Skeletal Muscle Expression of Phosphofructokinase Is Influenced by Genetic Variation and Associated with Insulin Sensitivity
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Program Nr: 1 from the 2004 ASHG Annual Meeting Mutations in A
Program Nr: 1 from the 2004 ASHG Annual Meeting Mutations in a novel member of the chromodomain gene family cause CHARGE syndrome. L.E.L.M. Vissers1, C.M.A. van Ravenswaaij1, R. Admiraal2, J.A. Hurst3, B.B.A. de Vries1, I.M. Janssen1, W.A. van der Vliet1, E.H.L.P.G. Huys1, P.J. de Jong4, B.C.J. Hamel1, E.F.P.M. Schoenmakers1, H.G. Brunner1, A. Geurts van Kessel1, J.A. Veltman1. 1) Dept Human Genetics, UMC Nijmegen, Nijmegen, Netherlands; 2) Dept Otorhinolaryngology, UMC Nijmegen, Nijmegen, Netherlands; 3) Dept Clinical Genetics, The Churchill Hospital, Oxford, United Kingdom; 4) Children's Hospital Oakland Research Institute, BACPAC Resources, Oakland, CA. CHARGE association denotes the non-random occurrence of ocular coloboma, heart defects, choanal atresia, retarded growth and development, genital hypoplasia, ear anomalies and deafness (OMIM #214800). Almost all patients with CHARGE association are sporadic and its cause was unknown. We and others hypothesized that CHARGE association is due to a genomic microdeletion or to a mutation in a gene affecting early embryonic development. In this study array- based comparative genomic hybridization (array CGH) was used to screen patients with CHARGE association for submicroscopic DNA copy number alterations. De novo overlapping microdeletions in 8q12 were identified in two patients on a genome-wide 1 Mb resolution BAC array. A 2.3 Mb region of deletion overlap was defined using a tiling resolution chromosome 8 microarray. Sequence analysis of genes residing within this critical region revealed mutations in the CHD7 gene in 10 of the 17 CHARGE patients without microdeletions, including 7 heterozygous stop-codon mutations. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
Deubiquitinases in Cancer: New Functions and Therapeutic Options
Oncogene (2012) 31, 2373–2388 & 2012 Macmillan Publishers Limited All rights reserved 0950-9232/12 www.nature.com/onc REVIEW Deubiquitinases in cancer: new functions and therapeutic options JM Fraile1, V Quesada1, D Rodrı´guez, JMP Freije and C Lo´pez-Otı´n Departamento de Bioquı´mica y Biologı´a Molecular, Facultad de Medicina, Instituto Universitario de Oncologı´a, Universidad de Oviedo, Oviedo, Spain Deubiquitinases (DUBs) have fundamental roles in the Hunter, 2010). Consistent with the functional relevance ubiquitin system through their ability to specifically of proteases in these processes, alterations in their deconjugate ubiquitin from targeted proteins. The human structure or in the mechanisms controlling their genome encodes at least 98 DUBs, which can be grouped spatiotemporal expression patterns and activities cause into 6 families, reflecting the need for specificity in diverse pathologies such as arthritis, neurodegenerative their function. The activity of these enzymes affects the alterations, cardiovascular diseases and cancer. Accord- turnover rate, activation, recycling and localization ingly, many proteases are an important focus of of multiple proteins, which in turn is essential for attention for the pharmaceutical industry either as drug cell homeostasis, protein stability and a wide range of targets or as diagnostic and prognostic biomarkers signaling pathways. Consistent with this, altered DUB (Turk, 2006; Drag and Salvesen, 2010). function has been related to several diseases, including The recent availability of the genome sequence cancer. Thus, multiple DUBs have been classified as of different organisms has facilitated the identification oncogenes or tumor suppressors because of their regula- of their entire protease repertoire, which has been tory functions on the activity of other proteins involved in defined as degradome (Lopez-Otin and Overall, 2002). -
DYNC1I1 (NM 001135556) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC226881 DYNC1I1 (NM_001135556) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: DYNC1I1 (NM_001135556) Human Tagged ORF Clone Tag: Myc-DDK Symbol: DYNC1I1 Synonyms: DNCI1; DNCIC1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 DYNC1I1 (NM_001135556) Human Tagged ORF Clone – RC226881 ORF Nucleotide >RC226881 representing NM_001135556 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTGACAAAAGTGACTTAAAAGCTGAGCTAGAGCGCAAAAAGCAGCGCTTAGCACAGATAAGAGAAG AGAAGAAACGGAAGGAAGAGGAGAGGAAAAAGAAAGAGGCTGATATGCAGCAGAAGAAAGAACCCGTTCA GGACGACTCTGATCTGGATCGCAAACGACGAGAGACAGAGGCTTTGCTGCAAAGCATTGGTATCTCACCG GAGCCGCCTCTAGTCCCAACCCCTATGTCTCCCTCCTCGAAATCAGTGAGCACTCCCAGTGAAGCTGGAA GCCAAGACTCAGGCGATCTGGGGCCATTAACAAGGACCCTGCAGTGGGACACAGACCCCTCAGTGCTCCA GCTGCAGTCAGACTCAGAACTTGGAAGAAGACTGCATAAACTGGGCGTGTCAAAGGTCACCCAAGTGGAT TTCCTGCCAAGGGAAGTAGTGTCCTACTCAAAGGAGACCCAGACTCCTCTTGCCACGCATCAGTCTGAAG AGGATGAGGAAGATGAGGAAATGGTGGAATCTAAAGTTGGCCAGGACTCAGAACTGGAAAATCAGGACAA AAAACAGGAAGTGAAGGAAGCCCCTCCAAGAGAGTTGACAGAGGAAGAAAAACAGCAGATCATTCATTCA -
Localization of Ralb Signaling at Endomembrane Compartments and Its Modulation by Autophagy Received: 14 January 2019 Manish Kumar Singh1,2, Alexandre P
www.nature.com/scientificreports Corrected: Publisher Correction OPEN Localization of RalB signaling at endomembrane compartments and its modulation by autophagy Received: 14 January 2019 Manish Kumar Singh1,2, Alexandre P. J. Martin1,2, Carine Jofre 3, Giulia Zago1,2, Accepted: 30 May 2019 Jacques Camonis1,2, Mathieu Coppey1,4 & Maria Carla Parrini1,2 Published online: 20 June 2019 The monomeric GTPase RalB controls crucial physiological processes, including autophagy and invasion, but it still remains unclear how this multi-functionality is achieved. Previously, we reported that the RalGEF (Guanine nucleotide Exchange Factor) RGL2 binds and activates RalB to promote invasion. Here we show that RGL2, a major activator of RalB, is also required for autophagy. Using a novel automated image analysis method, Endomapper, we quantifed the endogenous localization of the RGL2 activator and its substrate RalB at diferent endomembrane compartments, in an isogenic normal and Ras-transformed cell model. In both normal and Ras-transformed cells, we observed that RGL2 and RalB substantially localize at early and recycling endosomes, and to lesser extent at autophagosomes, but not at trans-Golgi. Interestingly the use of a FRET-based RalB biosensor indicated that RalB signaling is active at these endomembrane compartments at basal level in rich medium. Furthermore, induction of autophagy by nutrient starvation led to a considerable reduction of early and recycling endosomes, in contrast to the expected increase of autophagosomes, in both normal and Ras-transformed cells. However, autophagy mildly afected relative abundances of both RGL2 and RalB at early and recycling endosomes, and at autophagosomes. Interestingly, RalB activity increased at autophagosomes upon starvation in normal cells. -
Investigation of Candidate Genes and Mechanisms Underlying Obesity
Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between -
The Role of Rala and Ralb in Cancer Samuel C
University of South Florida Scholar Commons Graduate Theses and Dissertations Graduate School 4-7-2008 The Role of RalA and RalB in Cancer Samuel C. Falsetti University of South Florida Follow this and additional works at: https://scholarcommons.usf.edu/etd Part of the American Studies Commons Scholar Commons Citation Falsetti, Samuel C., "The Role of RalA and RalB in Cancer" (2008). Graduate Theses and Dissertations. https://scholarcommons.usf.edu/etd/232 This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected]. The Role of RalA and RalB in Cancer By Samuel C. Falsetti A dissertation submitted in partial fulfillment Of the requirements for the degree of Doctor of Philosophy Department of Molecular Medicine College of Medicine University of South Florida Major Professor: Saïd M. Sebti, Ph.D. Larry P. Solomonson, Ph.D. Gloria C. Ferreira, Ph.D. Srikumar Chellapan, Ph.D. Gary Reuther, Ph.D. Douglas Cress, Ph.D. Date of Approval: April 7th, 2008 Keywords: Ras, RACK1, Geranylgeranyltransferase I inhibitors, ovarian cancer, proteomics © Copyright 2008, Samuel C. Falsetti Dedication This thesis is dedicated to my greatest supporter, my wife. Without her loving advice and patience none of this would be possible. Acknowledgments I would like to extend my sincere gratitude to my wife, Nicole. She is the most inspirational person in my life and I am honored to be with her; in truth, this degree ought to come with two names printed on it. -
1 Supporting Information for a Microrna Network Regulates
Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia. -
Serum Albumin OS=Homo Sapiens
Protein Name Cluster of Glial fibrillary acidic protein OS=Homo sapiens GN=GFAP PE=1 SV=1 (P14136) Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 Cluster of Isoform 3 of Plectin OS=Homo sapiens GN=PLEC (Q15149-3) Cluster of Hemoglobin subunit beta OS=Homo sapiens GN=HBB PE=1 SV=2 (P68871) Vimentin OS=Homo sapiens GN=VIM PE=1 SV=4 Cluster of Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 (Q13509) Cluster of Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 (P60709) Cluster of Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 (P68363) Cluster of Isoform 2 of Spectrin alpha chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTAN1 (Q13813-2) Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 Cluster of Spectrin beta chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTBN1 PE=1 SV=2 (Q01082) Cluster of Pyruvate kinase isozymes M1/M2 OS=Homo sapiens GN=PKM PE=1 SV=4 (P14618) Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 Clathrin heavy chain 1 OS=Homo sapiens GN=CLTC PE=1 SV=5 Filamin-A OS=Homo sapiens GN=FLNA PE=1 SV=4 Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens GN=DYNC1H1 PE=1 SV=5 Cluster of ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide OS=Homo sapiens GN=ATP1A2 PE=3 SV=1 (B1AKY9) Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 Dihydropyrimidinase-related protein 2 OS=Homo sapiens GN=DPYSL2 PE=1 SV=1 Cluster of Alpha-actinin-1 OS=Homo sapiens GN=ACTN1 PE=1 SV=2 (P12814) 60 kDa heat shock protein, mitochondrial OS=Homo -
Beyond K48 and K63: Non-Canonical Protein Ubiquitination
Tracz and Bialek Cell Mol Biol Lett (2021) 26:1 https://doi.org/10.1186/s11658‑020‑00245‑6 Cellular & Molecular Biology Letters REVIEW LETTER Open Access Beyond K48 and K63: non‑canonical protein ubiquitination Michal Tracz and Wojciech Bialek* *Correspondence: [email protected] Abstract Faculty of Biotechnology, Protein ubiquitination has become one of the most extensively studied post-trans- University of Wroclaw, Wroclaw, Poland lational modifcations. Originally discovered as a critical element in highly regulated proteolysis, ubiquitination is now regarded as essential for many other cellular pro- cesses. This results from the unique features of ubiquitin (Ub) and its ability to form various homo- and heterotypic linkage types involving one of the seven diferent lysine residues or the free amino group located at its N-terminus. While K48- and K63-linked chains are broadly covered in the literature, the other types of chains assembled through K6, K11, K27, K29, and K33 residues deserve equal attention in the light of the latest discoveries. Here, we provide a concise summary of recent advances in the feld of these poorly understood Ub linkages and their possible roles in vivo. Keywords: Ubiquitin, Non-canonical, Atypical ubiquitination, Ubiquitin chains Introduction Protein ubiquitination (interchangeably called ubiquitylation) involves the covalent attachment of the 76-amino acid eukaryotic molecule ubiquitin (Ub) to substrate pro- teins. An enzymatic cascade of a Ub activating enzyme (E1), Ub-conjugating enzymes (E2s), and Ub ligases (E3s) governs the process, which is now recognized as an essential post-translational protein modifcation (PTM) of eukaryotic cells [1]. Ubiquitination is initiated by E1, an enzyme requiring ATP for the activation of Ub, which forms a thi- oester bond between the C-terminal Gly carboxyl group of Ub and its active site Cys. -
Association of Gene Ontology Categories with Decay Rate for Hepg2 Experiments These Tables Show Details for All Gene Ontology Categories
Supplementary Table 1: Association of Gene Ontology Categories with Decay Rate for HepG2 Experiments These tables show details for all Gene Ontology categories. Inferences for manual classification scheme shown at the bottom. Those categories used in Figure 1A are highlighted in bold. Standard Deviations are shown in parentheses. P-values less than 1E-20 are indicated with a "0". Rate r (hour^-1) Half-life < 2hr. Decay % GO Number Category Name Probe Sets Group Non-Group Distribution p-value In-Group Non-Group Representation p-value GO:0006350 transcription 1523 0.221 (0.009) 0.127 (0.002) FASTER 0 13.1 (0.4) 4.5 (0.1) OVER 0 GO:0006351 transcription, DNA-dependent 1498 0.220 (0.009) 0.127 (0.002) FASTER 0 13.0 (0.4) 4.5 (0.1) OVER 0 GO:0006355 regulation of transcription, DNA-dependent 1163 0.230 (0.011) 0.128 (0.002) FASTER 5.00E-21 14.2 (0.5) 4.6 (0.1) OVER 0 GO:0006366 transcription from Pol II promoter 845 0.225 (0.012) 0.130 (0.002) FASTER 1.88E-14 13.0 (0.5) 4.8 (0.1) OVER 0 GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid metabolism3004 0.173 (0.006) 0.127 (0.002) FASTER 1.28E-12 8.4 (0.2) 4.5 (0.1) OVER 0 GO:0006357 regulation of transcription from Pol II promoter 487 0.231 (0.016) 0.132 (0.002) FASTER 6.05E-10 13.5 (0.6) 4.9 (0.1) OVER 0 GO:0008283 cell proliferation 625 0.189 (0.014) 0.132 (0.002) FASTER 1.95E-05 10.1 (0.6) 5.0 (0.1) OVER 1.50E-20 GO:0006513 monoubiquitination 36 0.305 (0.049) 0.134 (0.002) FASTER 2.69E-04 25.4 (4.4) 5.1 (0.1) OVER 2.04E-06 GO:0007050 cell cycle arrest 57 0.311 (0.054) 0.133 (0.002) -
CHARACTERIZATION, EPIGENETIC DRUG EFFECT, and GENE DELIVERY to BREAST CANCER CELLS a Dissertation Presented to the Graduate Facu
CHARACTERIZATION, EPIGENETIC DRUG EFFECT, AND GENE DELIVERY TO BREAST CANCER CELLS A Dissertation Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of Requirements for the Degree Doctor of Philosophy Shan Lu December, 2015 CHARACTERIZATION, EPIGENETIC DRUG EFFECT, AND GENE DELIVERY TO BREAST CANCER CELLS Shan Lu Dissertation Approved: Accepted: Advisor Department Chair Dr. Vinod Labhasetwar Dr. Stephen Weeks Committee Chair Dean of the College Dr. Coleen Pugh Dr. John Green Committee Member Dean of Graduate School Dr. Abraham Joy Dr. Chand Midha Committee Member Dr. Ali Dhinojwala Committee Member Dr. Anand Ramamurthi Committee Member Dr. Peter Niewiarowski ii ABSTRACT Cancer relapse is strongly associated with the presence of cancer stem cells (CSCs), which drive the development of metastasis and drug resistance. In human breast cancer, CSCs are identified by the CD44+/CD24- phenotype and characterized by drug resistance, high tumorigenicity and metastatic potential. In this study, I found that MCF-7/Adr cells that are breast cancer cells resistant to doxorubicin (Dox) uniformly displayed CSC surface markers, possessed CSC proteins, formed in vitro mammospheres, yet retained low migratory rate. They were also able to self-renew and differentiate under floating culture condition and are responsive to epigenetic drug treatment. High degree of DNA methylation (modifications of the cytosine residues of DNA) and histone deacetylation are major epigenetic landmarks of CSCs. In this work, I showed that MCF-7/Adr cells are sensitive to histone deacetylation inhibitor suberoylanilide hydroxamic acid (SAHA). Through RNA-sequencing technology, I also found that decitabine (DAC) and SAHA similarly affected a large number of the examined pathways, including drug and nanoparticle cellular uptake and transport, lipid metabolism, carcinogenesis and nuclear transport pathways.