DOCSLIB.ORG

How Abnormal RNA Metabolism Results in Childhood-Onset Neurological Diseases

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
How Abnormal RNA Metabolism Results in Childhood-Onset Neurological Diseases Exosomal Protein Deficiencies: How Abnormal RNA Metabolism Results in Childhood-Onset Neurological Diseases A thesis submitted for the degree of Doctor of Philosophy at Newcastle University October 2016 Michele Giunta Institute of Genetic Medicine ii Author’s declaration This thesis is submitted for the degree of Doctor of Philosophy at Newcastle University. I, Michele Giunta, declare that the work described here is my own, unless where clearly acknowledged and stated otherwise. I certify that I have not submitted any of the material in this thesis for a degree qualification at this or any other university. iii Abstract RNA metabolism is of critical importance for normal cellular functions and needs to be finely tuned in order to maintain stable conditions within the cell. The exosome complex is the most important RNA processing machinery, responsible for the correct processing of many different types of RNAs and interacting with different co-factors which bind and carry specific subtypes of RNA for degradation to the complex. Mutations in exosome complex subunits (EXOSC3, EXOSC8) were reported to cause severe childhood onset complex neurological disorders presenting with pontocerebellar hypoplasia type 1 (PCH1), spinal muscular atrophy (SMA) and central nervous system hypomyelination. We have recently identified a homozygous pathogenic mutation in RNA Binding Motif Protein 7 RBM7, a subunit of the nuclear exosome targeting (NEXT) complex in a single patient with SMA-like phenotype and proved that RBM7 is a novel human disease gene related to the exosome complex. In order to understand the disease mechanism in RBM7 deficiency and to explore the role of exosome complex in neurodevelopment, we performed gene expression studies (RT-PCR, RNA sequencing) in human cells of patients carrying mutations in EXOSC8 and RBM7. Furthermore we performed functional studies in zebrafish (D. rerio) by morpholino oligonucleotide mediated knock-down of rbm7, exosc8 and exosc3 and also by introducing pathogenic mutations in exosomal protein genes in zebrafish embryos by the CRISPR/Cas9 system. We showed that mutations in RBM7 and EXOSC8 mutant fibroblasts cause differential expression of several different transcripts, 62 of them being shared between the two cell lines. Altered gene expression of some AU-rich element containing genes may potentially contribute to the clinical presentation. Knock-down of rbm7, exosc8 and exosc3 caused impaired neurodevelopment in zebrafish, illustrated by abnormal growth of motor neuron axons and failure to differentiate cerebellar Purkinje cells. RT-PCR analysis in zebrafish showed a dramatic increase in expression of atxn1b (an AU-rich element containing homolog of the human ATXN1 gene) in rbm7, exosc8 and exosc3 downregulated fish, which may be responsible for the cerebellar defects. We have successfully introduced several germline mutations with CRISPR/Cas9 technology in rbm7. Phenotype of the F1 mutants is milder than what observed with the morpholino oligonucleotide injected fish. Mutants at a closer look do not show any morphological defect but further experiment may indicate similar characteristics to the morphants, although more iv subtle. Further studies on the CRISPR/Cas9 generated zebrafish models will extend our knowledge on the disease mechanisms caused by defective RNA metabolism. v Acknowledgements The last three years have been a great experience for me, I am grateful to the following people: firstly I would like to thank my supervisor Professor Rita Horvath, she has been always supportive and available for fruitful discussions throughout all my PhD. Dr. Juliane Mueller and Dr. Veronika Boczonadi for helping me with day to day life in the lab and in the pub. Dr. Aurora Gomez-Duran for helping with all the transcriptome-related-issues. Dr Angela Pyle and Dr. Jennifer Duff for being the cornerstones of the lab, I don’t know how I would have done without you. Rafiqul Hussain has always been on my (right-hand) side, no matter what. He has taught me every secret of the Agilent Bioanalyzer. I have been lucky to share these three years of work and fun with people from the mitochondrial group and stem cell group: Gavin Hudson, Jonathan Coxhead, Beccie Brennan, Padraig Flannery, Emily McIlwayne, David Moore, Marina Bartsakoulia, Florence Burte, George Cairns, Marzena Kurzawa-Akanbi, George Anyfantis, Valeria Chichagova, Katja Gassner, Ellie Meader, Joseph Collin, Carla Mellough, Boglarka Bansagi, Mikael Pezet. Thank you mum, dad, Elisa and all the people who have supported me until here through all my life. Thanks to the electron microscopy and zebrafish facilities staff: Kathryn White, Tracey Davey, Michael Robson, Paul Cairns. Finally, thanks to the Marie-Curie ‘MEET’ project co-ordination team: Prof. Giuseppe Gasparre and Serena Paterlini, University of Bologna, Italy. vi Table of contents Chapter 1: Introduction ............................................................................................. 1 1.1 RNA processing and disease .................................................................................................... 1 1.2 The exosome complex ............................................................................................................. 2 1.2.1 Exosome-Specificity Factors ............................................................................................ 4 1.2.2 The TRAMP complex ....................................................................................................... 4 1.2.3 The NEXT complex ........................................................................................................... 5 1.2.4 The SKI complex .............................................................................................................. 5 1.2.5 The CBC complex ............................................................................................................. 6 1.3 The exosome complex in health and disease .......................................................................... 7 1.3.1 Symptoms caused by EXOSC3 mutations ........................................................................ 7 1.3.2 Symptoms caused by EXOSC8 mutations ...................................................................... 10 1.3.3 Symptoms caused by EXOSC2 mutations ...................................................................... 13 1.4 RNA processing and pontocerebellar hypoplasias ................................................................ 16 1.4.1 Subtypes of pontocerebellar hypoplasias ..................................................................... 17 1.5 Zebrafish as a model system ................................................................................................. 19 1.6 Zebrafish development ......................................................................................................... 20 1.6.1 Spinal cord and Spinal Motor Neuron development in zebrafish ................................. 22 1.6.2 Myelination process in zebrafish .................................................................................. 23 1.6.3 Cerebellar development in zebrafish ............................................................................ 26 1.7 Zebrafish models of PCH ....................................................................................................... 30 1.7.1 TSEN54 .......................................................................................................................... 30 1.7.2 CLP1 ............................................................................................................................... 33 1.7.3 CHMP1A ........................................................................................................................ 36 1.7.4 QARS .............................................................................................................................. 37 2 Chapter 2: Materials & Methods ...................................................................... 39 2.1 Next Generation sequencing (NGS) ...................................................................................... 39 2.1.1 Whole exome sequencing ............................................................................................. 39 2.1.2 Bioinformatic analysis ................................................................................................... 39 2.1.3 RNA-seq ......................................................................................................................... 39 2.1.4 Bioinformatic analysis ................................................................................................... 39 2.2 Sanger sequencing ................................................................................................................ 40 2.2.1 Polymerase Chain Reaction ........................................................................................... 40 2.2.2 Electrophoresis on agarose gel ..................................................................................... 41 vii 2.2.3 ExoFAP PCR clean up ..................................................................................................... 42 2.2.4 BigDye Terminator cycle ............................................................................................... 42 2.2.5 Ethanol precipitation ..................................................................................................... 42 2.2.6 Sanger Sequencing .......................................................................................................
Load more

Recommended publications
  • Correct Setup of the Substantia Nigra Requires Reelin-Mediated Fast, Laterally- Directed Migration of Dopaminergic Neurons
    RESEARCH ARTICLE Correct setup of the substantia nigra requires Reelin-mediated fast, laterally- directed migration of dopaminergic neurons Ankita Ravi Vaswani1, Beatrice Weykopf2†, Cathleen Hagemann1, Hans-Ulrich Fried3, Oliver Bru¨ stle2, Sandra Blaess1* 1Neurodevelopmental Genetics, Institute of Reconstructive Neurobiology, University of Bonn School of Medicine & University Hospital Bonn, Bonn, Germany; 2Institute of Reconstructive Neurobiology, University of Bonn School of Medicine & University Hospital Bonn, Bonn, Germany; 3Light Microscope Facility, German Center for Neurodegenerative Diseases, Bonn, Germany Abstract Midbrain dopaminergic (mDA) neurons migrate to form the laterally-located substantia nigra pars compacta (SN) and medially-located ventral tegmental area (VTA), but little is known about the underlying cellular and molecular processes. Here we visualize the dynamic cell morphologies of tangentially migrating SN-mDA neurons in 3D and identify two distinct migration modes. Slow migration is the default mode in SN-mDA neurons, while fast, laterally-directed *For correspondence: migration occurs infrequently and is strongly associated with bipolar cell morphology. Tangential [email protected] migration of SN-mDA neurons is altered in absence of Reelin signaling, but it is unclear whether Reelin acts directly on migrating SN-mDA neurons and how it affects their cell morphology and † Present address: Precision migratory behavior. By specifically inactivating Reelin signaling in mDA neurons we demonstrate its Neurology Program & Advanced direct role in SN-mDA tangential migration. Reelin promotes laterally-biased movements in mDA Center for Parkinson’s Disease neurons during their slow migration mode, stabilizes leading process morphology and increases the Research, Harvard Medical School and Brigham & Women’s probability of fast, laterally-directed migration.
    [Show full text]
  • PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41
    American Society of Human Genetics 62nd Annual Meeting November 6–10, 2012 San Francisco, California PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41. Genes Underlying Neurological Disease Room 134 #196–#204 2. 4:30–6:30pm: Plenary Abstract 42. Cancer Genetics III: Common Presentations Hall D #1–#6 Variants Ballroom 104 #205–#213 43. Genetics of Craniofacial and Wednesday, November 7 Musculoskeletal Disorders Room 124 #214–#222 10:30am–12:45 pm: Concurrent Platform Session A (11–19): 44. Tools for Phenotype Analysis Room 132 #223–#231 11. Genetics of Autism Spectrum 45. Therapy of Genetic Disorders Room 130 #232–#240 Disorders Hall D #7–#15 46. Pharmacogenetics: From Discovery 12. New Methods for Big Data Ballroom 103 #16–#24 to Implementation Room 123 #241–#249 13. Cancer Genetics I: Rare Variants Room 135 #25–#33 14. Quantitation and Measurement of Friday, November 9 Regulatory Oversight by the Cell Room 134 #34–#42 8:00am–10:15am: Concurrent Platform Session D (47–55): 15. New Loci for Obesity, Diabetes, and 47. Structural and Regulatory Genomic Related Traits Ballroom 104 #43–#51 Variation Hall D #250–#258 16. Neuromuscular Disease and 48. Neuropsychiatric Disorders Ballroom 103 #259–#267 Deafness Room 124 #52–#60 49. Common Variants, Rare Variants, 17. Chromosomes and Disease Room 132 #61–#69 and Everything in-Between Room 135 #268–#276 18. Prenatal and Perinatal Genetics Room 130 #70–#78 50. Population Genetics Genome-Wide Room 134 #277–#285 19. Vascular and Congenital Heart 51. Endless Forms Most Beautiful: Disease Room 123 #79–#87 Variant Discovery in Genomic Data Ballroom 104 #286–#294 52.
    [Show full text]
  • Watsonjn2018.Pdf (1.780Mb)
    UNIVERSITY OF CENTRAL OKLAHOMA Edmond, Oklahoma Department of Biology Investigating Differential Gene Expression in vivo of Cardiac Birth Defects in an Avian Model of Maternal Phenylketonuria A THESIS SUBMITTED TO THE GRADUATE FACULTY In partial fulfillment of the requirements For the degree of MASTER OF SCIENCE IN BIOLOGY By Jamie N. Watson Edmond, OK June 5, 2018 J. Watson/Dr. Nikki Seagraves ii J. Watson/Dr. Nikki Seagraves Acknowledgements It is difficult to articulate the amount of gratitude I have for the support and encouragement I have received throughout my master’s thesis. Many people have added value and support to my life during this time. I am thankful for the education, experience, and friendships I have gained at the University of Central Oklahoma. First, I would like to thank Dr. Nikki Seagraves for her mentorship and friendship. I lucked out when I met her. I have enjoyed working on this project and I am very thankful for her support. I would like thank Thomas Crane for his support and patience throughout my master’s degree. I would like to thank Dr. Shannon Conley for her continued mentorship and support. I would like to thank Liz Bullen and Dr. Eric Howard for their training and help on this project. I would like to thank Kristy Meyer for her friendship and help throughout graduate school. I would like to thank my committee members Dr. Robert Brennan and Dr. Lilian Chooback for their advisement on this project. Also, I would like to thank the biology faculty and staff. I would like to thank the Seagraves lab members: Jailene Canales, Kayley Pate, Mckayla Muse, Grace Thetford, Kody Harvey, Jordan Guffey, and Kayle Patatanian for their hard work and support.
    [Show full text]
  • Meta-Analyses of Expression Profiling Data in the Postmortem
    META-ANALYSES OF EXPRESSION PROFILING DATA IN THE POSTMORTEM HUMAN BRAIN by Meeta Mistry B.Sc., McMaster University, 2005 A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF THE REQUIREMENTS FOR THE DEGREE OF DOCTOR OF PHILOSOPHY in THE FACULTY OF GRADUATE STUDIES (Bioinformatics) THE UNIVERSITY OF BRITISH COLUMBIA (Vancouver) July 2012 © Meeta Mistry, 2012 Abstract Schizophrenia is a severe psychiatric illness for which the precise etiology remains unknown. Studies using postmortem human brain have become increasingly important in schizophrenia research, providing an opportunity to directly investigate the diseased brain tissue. Gene expression profiling technologies have been used by a number of groups to explore the postmortem human brain and seek genes which show changes in expression correlated with schizophrenia. While this has been a valuable means of generating hypotheses, there is a general lack of consensus in the findings across studies. Expression profiling of postmortem human brain tissue is difficult due to the effect of various factors that can confound the data. The first aim of this thesis was to use control postmortem human cortex for identification of expression changes associated with several factors, specifically: age, sex, brain pH and postmortem interval. I conducted a meta-analysis across the control arm of eleven microarray datasets (representing over 400 subjects), and identified a signature of genes associated with each factor. These genes provide critical information towards the identification of problematic genes when investigating postmortem human brain in schizophrenia and other neuropsychiatric illnesses. The second aim of this thesis was to evaluate gene expression patterns in the prefrontal cortex associated with schizophrenia by exploring two methods of analysis: differential expression and coexpression.
    [Show full text]
  • Supplementary Materials
    Lists of figures Figure S1: A-B: Principal Component Analysis (PCA) was applied to 3 pairs of SCEC tissues (red) and matched adjacent normal tissues (blue) that were characterized by the gene expression of all probes on Affymetrix HG U133 Plus 2.0 Array. C: Box plot of SCEC group. D: Pearson’s correlation matrix of SCEC group. 17 / 25 Figure S2: MvA plot of SCEC group. Figure S3: Volcano plots of probe sets differing between SCEC and matched normal tissues. Fold change (X axis) is plotted against statistical significance (Y axis) for each probe sets. Genes altered with a fold change ≥2 and FDR <0.01 are depicted in red. Grey represents genes in the arrays that were not found to differ significantly between cancerous samples and matched normal samples. Figure S4: Gene regulatory network plotted by the top 120 DEGs (ranked by FDR) of SCEC groups. 18 / 25 Figure S5: DNA copy number change profiles in 3 pairs of SCEC samples. The CNVs frequency of the whole genome was analyzed by aCGH. Gains were marked in red and losses in bule. Lists of tables Table S1. Primers used in qRT-PCR for microarray gene expression validation Gene Forward Primer (5’-3’) Reverse Primer (5’-3’) Product β-actin AAGGTGACAGCAGTCGGTT TGTGTGGACTTGGGAGAGG 195bp INSM1 GTATTCGCTGTGTTCATGGTC CGCTACATACATAGAGAGCAGAG 79bp ASCL1 AACTCCCATCACCTCTAACA TGAGACGAAAGACACCAACT 120bp NRCAM GATGGCGAAGAATGAAGTT ACAGTGAGGGATAAGGTGTG 141bp NUF2 ATGATGCCAGTGAACTCTGAA GACTTGTCCGTTTTGCTTTTG 160bp 19 / 25 SNAP25 CCTGGATATGGGCAATGAGAT ACACGGGTGGGCACACTTA 146bp PTP4A3 GCTTCCTCATCACCCACAA CCGTACTTCTTCAGGTCCTCA
    [Show full text]
  • Interpreting Human Genetic Variation with in Vivo Zebrafish Assays Erica E
    Interpreting Human Genetic Variation With In Vivo Zebrafish Assays Erica E. Davis, PhD, Stephan Frangakis, BS, and Nicholas Katsanis, PhD Center for Human Disease Modeling Duke University Medical Center Durham, North Carolina © 20132015 Katsanis Interpreting Human Genetic Variation With In Vivo Zebrafish Assays 11 Introduction bona fide pathogenic mutations alone in the average NOTES Rapid advances and cost erosion in exome and human exome, studies have reported a median of 50– genome analysis of patients with both rare and 150 nonsense mutations, several in homozygosity, common genetic disorders have accelerated gene while the abundance of unique single nucleotide discovery and illuminated fundamental biological variants (SNVs) can be in the low-to-mid 100s mechanisms. The thrill of discovery has been (1000 Genomes Project Consortium et al., 2010). accompanied, however, by the sobering appreciation Importantly, the number of rare and ultra-rare SNVs that human genomes are burdened with a large has continued to increase proportionately to the number of rare and ultra-rare variants, thereby posing number of available exomes and genomes (Tennessen a significant challenge in dissecting both the effect of et al., 2012), indicating that we are unlikely to reach such alleles on protein function and the biological saturation of such alleles soon. These observations relevance of these events to patient pathology. In have generated a significant interpretive problem an effort to develop model systems that are able to for disease gene discovery and for clinical genomics, generate surrogates of human pathologies, a powerful as population-based arguments alone have been suite of tools has been developed in zebrafish, unable to dissect the contribution of the majority of taking advantage of the relatively small (compared these alleles to clinical phenotypes.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Biocuration 2016 - Posters
    Biocuration 2016 - Posters Source: http://www.sib.swiss/events/biocuration2016/posters 1 RAM: A standards-based database for extracting and analyzing disease-specified concepts from the multitude of biomedical resources Jinmeng Jia and Tieliu Shi Each year, millions of people around world suffer from the consequence of the misdiagnosis and ineffective treatment of various disease, especially those intractable diseases and rare diseases. Integration of various data related to human diseases help us not only for identifying drug targets, connecting genetic variations of phenotypes and understanding molecular pathways relevant to novel treatment, but also for coupling clinical care and biomedical researches. To this end, we built the Rare disease Annotation & Medicine (RAM) standards-based database which can provide reference to map and extract disease-specified information from multitude of biomedical resources such as free text articles in MEDLINE and Electronic Medical Records (EMRs). RAM integrates disease-specified concepts from ICD-9, ICD-10, SNOMED-CT and MeSH (http://www.nlm.nih.gov/mesh/MBrowser.html) extracted from the Unified Medical Language System (UMLS) based on the UMLS Concept Unique Identifiers for each Disease Term. We also integrated phenotypes from OMIM for each disease term, which link underlying mechanisms and clinical observation. Moreover, we used disease-manifestation (D-M) pairs from existing biomedical ontologies as prior knowledge to automatically recognize D-M-specific syntactic patterns from full text articles in MEDLINE. Considering that most of the record-based disease information in public databases are textual format, we extracted disease terms and their related biomedical descriptive phrases from Online Mendelian Inheritance in Man (OMIM), National Organization for Rare Disorders (NORD) and Orphanet using UMLS Thesaurus.
    [Show full text]
  • Computational Analyses of Small Molecules Activity from Phenotypic Screens
    Computational analyses of small molecules activity from phenotypic screens Azedine Zoufir Hughes Hall This dissertation is submitted for the degree of Doctor of Philosophy July 2018 Declaration This thesis is submitted as the result of my own work and includes nothing which is the outcome of work done in collaboration except where specifically indicated in the text. It is not substantially the same as any that I have submitted, or, is being concurrently submitted for a degree or diploma or other qualification at the University of Cambridge or any other University or similar institution except as declared in the preface and specified in the text. I further state that no substantial part of my dissertation has already been submitted, or, is being concurrently submitted for any such degree, diploma or other qualification at the University of Cambridge or any other University or similar institution except as declared in the Preface and specified in the text. This dissertation does not exceed the word limit of 60,000 words. Azedine Zoufir July 2018 Summary Title: Computational analyses of small molecules activity from phenotypic screens Author: Azedine Zoufir Drug discovery is no longer relying on the one gene-one disease paradigm nor on target-based screening alone to discover new drugs. Phenotypic-based screening is regaining momentum to discover new compounds since those assays provide an environment closer to the physiological state of the disease and allow to better anticipate off-target effects and other factors that can limit the efficacy of the drugs. However, uncovering the mechanism of action of the compounds active in those assays relies on in vitro techniques that are expensive and time- consuming.
    [Show full text]
  • Identification of Transcriptional Mechanisms Downstream of Nf1 Gene Defeciency in Malignant Peripheral Nerve Sheath Tumors Daochun Sun Wayne State University
    Wayne State University DigitalCommons@WayneState Wayne State University Dissertations 1-1-2012 Identification of transcriptional mechanisms downstream of nf1 gene defeciency in malignant peripheral nerve sheath tumors Daochun Sun Wayne State University, Follow this and additional works at: http://digitalcommons.wayne.edu/oa_dissertations Recommended Citation Sun, Daochun, "Identification of transcriptional mechanisms downstream of nf1 gene defeciency in malignant peripheral nerve sheath tumors" (2012). Wayne State University Dissertations. Paper 558. This Open Access Dissertation is brought to you for free and open access by DigitalCommons@WayneState. It has been accepted for inclusion in Wayne State University Dissertations by an authorized administrator of DigitalCommons@WayneState. IDENTIFICATION OF TRANSCRIPTIONAL MECHANISMS DOWNSTREAM OF NF1 GENE DEFECIENCY IN MALIGNANT PERIPHERAL NERVE SHEATH TUMORS by DAOCHUN SUN DISSERTATION Submitted to the Graduate School of Wayne State University, Detroit, Michigan in partial fulfillment of the requirements for the degree of DOCTOR OF PHILOSOPHY 2012 MAJOR: MOLECULAR BIOLOGY AND GENETICS Approved by: _______________________________________ Advisor Date _______________________________________ _______________________________________ _______________________________________ © COPYRIGHT BY DAOCHUN SUN 2012 All Rights Reserved DEDICATION This work is dedicated to my parents and my wife Ze Zheng for their continuous support and understanding during the years of my education. I could not achieve my goal without them. ii ACKNOWLEDGMENTS I would like to express tremendous appreciation to my mentor, Dr. Michael Tainsky. His guidance and encouragement throughout this project made this dissertation come true. I would also like to thank my committee members, Dr. Raymond Mattingly and Dr. John Reiners Jr. for their sustained attention to this project during the monthly NF1 group meetings and committee meetings, Dr.
    [Show full text]
  • Maternal Plasma Autoantibodies Screening in Fetal Down Syndrome
    Hindawi Publishing Corporation Journal of Immunology Research Volume 2016, Article ID 9362169, 11 pages http://dx.doi.org/10.1155/2016/9362169 Research Article Brief Communication: Maternal Plasma Autoantibodies Screening in Fetal Down Syndrome Karol Charkiewicz,1 Monika Zbucka-Kretowska,2 Joanna Goscik,3 Slawomir Wolczynski,2 Adam Lemancewicz,1 and Piotr Laudanski1 1 Department of Perinatology and Obstetrics, Medical University of Bialystok, Marii Sklodowskiej-Curie 24a, 15-276 Bialystok, Poland 2Department of Reproduction and Gynecological Endocrinology, Medical University of Bialystok, Marii Sklodowskiej-Curie 24a, 15-276 Bialystok, Poland 3Faculty of Computer Science, Bialystok University of Technology, Wiejska 45A, 15-351 Bialystok, Poland Correspondence should be addressed to Piotr Laudanski; [email protected] Received 21 July 2015; Revised 14 January 2016; Accepted 27 January 2016 Academic Editor: Mario Clerici Copyright © 2016 Karol Charkiewicz et al. This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Imbalance in the metabolites levels which can potentially be related to certain fetal chromosomal abnormalities can stimulate mother’s immune response to produce autoantibodies directed against proteins. The aim of the study was to determine the concentration of 9000 autoantibodies in maternal plasma to detect fetal Down syndrome. Method. Weperformed 190 amniocenteses and found 10 patients with confirmed fetal Down syndrome (15th–18th weeks of gestation). For the purpose of our control we chose 11 women without confirmed chromosomal aberration. To assess the expression of autoantibodies in the blood plasma, we used a protein microarray, which allows for simultaneous determination of 9000 proteins per sample.
    [Show full text]
  • KLEIN-DISSERTATION-2014.Pdf (5.178Mb)
    IDENTIFICATION AND CHARACTERIZATION OF THE MULTIFUNCTIONAL EPIGENETIC REGULATOR CFP1 AS AN ERK1/2 SUBSTRATE APPROVED BY SUPERVISORY COMMITTEE Melanie H. Cobb, Ph.D. Paul Sternweis, Ph.D. Joel Goodman, Ph.D. Nicholas Conrad, Ph.D. ii DEDICATION Thank you to all of the nerds, geeks and dorks who inspired and supported me through this endeavor, especially TJ, my parents, and Melanie. IDENTIFICATION AND CHARACTERIZATION OF THE MULTIFUNCTIONAL EPIGENETIC REGULATOR CFP1 AS AN ERK1/2 SUBSTRATE by AILEEN MELANIE KLEIN DISSERTATION Presented to the Faculty of the Graduate School of Biomedical Sciences The University of Texas Southwestern Medical Center at Dallas In Partial Fulfillment of the Requirements For the Degree of DOCTOR OF PHILOSOPHY The University of Texas Southwestern Medical Center at Dallas Dallas, Texas December, 2014 Copyright by Aileen Melanie Klein, 2014 All Rights Reserved IDENTIFICATION AND CHARACTERIZATION OF THE MULTIFUNCTIONAL EPIGENETIC REGULATOR CFP1 AS AN ERK1/2 SUBSTRATE Aileen Melanie Klein The University of Texas Southwestern Medical Center at Dallas, 2014 Supervising Professor: Melanie H. Cobb, Ph.D. Epigenetic regulation of gene transcription occurs as an integration of multiple layers of signals at a genetic locus. These signals can include local chromatin structure, covalent modifications to both histone proteins and DNA, the presence of transcription factors, and modification directly to the transcriptional machinery. Our lab is interested in the control of cellular processes by the mitogen activated protein kinases ERK1/2. In a yeast two-hybrid screen with activated ERK2 (extracellular signal-regulated kinase 2) to find novel interacting partners, our lab identified CFP1 (CxxC finger protein 1), a DNA-binding protein that is a vital component of the H3K4 trimethylating Set1A/B complexes to promote gene transcription.
    [Show full text]