DOCSLIB.ORG

FLNC Missense Variants in Familial Noncompaction Cardiomyopathy

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
FLNC Missense Variants in Familial Noncompaction Cardiomyopathy Cardiogenetics 2019; volume 9:8181 FLNC missense variants than 2 according to current echocardio- in familial noncompaction graphic criteria, or 2.3 on CMR.1,2 Correspondence: Jaap I. van Waning, Approximately 10% of patients diagnosed Department of Clinical Genetics, EE 2038, cardiomyopathy with NCCM have concurrent congenital Erasmus MC, POB 2040, 3000CA Rotterdam, heart defects (CHD).3,4 the Netherlands. Tel.: +3107038388 - Fax: +3107043072. Jaap I. van Waning,1 In 30-40% of cases diagnosed with E-mail: [email protected] Yvonne M. Hoedemaekers,2 NCCM a pathogenic variant can be identi- 2,3 4 Wouter P. te Rijdt, Arne I. Jpma, fied. Around 80% of these pathogenic vari- Acknowledgements: JVW was supported by a Daphne Heijsman,4 Kadir Caliskan,5 ants involve the same sarcomere genes, that grant from the Jaap Schouten Foundation. Elke S. Hoendermis,6 are the major causes for hypertrophic car- WPTR was supported by a Young Talent Program (CVON PREDICT) grant 2017T001 Tineke P. Willems,7 diomyopathy (HCM) and dilated cardiomy- - Dutch Heart Foundation. 8 opathy (DCM), in particular MYH7, Arthur van den Wijngaard, 5,6 3 MYBPC3 and TTN. Filamin C (FLNC) Albert Suurmeijer, Conflict of interest: the authors declare no plays a central role in muscle functioning Marjon A. van Slegtenhorst,1 potential conflict of interest. by maintaining the structural integrity of the Jan D.H. Jongbloed,2 muscle fibers. Pathogenic variants in FLNC Received for publication: 20 March 2019. Danielle F. Majoor-Krakauer,1 2 were found to be associated with a wide Revision received: 29 July 2019. Paul A. van der Zwaag spectrum of myopathies ranging from car- Accepted for publication: 17 September 2019. 1Department of Clinical Genetics, diomyopathies to distal skeletal Erasmus Medical Center, Rotterdam; myopathies. Truncating FLNC variants This work is licensed under a Creative Commons Attribution NonCommercial 4.0 2Department of Genetics, University of were previously associated with dilated car- 7-9 License (CC BY-NC 4.0). Groningen, University Medical Center diomyopathy and missense variants were Groningen, Groningen; 3Department of identified in familial HCM and restrictive ©Copyright: the Author(s), 2019 Pathology, University of Groningen, cardiomyopathy. FLNC has not been associ- Licensee PAGEPress, Italy University Medical Center Groningen, ated with NCCM or CHD before. onlyCardiogenetics 2019; 9:8181 4 We present two Dutch families where doi:10.4081/cardiogenetics.2019.8181 Groningen; Department of Pathology, familial NCCM with CHD were linked to Erasmus Medical Center, Rotterdam; rare FLNC missense variants. These obser- 5Department of Cardiology, Erasmus vations suggest that the spectrum of clinical Medical Center, Rotterdam; use 6 manifestations of FLNC variants include the anterior mitral valve leaflet (Figure 2A Department of Cardiology, University familial NCCM with CHD. and B). The noncompaction had not been of Groningen, University Medical recognized in the past on echocardiography. Center Groningen, Groningen; Cardiologic screening of an asymptomatic 7 Department of Radiology, University of brother (II:4) at age 54 years showed that he Groningen, University Medical Center Case Reports also had NCCM; with a NC/C ratio of 2.3 Groningen, Groningen; 8Department of on echocardiography and a ratio of 2.9 on Clinical Genetics, Maastricht University Family A CMR. No previous cardiac imaging had Medical Center, Maastricht, the In this family (Figure 1A), a 52-year- been performed. He had elevated CK-levels Netherlands old woman (II:3) was first diagnosed with of 265 U/L without neuromuscular signs. NCCM when she underwent cardiologic Ten years after the diagnosis NCCM he had examination for a suspected perimyocardi- an episode of atrial fibrillation that required tis. Echocardiography showed pericardial electric cardioversion. CMR from the broth- Abstract effusion and normal LV dimensions without er (II:1) and the son (III:1) of the proband LV dysfunction. The LV walls showed were performed at age 57 and 15 years, The majority of familial noncompaction hypertrabeculation with end-systolic non- respectively, showing borderline NC/C cardiomyopathy (NCCM) is explained by compacted/compacted (NC/C) ratio >2. ratios of respectively 2.1 and 2.2 on MRI, pathogenic variants in the sameNon-commercial sarcomeric Electrocardiographically, inferolateral repo- i.e. just below the diagnostic criteria. genes that are associated with hypertrophic larization abnormalities were observed. Proband III-2 did not participate in the fam- (HCM) and dilated (DCM) cardiomyopa- Cardiac magnetic resonance imaging ily screening. thy. Pathogenic variants in the filamin C (CMR) confirmed the diagnosis of NCCM gene (FLNC) have been linked to HCM and with diastolic NC/C ratio >2.3 in the LV Family B DCM. We expand the spectrum of FLNC inferoseptal wall. She had elevated CK lev- In family B (Figure 1B) the diagnosis related cardiomyopathies by presenting two els of 1234 U/L [ref <200U/l]. No signs for NCCM in a 17-year-old boy (III:1) was families with likely pathogenic FLNC vari- neuromuscular disease were detected at made by echocardiography. He was referred ants showing familial segregation of neurologic examination. After seven years because of multiple unexplained episodes NCCM and concurrent coarctation of the of follow-up, she remained cardiologically of syncope. He also had a ventricular septal aorta and/or mitral valve abnormalities. asymptomatic (NYHA class I). defect (VSD) and a mild mitral valve pro- Family screening revealed NCCM in lapse (MVP). CMR revealed partial LV two relatives. A niece (III:3), was diagnosed noncompaction from the apex to midven- Introduction with NCCM at age 21 and had surgery at tricular region with an NC/C ratio of 3.0 Noncompaction cardiomyopathy age seven for coarctation of the aorta (Figure 2C and D). An implantable car- (NCCM) is characterized by excessive tra- (CoA). She fulfilled both the echocardiog- dioverter-defibrillator (ICD) was implanted. beculation of the left ventricle (LV) with a raphy and CMR diagnostic criteria for After 9 years of follow-up, the LV function noncompacted to compacted ratio of more NCCM and had excessive long chordae of remained normal without ICD shocks. CK- [Cardiogenetics 2019; 9:8181] [page 9] Article levels were elevated (419-1188 U/L) in the Segregating synonymous variants and vari- family B (III:1) were stained with hema- absence of neuromuscular signs. His mother ants predicted to be tolerated were exclud- toxylin and eosin as well as Masson’s (II:2) was under cardiologic surveillance ed. In Family A, two candidate genes trichrome. To visualize protein aggregation because she had a VSD, MVP, CoA and a remained after filtering, MYH4 and FLNC, and autophagic activity in cardiomyocytes, bicuspid aortic valve. The CMR showed of which only the last was previously asso- immunohistochemistry for microtubule- that she complied for the diagnostic criteria ciated with cardiomyopathy. A variant in associated protein 1A/1B-light chain 3 for NCCM with a NC/C ratio of 2.4. She FLNC (c.6397C>T, p.(Arg2133Cys), (LC3) was performed, as described previ- had diastolic LV dysfunction, with pre- NM_001458.4, confirmed by sanger ously.16 Light microscopic analysis showed served LV systolic function and underwent sequencing) segregated with the cardiac nonspecific cardiomyopathic changes of multiple cardiac ablations for atrial fibrilla- phenotype of NCCM in the three NCCM myocyte hypertrophy and increased intersti- tion. At age 44 years she experienced severe patients and in the two relatives with bor- tial fibrosis (Figure 3A). The RV did not bradycardia, which necessitated cardiac derline NCCM features. A variant in the show an excessively thickened endocardial resuscitation, resulting from combined fle- same location (p.(Arg2133His)) was previ- layer or hypertrabeculation, or intracellular cainide and metoprolol treatment. A pace- ously reported in a family with HCM and aggregates or autophagic activity (Figure maker was implanted. Her highest CK-level classified as probably pathogenic.15 In fam- 3B). was 1174 U/L. The proband’s brother (III:2) ily B, a novel FLNC variant (c.7177C>T, also suffered multiple episodes of syncope p.(Pro2393Ser)) was identified. The two and was diagnosed with NCCM at age 19, FLNC variants were absent in the Genome with a NC/C ratio of 3.1 on CMR. His high- Aggregation Database (http://gnomad. Discussion and conclusions est CK-level was 294U/l. Proband III-3 was broadinstitute.org), affect highly conserved This is the first report linking FLNC to screened cardiologically and had no signs amino acids, and were predicted to be dele- NCCM in two families with rare FLNC of NCCM on echocardiography. No DNA terious by multiple in silico prediction pro- variants. In these two families the cardiac analysis was performed. grams. No FLNC variants were found in thirteen unrelated NCCM patients without a phenotype included NCCM, NCCM with Genetic testing CHD and without a pathogenic variant in 48 concurrentonly CoA, NCCM with concurrent Diagnostic DNA NGS targeted testing cardiomyopathy genes. VSD and MPV and also a NCCM patient of a panel of 54 cardiomyopathy genes, that with a complex CHD consisting of VSD, did not include FLNC, as presented in Table Histology MVP, CoA and bicuspid aortic valve, and 1, did not reveal a genetic causes for NCCM Right ventricular endomyocardial biop- myocardial dysfunction. These observations in the two index cases. Also single- sy (RVEMB) samples from the probanduse of suggest that missense FLNC variants may nucleotide polymorphism-array DNA test- ing showed no structural DNA changes. Subsequently, whole exome sequencing was performed in the NCCM patients II:1, III:1 and III:3 from family A and III:1, III:2, and II:2 from family B. Patients II-2 from family B was included because we suspect- ed that a causative mutation may underlie a spectrum of cardiac phenotypes. Written informed consent was obtained from all par- ticipating family members. The investiga- tion conforms to the principles outlined in the Declaration of Helsinki.
Load more

Recommended publications
  • RNA Sequencing Reveals a Slow to Fast Muscle Fiber Type Transition After Olanzapine Infusion in Rats
    RESEARCH ARTICLE RNA Sequencing Reveals a Slow to Fast Muscle Fiber Type Transition after Olanzapine Infusion in Rats Christopher J. Lynch1*, Yuping Xu1, Andras Hajnal2, Anna C. Salzberg3, Yuka Imamura Kawasawa4,5,6 1 Department of Cellular and Molecular Physiology, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 2 Department of Neural and Behavioral Sciences, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 3 Department a11111 of Public Health Sciences, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 4 Department of Pharmacology, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 5 Department of Biochemistry and Molecular Biology, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America, 6 The Institute for Personalized Medicine, College of Medicine, Penn State University, Hershey, Pennsylvania, 17033, United States of America * [email protected] OPEN ACCESS Citation: Lynch CJ, Xu Y, Hajnal A, Salzberg AC, Kawasawa YI (2015) RNA Sequencing Reveals a Abstract Slow to Fast Muscle Fiber Type Transition after Olanzapine Infusion in Rats. PLoS ONE 10(4): Second generation antipsychotics (SGAs), like olanzapine, exhibit acute metabolic side ef- e0123966. doi:10.1371/journal.pone.0123966 fects leading to metabolic inflexibility, hyperglycemia, adiposity and diabetes. Understand- Academic Editor: Guillermo López Lluch, ing how SGAs affect the skeletal muscle transcriptome could elucidate approaches for Universidad Pablo de Olavide, Centro Andaluz de mitigating these side effects. Male Sprague-Dawley rats were infused intravenously with ve- Biología del Desarrollo-CSIC, SPAIN hicle or olanzapine for 24h using a dose leading to a mild hyperglycemia.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • The Cytoskeleton in Cell-Autonomous Immunity: Structural Determinants of Host Defence
    Mostowy & Shenoy, Nat Rev Immunol, doi:10.1038/nri3877 The cytoskeleton in cell-autonomous immunity: structural determinants of host defence Serge Mostowy and Avinash R. Shenoy Medical Research Council Centre of Molecular Bacteriology and Infection (CMBI), Imperial College London, Armstrong Road, London SW7 2AZ, UK. e‑mails: [email protected] ; [email protected] doi:10.1038/nri3877 Published online 21 August 2015 Abstract Host cells use antimicrobial proteins, pathogen-restrictive compartmentalization and cell death in their defence against intracellular pathogens. Recent work has revealed that four components of the cytoskeleton — actin, microtubules, intermediate filaments and septins, which are well known for their roles in cell division, shape and movement — have important functions in innate immunity and cellular self-defence. Investigations using cellular and animal models have shown that these cytoskeletal proteins are crucial for sensing bacteria and for mobilizing effector mechanisms to eliminate them. In this Review, we highlight the emerging roles of the cytoskeleton as a structural determinant of cell-autonomous host defence. 1 Mostowy & Shenoy, Nat Rev Immunol, doi:10.1038/nri3877 Cell-autonomous immunity, which is defined as the ability of a host cell to eliminate an invasive infectious agent, is a first line of defence against microbial pathogens 1 . It relies on antimicrobial proteins, specialized degradative compartments and programmed host cell death 1–3 . Cell- autonomous immunity is mediated by tiered innate immune signalling networks that sense microbial pathogens and stimulate downstream pathogen elimination programmes. Recent studies on host– microorganism interactions show that components of the host cell cytoskeleton are integral to the detection of bacterial pathogens as well as to the mobilization of antibacterial responses (FIG.
    [Show full text]
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • Genetic Mutations and Mechanisms in Dilated Cardiomyopathy
    Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, … , Jessica R. Golbus, Megan J. Puckelwartz J Clin Invest. 2013;123(1):19-26. https://doi.org/10.1172/JCI62862. Review Series Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of congestive heart failure. In hypertrophic cardiomyopathy (HCM), cardiac output is limited by the thickened myocardium through impaired filling and outflow. Mutations in the genes encoding the thick filament components myosin heavy chain and myosin binding protein C (MYH7 and MYBPC3) together explain 75% of inherited HCMs, leading to the observation that HCM is a disease of the sarcomere. Many mutations are “private” or rare variants, often unique to families. In contrast, dilated cardiomyopathy (DCM) is far more genetically heterogeneous, with mutations in genes encoding cytoskeletal, nucleoskeletal, mitochondrial, and calcium-handling proteins. DCM is characterized by enlarged ventricular dimensions and impaired systolic and diastolic function. Private mutations account for most DCMs, with few hotspots or recurring mutations. More than 50 single genes are linked to inherited DCM, including many genes that also link to HCM. Relatively few clinical clues guide the diagnosis of inherited DCM, but emerging evidence supports the use of genetic testing to identify those patients at risk for faster disease progression, congestive heart failure, and arrhythmia. Find the latest version: https://jci.me/62862/pdf Review series Genetic mutations and mechanisms in dilated cardiomyopathy Elizabeth M. McNally, Jessica R. Golbus, and Megan J. Puckelwartz Department of Human Genetics, University of Chicago, Chicago, Illinois, USA. Genetic mutations account for a significant percentage of cardiomyopathies, which are a leading cause of conges- tive heart failure.
    [Show full text]
  • Defining Functional Interactions During Biogenesis of Epithelial Junctions
    ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK.
    [Show full text]
  • Communication Pathways in Human Nonmuscle Myosin-2C 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Authors: 25 Krishna Chinthalapudia,B,C,1, Sarah M
    1 Mechanistic Insights into the Active Site and Allosteric 2 Communication Pathways in Human Nonmuscle Myosin-2C 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Authors: 25 Krishna Chinthalapudia,b,c,1, Sarah M. Heisslera,d,1, Matthias Prellera,e, James R. Sellersd,2, and 26 Dietmar J. Mansteina,b,2 27 28 Author Affiliations 29 aInstitute for Biophysical Chemistry, OE4350 Hannover Medical School, 30625 Hannover, 30 Germany. 31 bDivision for Structural Biochemistry, OE8830, Hannover Medical School, 30625 Hannover, 32 Germany. 33 cCell Adhesion Laboratory, Department of Integrative Structural and Computational Biology, The 34 Scripps Research Institute, Jupiter, Florida 33458, USA. 35 dLaboratory of Molecular Physiology, NHLBI, National Institutes of Health, Bethesda, Maryland 36 20892, USA. 37 eCentre for Structural Systems Biology (CSSB), German Electron Synchrotron (DESY), 22607 38 Hamburg, Germany. 39 1K.C. and S.M.H. contributed equally to this work 40 2To whom correspondence may be addressed: E-mail: [email protected] or 41 [email protected] 42 43 1 44 Abstract 45 Despite a generic, highly conserved motor domain, ATP turnover kinetics and their activation by 46 F-actin vary greatly between myosin-2 isoforms. Here, we present a 2.25 Å crystal pre- 47 powerstroke state (ADPVO4) structure of the human nonmuscle myosin-2C motor domain, one 48 of the slowest myosins characterized. In combination with integrated mutagenesis, ensemble- 49 solution kinetics, and molecular dynamics simulation approaches, the structure reveals an 50 allosteric communication pathway that connects the distal end of the motor domain with the 51 active site.
    [Show full text]
  • Cardiomyopathy
    UNIVERSITY OF MINNESOTA PHYSICIANS OUTREACH LABS Submit this form along with the appropriate MOLECULAR DIAGNOSTICS (612) 273-8445 Molecular requisition (Molecular Diagnostics or DATE: TIME COLLECTED: PCU/CLINIC: Molecular NGS Oncology). AM PM PATIENT IDENTIFICATION DIAGNOSIS (Dx) / DIAGNOSIS CODES (ICD-9) - OUTPATIENTS ONLY SPECIMEN TYPE: o Blood (1) (2) (3) (4) PLEASE COLLECT 5-10CC IN ACD-A OR EDTA TUBE ORDERING PHYSICIAN NAME AND PHONE NUMBER: Tests can be ordered as a full panel, or by individual gene(s). Please contact the genetic counselor with any questions at 612-624-8948 or by pager at 612-899-3291. _______________________________________________ Test Ordered- EPIC: Next generation sequencing(Next Gen) Sunquest: NGS Brugada syndrome DMD Aortopathy Full panel DNAJC19 SCN5A DSP Full panel GPD1L Cardiomyopathy, familial MYH11 CACNA1C hypertrophic ACTA2 SCN1B Full panel MYLK KCNE3 ANKRD1 FBN2 SCN3B JPH2 SLC2A10 HCN4 PRKAG2 COL5A2 MYH7 COL5A1 MYL2 COL3A1 Cardiomyopathy ACTC1 CBS Cardiomyopathy, dilated CSRP3 SMAD3 Full panel TNNC1 TGFBR1 LDB3 MYH6 TGFBR2 LMNA VCL FBN1 ACTN2 MYOZ2 Arrhythmogenic right ventricular DSG2 PLN dysplasia NEXN CALR3 TNNT2 TNNT2 NEXN Full panel RBM20 TPM1 TGFB3 SCN5A MYBPC3 DSG2 MYH6 TNNI3 DSC2 TNNI3 MYL3 JUP TTN TTN RYR2 BAG3 MYLK2 TMEM43 DES Cardiomyopathy, familial DSP CRYAB EYA4 restrictive PKP2 Full panel Atrial fibrillation LAMA4 MYPN TNNI3 SGCD MYPN TNNT2 Full panel CSRP3 SCN5A MYBPC3 GJA5 TCAP ABCC9 ABCC9 SCN1B PLN SCN2B ACTC1 KCNQ1 MYH7 KCNE2 TMPO NPPA VCL NPPA TPM1 KCNA5 TNNC1 KCNJ2 GATAD1 4/1/2014
    [Show full text]
  • A Rare Missense Mutation in MYH6 Confers High Risk of Coarctation of the Aorta
    bioRxiv preprint doi: https://doi.org/10.1101/180794; this version posted August 29, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. A rare missense mutation in MYH6 confers high risk of coarctation of the aorta Thorsteinn Bjornsson1,12, Rosa B. Thorolfsdottir1,12, Gardar Sveinbjornsson1, Patrick Sulem1, Gudmundur L. Norddahl1, Anna Helgadottir1, Solveig Gretarsdottir1, Audur Magnusdottir1, Ragnar Danielsen2, Emil L. Sigurdsson3,4, Berglind Adalsteinsdottir5,6, Sverrir I. Gunnarsson7, Ingileif Jonsdottir1,6,8, David O. Arnar2,6, Hrodmar Helgason9, Tomas Gudbjartsson6,10, Daniel F. Gudbjartsson1,11, Unnur Thorsteinsdottir1,6, Hilma Holm1, Kari Stefansson1,6 1deCODE genetics/Amgen, Inc., Reykjavik, Iceland. 2Department of Medicine, Landspitali – The National University Hospital of Iceland, Reykjavik, Iceland. 3Department of Family Medicine, University of Iceland, Reykjavik, Iceland. 4Department of Development, Primary Health Care of the Capital Area, Reykjavik, Iceland. 5Department of Cardiology, Haukeland University Hospital, Bergen, Norway 6Faculty of Medicine, University of Iceland, Reykjavik, Iceland. 7Division of Cardiovascular Medicine, Department of Medicine, University of Wisconsin, Madison, WI, USA. 8Department of Immunology, Landspitali – The National University Hospital of Iceland, Reykjavik, Iceland. 9Children's Hospital, Landspitali – The National University Hospital of Iceland, Reykjavik, Iceland. 10Department of Cardiothoracic Surgery, Landspitali – The National University Hospital of Iceland, Reykjavik, Iceland. 11School of Engineering and Natural Sciences, University of Iceland, Reykjavik, Iceland. 12These authors contributed equally to this work. 1 bioRxiv preprint doi: https://doi.org/10.1101/180794; this version posted August 29, 2017. The copyright holder for this preprint (which was not certified by peer review) is the author/funder.
    [Show full text]
  • Novel Pathogenic Variants in Filamin C Identified in Pediatric Restrictive Cardiomyopathy
    Novel pathogenic variants in filamin C identified in pediatric restrictive cardiomyopathy Jeffrey Schubert1, 2, Muhammad Tariq3, Gabrielle Geddes4, Steven Kindel4, Erin M. Miller5, and Stephanie M. Ware2. 1 Department of Molecular Genetics, Microbiology, and Biochemistry, University of Cincinnati College of Medicine, Cincinnati, OH; 2 Departments of Pediatrics and Medical and Molecular Genetics, Indiana University School of Medicine, Indianapolis, IN; 3 Faculty of Applied Medical Science, University of Tabuk, Tabuk, Kingdom of Saudi Arabia; 4Department of Pediatrics, Medical College of Wisconsin, Milwaukee, WI; 5Cincinnati Children’s Hospital Medical Center, Cincinnati, OH. Correspondence: Stephanie M. Ware, MD, PhD Department of Pediatrics Indiana University School of Medicine 1044 W. Walnut Street Indianapolis, IN 46202 Telephone: 317 274-8939 Email: [email protected] Grant Sponsor: The project was supported by the Children’s Cardiomyopathy Foundation (S.M.W.), an American Heart Association Established Investigator Award 13EIA13460001 (S.M.W.) and an AHA Postdoctoral Fellowship Award 12POST10370002 (M.T.). ___________________________________________________________________ This is the author's manuscript of the article published in final edited form as: Schubert, J., Tariq, M., Geddes, G., Kindel, S., Miller, E. M., & Ware, S. M. (2018). Novel pathogenic variants in filamin C identified in pediatric restrictive cardiomyopathy. Human Mutation, 0(ja). https://doi.org/10.1002/humu.23661 Abstract Restrictive cardiomyopathy (RCM) is a rare and distinct form of cardiomyopathy characterized by normal ventricular chamber dimensions, normal myocardial wall thickness, and preserved systolic function. The abnormal myocardium, however, demonstrates impaired relaxation. To date, dominant variants causing RCM have been reported in a small number of sarcomeric or cytoskeletal genes, but the genetic causes in a majority of cases remain unexplained especially in early childhood.
    [Show full text]
  • Insights from Conventional and Unconventional Myosins A
    Structure-Function Analysis of Motor Proteins: Insights from Conventional and Unconventional Myosins A Thesis SUBMITTED TO THE FACULTY OF UNIVERSITY OF MINNESOTA BY Karl J. Petersen IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY Margaret A. Titus, Advisor David D. Thomas, Co-Advisor December 2016 © Karl J. Petersen 2016 Acknowledgements This thesis would not exist without the patient support of my advisors, Meg Titus and Dave Thomas. Any shortcomings are my own. Collaborators Holly Goodson, Anne Houdusse, and Gant Luxton also provided invaluable training and support. I am also grateful for essential services provided by departmental staff: Sarah Blakely Anderson, Octavian Cornea, Sarah Dittrich, Karen Hawkinson, Michelle Lewis, Mary Muwahid, Laurie O’Neill, Darlene Toedter, with apologies to others not listed. Thanks to friends and colleagues at the University of Minnesota: Ashley Arthur, Kelly Bower, Brett Colson, Sinziana Cornea, Chi Meng Fong, Greg Gillispie, Piyali Guhathakurta, Tejas Gupte, Tom Hays, Norma Jiménez Ramírez, Dawn Lowe, Allison MacLean, Santiago Martínez Cifuentes, Jared Matzke, Megan McCarthy, Joachim Mueller, Joe Muretta, Kurt Peterson, Mary Porter, Ewa Prochniewicz, Mike Ritt, Cosmo Saunders, Shiv Sivaramakrishnan, Ruth Sommese, Doug Tritschler, Brian Woolums. i Abstract Myosin motor proteins play fundamental roles in a multitude of cellular processes. Myosin generates force on cytoskeletal actin filaments to control cell shape, most dramatically during cytokinesis, and has a conserved role in defining cell polarity. Myosin contracts the actin cytoskeleton, ensuring prompt turnover of cellular adhesion sites, retracting the cell body during migration and development, and contracting muscle among diverse other functions. How myosins work, and why force generation is essential for their function, is in many cases an open question.
    [Show full text]
  • A CRISPR Path to Engineering New Genetic Mouse Models for Cardiovascular Research
    Cutting-Edge Review A CRISPR Path to Engineering New Genetic Mouse Models for Cardiovascular Research Joseph M. Miano, Qiuyu Martin Zhu, Charles J. Lowenstein Abstract—Previous efforts to target the mouse genome for the addition, subtraction, or substitution of biologically informative sequences required complex vector design and a series of arduous steps only a handful of laboratories could master. The facile and inexpensive clustered regularly interspaced short palindromic repeats (CRISPR) method has now superseded traditional means of genome modification such that virtually any laboratory can quickly assemble reagents for developing new mouse models for cardiovascular research. Here, we briefly review the history of CRISPR in prokaryotes, highlighting major discoveries leading to its formulation for genome modification in the animal kingdom. Core components of CRISPR technology are reviewed and updated. Practical pointers for 2-component and 3-component CRISPR editing are summarized with many applications in mice including frameshift mutations, deletion of enhancers and noncoding genes, nucleotide substitution of protein-coding and gene regulatory sequences, incorporation of loxP sites for conditional gene inactivation, and epitope tag integration. Genotyping strategies are presented and topics of genetic mosaicism and inadvertent targeting discussed. Finally, clinical applications and ethical considerations are addressed as the biomedical community eagerly embraces this astonishing innovation in genome editing to tackle previously
    [Show full text]