Site-Specific and Common Prostate Cancer Metastasis Genes
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Kinesin-14 Motor Protein KIFC1 Participates in DNA Synthesis and Chromatin Maintenance Ya-Lan Wei1 and Wan-Xi Yang 1
Wei and Yang Cell Death and Disease (2019) 10:402 https://doi.org/10.1038/s41419-019-1619-9 Cell Death & Disease ARTICLE Open Access Kinesin-14 motor protein KIFC1 participates in DNA synthesis and chromatin maintenance Ya-Lan Wei1 and Wan-Xi Yang 1 Abstract The nuclear localization signal (NLS) in kinesin-14 KIFC1 is associated with nuclear importins and Ran gradient, but detailed mechanism remains unknown. In this study, we found that KIFC1 proteins have specific transport characteristics during cell cycle. In the absence of KIFC1, cell cycle kinetics decrease significantly with a prolonged S phase. After KIFC1 overexpression, the duration of S phase becomes shorten. KIFC1 may transport the recombinant/ replicate-related proteins into the nucleus, meanwhile avoiding excessive KIFC1 in the cytoplasm, which results in aberrant microtubule bundling. Interestingly, the deletion of kifc1 in human cells results in a higher ratio of aberrant nuclear membrane, and the degradation of lamin B and lamin A/C. We also found that kifc1 deletion leads to defects in metaphase mitotic spindle assembly, and then results in chromosome structural abnormality. The kifc1-/- cells finally form micronuclei in daughter cells, and results in aneuploidy and chromosome loss in cell cycle. In this study, we demonstrate that kinesin-14 KIFC1 proteins involve in regulating DNA synthesis in S phase, and chromatin maintenance in mitosis, and maintain cell growth in a nuclear transport-independent way. 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; Introduction KIFC1 mainly cluster the spindles involving in chromo- Kinesin-14 KIFC1 transports various cargos along the some alignment and segregation. While chromokinesins microtubule to the minus ends1. -
Roles and Mechanisms of Kinesin-6 KIF20A in Spindle Organization During Cell Division T ⁎ Wen-Da Wu, Kai-Wei Yu, Ning Zhong, Yu Xiao, Zhen-Yu She
European Journal of Cell Biology 98 (2019) 74–80 Contents lists available at ScienceDirect European Journal of Cell Biology journal homepage: www.elsevier.com/locate/ejcb Review Roles and mechanisms of Kinesin-6 KIF20A in spindle organization during cell division T ⁎ Wen-Da Wu, Kai-Wei Yu, Ning Zhong, Yu Xiao, Zhen-Yu She Department of Cell Biology and Genetics/Center for Cell and Developmental Biology, The School of Basic Medical Sciences, Fujian Medical University, Fuzhou, Fujian 350108, China ARTICLE INFO ABSTRACT Keywords: Mitotic kinesin is crucial for spindle assembly and chromosome segregation in cell division. KIF20A/MKlp2, a Kinesin-6 member of kinesin-6 subfamily, plays important roles in the central spindle organization at anaphase and cy- KIF20A tokinesis. In this review, we briefly introduce the discovery and classification of kinesin-6 motors in model Microtubule organisms, and summarize the biochemical features and mechanics of KIF20A proteins. We emphasize the Anaphase complicated interactions of KIF20A with partner proteins, including MKlp1, Plk1 and Rab6. Particularly, we Spindle assembly highlight the regulation of Cdk1 and chromosomal passenger complex on kinesin-6 KIF20A at late stage of Mitosis mitosis. We summarized the multiple functions of KIF20A in central spindle assembly and the formation of cleavage furrow in both mitosis and meiosis. In addition, we conclude the expression patterns of KIF20A in tumorigenesis and its applications in tumor therapy. 1. Introduction kinesin superfamily proteins (Miki et al., 2005). Kinesin-6 subfamily is comprised of KIF20A (Lawrence et al., 2004), KIF20B (MPP1) Kinesin superfamily proteins (KIFs) are molecular motors that (Kamimoto et al., 2001; Matsumoto-Taniura et al., 1996; Westendorf mediate the transport of various cargos, including the newly synthe- et al., 1994) and MKlp1 (Lawrence et al., 2004; Nislow et al., 1990; sized protein complexes, vesicles and mRNAs along the microtubule Sellitto and Kuriyama, 1988). -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
DYNC1I1 (NM 001135556) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC226881 DYNC1I1 (NM_001135556) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: DYNC1I1 (NM_001135556) Human Tagged ORF Clone Tag: Myc-DDK Symbol: DYNC1I1 Synonyms: DNCI1; DNCIC1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 DYNC1I1 (NM_001135556) Human Tagged ORF Clone – RC226881 ORF Nucleotide >RC226881 representing NM_001135556 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTGACAAAAGTGACTTAAAAGCTGAGCTAGAGCGCAAAAAGCAGCGCTTAGCACAGATAAGAGAAG AGAAGAAACGGAAGGAAGAGGAGAGGAAAAAGAAAGAGGCTGATATGCAGCAGAAGAAAGAACCCGTTCA GGACGACTCTGATCTGGATCGCAAACGACGAGAGACAGAGGCTTTGCTGCAAAGCATTGGTATCTCACCG GAGCCGCCTCTAGTCCCAACCCCTATGTCTCCCTCCTCGAAATCAGTGAGCACTCCCAGTGAAGCTGGAA GCCAAGACTCAGGCGATCTGGGGCCATTAACAAGGACCCTGCAGTGGGACACAGACCCCTCAGTGCTCCA GCTGCAGTCAGACTCAGAACTTGGAAGAAGACTGCATAAACTGGGCGTGTCAAAGGTCACCCAAGTGGAT TTCCTGCCAAGGGAAGTAGTGTCCTACTCAAAGGAGACCCAGACTCCTCTTGCCACGCATCAGTCTGAAG AGGATGAGGAAGATGAGGAAATGGTGGAATCTAAAGTTGGCCAGGACTCAGAACTGGAAAATCAGGACAA AAAACAGGAAGTGAAGGAAGCCCCTCCAAGAGAGTTGACAGAGGAAGAAAAACAGCAGATCATTCATTCA -
Prox1regulates the Subtype-Specific Development of Caudal Ganglionic
The Journal of Neuroscience, September 16, 2015 • 35(37):12869–12889 • 12869 Development/Plasticity/Repair Prox1 Regulates the Subtype-Specific Development of Caudal Ganglionic Eminence-Derived GABAergic Cortical Interneurons X Goichi Miyoshi,1 Allison Young,1 Timothy Petros,1 Theofanis Karayannis,1 Melissa McKenzie Chang,1 Alfonso Lavado,2 Tomohiko Iwano,3 Miho Nakajima,4 Hiroki Taniguchi,5 Z. Josh Huang,5 XNathaniel Heintz,4 Guillermo Oliver,2 Fumio Matsuzaki,3 Robert P. Machold,1 and Gord Fishell1 1Department of Neuroscience and Physiology, NYU Neuroscience Institute, Smilow Research Center, New York University School of Medicine, New York, New York 10016, 2Department of Genetics & Tumor Cell Biology, St. Jude Children’s Research Hospital, Memphis, Tennessee 38105, 3Laboratory for Cell Asymmetry, RIKEN Center for Developmental Biology, Kobe 650-0047, Japan, 4Laboratory of Molecular Biology, Howard Hughes Medical Institute, GENSAT Project, The Rockefeller University, New York, New York 10065, and 5Cold Spring Harbor Laboratory, Cold Spring Harbor, New York 11724 Neurogliaform (RELNϩ) and bipolar (VIPϩ) GABAergic interneurons of the mammalian cerebral cortex provide critical inhibition locally within the superficial layers. While these subtypes are known to originate from the embryonic caudal ganglionic eminence (CGE), the specific genetic programs that direct their positioning, maturation, and integration into the cortical network have not been eluci- dated. Here, we report that in mice expression of the transcription factor Prox1 is selectively maintained in postmitotic CGE-derived cortical interneuron precursors and that loss of Prox1 impairs the integration of these cells into superficial layers. Moreover, Prox1 differentially regulates the postnatal maturation of each specific subtype originating from the CGE (RELN, Calb2/VIP, and VIP). -
Molecular Profiling of Peripheral Blood Is Associated with Circulating Tumor Cells Content and Poor Survival in Metastatic Castration-Resistant Prostate Cancer
www.impactjournals.com/oncotarget/ Oncotarget, Vol. 6, No. 12 Molecular profiling of peripheral blood is associated with circulating tumor cells content and poor survival in metastatic castration-resistant prostate cancer Mercedes Marín-Aguilera1, Òscar Reig1,2, Juan José Lozano3, Natalia Jiménez1, Susana García-Recio1,4, Nadina Erill5, Lydia Gaba2, Andrea Tagliapietra2, Vanesa Ortega2, Gemma Carrera6, Anna Colomer5, Pedro Gascón4 and Begoña Mellado1,2 1 Translational Genomics Group and Targeted Therapeutics in Solid Tumors Group, Institut d’Investigacions Biomèdiques August Pi i Sunyer (IDIBAPS), Barcelona, Spain 2 Medical Oncology Department, Hospital Clínic, Barcelona, Spain 3 Bioinformatics Platform Department, Centro de Investigación Biomédica en Red en el Área temática de Enfermedades Hepáticas y Digestivas (CIBEREHD), Hospital Clínic, Barcelona, Spain 4 Laboratory of Translational Oncology, Fundació Clínic per a la Recerca Biomèdica, Barcelona, Spain 5 Althia, Barcelona, Spain 6 Medical Oncology Department, Hospital Plató, Barcelona, Spain Correspondence to: Begoña Mellado, email: [email protected] Keywords: circulating tumor cells, peripheral blood, microarrays, cell search system Received: January 22, 2015 Accepted: February 14, 2015 Published: March 12, 2015 This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT The enumeration of circulating -
Investigation of Candidate Genes and Mechanisms Underlying Obesity
Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between -
Redefining the Specificity of Phosphoinositide-Binding by Human
bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.163253; this version posted June 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. Redefining the specificity of phosphoinositide-binding by human PH domain-containing proteins Nilmani Singh1†, Adriana Reyes-Ordoñez1†, Michael A. Compagnone1, Jesus F. Moreno Castillo1, Benjamin J. Leslie2, Taekjip Ha2,3,4,5, Jie Chen1* 1Department of Cell & Developmental Biology, University of Illinois at Urbana-Champaign, Urbana, IL 61801; 2Department of Biophysics and Biophysical Chemistry, Johns Hopkins University School of Medicine, Baltimore, MD 21205; 3Department of Biophysics, Johns Hopkins University, Baltimore, MD 21218; 4Department of Biomedical Engineering, Johns Hopkins University, Baltimore, MD 21205; 5Howard Hughes Medical Institute, Baltimore, MD 21205, USA †These authors contributed equally to this work. *Correspondence: [email protected]. bioRxiv preprint doi: https://doi.org/10.1101/2020.06.20.163253; this version posted June 21, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC 4.0 International license. ABSTRACT Pleckstrin homology (PH) domains are presumed to bind phosphoinositides (PIPs), but specific interaction with and regulation by PIPs for most PH domain-containing proteins are unclear. Here we employed a single-molecule pulldown assay to study interactions of lipid vesicles with full-length proteins in mammalian whole cell lysates. -
Serum Albumin OS=Homo Sapiens
Protein Name Cluster of Glial fibrillary acidic protein OS=Homo sapiens GN=GFAP PE=1 SV=1 (P14136) Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 Cluster of Isoform 3 of Plectin OS=Homo sapiens GN=PLEC (Q15149-3) Cluster of Hemoglobin subunit beta OS=Homo sapiens GN=HBB PE=1 SV=2 (P68871) Vimentin OS=Homo sapiens GN=VIM PE=1 SV=4 Cluster of Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 (Q13509) Cluster of Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 (P60709) Cluster of Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 (P68363) Cluster of Isoform 2 of Spectrin alpha chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTAN1 (Q13813-2) Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 Cluster of Spectrin beta chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTBN1 PE=1 SV=2 (Q01082) Cluster of Pyruvate kinase isozymes M1/M2 OS=Homo sapiens GN=PKM PE=1 SV=4 (P14618) Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 Clathrin heavy chain 1 OS=Homo sapiens GN=CLTC PE=1 SV=5 Filamin-A OS=Homo sapiens GN=FLNA PE=1 SV=4 Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens GN=DYNC1H1 PE=1 SV=5 Cluster of ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide OS=Homo sapiens GN=ATP1A2 PE=3 SV=1 (B1AKY9) Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 Dihydropyrimidinase-related protein 2 OS=Homo sapiens GN=DPYSL2 PE=1 SV=1 Cluster of Alpha-actinin-1 OS=Homo sapiens GN=ACTN1 PE=1 SV=2 (P12814) 60 kDa heat shock protein, mitochondrial OS=Homo -
Wnt/Β-Catenin and Sex Hormone Signaling in Endometrial Homeostasis and Cancer
www.impactjournals.com/oncotarget/ Oncotarget, November, Vol.1, No 7 Wnt/Β-Catenin and Sex Hormone Signaling in Endometrial Homeostasis and Cancer Yongyi Wang1,2, Marten van der Zee1,2, Riccardo Fodde2, Leen J Blok1 1 Department of Obstetrics & Gynaecology, Josephine Nefkens Institute, Erasmus University Medical Center Rotterdam, PO Box 2040, 3000 CA Rotterdam, The Netherlands 2 Departments of Pathology, Josephine Nefkens Institute, Erasmus University Medical Center Rotterdam, PO Box 2040, 3000 CA Rotterdam, The Netherlands Correspondence to: Leen J Blok, e-mail: [email protected] Keywords: Wnt/β-catenin, estradiol, progesterone, endometrium Received: September 30, 2010, Accepted: October 11, 2010, Published: October 12, 2010 Copyright: © Wang et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT: A delicate balance between estrogen and progestagen signaling underlies proper functioning of the female reproductive tract and, in particular, the monthly re- and degenerative phases characteristic of the menstrual cycle. Here, we propose that the canonical Wnt/β-catenin signaling pathway may underlie this finely tuned hormonal equilibrium in endometrial homeostasis and, upon its constitutive activation, lead to neoplastic transformation of the endometrium. During the menstrual cycle, estradiol will enhance Wnt/β-catenin signaling in the proliferative phase, while progesterone inhibits Wnt/β-catenin signaling, thus restraining estrogens’ proliferative actions, during the secretory phase. In case of enhanced or unopposed estrogen signaling, constitutive activation of Wnt/β-catenin signaling will trigger endometrial hyperplasia, which may develop further into endometrial cancer. -
Screening and Identification of Hub Genes in Bladder Cancer by Bioinformatics Analysis and KIF11 Is a Potential Prognostic Biomarker
ONCOLOGY LETTERS 21: 205, 2021 Screening and identification of hub genes in bladder cancer by bioinformatics analysis and KIF11 is a potential prognostic biomarker XIAO‑CONG MO1,2*, ZI‑TONG ZHANG1,3*, MENG‑JIA SONG1,2, ZI‑QI ZHOU1,2, JIAN‑XIONG ZENG1,2, YU‑FEI DU1,2, FENG‑ZE SUN1,2, JIE‑YING YANG1,2, JUN‑YI HE1,2, YUE HUANG1,2, JIAN‑CHUAN XIA1,2 and DE‑SHENG WENG1,2 1State Key Laboratory of Oncology in South China, Collaborative Innovation Centre for Cancer Medicine; 2Department of Biotherapy, Sun Yat‑Sen University Cancer Center; 3Department of Radiation Oncology, Sun Yat‑Sen University Cancer Center, Guangzhou, Guangdong 510060, P.R. China Received July 31, 2020; Accepted December 18, 2020 DOI: 10.3892/ol.2021.12466 Abstract. Bladder cancer (BC) is the ninth most common immunohistochemistry and western blotting. In summary, lethal malignancy worldwide. Great efforts have been devoted KIF11 was significantly upregulated in BC and might act as to clarify the pathogenesis of BC, but the underlying molecular a potential prognostic biomarker. The present identification mechanisms remain unclear. To screen for the genes associated of DEGs and hub genes in BC may provide novel insight for with the progression and carcinogenesis of BC, three datasets investigating the molecular mechanisms of BC. were obtained from the Gene Expression Omnibus. A total of 37 tumor and 16 non‑cancerous samples were analyzed to Introduction identify differentially expressed genes (DEGs). Subsequently, 141 genes were identified, including 55 upregulated and Bladder cancer (BC) is the ninth most common malignancy 86 downregulated genes. The protein‑protein interaction worldwide with substantial morbidity and mortality. -
WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT
(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization I International Bureau (10) International Publication Number (43) International Publication Date WO 2019/079361 Al 25 April 2019 (25.04.2019) W 1P O PCT (51) International Patent Classification: CA, CH, CL, CN, CO, CR, CU, CZ, DE, DJ, DK, DM, DO, C12Q 1/68 (2018.01) A61P 31/18 (2006.01) DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, HN, C12Q 1/70 (2006.01) HR, HU, ID, IL, IN, IR, IS, JO, JP, KE, KG, KH, KN, KP, KR, KW, KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, (21) International Application Number: MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, PCT/US2018/056167 OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, (22) International Filing Date: SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, 16 October 2018 (16. 10.2018) TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (25) Filing Language: English (84) Designated States (unless otherwise indicated, for every kind of regional protection available): ARIPO (BW, GH, (26) Publication Language: English GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, TZ, (30) Priority Data: UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, 62/573,025 16 October 2017 (16. 10.2017) US TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, EE, ES, FI, FR, GB, GR, HR, HU, ΓΕ , IS, IT, LT, LU, LV, (71) Applicant: MASSACHUSETTS INSTITUTE OF MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, TECHNOLOGY [US/US]; 77 Massachusetts Avenue, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, Cambridge, Massachusetts 02139 (US).