Running title: dynein light intermediate chain mutant mouse Behavioural and other phenotypes in a cytoplasmic dynein light intermediate chain 1 mutant mouse Gareth T. Banks1,*, Matilda A. Haas5,*, Samantha Line6, Hazel L. Shepherd6, Mona AlQatari7, Sammy Stewart7, Ida Rishal8, Amelia Philpott9, Bernadett Kalmar2, Anna Kuta1, Michael Groves3, Nicholas Parkinson1, Abraham Acevedo-Arozena10, Sebastian Brandner3,4, David Bannerman6, Linda Greensmith2,4, Majid Hafezparast9, Martin Koltzenburg2,4,7, Robert Deacon6, Mike Fainzilber8, Elizabeth M.C. Fisher1,4 1Department of Neurodegenerative Disease, 2Sobell Department of Motor Science and Movement Disorders, 3Division of Neuropathology, 4MRC Centre for Neuromuscular Diseases, UCL Institute of Neurology, Queen Square, London, WC1N 3BG, UK 5MRC National Institute for Medical Research, Mill Hill, London NW7 1AA, UK 6Department of Experimental Psychology, University of Oxford, Oxford, OX1 3UD, UK 7UCL Institute of Child Health, Guilford Street, London, WC1N 1EH, UK 8Department of Biological Chemistry, Weizmann Institute of Science, 76100 Rehovot, Israel 9School of Life Sciences, University of Sussex, Brighton, BN1 9QG, UK 10MRC Mammalian Genetics Unit, Harwell, OX11 ORD, UK *These authors contributed equally. Corresponding author: Elizabeth M.C. Fisher Email:
[email protected] Telephone: +44 207 837 3611 Fax: +44 207 676 2180 1 Supplementary Information Materials and methods Heteroduplex screening of the MRC Mammalian Genetics Unit ENU mutagenised DNA archive Genomic DNA samples were pooled 4 into 1 well (12.5ng per individual genomic DNA, total 50ng per well) and were amplified to produce 248bp fragment that included exon 5 of Dync1li1: forward primer: CACATGGTTCCATTTCTAAACTG; reverse primer: GACAGTTAGTTGCAAGGTCAG. Resulting amplicons were repeatedly denatured and reannealed before screening for the presence of heteroduplex regions on a Transgenomic WAVE model 4500 (http://www.transgenomic.com/pd/items/WAVE%204500%20all.asp).