DYNC1I1 (NM 001135556) Human Tagged ORF Clone Product Data
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Investigation of Candidate Genes and Mechanisms Underlying Obesity
Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between -
Serum Albumin OS=Homo Sapiens
Protein Name Cluster of Glial fibrillary acidic protein OS=Homo sapiens GN=GFAP PE=1 SV=1 (P14136) Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 Cluster of Isoform 3 of Plectin OS=Homo sapiens GN=PLEC (Q15149-3) Cluster of Hemoglobin subunit beta OS=Homo sapiens GN=HBB PE=1 SV=2 (P68871) Vimentin OS=Homo sapiens GN=VIM PE=1 SV=4 Cluster of Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 (Q13509) Cluster of Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 (P60709) Cluster of Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 (P68363) Cluster of Isoform 2 of Spectrin alpha chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTAN1 (Q13813-2) Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 Cluster of Spectrin beta chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTBN1 PE=1 SV=2 (Q01082) Cluster of Pyruvate kinase isozymes M1/M2 OS=Homo sapiens GN=PKM PE=1 SV=4 (P14618) Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 Clathrin heavy chain 1 OS=Homo sapiens GN=CLTC PE=1 SV=5 Filamin-A OS=Homo sapiens GN=FLNA PE=1 SV=4 Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens GN=DYNC1H1 PE=1 SV=5 Cluster of ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide OS=Homo sapiens GN=ATP1A2 PE=3 SV=1 (B1AKY9) Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 Dihydropyrimidinase-related protein 2 OS=Homo sapiens GN=DPYSL2 PE=1 SV=1 Cluster of Alpha-actinin-1 OS=Homo sapiens GN=ACTN1 PE=1 SV=2 (P12814) 60 kDa heat shock protein, mitochondrial OS=Homo -
Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations
Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations by Jelena Perovanovic M.S. in Molecular Biology and Physiology, September 2009, University of Belgrade M.Phil. in Molecular Medicine, August 2013, The George Washington University A Dissertation submitted to The Faculty of The Columbian College of Arts and Sciences of The George Washington University in partial fulfillment of the requirements for the degree of Doctor of Philosophy August 31, 2015 Dissertation directed by Eric P. Hoffman Professor of Integrative Systems Biology The Columbian College of Arts and Sciences of The George Washington University certifies that Jelena Perovanovic has passed the Final Examination for the degree of Doctor of Philosophy as of May 5, 2015. This is the final and approved form of the dissertation. Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations Jelena Perovanovic Dissertation Research Committee: Eric P. Hoffman, Professor of Integrative Systems Biology, Dissertation Director Anamaris Colberg-Poley, Professor of Integrative Systems Biology, Committee Member Robert J. Freishtat, Associate Professor of Pediatrics, Committee Member Vittorio Sartorelli, Senior Investigator, National Institutes of Health, Committee Member ii © Copyright 2015 by Jelena Perovanovic All rights reserved iii Acknowledgments I am deeply indebted to countless individuals for their support and encouragement during the past five years of graduate studies. First and foremost, I would like to express my gratitude to my mentor, Dr. Eric P. Hoffman, for his unwavering support and guidance, and keen attention to my professional development. This Dissertation would not have been possible without the critical input he provided and the engaging environment he created. -
Site-Specific and Common Prostate Cancer Metastasis Genes
life Article Site-Specific and Common Prostate Cancer Metastasis Genes as Suggested by Meta-Analysis of Gene Expression Data Ivana Samaržija 1,2 1 Laboratory for Epigenomics, Division of Molecular Medicine, Ruder¯ Boškovi´cInstitute, Bijeniˇcka54, 10000 Zagreb, Croatia; [email protected] 2 Laboratory for Cell Biology and Signalling, Division of Molecular Biology, Ruder¯ Boškovi´cInstitute, Bijeniˇcka54, 10000 Zagreb, Croatia Abstract: Anticancer therapies mainly target primary tumor growth and little attention is given to the events driving metastasis formation. Metastatic prostate cancer, in comparison to localized disease, has a much worse prognosis. In the work presented here, groups of genes that are common to prostate cancer metastatic cells from bones, lymph nodes, and liver and those that are site-specific were delineated. The purpose of the study was to dissect potential markers and targets of anticancer therapies considering the common characteristics and differences in transcriptional programs of metastatic cells from different secondary sites. To that end, a meta-analysis of gene expression data of prostate cancer datasets from the GEO database was conducted. Genes with differential expression in all metastatic sites analyzed belong to the class of filaments, focal adhesion, and androgen receptor signaling. Bone metastases undergo the largest transcriptional changes that are highly enriched for the term of the chemokine signaling pathway, while lymph node metastasis show perturbation in signaling cascades. Liver metastases change the expression of genes in a way that is reminiscent of processes that take place in the target organ. Survival analysis for the common hub genes revealed Citation: Samaržija, I. Site-Specific involvements in prostate cancer prognosis and suggested potential biomarkers. -
UC San Diego UC San Diego Electronic Theses and Dissertations
UC San Diego UC San Diego Electronic Theses and Dissertations Title Insights from reconstructing cellular networks in transcription, stress, and cancer Permalink https://escholarship.org/uc/item/6s97497m Authors Ke, Eugene Yunghung Ke, Eugene Yunghung Publication Date 2012 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, SAN DIEGO Insights from Reconstructing Cellular Networks in Transcription, Stress, and Cancer A dissertation submitted in the partial satisfaction of the requirements for the degree Doctor of Philosophy in Bioinformatics and Systems Biology by Eugene Yunghung Ke Committee in charge: Professor Shankar Subramaniam, Chair Professor Inder Verma, Co-Chair Professor Web Cavenee Professor Alexander Hoffmann Professor Bing Ren 2012 The Dissertation of Eugene Yunghung Ke is approved, and it is acceptable in quality and form for the publication on microfilm and electronically ________________________________________________________________ ________________________________________________________________ ________________________________________________________________ ________________________________________________________________ Co-Chair ________________________________________________________________ Chair University of California, San Diego 2012 iii DEDICATION To my parents, Victor and Tai-Lee Ke iv EPIGRAPH [T]here are known knowns; there are things we know we know. We also know there are known unknowns; that is to say we know there -
Host Cell Factors Necessary for Influenza a Infection: Meta-Analysis of Genome Wide Studies
Host Cell Factors Necessary for Influenza A Infection: Meta-Analysis of Genome Wide Studies Juliana S. Capitanio and Richard W. Wozniak Department of Cell Biology, Faculty of Medicine and Dentistry, University of Alberta Abstract: The Influenza A virus belongs to the Orthomyxoviridae family. Influenza virus infection occurs yearly in all countries of the world. It usually kills between 250,000 and 500,000 people and causes severe illness in millions more. Over the last century alone we have seen 3 global influenza pandemics. The great human and financial cost of this disease has made it the second most studied virus today, behind HIV. Recently, several genome-wide RNA interference studies have focused on identifying host molecules that participate in Influen- za infection. We used nine of these studies for this meta-analysis. Even though the overlap among genes identified in multiple screens was small, network analysis indicates that similar protein complexes and biological functions of the host were present. As a result, several host gene complexes important for the Influenza virus life cycle were identified. The biological function and the relevance of each identified protein complex in the Influenza virus life cycle is further detailed in this paper. Background and PA bound to the viral genome via nucleoprotein (NP). The viral core is enveloped by a lipid membrane derived from Influenza virus the host cell. The viral protein M1 underlies the membrane and anchors NEP/NS2. Hemagglutinin (HA), neuraminidase Viruses are the simplest life form on earth. They parasite host (NA), and M2 proteins are inserted into the envelope, facing organisms and subvert the host cellular machinery for differ- the viral exterior. -
Downregulation of Carnitine Acyl-Carnitine Translocase by Mirnas
Page 1 of 288 Diabetes 1 Downregulation of Carnitine acyl-carnitine translocase by miRNAs 132 and 212 amplifies glucose-stimulated insulin secretion Mufaddal S. Soni1, Mary E. Rabaglia1, Sushant Bhatnagar1, Jin Shang2, Olga Ilkayeva3, Randall Mynatt4, Yun-Ping Zhou2, Eric E. Schadt6, Nancy A.Thornberry2, Deborah M. Muoio5, Mark P. Keller1 and Alan D. Attie1 From the 1Department of Biochemistry, University of Wisconsin, Madison, Wisconsin; 2Department of Metabolic Disorders-Diabetes, Merck Research Laboratories, Rahway, New Jersey; 3Sarah W. Stedman Nutrition and Metabolism Center, Duke Institute of Molecular Physiology, 5Departments of Medicine and Pharmacology and Cancer Biology, Durham, North Carolina. 4Pennington Biomedical Research Center, Louisiana State University system, Baton Rouge, Louisiana; 6Institute for Genomics and Multiscale Biology, Mount Sinai School of Medicine, New York, New York. Corresponding author Alan D. Attie, 543A Biochemistry Addition, 433 Babcock Drive, Department of Biochemistry, University of Wisconsin-Madison, Madison, Wisconsin, (608) 262-1372 (Ph), (608) 263-9608 (fax), [email protected]. Running Title: Fatty acyl-carnitines enhance insulin secretion Abstract word count: 163 Main text Word count: 3960 Number of tables: 0 Number of figures: 5 Diabetes Publish Ahead of Print, published online June 26, 2014 Diabetes Page 2 of 288 2 ABSTRACT We previously demonstrated that micro-RNAs 132 and 212 are differentially upregulated in response to obesity in two mouse strains that differ in their susceptibility to obesity-induced diabetes. Here we show the overexpression of micro-RNAs 132 and 212 enhances insulin secretion (IS) in response to glucose and other secretagogues including non-fuel stimuli. We determined that carnitine acyl-carnitine translocase (CACT, Slc25a20) is a direct target of these miRNAs. -
Transforming Growth Factor ß1-Mediated Functional Inhibition Of
Myelodysplastic Syndromes SUPPLEMENTARY APPENDIX Transforming growth factor 1- mediated functional inhibition of mesenchymal stromal celβls in myelodysplastic syndromes and acute myeloid leukemia Stefanie Geyh, 1* Manuel Rodríguez-Paredes, 1,2 * Paul Jäger, 1 Annemarie Koch, 1 Felix Bormann, 2 Julian Gutekunst, 2 Christoph Zilkens, 3 Ulrich Germing, 1 Guido Kobbe, 1 Frank Lyko, 2 Rainer Haas 1 and Thomas Schroeder 1 1Department of Hematology, Oncology and Clinical Immunology, University of Duesseldorf, Medical Faculty; 2Division of Epigenetics, DKFZ- ZMBH Alliance, German Cancer Research Center, Heidelberg and 3Department of Orthopedic Surgery, University of Duesseldorf, Medical Faculty, Germany *SG and MR-P contributed equally to this work. ©2018 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol. 2017.186734 Received: December 19, 2017. Accepted: May 14, 2018. Pre-published: May 17, 2018. Correspondence: [email protected] Figure S1 Downregulated genes Downregulated genes Upregulated Figure S1. Heatmaps showing the 50 most upregulated and downregulated genes between the 3 healthy MSC controls and the 9 RCMD-, RAEB- and AML-derived MSC samples. Color scale depicts the rlog-transformed FPKM values for each gene and every sample. Figure S2 Downregulated genes Downregulated genes Upregulated Figure S2. Heatmaps showing the 50 most upregulated and downregulated genes between the 3 healthy MSC controls and the 3 RCMD, RAEB and AML MSC samples, respectively. Color scales depict the rlog-transformed FPKM values for each gene and every sample. Figure S3 A. B. 0.0015 *** ** <-3 -2 0.0010 RCMD RAEB AML -1 0 1 0.0005 Log2FC LTF 2 CCL26/GAPDH INHBB >3 0.0000 TGFB2 y S h D ML M A ealt ll LTF H a EGF 0.003 *** ** INHBB TGFB2 0.002 INHBB IGFBP7 0.001 GDF11 LIF/GAPDH BMP1 0.000 y L th M TNFSF12 l A FGF13 ea ll MDS H a FGF13 0.0015 * TNFSF10 TNFSF10 0.0010 0.0005 SPP1/GAPDH 0.0000 y th l AML ea H all MDS Figure S3. -
Skeletal Muscle Expression of Phosphofructokinase Is Influenced by Genetic Variation and Associated with Insulin Sensitivity
Diabetes Page 2 of 64 Skeletal Muscle Expression of Phosphofructokinase is Influenced by Genetic Variation and Associated with Insulin Sensitivity Sarah Keildson,1* Joao Fadista,2* Claes Ladenvall,2 Åsa K. Hedman,1 Targ Elgzyri,2 Kerrin S. Small,3,4 Elin Grundberg,3.4 Alexandra C. Nica,5 Daniel Glass,3 J. Brent Richards,3,6 Amy Barrett,7 James Nisbet,4 Hou-Feng Zheng,6 Tina Rönn,2 Kristoffer Ström,2,8 Karl-Fredrik Eriksson,2 Inga Prokopenko,1 MAGIC consortium, DIAGRAM consortium, MuTHER consortium, Timothy D Spector,3 Emmanouil T. Dermitzakis,5 Panos Deloukas,4 Mark I McCarthy,1,7,10 Johan Rung,9 Leif Groop,2 Paul W. Franks,11 Cecilia M. Lindgren,1,12* Ola Hansson,2* 1. Wellcome Trust Centre for Human Genetics, University of Oxford, Oxford, OX3 7BN, United Kingdom 2. Lund University Diabetes Center, Department of Clinical Sciences, Diabetes and Endocrinology, Skåne University Hospital Malmö, Lund University, Malmö 20502, Sweden 3. Department of Twin Research and Genetic Epidemiology, King’s College London, London, SE1 7EH, United Kingdom 4. Wellcome Trust Sanger Institute, Wellcome Trust Genome Campus, Hinxton, CB10 1SA, United Kingdom 5. Department of Genetic Medicine and Development, University of Geneva, Medical School, 1211 Geneva 4, Switzerland 6. Department of Medicine, Human Genetics, Epidemiology and Biostatistics, McGill University, Lady Davis Institute for Medical Research, Jewish General Hospital, Montreal, Quebec, H3T 1E2, Canada 7. Oxford Centre for Diabetes, Endocrinology & Metabolism, University of Oxford, Churchill Hospital, Oxford, OX3 7LJ, United Kingdom 8. Swedish Winter Sports Research Centre, Department of Health Sciences, Mid Sweden University, SE-83125 Östersund, Sweden 9. -
Oxidized Phospholipids Regulate Amino Acid Metabolism Through MTHFD2 to Facilitate Nucleotide Release in Endothelial Cells
ARTICLE DOI: 10.1038/s41467-018-04602-0 OPEN Oxidized phospholipids regulate amino acid metabolism through MTHFD2 to facilitate nucleotide release in endothelial cells Juliane Hitzel1,2, Eunjee Lee3,4, Yi Zhang 3,5,Sofia Iris Bibli2,6, Xiaogang Li7, Sven Zukunft 2,6, Beatrice Pflüger1,2, Jiong Hu2,6, Christoph Schürmann1,2, Andrea Estefania Vasconez1,2, James A. Oo1,2, Adelheid Kratzer8,9, Sandeep Kumar 10, Flávia Rezende1,2, Ivana Josipovic1,2, Dominique Thomas11, Hector Giral8,9, Yannick Schreiber12, Gerd Geisslinger11,12, Christian Fork1,2, Xia Yang13, Fragiska Sigala14, Casey E. Romanoski15, Jens Kroll7, Hanjoong Jo 10, Ulf Landmesser8,9,16, Aldons J. Lusis17, 1234567890():,; Dmitry Namgaladze18, Ingrid Fleming2,6, Matthias S. Leisegang1,2, Jun Zhu 3,4 & Ralf P. Brandes1,2 Oxidized phospholipids (oxPAPC) induce endothelial dysfunction and atherosclerosis. Here we show that oxPAPC induce a gene network regulating serine-glycine metabolism with the mitochondrial methylenetetrahydrofolate dehydrogenase/cyclohydrolase (MTHFD2) as a cau- sal regulator using integrative network modeling and Bayesian network analysis in human aortic endothelial cells. The cluster is activated in human plaque material and by atherogenic lipo- proteins isolated from plasma of patients with coronary artery disease (CAD). Single nucleotide polymorphisms (SNPs) within the MTHFD2-controlled cluster associate with CAD. The MTHFD2-controlled cluster redirects metabolism to glycine synthesis to replenish purine nucleotides. Since endothelial cells secrete purines in response to oxPAPC, the MTHFD2- controlled response maintains endothelial ATP. Accordingly, MTHFD2-dependent glycine synthesis is a prerequisite for angiogenesis. Thus, we propose that endothelial cells undergo MTHFD2-mediated reprogramming toward serine-glycine and mitochondrial one-carbon metabolism to compensate for the loss of ATP in response to oxPAPC during atherosclerosis. -
Supplemental Material
Running title: dynein light intermediate chain mutant mouse Behavioural and other phenotypes in a cytoplasmic dynein light intermediate chain 1 mutant mouse Gareth T. Banks1,*, Matilda A. Haas5,*, Samantha Line6, Hazel L. Shepherd6, Mona AlQatari7, Sammy Stewart7, Ida Rishal8, Amelia Philpott9, Bernadett Kalmar2, Anna Kuta1, Michael Groves3, Nicholas Parkinson1, Abraham Acevedo-Arozena10, Sebastian Brandner3,4, David Bannerman6, Linda Greensmith2,4, Majid Hafezparast9, Martin Koltzenburg2,4,7, Robert Deacon6, Mike Fainzilber8, Elizabeth M.C. Fisher1,4 1Department of Neurodegenerative Disease, 2Sobell Department of Motor Science and Movement Disorders, 3Division of Neuropathology, 4MRC Centre for Neuromuscular Diseases, UCL Institute of Neurology, Queen Square, London, WC1N 3BG, UK 5MRC National Institute for Medical Research, Mill Hill, London NW7 1AA, UK 6Department of Experimental Psychology, University of Oxford, Oxford, OX1 3UD, UK 7UCL Institute of Child Health, Guilford Street, London, WC1N 1EH, UK 8Department of Biological Chemistry, Weizmann Institute of Science, 76100 Rehovot, Israel 9School of Life Sciences, University of Sussex, Brighton, BN1 9QG, UK 10MRC Mammalian Genetics Unit, Harwell, OX11 ORD, UK *These authors contributed equally. Corresponding author: Elizabeth M.C. Fisher Email: [email protected] Telephone: +44 207 837 3611 Fax: +44 207 676 2180 1 Supplementary Information Materials and methods Heteroduplex screening of the MRC Mammalian Genetics Unit ENU mutagenised DNA archive Genomic DNA samples were pooled 4 into 1 well (12.5ng per individual genomic DNA, total 50ng per well) and were amplified to produce 248bp fragment that included exon 5 of Dync1li1: forward primer: CACATGGTTCCATTTCTAAACTG; reverse primer: GACAGTTAGTTGCAAGGTCAG. Resulting amplicons were repeatedly denatured and reannealed before screening for the presence of heteroduplex regions on a Transgenomic WAVE model 4500 (http://www.transgenomic.com/pd/items/WAVE%204500%20all.asp).