The Role of Lamin Associated Domains in Global Chromatin Organization and Nuclear Architecture
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
The Connections of Wnt Pathway Components with Cell Cycle and Centrosome: Side Effects Or a Hidden Logic?
Critical Reviews in Biochemistry and Molecular Biology ISSN: 1040-9238 (Print) 1549-7798 (Online) Journal homepage: http://www.tandfonline.com/loi/ibmg20 The connections of Wnt pathway components with cell cycle and centrosome: side effects or a hidden logic? Vítězslav Bryja , Igor Červenka & Lukáš Čajánek To cite this article: Vítězslav Bryja , Igor Červenka & Lukáš Čajánek (2017): The connections of Wnt pathway components with cell cycle and centrosome: side effects or a hidden logic?, Critical Reviews in Biochemistry and Molecular Biology, DOI: 10.1080/10409238.2017.1350135 To link to this article: http://dx.doi.org/10.1080/10409238.2017.1350135 Published online: 25 Jul 2017. Submit your article to this journal Article views: 72 View related articles View Crossmark data Full Terms & Conditions of access and use can be found at http://www.tandfonline.com/action/journalInformation?journalCode=ibmg20 Download by: [Masarykova Univerzita v Brne], [Lukas Cajanek] Date: 08 August 2017, At: 01:58 CRITICAL REVIEWS IN BIOCHEMISTRY AND MOLECULAR BIOLOGY, 2017 https://doi.org/10.1080/10409238.2017.1350135 REVIEW ARTICLE The connections of Wnt pathway components with cell cycle and centrosome: side effects or a hidden logic? Vıtezslav Bryjaa , Igor Cervenka b and Lukas Caj anekc aDepartment of Experimental Biology, Faculty of Science, Masaryk University, Brno, Czech Republic; bMolecular and Cellular Exercise Physiology, Department of Physiology and Pharmacology, Karolinska Institutet, Stockholm, Sweden; cDepartment of Histology and Embryology, Faculty of Medicine, Masaryk University, Brno, Czech Republic ABSTRACT ARTICLE HISTORY Wnt signaling cascade has developed together with multicellularity to orchestrate the develop- Received 10 April 2017 ment and homeostasis of complex structures. -
Download (PDF)
ANALYTICAL SCIENCES NOVEMBER 2020, VOL. 36 1 2020 © The Japan Society for Analytical Chemistry Supporting Information Fig. S1 Detailed MS/MS data of myoglobin. 17 2 ANALYTICAL SCIENCES NOVEMBER 2020, VOL. 36 Table S1 : The protein names (antigens) identified by pH 2.0 solution in the eluted-fraction. These proteins were identified one or more out of six analyses. Accession Description P08908 5-hydroxytryptamine receptor 1A OS=Homo sapiens GN=HTR1A PE=1 SV=3 - [5HT1A_HUMAN] Q9NRR6 72 kDa inositol polyphosphate 5-phosphatase OS=Homo sapiens GN=INPP5E PE=1 SV=2 - [INP5E_HUMAN] P82987 ADAMTS-like protein 3 OS=Homo sapiens GN=ADAMTSL3 PE=2 SV=4 - [ATL3_HUMAN] Q9Y6K8 Adenylate kinase isoenzyme 5 OS=Homo sapiens GN=AK5 PE=1 SV=2 - [KAD5_HUMAN] P02763 Alpha-1-acid glycoprotein 1 OS=Homo sapiens GN=ORM1 PE=1 SV=1 - [A1AG1_HUMAN] P19652 Alpha-1-acid glycoprotein 2 OS=Homo sapiens GN=ORM2 PE=1 SV=2 - [A1AG2_HUMAN] P01011 Alpha-1-antichymotrypsin OS=Homo sapiens GN=SERPINA3 PE=1 SV=2 - [AACT_HUMAN] P01009 Alpha-1-antitrypsin OS=Homo sapiens GN=SERPINA1 PE=1 SV=3 - [A1AT_HUMAN] P04217 Alpha-1B-glycoprotein OS=Homo sapiens GN=A1BG PE=1 SV=4 - [A1BG_HUMAN] P08697 Alpha-2-antiplasmin OS=Homo sapiens GN=SERPINF2 PE=1 SV=3 - [A2AP_HUMAN] P02765 Alpha-2-HS-glycoprotein OS=Homo sapiens GN=AHSG PE=1 SV=1 - [FETUA_HUMAN] P01023 Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 - [A2MG_HUMAN] P01019 Angiotensinogen OS=Homo sapiens GN=AGT PE=1 SV=1 - [ANGT_HUMAN] Q9NQ90 Anoctamin-2 OS=Homo sapiens GN=ANO2 PE=1 SV=2 - [ANO2_HUMAN] P01008 Antithrombin-III -
The Heterotaxy Candidate Gene, TMEM195, Regulates Nuclear Localization of Beta-Catenin
Yale University EliScholar – A Digital Platform for Scholarly Publishing at Yale Yale Medicine Thesis Digital Library School of Medicine January 2015 The etH erotaxy Candidate Gene, Tmem195, Regulates Nuclear Localization Of Beta-Catenin Anna Ruth Duncan Yale School of Medicine, [email protected] Follow this and additional works at: http://elischolar.library.yale.edu/ymtdl Recommended Citation Duncan, Anna Ruth, "The eH terotaxy Candidate Gene, Tmem195, Regulates Nuclear Localization Of Beta-Catenin" (2015). Yale Medicine Thesis Digital Library. 1961. http://elischolar.library.yale.edu/ymtdl/1961 This Open Access Thesis is brought to you for free and open access by the School of Medicine at EliScholar – A Digital Platform for Scholarly Publishing at Yale. It has been accepted for inclusion in Yale Medicine Thesis Digital Library by an authorized administrator of EliScholar – A Digital Platform for Scholarly Publishing at Yale. For more information, please contact [email protected]. The Heterotaxy Candidate Gene, TMEM195, Regulates Nuclear Localization of Beta-catenin A Thesis Submitted to the Yale University School of Medicine in Partial Fulfillment of the Requirements for the Degree of Doctor of Medicine By Anna Ruth Duncan 2015 Abstract THE HETEROTAXY CANDIDATE GENE, TMEM195, REGULATES NUCLEAR LOCALIZATION OF BETA-CATENIN. Anna R. Duncan, John Griffin, Andrew Robson, and Mustafa K. Khokha. Department of Pediatrics, Yale University, School of Medicine, New Haven, CT. Congenital heart disease (CHD) affects 1 in every 130 newborns and is the leading cause of infant mortality (2). Heterotaxy (Htx), a disorder of left-right (LR) development, commonly leads to CHD. Despite aggressive surgical management, patients with Htx have poor survival rates and severe morbidity due to their complex CHD. -
Next Generation Sequencing Panels for Disorders of Sex Development
Next Generation Sequencing Panels for Disorders of Sex Development Disorders of Sex Development – Overview Disorders of sex development (DSDs) occur when sex development does not follow the course of typical male or female patterning. Types of DSDs include congenital development of ambiguous genitalia, disjunction between the internal and external sex anatomy, incomplete development of the sex anatomy, and abnormalities of the development of gonads (such as ovotestes or streak ovaries) (1). Sex chromosome anomalies including Turner syndrome and Klinefelter syndrome as well as sex chromosome mosaicism are also considered to be DSDs. DSDs can be caused by a wide range of genetic abnormalities (2). Determining the etiology of a patient’s DSD can assist in deciding gender assignment, provide recurrence risk information for future pregnancies, and can identify potential health problems such as adrenal crisis or gonadoblastoma (1, 3). Sex chromosome aneuploidy and copy number variation are common genetic causes of DSDs. For this reason, chromosome analysis and/or microarray analysis typically should be the first genetic analysis in the case of a patient with ambiguous genitalia or other suspected disorder of sex development. Identifying whether a patient has a 46,XY or 46,XX karyotype can also be helpful in determining appropriate additional genetic testing. Abnormal/Ambiguous Genitalia Panel Our Abnormal/Ambiguous Genitalia Panel includes mutation analysis of 72 genes associated with both syndromic and non-syndromic DSDs. This comprehensive panel evaluates a broad range of genetic causes of ambiguous or abnormal genitalia, including conditions in which abnormal genitalia are the primary physical finding as well as syndromic conditions that involve abnormal genitalia in addition to other congenital anomalies. -
Sanjay Kumar Gupta
The human CCHC-type Zinc Finger Nucleic Acid Binding Protein (CNBP) binds to the G-rich elements in target mRNA coding sequences and promotes translation Das humane CCHC-Typ-Zinkfinger-Nukleinsäure-Binde-Protein (CNBP) bindet an G-reiche Elemente in der kodierenden Sequenz seiner Ziel-mRNAs und fördert deren Translation Doctoral thesis for a doctoral degree at the Graduate School of Life Sciences, Julius-Maximilians-Universität WürzBurg, Section: Biomedicine suBmitted By Sanjay Kumar Gupta from Varanasi, India WürzBurg, 2016 1 Submitted on: …………………………………………………………..…….. Office stamp Members of the Promotionskomitee: Chairperson: Prof. Dr. Alexander Buchberger Primary Supervisor: Dr. Stefan Juranek Supervisor (Second): Prof. Dr. Utz Fischer Supervisor (Third): Dr. Markus Landthaler Date of Public Defence: …………………………………………….………… Date of Receipt of Certificates: ………………………………………………. 2 Summary The genetic information encoded with in the genes are transcribed and translated to give rise to the functional proteins, which are building block of a cell. At first, it was thought that the regulation of gene expression particularly occurs at the level of transcription By various transcription factors. Recent discoveries have shown the vital role of gene regulation at the level of RNA also known as post-transcriptional gene regulation (PTGR). Apart from non-coding RNAs e.g. micro RNAs, various RNA Binding proteins (RBPs) play essential role in PTGR. RBPs have been implicated in different stages of mRNA life cycle ranging from splicing, processing, transport, localization and decay. In last 20 years studies have shown the presence of hundreds of RBPs across eukaryotic systems many of which are widely conserved. Given the rising numBer of RBPs and their link to human diseases it is quite evident that RBPs have major role in cellular processes and their regulation. -
PDF Output of CLIC (Clustering by Inferred Co-Expression)
PDF Output of CLIC (clustering by inferred co-expression) Dataset: Num of genes in input gene set: 7 Total number of genes: 16493 CLIC PDF output has three sections: 1) Overview of Co-Expression Modules (CEMs) Heatmap shows pairwise correlations between all genes in the input query gene set. Red lines shows the partition of input genes into CEMs, ordered by CEM strength. Each row shows one gene, and the brightness of squares indicates its correlations with other genes. Gene symbols are shown at left side and on the top of the heatmap. 2) Details of each CEM and its expansion CEM+ Top panel shows the posterior selection probability (dataset weights) for top GEO series datasets. Bottom panel shows the CEM genes (blue rows) as well as expanded CEM+ genes (green rows). Each column is one GEO series dataset, sorted by their posterior probability of being selected. The brightness of squares indicates the gene's correlations with CEM genes in the corresponding dataset. CEM+ includes genes that co-express with CEM genes in high-weight datasets, measured by LLR score. 3) Details of each GEO series dataset and its expression profile: Top panel shows the detailed information (e.g. title, summary) for the GEO series dataset. Bottom panel shows the background distribution and the expression profile for CEM genes in this dataset. Overview of Co-Expression Modules (CEMs) with Dataset Weighting Scale of average Pearson correlations Num of Genes in Query Geneset: 7. Num of CEMs: 1. 0.0 0.2 0.4 0.6 0.8 1.0 Ctr9 Rtf1 Paf1 Cdc73 Leo1 Wdr61 Pex2 Ctr9 Rtf1 -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
DYNC1I1 (NM 001135556) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC226881 DYNC1I1 (NM_001135556) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: DYNC1I1 (NM_001135556) Human Tagged ORF Clone Tag: Myc-DDK Symbol: DYNC1I1 Synonyms: DNCI1; DNCIC1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 DYNC1I1 (NM_001135556) Human Tagged ORF Clone – RC226881 ORF Nucleotide >RC226881 representing NM_001135556 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTGACAAAAGTGACTTAAAAGCTGAGCTAGAGCGCAAAAAGCAGCGCTTAGCACAGATAAGAGAAG AGAAGAAACGGAAGGAAGAGGAGAGGAAAAAGAAAGAGGCTGATATGCAGCAGAAGAAAGAACCCGTTCA GGACGACTCTGATCTGGATCGCAAACGACGAGAGACAGAGGCTTTGCTGCAAAGCATTGGTATCTCACCG GAGCCGCCTCTAGTCCCAACCCCTATGTCTCCCTCCTCGAAATCAGTGAGCACTCCCAGTGAAGCTGGAA GCCAAGACTCAGGCGATCTGGGGCCATTAACAAGGACCCTGCAGTGGGACACAGACCCCTCAGTGCTCCA GCTGCAGTCAGACTCAGAACTTGGAAGAAGACTGCATAAACTGGGCGTGTCAAAGGTCACCCAAGTGGAT TTCCTGCCAAGGGAAGTAGTGTCCTACTCAAAGGAGACCCAGACTCCTCTTGCCACGCATCAGTCTGAAG AGGATGAGGAAGATGAGGAAATGGTGGAATCTAAAGTTGGCCAGGACTCAGAACTGGAAAATCAGGACAA AAAACAGGAAGTGAAGGAAGCCCCTCCAAGAGAGTTGACAGAGGAAGAAAAACAGCAGATCATTCATTCA -
ARTICLE Doi:10.1038/Nature10523
ARTICLE doi:10.1038/nature10523 Spatio-temporal transcriptome of the human brain Hyo Jung Kang1*, Yuka Imamura Kawasawa1*, Feng Cheng1*, Ying Zhu1*, Xuming Xu1*, Mingfeng Li1*, Andre´ M. M. Sousa1,2, Mihovil Pletikos1,3, Kyle A. Meyer1, Goran Sedmak1,3, Tobias Guennel4, Yurae Shin1, Matthew B. Johnson1,Zˇeljka Krsnik1, Simone Mayer1,5, Sofia Fertuzinhos1, Sheila Umlauf6, Steven N. Lisgo7, Alexander Vortmeyer8, Daniel R. Weinberger9, Shrikant Mane6, Thomas M. Hyde9,10, Anita Huttner8, Mark Reimers4, Joel E. Kleinman9 & Nenad Sˇestan1 Brain development and function depend on the precise regulation of gene expression. However, our understanding of the complexity and dynamics of the transcriptome of the human brain is incomplete. Here we report the generation and analysis of exon-level transcriptome and associated genotyping data, representing males and females of different ethnicities, from multiple brain regions and neocortical areas of developing and adult post-mortem human brains. We found that 86 per cent of the genes analysed were expressed, and that 90 per cent of these were differentially regulated at the whole-transcript or exon level across brain regions and/or time. The majority of these spatio-temporal differences were detected before birth, with subsequent increases in the similarity among regional transcriptomes. The transcriptome is organized into distinct co-expression networks, and shows sex-biased gene expression and exon usage. We also profiled trajectories of genes associated with neurobiological categories and diseases, and identified associations between single nucleotide polymorphisms and gene expression. This study provides a comprehensive data set on the human brain transcriptome and insights into the transcriptional foundations of human neurodevelopment. -
Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights Into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle
animals Article Integrating Single-Step GWAS and Bipartite Networks Reconstruction Provides Novel Insights into Yearling Weight and Carcass Traits in Hanwoo Beef Cattle Masoumeh Naserkheil 1 , Abolfazl Bahrami 1 , Deukhwan Lee 2,* and Hossein Mehrban 3 1 Department of Animal Science, University College of Agriculture and Natural Resources, University of Tehran, Karaj 77871-31587, Iran; [email protected] (M.N.); [email protected] (A.B.) 2 Department of Animal Life and Environment Sciences, Hankyong National University, Jungang-ro 327, Anseong-si, Gyeonggi-do 17579, Korea 3 Department of Animal Science, Shahrekord University, Shahrekord 88186-34141, Iran; [email protected] * Correspondence: [email protected]; Tel.: +82-31-670-5091 Received: 25 August 2020; Accepted: 6 October 2020; Published: 9 October 2020 Simple Summary: Hanwoo is an indigenous cattle breed in Korea and popular for meat production owing to its rapid growth and high-quality meat. Its yearling weight and carcass traits (backfat thickness, carcass weight, eye muscle area, and marbling score) are economically important for the selection of young and proven bulls. In recent decades, the advent of high throughput genotyping technologies has made it possible to perform genome-wide association studies (GWAS) for the detection of genomic regions associated with traits of economic interest in different species. In this study, we conducted a weighted single-step genome-wide association study which combines all genotypes, phenotypes and pedigree data in one step (ssGBLUP). It allows for the use of all SNPs simultaneously along with all phenotypes from genotyped and ungenotyped animals. Our results revealed 33 relevant genomic regions related to the traits of interest. -
Molecular Characterization of Acute Myeloid Leukemia by Next Generation Sequencing: Identification of Novel Biomarkers and Targets of Personalized Therapies
Alma Mater Studiorum – Università di Bologna Dipartimento di Medicina Specialistica, Diagnostica e Sperimentale Dottorato di Ricerca in Oncologia, Ematologia e Patologia XXX Ciclo Settore Scientifico Disciplinare: MED/15 Settore Concorsuale:06/D3 Molecular characterization of acute myeloid leukemia by Next Generation Sequencing: identification of novel biomarkers and targets of personalized therapies Presentata da: Antonella Padella Coordinatore Prof. Pier-Luigi Lollini Supervisore: Prof. Giovanni Martinelli Esame finale anno 2018 Abstract Acute myeloid leukemia (AML) is a hematopoietic neoplasm that affects myeloid progenitor cells and it is one of the malignancies best studied by next generation sequencing (NGS), showing a highly heterogeneous genetic background. The aim of the study was to characterize the molecular landscape of 2 subgroups of AML patients carrying either chromosomal number alterations (i.e. aneuploidy) or rare fusion genes. We performed whole exome sequencing and we integrated the mutational data with transcriptomic and copy number analysis. We identified the cell cycle, the protein degradation, response to reactive oxygen species, energy metabolism and biosynthetic process as the pathways mostly targeted by alterations in aneuploid AML. Moreover, we identified a 3-gene expression signature including RAD50, PLK1 and CDC20 that characterize this subgroup. Taking advantage of RNA sequencing we aimed at the discovery of novel and rare gene fusions. We detected 9 rare chimeric transcripts, of which partner genes were transcription factors (ZEB2, BCL11B and MAFK) or tumor suppressors (SAV1 and PUF60) rarely translocated across cancer types. Moreover, we detected cryptic events hiding the loss of NF1 and WT1, two recurrently altered genes in AML. Finally, we explored the oncogenic potential of the ZEB2-BCL11B fusion, which revealed no transforming ability in vitro. -
B4GALT2 Rabbit Pab
Leader in Biomolecular Solutions for Life Science B4GALT2 Rabbit pAb Catalog No.: A17573 Basic Information Background Catalog No. This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They A17573 encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to Observed MW similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in 42kDa the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs Calculated MW the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: Category beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. The enzyme encoded by this gene synthesizes N-acetyllactosamine in Primary antibody glycolipids and glycoproteins. Its substrate specificity is affected by alpha-lactalbumin but it is not expressed in lactating mammary tissue. Three transcript variants encoding Applications two different isoforms have been found for this gene. [provided by RefSeq, Jul 2011] WB,IHC Cross-Reactivity Human, Mouse, Rat Recommended Dilutions Immunogen Information WB 1:500 - 1:2000 Gene ID Swiss Prot 8704 O60909 IHC 1:100 - 1:200 Immunogen Recombinant fusion protein containing a sequence corresponding to amino acids 155-271 of human B4GALT2 (NP_085076.2). Synonyms B4Gal-T2;B4Gal-T3;beta4Gal-T2;B4GALT2 Contact Product Information 400-999-6126 Source Isotype Purification Rabbit IgG Affinity purification [email protected] www.abclonal.com.cn Storage Store at -20℃.