Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations

Total Page:16

File Type:pdf, Size:1020Kb

Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations by Jelena Perovanovic M.S. in Molecular Biology and Physiology, September 2009, University of Belgrade M.Phil. in Molecular Medicine, August 2013, The George Washington University A Dissertation submitted to The Faculty of The Columbian College of Arts and Sciences of The George Washington University in partial fulfillment of the requirements for the degree of Doctor of Philosophy August 31, 2015 Dissertation directed by Eric P. Hoffman Professor of Integrative Systems Biology The Columbian College of Arts and Sciences of The George Washington University certifies that Jelena Perovanovic has passed the Final Examination for the degree of Doctor of Philosophy as of May 5, 2015. This is the final and approved form of the dissertation. Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations Jelena Perovanovic Dissertation Research Committee: Eric P. Hoffman, Professor of Integrative Systems Biology, Dissertation Director Anamaris Colberg-Poley, Professor of Integrative Systems Biology, Committee Member Robert J. Freishtat, Associate Professor of Pediatrics, Committee Member Vittorio Sartorelli, Senior Investigator, National Institutes of Health, Committee Member ii © Copyright 2015 by Jelena Perovanovic All rights reserved iii Acknowledgments I am deeply indebted to countless individuals for their support and encouragement during the past five years of graduate studies. First and foremost, I would like to express my gratitude to my mentor, Dr. Eric P. Hoffman, for his unwavering support and guidance, and keen attention to my professional development. This Dissertation would not have been possible without the critical input he provided and the engaging environment he created. I would also like to thank my Dissertation Committee of Dr. Anamaris Colberg-Poley, Dr. Robert J. Freishtat, Dr. Vittorio Sartorelli and Dr. Ashley Hill for challenging and guiding me throughout the development of this Dissertation. I am grateful to my Master thesis mentor, Dr. Nikola Tucic at University of Belgrade, Serbia, who taught me to observe biological phenomena through the lens of evolution and encouraged me to pursue my doctoral degree in the US. Furthermore, I would like to thank Hoffman lab members for their friendship, help and support throughout the years, Center for Genetic Medicine at Children’s National Medical Center and Institute for Biological Sciences at the George Washington University, especially Dr. Linda Werling, Dr. Anne Chiaramello and Marc Wittlif. I owe much gratitude to my parents, Milan and Sladjanka Perovanovic, and brother, Rade, for their continuous love and support throughout my life. Finally, I would like to thank my beloved Nikola for his unconditional love, patience and support. iv Abstract of Dissertation Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations The nuclear envelope is important to myogenesis, where the transition of lamin B to lamin A/C during terminal myogenic differentiation is needed for correct muscle development. Gene mutations of inner nuclear envelope components (LMNA, EDM) cause muscular dystrophy phenotypes (Emery-Dreifuss muscular dystrophy [EDMD]; limb-girdle muscular dystrophy). There is considerable allelic and clinical heterogeneity of the laminopathies, where distinct LMNA mutations selectively affect striated muscle, adipose, peripheral nerve, or multiple systems. These nuclear envelope components provide structural support to eukaryotic nuclei, but emerging data suggest key roles in DNA replication, transcription and chromatin organization. Previous studies in our lab have shown that patients with EDMD show specific alterations of MyoD/Rb pathways compared to other dystrophies (Bakay et al., 2006), and further that emerin null mice show a specific block in myogenesis during terminal differentiation of myoblasts (Melcon et al., 2006). In this dissertation it is shown that mutations in LMNA and loss of emerin causing EDMD lead to disruption of developmentally appropriate chromatin-nuclear envelope associations during myogenesis. We scanned for genomic loci interacting with lamin A protein during myogenic differentiation using DamID-seq, and determined the effect of disease-associated amino acid changes on these protein/chromatin interactions (p.R453W Emery-Dreifuss Muscular Dystrophy; p.R482W Familial Partial Lipodystrophy). Lamin A missense mutations caused both promiscuous formation of lamin A associated heterochromatin domains (LAD), and decreased the length of WT v LADs. These epigenetic alterations corresponded with pervasive presence of lamin A p.R452W (EDMD) at myogenic loci that was not seen with WT and p.R482W (FPLD). This finding was validated by DNA methylation studies in EDMD patient myogenic cells (WT vs. p.H222P). Also, appropriate exit from the cell cycle was perturbed by both mutations, with CDK1 and RB1 loci showing failure to attain LAD-mediated heterochromatin formation by DamID-seq and Chromatin Immuprecipitation sequencing ChIP-seq (H3K9me3 heterochromatin mark) analyses. Epigenetic findings in EDMD-AD (lamin A missense) were shared with the clinical phenocopy EDMD-XR (lamin A- associated emerin loss of function), with ChIP-seq of emerin null myogenic cells showing loss of heterochromatin marks at Sox2 and pluripotency pathway members. The failure of epigenetic remodeling at Sox2 was validated by mRNA (in vitro, and in EDMD patient muscle biopsies), and by lamin A p.H222P ChIP-qPCR. The alterations of SOX2 epigenetics may be upstream of the observed myogenic and cell cycle changes, as over- expression of SOX2 inhibited myogenic differentiation in vitro. Our findings suggest that nuclear envelopathies are disorders of developmental epigenetic programming caused by altered chromatin tethering to the nuclear periphery. vi Table of Contents Acknowledgments ............................................................................................................ iv Abstract of Dissertation ..................................................................................................... v List of Figures ................................................................................................................... ix List of Tables ..................................................................................................................... x List of Abbreviations ......................................................................................................... xi 1 Chapter: Introduction ................................................................................................... 1 1.1 Overview ............................................................................................................... 1 1.2 Diseases linked to mutations in LMNA .................................................................. 6 1.3 Molecular role of LMNA in normal and pathogenic conditions ............................ 16 1.4 Current molecular laminopathy models ............................................................... 28 1.5 Significance ......................................................................................................... 29 2 Chapter: Material and Methods ................................................................................. 30 2.1 Cell culture .......................................................................................................... 30 2.2 qRT-PCR ............................................................................................................. 32 2.3 Chromatin immunoprecipitation assay and ChIP-seq ......................................... 34 2.4 ChIP-seq data analysis ....................................................................................... 35 2.5 DamID sequencing .............................................................................................. 35 2.6 Bioinformatics analysis ....................................................................................... 41 2.7 Methylation analysis ............................................................................................ 41 2.8 Expression data .................................................................................................. 42 2.9 Overexpression and myogenic differentiation experiments ................................ 42 3 Chapter: Results ........................................................................................................ 43 3.1 Summary ............................................................................................................. 43 vii 3.2 Introduction ......................................................................................................... 44 3.3 Results ................................................................................................................ 47 3.3.1 Lamin mutations alter genomic LADs of human muscle cells ...................... 47 3.3.2 EDMD mutations show allele-specific alteration of epigenomic programming of myogenic differentiation ................................................................. 56 3.3.3 Delayed E2F cell cycle suppression is predicted by lamin A mutation (EDMD-AD) ............................................................................................... 76 3.3.4 Genome-wide prioritization of ChIP-seq alterations identifies aberrant persistence of pluripotency
Recommended publications
  • The Role of Nuclear Lamin B1 in Cell Proliferation and Senescence
    Downloaded from genesdev.cshlp.org on September 29, 2021 - Published by Cold Spring Harbor Laboratory Press The role of nuclear lamin B1 in cell proliferation and senescence Takeshi Shimi,1 Veronika Butin-Israeli,1 Stephen A. Adam,1 Robert B. Hamanaka,2 Anne E. Goldman,1 Catherine A. Lucas,1 Dale K. Shumaker,1 Steven T. Kosak,1 Navdeep S. Chandel,2 and Robert D. Goldman1,3 1Department of Cell and Molecular Biology, 2Department of Medicine, Division of Pulmonary and Critical Care Medicine, Feinberg School of Medicine, Northwestern University, Chicago, Illinois 60611, USA Nuclear lamin B1 (LB1) is a major structural component of the nucleus that appears to be involved in the regulation of many nuclear functions. The results of this study demonstrate that LB1 expression in WI-38 cells decreases during cellular senescence. Premature senescence induced by oncogenic Ras also decreases LB1 expression through a retinoblastoma protein (pRb)-dependent mechanism. Silencing the expression of LB1 slows cell proliferation and induces premature senescence in WI-38 cells. The effects of LB1 silencing on proliferation require the activation of p53, but not pRb. However, the induction of premature senescence requires both p53 and pRb. The proliferation defects induced by silencing LB1 are accompanied by a p53-dependent reduction in mitochondrial reactive oxygen species (ROS), which can be rescued by growth under hypoxic conditions. In contrast to the effects of LB1 silencing, overexpression of LB1 increases the proliferation rate and delays the onset of senescence of WI-38 cells. This overexpression eventually leads to cell cycle arrest at the G1/S boundary.
    [Show full text]
  • Targeted Genes and Methodology Details for Neuromuscular Genetic Panels
    Targeted Genes and Methodology Details for Neuromuscular Genetic Panels Reference transcripts based on build GRCh37 (hg19) interrogated by Neuromuscular Genetic Panels Next-generation sequencing (NGS) and/or Sanger sequencing is performed Motor Neuron Disease Panel to test for the presence of a mutation in these genes. Gene GenBank Accession Number Regions of homology, high GC-rich content, and repetitive sequences may ALS2 NM_020919 not provide accurate sequence. Therefore, all reported alterations detected ANG NM_001145 by NGS are confirmed by an independent reference method based on laboratory developed criteria. However, this does not rule out the possibility CHMP2B NM_014043 of a false-negative result in these regions. ERBB4 NM_005235 Sanger sequencing is used to confirm alterations detected by NGS when FIG4 NM_014845 appropriate.(Unpublished Mayo method) FUS NM_004960 HNRNPA1 NM_031157 OPTN NM_021980 PFN1 NM_005022 SETX NM_015046 SIGMAR1 NM_005866 SOD1 NM_000454 SQSTM1 NM_003900 TARDBP NM_007375 UBQLN2 NM_013444 VAPB NM_004738 VCP NM_007126 ©2018 Mayo Foundation for Medical Education and Research Page 1 of 14 MC4091-83rev1018 Muscular Dystrophy Panel Muscular Dystrophy Panel Gene GenBank Accession Number Gene GenBank Accession Number ACTA1 NM_001100 LMNA NM_170707 ANO5 NM_213599 LPIN1 NM_145693 B3GALNT2 NM_152490 MATR3 NM_199189 B4GAT1 NM_006876 MYH2 NM_017534 BAG3 NM_004281 MYH7 NM_000257 BIN1 NM_139343 MYOT NM_006790 BVES NM_007073 NEB NM_004543 CAPN3 NM_000070 PLEC NM_000445 CAV3 NM_033337 POMGNT1 NM_017739 CAVIN1 NM_012232 POMGNT2
    [Show full text]
  • Impairments in Contractility and Cytoskeletal Organisation Cause Nuclear Defects in Nemaline Myopathy
    bioRxiv preprint doi: https://doi.org/10.1101/518522; this version posted January 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Impairments in contractility and cytoskeletal organisation cause nuclear defects in nemaline myopathy Jacob A Ross1, Yotam Levy1, Michela Ripolone2, Justin S Kolb3, Mark Turmaine4, Mark Holt5, Maurizio Moggio2, Chiara Fiorillo6, Johan Lindqvist3, Nicolas Figeac5, Peter S Zammit5, Heinz Jungbluth5,7,8, John Vissing9, Nanna Witting9, Henk Granzier3, Edmar Zanoteli10, Edna C Hardeman11, Carina Wallgren- Pettersson12, Julien Ochala1,5. 1. Centre for Human & Applied Physiological Sciences, School of Basic & Medical Biosciences, Faculty of Life Sciences & Medicine, Guy’s Campus, King’s College London, SE1 1UL, UK 2. Neuromuscular and Rare Diseases Unit, Department of Neuroscience, Fondazione IRCCS Ca' Granda, Ospedale Maggiore Policlinico, Milan 20122, Italy 3. Department of Cellular and Molecular Medicine, University of Arizona, Tucson, Arizona, 85721, USA 4. Division of Biosciences, University College London, Gower Street, London WC1E 6BT, UK 5. Randall Centre for Cell and Molecular Biophysics, School of Basic & Medical Biosciences, Faculty of Life Sciences & Medicine, Guy’s Campus, King’s College London, SE1 1UL, UK 6. Molecular Medicine, IRCCS Fondazione Stella Maris, Pisa and Department of Neuroscience, Rehabilitation, Ophthalmology, Genetics, Maternal and Child Health, University of Genova, Genoa, Italy 7. Department of Paediatric Neurology, Neuromuscular Service, Evelina's Children Hospital, Guy's and St Thomas' Hospital National Health Service Foundation Trust, London, SE1 9RT, UK 8. Department of Basic and Clinical Neuroscience, Institute of Psychiatry, Psychology & Neuroscience, King's College, London, SE1 1UL, UK 9.
    [Show full text]
  • Supplemental Table S1
    Entrez Gene Symbol Gene Name Affymetrix EST Glomchip SAGE Stanford Literature HPA confirmed Gene ID Profiling profiling Profiling Profiling array profiling confirmed 1 2 A2M alpha-2-macroglobulin 0 0 0 1 0 2 10347 ABCA7 ATP-binding cassette, sub-family A (ABC1), member 7 1 0 0 0 0 3 10350 ABCA9 ATP-binding cassette, sub-family A (ABC1), member 9 1 0 0 0 0 4 10057 ABCC5 ATP-binding cassette, sub-family C (CFTR/MRP), member 5 1 0 0 0 0 5 10060 ABCC9 ATP-binding cassette, sub-family C (CFTR/MRP), member 9 1 0 0 0 0 6 79575 ABHD8 abhydrolase domain containing 8 1 0 0 0 0 7 51225 ABI3 ABI gene family, member 3 1 0 1 0 0 8 29 ABR active BCR-related gene 1 0 0 0 0 9 25841 ABTB2 ankyrin repeat and BTB (POZ) domain containing 2 1 0 1 0 0 10 30 ACAA1 acetyl-Coenzyme A acyltransferase 1 (peroxisomal 3-oxoacyl-Coenzyme A thiol 0 1 0 0 0 11 43 ACHE acetylcholinesterase (Yt blood group) 1 0 0 0 0 12 58 ACTA1 actin, alpha 1, skeletal muscle 0 1 0 0 0 13 60 ACTB actin, beta 01000 1 14 71 ACTG1 actin, gamma 1 0 1 0 0 0 15 81 ACTN4 actinin, alpha 4 0 0 1 1 1 10700177 16 10096 ACTR3 ARP3 actin-related protein 3 homolog (yeast) 0 1 0 0 0 17 94 ACVRL1 activin A receptor type II-like 1 1 0 1 0 0 18 8038 ADAM12 ADAM metallopeptidase domain 12 (meltrin alpha) 1 0 0 0 0 19 8751 ADAM15 ADAM metallopeptidase domain 15 (metargidin) 1 0 0 0 0 20 8728 ADAM19 ADAM metallopeptidase domain 19 (meltrin beta) 1 0 0 0 0 21 81792 ADAMTS12 ADAM metallopeptidase with thrombospondin type 1 motif, 12 1 0 0 0 0 22 9507 ADAMTS4 ADAM metallopeptidase with thrombospondin type 1
    [Show full text]
  • Β-Catenin Confers Resistance to PI3K and AKT Inhibitors and Subverts Foxo3a to Promote Metastasis in Colon Cancer
    β-catenin Confers Resistance to PI3K and AKT inhibitors and Subverts FOXO3a to Promote Metastasis in Colon Cancer Stephan P. Tenbaum1§, Paloma Ordóñez-Morán2§#, Isabel Puig1§, Irene Chicote1, Oriol Arqués1, Stefania Landolfi3, Yolanda Fernández4, José Raúl Herance5, Juan D. Gispert5, Leire Mendizabal6, Susana Aguilar7, Santiago Ramón y Cajal3, Simó Schwartz Jr4, Ana Vivancos6, Eloy Espín8, Santiago Rojas5, José Baselga9, Josep Tabernero10, Alberto Muñoz2, Héctor G. Palmer1* 1 Vall d’Hebrón Institut d´Oncología (VHIO). Stem Cells and Cancer Laboratory. Barcelona, Spain. 2 Instituto de Investigaciones Biomédicas "Alberto Sols", Consejo Superior de Investigaciones Científicas-Universidad Autónoma de Madrid, Madrid, Spain. 3 Department of Pathology, Hospital Universitari Vall d'Hebrón, Universitat Autònoma de Barcelona, Barcelona, Spain. 4 Group of Drug Delivery and Targeting, CIBBIM-Nanomedicine and Networking Biomedical Research Center on Bioengineering, Biomaterials and Nanomedicine (CIBER-BBN), Hospital Universitari Vall d’Hebrón, Institut de Recerca Vall d’Hebrón, Universitat Autònoma de Barcelona, Barcelona, Spain. 5 Parc de Recerca Biomèdica de Barcelona (PRBB), Centre d´Imatge Molecular (CRC) Corporació Sanitària, Barcelona, Spain. 6 Vall d’Hebrón Institut d´Oncología (VHIO). Genomics Cancer Group. Barcelona, Spain. 7 Centre for Respiratory Research, Rayne Institute, University College London, London, United Kingdom, Hematopoietic Stem Cell Laboratory, London Research Institute, Cancer Research UK, London, United Kingdom. 8 General Surgery Service, Hospital Universitari Vall d'Hebrón, Barcelona, Spain. 9 Massachusetts General Hospital Cancer Center, Harvard Medical School, Charlestown, USA; Howard Hughes Medical Institute, Chevy Chase, USA. 10 Medical Oncology Department, Hospital Universitari Vall d'Hebrón, Barcelona, Spain. # Swiss Institute for Experimental Cancer Research, École Polytechnique Fédérale de Lausanne, Lausanne, Switzerland.
    [Show full text]
  • Defining Functional Interactions During Biogenesis of Epithelial Junctions
    ARTICLE Received 11 Dec 2015 | Accepted 13 Oct 2016 | Published 6 Dec 2016 | Updated 5 Jan 2017 DOI: 10.1038/ncomms13542 OPEN Defining functional interactions during biogenesis of epithelial junctions J.C. Erasmus1,*, S. Bruche1,*,w, L. Pizarro1,2,*, N. Maimari1,3,*, T. Poggioli1,w, C. Tomlinson4,J.Lees5, I. Zalivina1,w, A. Wheeler1,w, A. Alberts6, A. Russo2 & V.M.M. Braga1 In spite of extensive recent progress, a comprehensive understanding of how actin cytoskeleton remodelling supports stable junctions remains to be established. Here we design a platform that integrates actin functions with optimized phenotypic clustering and identify new cytoskeletal proteins, their functional hierarchy and pathways that modulate E-cadherin adhesion. Depletion of EEF1A, an actin bundling protein, increases E-cadherin levels at junctions without a corresponding reinforcement of cell–cell contacts. This unexpected result reflects a more dynamic and mobile junctional actin in EEF1A-depleted cells. A partner for EEF1A in cadherin contact maintenance is the formin DIAPH2, which interacts with EEF1A. In contrast, depletion of either the endocytic regulator TRIP10 or the Rho GTPase activator VAV2 reduces E-cadherin levels at junctions. TRIP10 binds to and requires VAV2 function for its junctional localization. Overall, we present new conceptual insights on junction stabilization, which integrate known and novel pathways with impact for epithelial morphogenesis, homeostasis and diseases. 1 National Heart and Lung Institute, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK. 2 Computing Department, Imperial College London, London SW7 2AZ, UK. 3 Bioengineering Department, Faculty of Engineering, Imperial College London, London SW7 2AZ, UK. 4 Department of Surgery & Cancer, Faculty of Medicine, Imperial College London, London SW7 2AZ, UK.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • DYNC1I1 (NM 001135556) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC226881 DYNC1I1 (NM_001135556) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: DYNC1I1 (NM_001135556) Human Tagged ORF Clone Tag: Myc-DDK Symbol: DYNC1I1 Synonyms: DNCI1; DNCIC1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 DYNC1I1 (NM_001135556) Human Tagged ORF Clone – RC226881 ORF Nucleotide >RC226881 representing NM_001135556 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTGACAAAAGTGACTTAAAAGCTGAGCTAGAGCGCAAAAAGCAGCGCTTAGCACAGATAAGAGAAG AGAAGAAACGGAAGGAAGAGGAGAGGAAAAAGAAAGAGGCTGATATGCAGCAGAAGAAAGAACCCGTTCA GGACGACTCTGATCTGGATCGCAAACGACGAGAGACAGAGGCTTTGCTGCAAAGCATTGGTATCTCACCG GAGCCGCCTCTAGTCCCAACCCCTATGTCTCCCTCCTCGAAATCAGTGAGCACTCCCAGTGAAGCTGGAA GCCAAGACTCAGGCGATCTGGGGCCATTAACAAGGACCCTGCAGTGGGACACAGACCCCTCAGTGCTCCA GCTGCAGTCAGACTCAGAACTTGGAAGAAGACTGCATAAACTGGGCGTGTCAAAGGTCACCCAAGTGGAT TTCCTGCCAAGGGAAGTAGTGTCCTACTCAAAGGAGACCCAGACTCCTCTTGCCACGCATCAGTCTGAAG AGGATGAGGAAGATGAGGAAATGGTGGAATCTAAAGTTGGCCAGGACTCAGAACTGGAAAATCAGGACAA AAAACAGGAAGTGAAGGAAGCCCCTCCAAGAGAGTTGACAGAGGAAGAAAAACAGCAGATCATTCATTCA
    [Show full text]
  • Supplementary Materials
    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
    [Show full text]
  • Dynamics of the Linc Complex
    DYNAMICS OF THE LINC COMPLEX Loic Gazquez University of Manchester School of Biological Sciences 2017 A thesis submitted to the University of Manchester for the degree of Doctor of Philosophy in the Faculty of Biology, Medicine and Health TABLE OF CONTENTS Table of Contents .................................................................................................................................... 2 Abstract.................................................................................................................................................... 4 Declaration .............................................................................................................................................. 5 Copyright statement ................................................................................................................................ 5 Acknowledgements ................................................................................................................................. 6 I. Introduction .................................................................................................................................. 7 Nuclear Envelope and the LINC complex ................................................................................... 7 I. 1.1. The first LINC component: the SUN ................................................................................ 8 I. 1.2. The second LINC component: the KASH ........................................................................ 8 I. 1.1. Structure
    [Show full text]
  • Circular RNA Hsa Circ 0005114‑Mir‑142‑3P/Mir‑590‑5P‑ Adenomatous
    ONCOLOGY LETTERS 21: 58, 2021 Circular RNA hsa_circ_0005114‑miR‑142‑3p/miR‑590‑5p‑ adenomatous polyposis coli protein axis as a potential target for treatment of glioma BO WEI1*, LE WANG2* and JINGWEI ZHAO1 1Department of Neurosurgery, China‑Japan Union Hospital of Jilin University, Changchun, Jilin 130033; 2Department of Ophthalmology, The First Hospital of Jilin University, Jilin University, Changchun, Jilin 130021, P.R. China Received September 12, 2019; Accepted October 22, 2020 DOI: 10.3892/ol.2020.12320 Abstract. Glioma is the most common type of brain tumor APC expression with a good overall survival rate. UALCAN and is associated with a high mortality rate. Despite recent analysis using TCGA data of glioblastoma multiforme and the advances in treatment options, the overall prognosis in patients GSE25632 and GSE103229 microarray datasets showed that with glioma remains poor. Studies have suggested that circular hsa‑miR‑142‑3p/hsa‑miR‑590‑5p was upregulated and APC (circ)RNAs serve important roles in the development and was downregulated. Thus, hsa‑miR‑142‑3p/hsa‑miR‑590‑5p‑ progression of glioma and may have potential as therapeutic APC‑related circ/ceRNA axes may be important in glioma, targets. However, the expression profiles of circRNAs and their and hsa_circ_0005114 interacted with both of these miRNAs. functions in glioma have rarely been studied. The present study Functional analysis showed that hsa_circ_0005114 was aimed to screen differentially expressed circRNAs (DECs) involved in insulin secretion, while APC was associated with between glioma and normal brain tissues using sequencing the Wnt signaling pathway. In conclusion, hsa_circ_0005114‑ data collected from the Gene Expression Omnibus database miR‑142‑3p/miR‑590‑5p‑APC ceRNA axes may be potential (GSE86202 and GSE92322 datasets) and explain their mecha‑ targets for the treatment of glioma.
    [Show full text]
  • Transcriptional Control of Tissue-Resident Memory T Cell Generation
    Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Graduate School of Arts and Sciences COLUMBIA UNIVERSITY 2019 © 2019 Filip Cvetkovski All rights reserved ABSTRACT Transcriptional control of tissue-resident memory T cell generation Filip Cvetkovski Tissue-resident memory T cells (TRM) are a non-circulating subset of memory that are maintained at sites of pathogen entry and mediate optimal protection against reinfection. Lung TRM can be generated in response to respiratory infection or vaccination, however, the molecular pathways involved in CD4+TRM establishment have not been defined. Here, we performed transcriptional profiling of influenza-specific lung CD4+TRM following influenza infection to identify pathways implicated in CD4+TRM generation and homeostasis. Lung CD4+TRM displayed a unique transcriptional profile distinct from spleen memory, including up-regulation of a gene network induced by the transcription factor IRF4, a known regulator of effector T cell differentiation. In addition, the gene expression profile of lung CD4+TRM was enriched in gene sets previously described in tissue-resident regulatory T cells. Up-regulation of immunomodulatory molecules such as CTLA-4, PD-1, and ICOS, suggested a potential regulatory role for CD4+TRM in tissues. Using loss-of-function genetic experiments in mice, we demonstrate that IRF4 is required for the generation of lung-localized pathogen-specific effector CD4+T cells during acute influenza infection. Influenza-specific IRF4−/− T cells failed to fully express CD44, and maintained high levels of CD62L compared to wild type, suggesting a defect in complete differentiation into lung-tropic effector T cells.
    [Show full text]