Axonal Transport: Cargo-Specific Mechanisms of Motility And
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
DYNC1I1 (NM 001135556) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC226881 DYNC1I1 (NM_001135556) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: DYNC1I1 (NM_001135556) Human Tagged ORF Clone Tag: Myc-DDK Symbol: DYNC1I1 Synonyms: DNCI1; DNCIC1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 4 DYNC1I1 (NM_001135556) Human Tagged ORF Clone – RC226881 ORF Nucleotide >RC226881 representing NM_001135556 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGTCTGACAAAAGTGACTTAAAAGCTGAGCTAGAGCGCAAAAAGCAGCGCTTAGCACAGATAAGAGAAG AGAAGAAACGGAAGGAAGAGGAGAGGAAAAAGAAAGAGGCTGATATGCAGCAGAAGAAAGAACCCGTTCA GGACGACTCTGATCTGGATCGCAAACGACGAGAGACAGAGGCTTTGCTGCAAAGCATTGGTATCTCACCG GAGCCGCCTCTAGTCCCAACCCCTATGTCTCCCTCCTCGAAATCAGTGAGCACTCCCAGTGAAGCTGGAA GCCAAGACTCAGGCGATCTGGGGCCATTAACAAGGACCCTGCAGTGGGACACAGACCCCTCAGTGCTCCA GCTGCAGTCAGACTCAGAACTTGGAAGAAGACTGCATAAACTGGGCGTGTCAAAGGTCACCCAAGTGGAT TTCCTGCCAAGGGAAGTAGTGTCCTACTCAAAGGAGACCCAGACTCCTCTTGCCACGCATCAGTCTGAAG AGGATGAGGAAGATGAGGAAATGGTGGAATCTAAAGTTGGCCAGGACTCAGAACTGGAAAATCAGGACAA AAAACAGGAAGTGAAGGAAGCCCCTCCAAGAGAGTTGACAGAGGAAGAAAAACAGCAGATCATTCATTCA -
Investigation of Candidate Genes and Mechanisms Underlying Obesity
Prashanth et al. BMC Endocrine Disorders (2021) 21:80 https://doi.org/10.1186/s12902-021-00718-5 RESEARCH ARTICLE Open Access Investigation of candidate genes and mechanisms underlying obesity associated type 2 diabetes mellitus using bioinformatics analysis and screening of small drug molecules G. Prashanth1 , Basavaraj Vastrad2 , Anandkumar Tengli3 , Chanabasayya Vastrad4* and Iranna Kotturshetti5 Abstract Background: Obesity associated type 2 diabetes mellitus is a metabolic disorder ; however, the etiology of obesity associated type 2 diabetes mellitus remains largely unknown. There is an urgent need to further broaden the understanding of the molecular mechanism associated in obesity associated type 2 diabetes mellitus. Methods: To screen the differentially expressed genes (DEGs) that might play essential roles in obesity associated type 2 diabetes mellitus, the publicly available expression profiling by high throughput sequencing data (GSE143319) was downloaded and screened for DEGs. Then, Gene Ontology (GO) and REACTOME pathway enrichment analysis were performed. The protein - protein interaction network, miRNA - target genes regulatory network and TF-target gene regulatory network were constructed and analyzed for identification of hub and target genes. The hub genes were validated by receiver operating characteristic (ROC) curve analysis and RT- PCR analysis. Finally, a molecular docking study was performed on over expressed proteins to predict the target small drug molecules. Results: A total of 820 DEGs were identified between -
Serum Albumin OS=Homo Sapiens
Protein Name Cluster of Glial fibrillary acidic protein OS=Homo sapiens GN=GFAP PE=1 SV=1 (P14136) Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 Cluster of Isoform 3 of Plectin OS=Homo sapiens GN=PLEC (Q15149-3) Cluster of Hemoglobin subunit beta OS=Homo sapiens GN=HBB PE=1 SV=2 (P68871) Vimentin OS=Homo sapiens GN=VIM PE=1 SV=4 Cluster of Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 (Q13509) Cluster of Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 (P60709) Cluster of Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 (P68363) Cluster of Isoform 2 of Spectrin alpha chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTAN1 (Q13813-2) Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 Cluster of Spectrin beta chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTBN1 PE=1 SV=2 (Q01082) Cluster of Pyruvate kinase isozymes M1/M2 OS=Homo sapiens GN=PKM PE=1 SV=4 (P14618) Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 Clathrin heavy chain 1 OS=Homo sapiens GN=CLTC PE=1 SV=5 Filamin-A OS=Homo sapiens GN=FLNA PE=1 SV=4 Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens GN=DYNC1H1 PE=1 SV=5 Cluster of ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide OS=Homo sapiens GN=ATP1A2 PE=3 SV=1 (B1AKY9) Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 Dihydropyrimidinase-related protein 2 OS=Homo sapiens GN=DPYSL2 PE=1 SV=1 Cluster of Alpha-actinin-1 OS=Homo sapiens GN=ACTN1 PE=1 SV=2 (P12814) 60 kDa heat shock protein, mitochondrial OS=Homo -
Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations
Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations by Jelena Perovanovic M.S. in Molecular Biology and Physiology, September 2009, University of Belgrade M.Phil. in Molecular Medicine, August 2013, The George Washington University A Dissertation submitted to The Faculty of The Columbian College of Arts and Sciences of The George Washington University in partial fulfillment of the requirements for the degree of Doctor of Philosophy August 31, 2015 Dissertation directed by Eric P. Hoffman Professor of Integrative Systems Biology The Columbian College of Arts and Sciences of The George Washington University certifies that Jelena Perovanovic has passed the Final Examination for the degree of Doctor of Philosophy as of May 5, 2015. This is the final and approved form of the dissertation. Nuclear Envelope Laminopathies: Evidence for Developmentally Inappropriate Nuclear Envelope-Chromatin Associations Jelena Perovanovic Dissertation Research Committee: Eric P. Hoffman, Professor of Integrative Systems Biology, Dissertation Director Anamaris Colberg-Poley, Professor of Integrative Systems Biology, Committee Member Robert J. Freishtat, Associate Professor of Pediatrics, Committee Member Vittorio Sartorelli, Senior Investigator, National Institutes of Health, Committee Member ii © Copyright 2015 by Jelena Perovanovic All rights reserved iii Acknowledgments I am deeply indebted to countless individuals for their support and encouragement during the past five years of graduate studies. First and foremost, I would like to express my gratitude to my mentor, Dr. Eric P. Hoffman, for his unwavering support and guidance, and keen attention to my professional development. This Dissertation would not have been possible without the critical input he provided and the engaging environment he created. -
Passive and Active Transport
Passive and Active Transport 1. Thermodynamics of transport 2. Passive-mediated transport 3. Active transport neuron, membrane potential, ion transport Membranes • Provide barrier function – Extracellular – Organelles • Barrier can be overcome by „transport proteins“ – To mediate transmembrane movements of ions, Na+, K+ – Nutrients, glucose, amino acids etc. – Water (aquaporins) 1) Thermodynamics of Transport • Aout <-> Ain (ressembles a chemical equilibration) o‘ • GA - G A = RT ln [A] • ∆GA = GA(in) - GA(out) = RT ln ([A]in/[A]out) • GA: chemical potential of A o‘ • G A: chemical potential of standard state of A • If membrane has a potential, i.e., plasma membrane: -100mV (inside negative) then GA is termed the electrochemical potential of A Two types of transport across a membrane: o Nonmediated transport occurs by passive diffusion, i.e., O2, CO2 driven by chemical potential gradient, i.e. cannot occur against a concentration gradient o Mediated transport occurs by dedicated transport proteins 1. Passive-mediated transport/facilitated diffusion: [high] -> [low] 2. Active transport: [low] -> [high] May require energy in form of ATP or in form of a membrane potential 2) Passive-mediated transport Substances that are too large or too polar to diffuse across the bilayer must be transported by proteins: carriers, permeases, channels and transporters A) Ionophores B) Porins C) Ion Channels D) Aquaporins E) Transport Proteins A) Ionophores Organic molecules of divers types, often of bacterial origin => Increase the permeability of a target membrane for ions, frequently antibiotic, result in collapse of target membrane potential by ion equilibration 1. Carrier Ionophore, make ion soluble in membrane, i.e. valinomycin, 104 K+/sec 2. -
Site-Specific and Common Prostate Cancer Metastasis Genes
life Article Site-Specific and Common Prostate Cancer Metastasis Genes as Suggested by Meta-Analysis of Gene Expression Data Ivana Samaržija 1,2 1 Laboratory for Epigenomics, Division of Molecular Medicine, Ruder¯ Boškovi´cInstitute, Bijeniˇcka54, 10000 Zagreb, Croatia; [email protected] 2 Laboratory for Cell Biology and Signalling, Division of Molecular Biology, Ruder¯ Boškovi´cInstitute, Bijeniˇcka54, 10000 Zagreb, Croatia Abstract: Anticancer therapies mainly target primary tumor growth and little attention is given to the events driving metastasis formation. Metastatic prostate cancer, in comparison to localized disease, has a much worse prognosis. In the work presented here, groups of genes that are common to prostate cancer metastatic cells from bones, lymph nodes, and liver and those that are site-specific were delineated. The purpose of the study was to dissect potential markers and targets of anticancer therapies considering the common characteristics and differences in transcriptional programs of metastatic cells from different secondary sites. To that end, a meta-analysis of gene expression data of prostate cancer datasets from the GEO database was conducted. Genes with differential expression in all metastatic sites analyzed belong to the class of filaments, focal adhesion, and androgen receptor signaling. Bone metastases undergo the largest transcriptional changes that are highly enriched for the term of the chemokine signaling pathway, while lymph node metastasis show perturbation in signaling cascades. Liver metastases change the expression of genes in a way that is reminiscent of processes that take place in the target organ. Survival analysis for the common hub genes revealed Citation: Samaržija, I. Site-Specific involvements in prostate cancer prognosis and suggested potential biomarkers. -
The Axonal Transport of Mitochondria
Commentary 2095 The axonal transport of mitochondria William M. Saxton1,* and Peter J. Hollenbeck2 1Department of Molecular Cell and Developmental Biology, University of California, 1156 High Street, Santa Cruz, CA 95060, USA 2Department of Biological Sciences, Purdue University, 915 West State Street, West Lafayette, IN 47907, USA *Author for correspondence ([email protected]) Journal of Cell Science 125, 2095–2104 ß 2012. Published by The Company of Biologists Ltd doi: 10.1242/jcs.053850 Summary Vigorous transport of cytoplasmic components along axons over substantial distances is crucial for the maintenance of neuron structure and function. The transport of mitochondria, which serves to distribute mitochondrial functions in a dynamic and non-uniform fashion, has attracted special interest in recent years following the discovery of functional connections among microtubules, motor proteins and mitochondria, and their influences on neurodegenerative diseases. Although the motor proteins that drive mitochondrial movement are now well characterized, the mechanisms by which anterograde and retrograde movement are coordinated with one another and with stationary axonal mitochondria are not yet understood. In this Commentary, we review why mitochondria move and how they move, focusing particularly on recent studies of transport regulation, which implicate control of motor activity by specific cell-signaling pathways, regulation of motor access to transport tracks and static microtubule–mitochondrion linkers. A detailed mechanism for modulating anterograde mitochondrial transport has been identified that involves Miro, a mitochondrial Ca2+-binding GTPase, which with associated proteins, can bind and control kinesin-1. Elements of the Miro complex also have important roles in mitochondrial fission–fusion dynamics, highlighting questions about the interdependence of biogenesis, transport, dynamics, maintenance and degradation. -
UC San Diego UC San Diego Electronic Theses and Dissertations
UC San Diego UC San Diego Electronic Theses and Dissertations Title Insights from reconstructing cellular networks in transcription, stress, and cancer Permalink https://escholarship.org/uc/item/6s97497m Authors Ke, Eugene Yunghung Ke, Eugene Yunghung Publication Date 2012 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, SAN DIEGO Insights from Reconstructing Cellular Networks in Transcription, Stress, and Cancer A dissertation submitted in the partial satisfaction of the requirements for the degree Doctor of Philosophy in Bioinformatics and Systems Biology by Eugene Yunghung Ke Committee in charge: Professor Shankar Subramaniam, Chair Professor Inder Verma, Co-Chair Professor Web Cavenee Professor Alexander Hoffmann Professor Bing Ren 2012 The Dissertation of Eugene Yunghung Ke is approved, and it is acceptable in quality and form for the publication on microfilm and electronically ________________________________________________________________ ________________________________________________________________ ________________________________________________________________ ________________________________________________________________ Co-Chair ________________________________________________________________ Chair University of California, San Diego 2012 iii DEDICATION To my parents, Victor and Tai-Lee Ke iv EPIGRAPH [T]here are known knowns; there are things we know we know. We also know there are known unknowns; that is to say we know there -
Host Cell Factors Necessary for Influenza a Infection: Meta-Analysis of Genome Wide Studies
Host Cell Factors Necessary for Influenza A Infection: Meta-Analysis of Genome Wide Studies Juliana S. Capitanio and Richard W. Wozniak Department of Cell Biology, Faculty of Medicine and Dentistry, University of Alberta Abstract: The Influenza A virus belongs to the Orthomyxoviridae family. Influenza virus infection occurs yearly in all countries of the world. It usually kills between 250,000 and 500,000 people and causes severe illness in millions more. Over the last century alone we have seen 3 global influenza pandemics. The great human and financial cost of this disease has made it the second most studied virus today, behind HIV. Recently, several genome-wide RNA interference studies have focused on identifying host molecules that participate in Influen- za infection. We used nine of these studies for this meta-analysis. Even though the overlap among genes identified in multiple screens was small, network analysis indicates that similar protein complexes and biological functions of the host were present. As a result, several host gene complexes important for the Influenza virus life cycle were identified. The biological function and the relevance of each identified protein complex in the Influenza virus life cycle is further detailed in this paper. Background and PA bound to the viral genome via nucleoprotein (NP). The viral core is enveloped by a lipid membrane derived from Influenza virus the host cell. The viral protein M1 underlies the membrane and anchors NEP/NS2. Hemagglutinin (HA), neuraminidase Viruses are the simplest life form on earth. They parasite host (NA), and M2 proteins are inserted into the envelope, facing organisms and subvert the host cellular machinery for differ- the viral exterior. -
Caveolar Endocytosis of Simian Virus 40 Reveals a New Two-Step Vesicular- Transport Pathway to the ER
articles Caveolar endocytosis of simian virus 40 reveals a new two-step vesicular- transport pathway to the ER Lucas Pelkmans*, Jürgen Kartenbeck† and Ari Helenius*‡ *Institute of Biochemistry, Swiss Federal Institute of Technology, Universitaetstrasse 16, CH-8092 Zürich, Switzerland †German Cancer Research Center (DKFZ) Heidelberg, Im Neuenheimer Feld 280, D-69120 Heidelberg, Germany ‡e-mail: [email protected] Simian virus 40 (SV40) is unusual among animal viruses in that it enters cells through caveolae, and the internalized virus accumulates in a smooth endoplasmic reticulum (ER) compartment. Using video-enhanced, dual-colour, live fluorescence microscopy, we show the uptake of individual virus particles in CV-1 cells. After associating with cave- olae, SV40 leaves the plasma membrane in small, caveolin-1-containing vesicles. It then enters larger, peripheral organelles with a non-acidic pH. Although rich in caveolin-1, these organelles do not contain markers for endo- somes, lysosomes, ER or Golgi, nor do they acquire ligands of clathrin-coated vesicle endocytosis. After several hours in these organelles, SV40 is sorted into tubular, caveolin-free membrane vesicles that move rapidly along microtubules, and is deposited in perinuclear, syntaxin 17-positive, smooth ER organelles. The microtubule-disrupt- ing agent nocodazole inhibits formation and transport of these tubular carriers, and blocks viral infection. Our results demonstrate the existence of a two-step transport pathway from plasma-membrane caveolae, through an intermediate organelle (termed the caveosome), to the ER. This pathway bypasses endosomes and the Golgi com- plex, and is part of the productive infectious route used by SV40. any animal viruses take advantage of receptor-mediated mutants of caveolin-3 localize to intracellular vesicles that are dis- endocytosis to enter their host cells. -
Downregulation of Carnitine Acyl-Carnitine Translocase by Mirnas
Page 1 of 288 Diabetes 1 Downregulation of Carnitine acyl-carnitine translocase by miRNAs 132 and 212 amplifies glucose-stimulated insulin secretion Mufaddal S. Soni1, Mary E. Rabaglia1, Sushant Bhatnagar1, Jin Shang2, Olga Ilkayeva3, Randall Mynatt4, Yun-Ping Zhou2, Eric E. Schadt6, Nancy A.Thornberry2, Deborah M. Muoio5, Mark P. Keller1 and Alan D. Attie1 From the 1Department of Biochemistry, University of Wisconsin, Madison, Wisconsin; 2Department of Metabolic Disorders-Diabetes, Merck Research Laboratories, Rahway, New Jersey; 3Sarah W. Stedman Nutrition and Metabolism Center, Duke Institute of Molecular Physiology, 5Departments of Medicine and Pharmacology and Cancer Biology, Durham, North Carolina. 4Pennington Biomedical Research Center, Louisiana State University system, Baton Rouge, Louisiana; 6Institute for Genomics and Multiscale Biology, Mount Sinai School of Medicine, New York, New York. Corresponding author Alan D. Attie, 543A Biochemistry Addition, 433 Babcock Drive, Department of Biochemistry, University of Wisconsin-Madison, Madison, Wisconsin, (608) 262-1372 (Ph), (608) 263-9608 (fax), [email protected]. Running Title: Fatty acyl-carnitines enhance insulin secretion Abstract word count: 163 Main text Word count: 3960 Number of tables: 0 Number of figures: 5 Diabetes Publish Ahead of Print, published online June 26, 2014 Diabetes Page 2 of 288 2 ABSTRACT We previously demonstrated that micro-RNAs 132 and 212 are differentially upregulated in response to obesity in two mouse strains that differ in their susceptibility to obesity-induced diabetes. Here we show the overexpression of micro-RNAs 132 and 212 enhances insulin secretion (IS) in response to glucose and other secretagogues including non-fuel stimuli. We determined that carnitine acyl-carnitine translocase (CACT, Slc25a20) is a direct target of these miRNAs.