These authors contributed equally. Abstract: The Z-disc acts as a protein-rich structure to tether thin filament in the contractile units, the sarcomeres, of striated muscle cells. Proteins found in the Z-disc are integral for maintaining the architecture of the sarcomere. They also enable it to function as a (bio-mechanical) signalling hub. Numerous proteins interact in the Z-disc to facilitate force transduction and intracellular signalling in both cardiac and skeletal muscle. This review will focus on six key Z-disc proteins: α-actinin 2, filamin C, myopalladin, myotilin, telethonin and Z-disc alternatively spliced PDZ-motif (ZASP), which have all been linked to myopathies and cardiomyopathies. We will summarise pathogenic variants identified in the six genes coding for these proteins and look at their involvement in myopathy and cardiomyopathy. Listing the Minor Allele Frequency (MAF) of these variants in the Genome Aggregation Database (GnomAD) version 3.1 will help to critically re-evaluate pathogenicity based on variant frequency in normal population cohorts.
    [Show full text]
  • Supplementary Materials
    Lists of figures Figure S1: A-B: Principal Component Analysis (PCA) was applied to 3 pairs of SCEC tissues (red) and matched adjacent normal tissues (blue) that were characterized by the gene expression of all probes on Affymetrix HG U133 Plus 2.0 Array. C: Box plot of SCEC group. D: Pearson’s correlation matrix of SCEC group. 17 / 25 Figure S2: MvA plot of SCEC group. Figure S3: Volcano plots of probe sets differing between SCEC and matched normal tissues. Fold change (X axis) is plotted against statistical significance (Y axis) for each probe sets. Genes altered with a fold change ≥2 and FDR <0.01 are depicted in red. Grey represents genes in the arrays that were not found to differ significantly between cancerous samples and matched normal samples. Figure S4: Gene regulatory network plotted by the top 120 DEGs (ranked by FDR) of SCEC groups. 18 / 25 Figure S5: DNA copy number change profiles in 3 pairs of SCEC samples. The CNVs frequency of the whole genome was analyzed by aCGH. Gains were marked in red and losses in bule. Lists of tables Table S1. Primers used in qRT-PCR for microarray gene expression validation Gene Forward Primer (5’-3’) Reverse Primer (5’-3’) Product β-actin AAGGTGACAGCAGTCGGTT TGTGTGGACTTGGGAGAGG 195bp INSM1 GTATTCGCTGTGTTCATGGTC CGCTACATACATAGAGAGCAGAG 79bp ASCL1 AACTCCCATCACCTCTAACA TGAGACGAAAGACACCAACT 120bp NRCAM GATGGCGAAGAATGAAGTT ACAGTGAGGGATAAGGTGTG 141bp NUF2 ATGATGCCAGTGAACTCTGAA GACTTGTCCGTTTTGCTTTTG 160bp 19 / 25 SNAP25 CCTGGATATGGGCAATGAGAT ACACGGGTGGGCACACTTA 146bp PTP4A3 GCTTCCTCATCACCCACAA CCGTACTTCTTCAGGTCCTCA
    [Show full text]
  • A Bootstrap-Based Regression Method for Comprehensive Discovery of Differential Gene Expressions: an Application to the Osteoporosis Study
    A bootstrap-based regression method for comprehensive discovery of differential gene expressions: an application to the osteoporosis study Yan Lu1,2, Yao-Zhong Liu3, Peng–Yuan Liu2, Volodymyr Dvornyk4, and Hong–Wen Deng1,3 1. College of Life Sciences and Bioengineering, Beijing Jiaotong University, Beijing 100044, P. R. China 2. Department of Physiology and the Cancer Center, Medical College of Wisconsin, Milwaukee, WI 53226, USA 3. Department of Biostatistics and Bioinformatics & Center for Bioinformatics and Genomics, Tulane University School of Public Health, New Orleans, LA 70112, USA 4. School of Biological Sciences, University of Hong Kong, Pokfulam Rd., Pokfulam, Hong Kong, P.R. China Running title: Bootstrap-based regression method for microarray analysis Key words: microarray, bootstrap, regression, osteoporosis Corresponding author: Hong–Wen Deng, Ph. D. Department of Biostatistics and Bioinformatics & Center for Bioinformatics and Genomics, Tulane University School of Public Health, 1440 Canal Street, Suite 2001, New Orleans, LA 70112 Tel: 504-988-1310 Email: [email protected] 1 Abstract A common purpose of microarray experiments is to study the variation in gene expression across the categories of an experimental factor such as tissue types and drug treatments. However, it is not uncommon that the studied experimental factor is a quantitative variable rather than categorical variable. Loss of information would occur by comparing gene-expression levels between groups that are factitiously defined according to the quantitative threshold values of an experimental factor. Additionally, lack of control for some sensitive clinical factors may bring serious false positive or negative findings. In the present study, we described a bootstrap-based regression method for analyzing gene expression data from the non-categorical microarray experiments.
    [Show full text]
  • Interpreting Human Genetic Variation with in Vivo Zebrafish Assays Erica E
    Interpreting Human Genetic Variation With In Vivo Zebrafish Assays Erica E. Davis, PhD, Stephan Frangakis, BS, and Nicholas Katsanis, PhD Center for Human Disease Modeling Duke University Medical Center Durham, North Carolina © 20132015 Katsanis Interpreting Human Genetic Variation With In Vivo Zebrafish Assays 11 Introduction bona fide pathogenic mutations alone in the average NOTES Rapid advances and cost erosion in exome and human exome, studies have reported a median of 50– genome analysis of patients with both rare and 150 nonsense mutations, several in homozygosity, common genetic disorders have accelerated gene while the abundance of unique single nucleotide discovery and illuminated fundamental biological variants (SNVs) can be in the low-to-mid 100s mechanisms. The thrill of discovery has been (1000 Genomes Project Consortium et al., 2010). accompanied, however, by the sobering appreciation Importantly, the number of rare and ultra-rare SNVs that human genomes are burdened with a large has continued to increase proportionately to the number of rare and ultra-rare variants, thereby posing number of available exomes and genomes (Tennessen a significant challenge in dissecting both the effect of et al., 2012), indicating that we are unlikely to reach such alleles on protein function and the biological saturation of such alleles soon. These observations relevance of these events to patient pathology. In have generated a significant interpretive problem an effort to develop model systems that are able to for disease gene discovery and for clinical genomics, generate surrogates of human pathologies, a powerful as population-based arguments alone have been suite of tools has been developed in zebrafish, unable to dissect the contribution of the majority of taking advantage of the relatively small (compared these alleles to clinical phenotypes.
    [Show full text]
  • Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations
    Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations by Jelena Perovanovic M.S. in Molecular Biology and Physiology, September 2009, University of Belgrade M.Phil. in Molecular Medicine, August 2013, The George Washington University A Dissertation submitted to The Faculty of The Columbian College of Arts and Sciences of The George Washington University in partial fulfillment of the requirements for the degree of Doctor of Philosophy August 31, 2015 Dissertation directed by Eric P. Hoffman Professor of Integrative Systems Biology The Columbian College of Arts and Sciences of The George Washington University certifies that Jelena Perovanovic has passed the Final Examination for the degree of Doctor of Philosophy as of May 5, 2015. This is the final and approved form of the dissertation. Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations Jelena Perovanovic Dissertation Research Committee: Eric P. Hoffman, Professor of Integrative Systems Biology, Dissertation Director Anamaris Colberg-Poley, Professor of Integrative Systems Biology, Committee Member Robert J. Freishtat, Associate Professor of Pediatrics, Committee Member Vittorio Sartorelli, Senior Investigator, National Institutes of Health, Committee Member ii © Copyright 2015 by Jelena Perovanovic All rights reserved iii Acknowledgments I am deeply indebted to countless individuals for their support and encouragement during the past five years of graduate studies. First and foremost, I would like to express my gratitude to my mentor, Dr. Eric P. Hoffman, for his unwavering support and guidance, and keen attention to my professional development. This Dissertation would not have been possible without the critical input he provided and the engaging environment he created.
    [Show full text]
  • DEAD-Box Helicase 27 Enhances Stem Cell-Like Properties with Poor Prognosis in Breast Cancer
    DEAD-Box Helicase 27 Enhances Stem Cell-Like Properties With Poor Prognosis in Breast Cancer Shan Li The First Aliated Hospital of China Medical University Jinfei Ma The First Aliated Hospital of China Medical University Ang Zheng The First Aliated Hospital of China Medical University Xinyue Song China Medical University Si Chen China Medical University Feng Jin ( [email protected] ) The First Aliated Hospital of China Medical University https://orcid.org/0000-0002-0325-5362 Research Article Keywords: DEAD-box helicase 27 (DDX27), Breast cancer, Stem cell-like properties, Prognosis Posted Date: June 7th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-521379/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published at Journal of Translational Medicine on August 6th, 2021. See the published version at https://doi.org/10.1186/s12967-021-03011-0. Page 1/22 Abstract Background Although the rapid development of diagnosis and treatment has improved prognosis in early breast cancer, challenges from different therapy response remain due to breast cancer heterogeneity. DEAD-box helicase 27 (DDX27) had been proved to inuence ribosome biogenesis and identied as a promoter in gastric and colorectal cancer associated with stem cell-like properties, while the impact of DDX27 on breast cancer prognosis and biological functions is unclear. We aimed to explore the inuence of DDX27 on stem cell-like properties and prognosis in breast cancer. Methods The expression of DDX27 was evaluated in 24 pairs of fresh breast cancer and normal tissue by western blot.
    [Show full text]
  • The Fission Yeast Non-Coding Transcriptome
    The Fission Yeast Non-Coding Transcriptome Sophie Radha Atkinson A thesis submitted for the degree of Doctor of Philosophy University College London September 2014 1 Declaration I, Sophie Radha Atkinson, confirm that the work presented in this thesis is my own. Where information has been derived from other sources, I confirm that this has been indicated in the thesis. 2 Abstract Long non-coding RNAs (lncRNAs) are emerging as important regulators of gene expression, although it remains unclear to what extent they contribute overall to the information flow from genotype to phenotype. Using strand-specific RNA- sequencing, I identify thousands of novel unstable, or cryptic, lncRNAs in Schizosaccharomyces pombe. The nuclear exosome, the RNAi pathway and the cytoplasmic exonuclease Exo2 represent three key pathways regulating lncRNAs in S. pombe, defining the overlapping classes of CUTs, RUTs and XUTs, respectively. The nuclear exosome and the RNAi pathway act cooperatively to control nuclear lncRNA expression, while the cytoplasmic Exo2 pathway is more distinct. Impairing both the nuclear exosome and the cytoplasmic exonuclease Exo2 is lethal in S. pombe. Importantly, I show that CUTs, RUTs and XUTs are stabilised under physiologically relevant growth conditions, with three key groups emerging: late meiotic RUTs/XUTs, early meiotic CUTs and quiescent CUTs. Late meiotic RUTs/XUTs tend to be antisense to protein-coding genes, and anti-correlate in expression with their sense loci. In contrast, early meiotic and quiescent CUTs tend to be transcribed divergently from protein-coding genes and positively correlate in expression with their mRNA partners. The current study provides an in-depth survey of the lncRNA repertoire of S.
    [Show full text]
  • Literature Mining Sustains and Enhances Knowledge Discovery from Omic Studies
    LITERATURE MINING SUSTAINS AND ENHANCES KNOWLEDGE DISCOVERY FROM OMIC STUDIES by Rick Matthew Jordan B.S. Biology, University of Pittsburgh, 1996 M.S. Molecular Biology/Biotechnology, East Carolina University, 2001 M.S. Biomedical Informatics, University of Pittsburgh, 2005 Submitted to the Graduate Faculty of School of Medicine in partial fulfillment of the requirements for the degree of Doctor of Philosophy University of Pittsburgh 2016 UNIVERSITY OF PITTSBURGH SCHOOL OF MEDICINE This dissertation was presented by Rick Matthew Jordan It was defended on December 2, 2015 and approved by Shyam Visweswaran, M.D., Ph.D., Associate Professor Rebecca Jacobson, M.D., M.S., Professor Songjian Lu, Ph.D., Assistant Professor Dissertation Advisor: Vanathi Gopalakrishnan, Ph.D., Associate Professor ii Copyright © by Rick Matthew Jordan 2016 iii LITERATURE MINING SUSTAINS AND ENHANCES KNOWLEDGE DISCOVERY FROM OMIC STUDIES Rick Matthew Jordan, M.S. University of Pittsburgh, 2016 Genomic, proteomic and other experimentally generated data from studies of biological systems aiming to discover disease biomarkers are currently analyzed without sufficient supporting evidence from the literature due to complexities associated with automated processing. Extracting prior knowledge about markers associated with biological sample types and disease states from the literature is tedious, and little research has been performed to understand how to use this knowledge to inform the generation of classification models from ‘omic’ data. Using pathway analysis methods to better understand the underlying biology of complex diseases such as breast and lung cancers is state-of-the-art. However, the problem of how to combine literature- mining evidence with pathway analysis evidence is an open problem in biomedical informatics research.
    [Show full text]