DOCSLIB.ORG

Insights from Conventional and Unconventional Myosins A

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Insights from Conventional and Unconventional Myosins A Structure-Function Analysis of Motor Proteins: Insights from Conventional and Unconventional Myosins A Thesis SUBMITTED TO THE FACULTY OF UNIVERSITY OF MINNESOTA BY Karl J. Petersen IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY Margaret A. Titus, Advisor David D. Thomas, Co-Advisor December 2016 © Karl J. Petersen 2016 Acknowledgements This thesis would not exist without the patient support of my advisors, Meg Titus and Dave Thomas. Any shortcomings are my own. Collaborators Holly Goodson, Anne Houdusse, and Gant Luxton also provided invaluable training and support. I am also grateful for essential services provided by departmental staff: Sarah Blakely Anderson, Octavian Cornea, Sarah Dittrich, Karen Hawkinson, Michelle Lewis, Mary Muwahid, Laurie O’Neill, Darlene Toedter, with apologies to others not listed. Thanks to friends and colleagues at the University of Minnesota: Ashley Arthur, Kelly Bower, Brett Colson, Sinziana Cornea, Chi Meng Fong, Greg Gillispie, Piyali Guhathakurta, Tejas Gupte, Tom Hays, Norma Jiménez Ramírez, Dawn Lowe, Allison MacLean, Santiago Martínez Cifuentes, Jared Matzke, Megan McCarthy, Joachim Mueller, Joe Muretta, Kurt Peterson, Mary Porter, Ewa Prochniewicz, Mike Ritt, Cosmo Saunders, Shiv Sivaramakrishnan, Ruth Sommese, Doug Tritschler, Brian Woolums. i Abstract Myosin motor proteins play fundamental roles in a multitude of cellular processes. Myosin generates force on cytoskeletal actin filaments to control cell shape, most dramatically during cytokinesis, and has a conserved role in defining cell polarity. Myosin contracts the actin cytoskeleton, ensuring prompt turnover of cellular adhesion sites, retracting the cell body during migration and development, and contracting muscle among diverse other functions. How myosins work, and why force generation is essential for their function, is in many cases an open question. Chapter 2 presents a structure-function analysis of the amoebozoan myosin 7 (DdMyo7) in live Dictyostelium discoideum cells. DdMyo7 bears structural resemblance to human Myosin 7 (a protein involved in maintenance of the retina, stereocilia of the ear, and gut microvilli) but has functional similarity to human Myosin 10, a regulator of cell adhesion that is also essential in formation of actin-based structures called filopodia. Phylogenetic analysis of these related proteins shows that DdMyo7 is not directly related to any human myosin but rather represents a molecular ancestor of several vertebrate myosins (Myo7, Myo10 and Myo15). Functional analysis focused on rescue of myo7– cells. The two MyTH4-FERM domains were fully redundant in rescuing formation of filopodia. A conserved Myo7 regulatory motif in the C-terminal FERM domain was found to stimulate filopodia formation when mutated, establishing DdMyo7 as a filopodial motor with features of Myo7 and Myo10. A molecular chimera of DdMyo7 motor/lever arm region fused to the MF domain of human Myo10 partially rescued filopodia formation, ii suggesting the MF domain plays a similar role in filopodia in divergent organisms. Structural information must be combined with physiological data to understand the mechanism of myosin motor function. Structural studies have long focused on conventional myosin 2 as a model due to ease of protein expression and purification. This approach has yielded considerable data regarding the static structures and in vitro kinetics of the myosin mechanochemical cycle; however, high-resolution methods to observe the dynamics of myosin activation in cells have been lacking. Chapter 4 introduces methods and instrumentation for rapid, precise measurement of fluorescence lifetime. This is a necessary step toward Myo2-based live cell FRET sensors described in Chapter 5. Implications of this work for future studies of myosin physiological function are discussed in Chapter 6. iii Table of Contents Acknowledgements .............................................................................................................. i Abstract ............................................................................................................................... ii Table of Contents ............................................................................................................... iv List of Tables ................................................................................................................... viii List of Figures .................................................................................................................... ix Abbreviations ..................................................................................................................... xi 1 Mechanical Control of Cell Shape and Motion by Actin and Myosin ....................... 1 1.1 Motor Proteins .............................................................................................. 1 1.2 Actin-based Cell Motility ............................................................................. 4 1.3 Conventional Myosins: Continuous Contraction .......................................... 6 1.4 Unconventional Myosins: Tension and Transport ........................................ 8 1.5 Dictyostelium is a Developmental Model Organism .................................. 10 1.6 MyTH4-FERM Myosins ............................................................................. 15 2 MyTH4-FERM Myosins Have an Ancient and Conserved Role in Filopodia Formation .......................................................................................................................... 26 2.1 Chapter Summary ....................................................................................... 26 iv 2.2 Introduction ................................................................................................. 27 2.3 Results ......................................................................................................... 31 2.3.1 Phylogenetic Relationship Between DdMyo7 and Metazoan Myosins 31 2.3.2 DdMyo7 is Present in Filopodia and Required for Their Formation .. 33 2.3.3 Complementary Roles of the DdMyo7 Head and Tail in Filopod Initiation 34 2.3.4 DdMyo7 FERM2 Domain Regulates Filopod Formation and Elongation 37 2.3.5 A Minimal Filopod Motor ................................................................... 41 2.3.6 Functional Conservation of MF Domains Across Kingdoms ............. 42 2.4 Discussion ................................................................................................... 45 2.4.1 Evolution of MF myosins .................................................................... 45 2.4.2 Minimal and conserved features of MF myosin required for filopod formation. 49 2.4.3 Conclusions ......................................................................................... 50 2.5 Methods....................................................................................................... 52 2.6 Acknowledgements ..................................................................................... 62 2.7 Figures......................................................................................................... 66 v 3 Biophysics of Myosin Function ................................................................................ 82 3.1 Historical Overview .................................................................................... 82 3.2 Crystallography and Cryo-Electron Microscopy ........................................ 83 3.3 Fluorescence Spectroscopy ......................................................................... 86 3.4 Biochemical and Mechanical Assays.......................................................... 90 4 Fluorescence Lifetime Plate Reader: Resolution and Precision Meet High- Throughput ........................................................................................................................ 94 4.1 Chapter Summary ....................................................................................... 94 4.2 Introduction ................................................................................................. 95 4.3 Materials and Methods ................................................................................ 97 4.3.1 Instrument ............................................................................................ 97 4.3.2 Microplate Preparation ........................................................................ 98 4.3.3 Data Analysis ....................................................................................... 98 4.4 Experimental Results ................................................................................ 101 4.4.1 Lifetime Compared with Intensity ..................................................... 101 4.4.2 Linearity of Detection ........................................................................ 103 4.4.3 Signal Quality .................................................................................... 104 4.4.4 Resolution of Lifetimes ..................................................................... 106 vi 4.5 Discussion ................................................................................................. 107 4.6 Acknowledgements ................................................................................... 111 4.7 Figures....................................................................................................... 112 5 Myosin Biosensors .................................................................................................
Load more

Recommended publications
  • FLNC Missense Variants in Familial Noncompaction Cardiomyopathy
    Cardiogenetics 2019; volume 9:8181 FLNC missense variants than 2 according to current echocardio- in familial noncompaction graphic criteria, or 2.3 on CMR.1,2 Correspondence: Jaap I. van Waning, Approximately 10% of patients diagnosed Department of Clinical Genetics, EE 2038, cardiomyopathy with NCCM have concurrent congenital Erasmus MC, POB 2040, 3000CA Rotterdam, heart defects (CHD).3,4 the Netherlands. Tel.: +3107038388 - Fax: +3107043072. Jaap I. van Waning,1 In 30-40% of cases diagnosed with E-mail: [email protected] Yvonne M. Hoedemaekers,2 NCCM a pathogenic variant can be identi- 2,3 4 Wouter P. te Rijdt, Arne I. Jpma, fied. Around 80% of these pathogenic vari- Acknowledgements: JVW was supported by a Daphne Heijsman,4 Kadir Caliskan,5 ants involve the same sarcomere genes, that grant from the Jaap Schouten Foundation. Elke S. Hoendermis,6 are the major causes for hypertrophic car- WPTR was supported by a Young Talent Program (CVON PREDICT) grant 2017T001 Tineke P. Willems,7 diomyopathy (HCM) and dilated cardiomy- - Dutch Heart Foundation. 8 opathy (DCM), in particular MYH7, Arthur van den Wijngaard, 5,6 3 MYBPC3 and TTN. Filamin C (FLNC) Albert Suurmeijer, Conflict of interest: the authors declare no plays a central role in muscle functioning Marjon A. van Slegtenhorst,1 potential conflict of interest. by maintaining the structural integrity of the Jan D.H. Jongbloed,2 muscle fibers. Pathogenic variants in FLNC Received for publication: 20 March 2019. Danielle F. Majoor-Krakauer,1 2 were found to be associated with a wide Revision received: 29 July 2019. Paul A.
    [Show full text]
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Myosin Myth4-FERM Structures Highlight Important Principles of Convergent Evolution
    Myosin MyTH4-FERM structures highlight important principles of convergent evolution Vicente José Planelles-Herreroa,b, Florian Blanca,c, Serena Sirigua, Helena Sirkiaa, Jeffrey Clausea, Yannick Souriguesa, Daniel O. Johnsrudd, Beatrice Amiguesa, Marco Cecchinic, Susan P. Gilberte, Anne Houdussea,1,2, and Margaret A. Titusd,1,2 aStructural Motility, Institut Curie, CNRS, UMR 144, PSL Research University, F-75005 Paris, France; bUPMC Université de Paris 6, Institut de Formation Doctorale, Sorbonne Universités, 75252 Paris Cedex 05, France; cLaboratoire d’Ingénierie des Fonctions Moléculaires, Institut de Science et d’Ingénierie Supramoléculaires, UMR 7006 CNRS, Université de Strasbourg, F-67083 Strasbourg Cedex, France; dDepartment of Genetics, Cell Biology and Development, University of Minnesota, Minneapolis, MN 55455; and eDepartment of Biological Sciences, Rensselaer Polytechnic Institute, Troy, NY 12180 Edited by James A. Spudich, Stanford University School of Medicine, Stanford, CA, and approved March 31, 2016 (received for review January 15, 2016) Myosins containing MyTH4-FERM (myosin tail homology 4-band (Fig. 1). These MF myosins are widespread and likely quite an- 4.1, ezrin, radixin, moesin, or MF) domains in their tails are found cient because they are found in many different branches of the in a wide range of phylogenetically divergent organisms, such as phylogenetic tree (5, 6), including Opisthokonts (which includes humans and the social amoeba Dictyostelium (Dd). Interestingly, Metazoa, unicellular Holozoa, and Fungi), Amoebozoa, and the evolutionarily distant MF myosins have similar roles in the exten- SAR (Stramenopiles, Alveolates, and Rhizaria) (Fig. 1 A and B). sion of actin-filled membrane protrusions such as filopodia and Over the course of hundreds of millions years of parallel evolution bind to microtubules (MT), suggesting that the core functions of the MF myosins have acquired or maintained roles in the formation these MF myosins have been highly conserved over evolution.
    [Show full text]
  • Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model
    Downloaded from http://www.jimmunol.org/ by guest on September 25, 2021 T + is online at: average * The Journal of Immunology , 34 of which you can access for free at: 2016; 197:1477-1488; Prepublished online 1 July from submission to initial decision 4 weeks from acceptance to publication 2016; doi: 10.4049/jimmunol.1600589 http://www.jimmunol.org/content/197/4/1477 Molecular Profile of Tumor-Specific CD8 Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A. Waugh, Sonia M. Leach, Brandon L. Moore, Tullia C. Bruno, Jonathan D. Buhrman and Jill E. Slansky J Immunol cites 95 articles Submit online. Every submission reviewed by practicing scientists ? is published twice each month by Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts http://jimmunol.org/subscription Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html http://www.jimmunol.org/content/suppl/2016/07/01/jimmunol.160058 9.DCSupplemental This article http://www.jimmunol.org/content/197/4/1477.full#ref-list-1 Information about subscribing to The JI No Triage! Fast Publication! Rapid Reviews! 30 days* Why • • • Material References Permissions Email Alerts Subscription Supplementary The Journal of Immunology The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. This information is current as of September 25, 2021. The Journal of Immunology Molecular Profile of Tumor-Specific CD8+ T Cell Hypofunction in a Transplantable Murine Cancer Model Katherine A.
    [Show full text]
  • Defining Functional Interactions During Biogenesis of Epithelial Junctions
    ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK.
    [Show full text]
  • Circmyo10 Promotes Osteosarcoma Progression by Regulating Mir-370
    Chen et al. Molecular Cancer (2019) 18:150 https://doi.org/10.1186/s12943-019-1076-1 RESEARCH Open Access CircMYO10 promotes osteosarcoma progression by regulating miR-370-3p/ RUVBL1 axis to enhance the transcriptional activity of β-catenin/LEF1 complex via effects on chromatin remodeling Junxin Chen1†, Gang Liu1†, Yizheng Wu1†, Jianjun Ma1†, Hongfei Wu2, Ziang Xie1, Shuai Chen1, Yute Yang1, Shengyu Wang1, Panyang Shen1, Yifan Fang3, Shunwu Fan1, Shuying Shen1* and Xiangqian Fang1* Abstract Background: CircMYO10 is a circular RNA generated by back-splicing of gene MYO10 and is upregulated in osteosarcoma cell lines, but its functional role in osteosarcoma is still unknown. This study aimed to clarify the mechanism of circMYO10 in osteosarcoma. Methods: CircMYO10 expression in 10 paired osteosarcoma and chondroma tissues was assessed by quantitative reverse transcription polymerase chain reaction (PCR). The function of circMYO10/miR-370-3p/RUVBL1 axis was assessed regarding two key characteristics: proliferation and endothelial–mesenchymal transition (EMT). Bioinformatics analysis, western blotting, real-time PCR, fluorescence in situ hybridization, immunoprecipitation, RNA pull-down assays, luciferase reporter assays, chromatin immunoprecipitation, and rescue experiments were used to evaluate the mechanism. Stably transfected MG63 cells were injected via tail vein or subcutaneously into nude mice to assess the role of circMYO10 in vivo. Results: CircMYO10 was significantly upregulated, while miR-370-3p was downregulated, in osteosarcoma cell lines and human osteosarcoma samples. Silencing circMYO10 inhibited cell proliferation and EMT in vivo and in vitro. Mechanistic investigations revealed that miR-370-3p targets RUVBL1 directly, and inhibits the interaction between RUVBL1 and β-catenin/LEF1 complex while circMYO10 showed a contrary effect via the inhibition of miR-370-3p.
    [Show full text]
  • Human Periprostatic Adipose Tissue: Secretome from Patients With
    CANCER GENOMICS & PROTEOMICS 16 : 29-58 (2019) doi:10.21873/cgp.20110 Human Periprostatic Adipose Tissue: Secretome from Patients With Prostate Cancer or Benign Prostate Hyperplasia PAULA ALEJANDRA SACCA 1, OSVALDO NÉSTOR MAZZA 2, CARLOS SCORTICATI 2, GONZALO VITAGLIANO 3, GABRIEL CASAS 4 and JUAN CARLOS CALVO 1,5 1Institute of Biology and Experimental Medicine (IBYME), CONICET, Buenos Aires, Argentina; 2Department of Urology, School of Medicine, University of Buenos Aires, Clínical Hospital “José de San Martín”, Buenos Aires, Argentina; 3Department of Urology, Deutsches Hospital, Buenos Aires, Argentina; 4Department of Pathology, Deutsches Hospital, Buenos Aires, Argentina; 5Department of Biological Chemistry, School of Exact and Natural Sciences, University of Buenos Aires, Buenos Aires, Argentina Abstract. Background/Aim: Periprostatic adipose tissue Prostate cancer (PCa) is the second most common cancer in (PPAT) directs tumour behaviour. Microenvironment secretome men worldwide. While most men have indolent disease, provides information related to its biology. This study was which can be treated properly, the problem consists in performed to identify secreted proteins by PPAT, from both reliably distinguishing between indolent and aggressive prostate cancer and benign prostate hyperplasia (BPH) disease. Evidence shows that the microenvironment affects patients. Patients and Methods: Liquid chromatography-mass tumour behavior. spectrometry-based proteomic analysis was performed in Adipose tissue microenvironment is now known to direct PPAT-conditioned media (CM) from patients with prostate tumour growth, invasion and metastases (1, 2). Adipose cancer (CMs-T) (stage T3: CM-T3, stage T2: CM-T2) or tissue is adjacent to the prostate gland and the site of benign disease (CM-BPH). Results: The highest number and invasion of PCa.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • I ABSTRACT KHAREL, PRAKASH, Ph.D., December 2018 Chemistry
    ABSTRACT KHAREL, PRAKASH, Ph.D., December 2018 Chemistry & Biochemistry RNA OXIDATION IN MULTIPLE SCLEROSIS NEURODEGENERATION (204 PP.) Dissertation advisor: Soumitra Basu An increase in the production of reactive oxygen species (ROS) and the inability of cellular machinery to adequately neutralize the ROS thus produced, lead the cells towards oxidative stress. ROS can damage all major classes of biomolecules including proteins, DNA and RNA. Recent findings show the evidence of high level of RNA oxidation in the neuronal cells of many neurological disorders suggesting a link between RNA oxidation and neurodegeneration. We have recently discovered the presence of extensive oxidative damage in the RNA molecules of neuronal cells in postmortem brains of multiple sclerosis (MS) patients. Working on the MS model system, we have established the identity of selectively oxidized mRNA molecules under MS microenvironment in human neuronal cells. Our study reveals that many of the mRNAs linked to various neurological pathways are selectively oxidized under oxidative stress. We have demonstrated the functional consequences of mRNA oxidation in two neuropathology related mRNAs (namely Nat8l and Nlrp3 mRNA). N-acetyl aspartate transferase 8 like protein (NAT8L) is a key trans-mitochondrial membrane protein that catalyzes the transfer of acetyl group from acetyl-CoA to aspartate to form N-acetyl aspartate (NAA) and transports NAA to neuronal cytoplasm. We have discovered that the oxidation in Nat8l mRNA molecule i results in the reduced expression of NAT8L enzyme. We also observed a reduced level of NAA present in the neuronal cells under oxidative stress. Using the neuronal tissue culture and MS animal model (cuprizone mouse model), we have established that a higher mRNA oxidation results in a reduced expression of NAT8L protein, which presumably contributes to the MS disease progression by weakening the myelin production machinery.
    [Show full text]
  • Communication Pathways in Human Nonmuscle Myosin-2C 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Authors: 25 Krishna Chinthalapudia,B,C,1, Sarah M
    1 Mechanistic Insights into the Active Site and Allosteric 2 Communication Pathways in Human Nonmuscle Myosin-2C 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 Authors: 25 Krishna Chinthalapudia,b,c,1, Sarah M. Heisslera,d,1, Matthias Prellera,e, James R. Sellersd,2, and 26 Dietmar J. Mansteina,b,2 27 28 Author Affiliations 29 aInstitute for Biophysical Chemistry, OE4350 Hannover Medical School, 30625 Hannover, 30 Germany. 31 bDivision for Structural Biochemistry, OE8830, Hannover Medical School, 30625 Hannover, 32 Germany. 33 cCell Adhesion Laboratory, Department of Integrative Structural and Computational Biology, The 34 Scripps Research Institute, Jupiter, Florida 33458, USA. 35 dLaboratory of Molecular Physiology, NHLBI, National Institutes of Health, Bethesda, Maryland 36 20892, USA. 37 eCentre for Structural Systems Biology (CSSB), German Electron Synchrotron (DESY), 22607 38 Hamburg, Germany. 39 1K.C. and S.M.H. contributed equally to this work 40 2To whom correspondence may be addressed: E-mail: [email protected] or 41 [email protected] 42 43 1 44 Abstract 45 Despite a generic, highly conserved motor domain, ATP turnover kinetics and their activation by 46 F-actin vary greatly between myosin-2 isoforms. Here, we present a 2.25 Å crystal pre- 47 powerstroke state (ADPVO4) structure of the human nonmuscle myosin-2C motor domain, one 48 of the slowest myosins characterized. In combination with integrated mutagenesis, ensemble- 49 solution kinetics, and molecular dynamics simulation approaches, the structure reveals an 50 allosteric communication pathway that connects the distal end of the motor domain with the 51 active site.
    [Show full text]
  • (ESI) for Toxicology Research
    Electronic Supplementary Material (ESI) for Toxicology Research. This journal is © The Royal Society of Chemistry 2014 Supplementary data 1 Particle preparation and characterization 1.1 SWCNT preparation The purchased SWCNTs (P2-SWNTs, Carbon Solutions, Inc. CA, USA) have a poor dispersibility and colloidal stability in aqueous medium. To make well-dispersed SWCNTs in aqueous medium with a proper colloidal stability for the duration of the experiments, the purchased SWCNTs were accurately weighted and suspended in dimethyl sulfoxide (DMSO) to 0.125 mg/mL, followed by ultrasonication for 30 minutes in a water bath sonicator (B3510, Branson Ultrasonics, 40KHz). In the last minute of ultrasonication, the SWCNTs-DMSO suspension was rapidly diluted 5 times by injecting a stabilization buffer (5 mg/mL BSA and 10 mM NaCl in MilliQ water). The mixture, referred to as as-dispersed SWCNTs (AD-SWCNTs), resulted in a clear dark-brown suspension. No sedimentation of AD-SWCNTs was observed for weeks at room temperature indicating a good colloidal stability. To remove the majority of DMSO and free BSA, AD-SWCNTs were pelleted by centrifugation at 16,000 g, 4 °C for 30 min followed by three times wash with 10 mM NaCl in MilliQ water under the same conditions. The colloidal stability and surface charge of SWCNTs at each step were monitored by dynamic light scattering analysis (DLS) (see below). The depletion of DMSO and BSA was monitored by UV-Visible absorption analysis (see below). The SWCNTs aggregates and metallic impurities were characterized by TEM and TEM-EDX (see below). After the washing steps, SWCNTs were re-dispersed in MilliQ water with 10 mM NaCl to about 0.4 mg/mL, which was used in the experiments and here referred to as prepared SWCNTs.
    [Show full text]
  • Cellular and Molecular Signatures in the Disease Tissue of Early
    Cellular and Molecular Signatures in the Disease Tissue of Early Rheumatoid Arthritis Stratify Clinical Response to csDMARD-Therapy and Predict Radiographic Progression Frances Humby1,* Myles Lewis1,* Nandhini Ramamoorthi2, Jason Hackney3, Michael Barnes1, Michele Bombardieri1, Francesca Setiadi2, Stephen Kelly1, Fabiola Bene1, Maria di Cicco1, Sudeh Riahi1, Vidalba Rocher-Ros1, Nora Ng1, Ilias Lazorou1, Rebecca E. Hands1, Desiree van der Heijde4, Robert Landewé5, Annette van der Helm-van Mil4, Alberto Cauli6, Iain B. McInnes7, Christopher D. Buckley8, Ernest Choy9, Peter Taylor10, Michael J. Townsend2 & Costantino Pitzalis1 1Centre for Experimental Medicine and Rheumatology, William Harvey Research Institute, Barts and The London School of Medicine and Dentistry, Queen Mary University of London, Charterhouse Square, London EC1M 6BQ, UK. Departments of 2Biomarker Discovery OMNI, 3Bioinformatics and Computational Biology, Genentech Research and Early Development, South San Francisco, California 94080 USA 4Department of Rheumatology, Leiden University Medical Center, The Netherlands 5Department of Clinical Immunology & Rheumatology, Amsterdam Rheumatology & Immunology Center, Amsterdam, The Netherlands 6Rheumatology Unit, Department of Medical Sciences, Policlinico of the University of Cagliari, Cagliari, Italy 7Institute of Infection, Immunity and Inflammation, University of Glasgow, Glasgow G12 8TA, UK 8Rheumatology Research Group, Institute of Inflammation and Ageing (IIA), University of Birmingham, Birmingham B15 2WB, UK 9Institute of
    [Show full text]