Page 1 of 65 Diabetes
The genetic program of pancreatic beta-cell replication in vivo
Agnes Klochendler1, Inbal Caspi2, Noa Corem1, Maya Moran3, Oriel Friedlich1, Sharona Elgavish4, Yuval Nevo4, Aharon Helman1, Benjamin Glaser5, Amir Eden3, Shalev Itzkovitz2, Yuval Dor1,*
1Department of Developmental Biology and Cancer Research, The Institute for Medical Research Israel Canada, The Hebrew University Hadassah Medical School, Jerusalem 91120, Israel
2Department of Molecular Cell Biology, Weizmann Institute of Science, Rehovot, Israel.
3Department of Cell and Developmental Biology, The Silberman Institute of Life Sciences, The Hebrew University of Jerusalem, Jerusalem 91904, Israel
4Info CORE, Bioinformatics Unit of the I CORE Computation Center, The Hebrew University and Hadassah, The Institute for Medical Research Israel Canada, The Hebrew University Hadassah Medical School, Jerusalem 91120, Israel
5Endocrinology and Metabolism Service, Department of Internal Medicine, Hadassah Hebrew University Medical Center, Jerusalem 91120, Israel
*Correspondence: [email protected]
Running title: The genetic program of pancreatic β cell replication
1
Diabetes Publish Ahead of Print, published online March 18, 2016 Diabetes Page 2 of 65
Abstract
The molecular program underlying infrequent replication of pancreatic beta cells remains largely inaccessible. Using transgenic mice expressing GFP in cycling cells we sorted live, replicating beta cells and determined their transcriptome. Replicating beta cells upregulate hundreds of proliferation related genes, along with many novel putative cell cycle components. Strikingly, genes involved in beta cell functions, namely glucose sensing and insulin secretion were repressed. Further studies using single molecule RNA in situ hybridization revealed that in fact, replicating beta cells double the amount of RNA for most genes, but this upregulation excludes genes involved in beta cell function. These data suggest that the quiescence proliferation transition involves global amplification of gene expression, except for a subset of tissue specific genes which are ‘left behind’ and whose relative mRNA amount decreases. Our work provides a unique resource for the study of replicating beta cells in-vivo.
2 Page 3 of 65 Diabetes
Introduction
Pancreatic beta cells residing in the islets of Langerhans are highly specialized for secreting insulin in response to small elevations of blood glucose, thereby maintaining systemic glucose homeostasis. Reduced beta cell mass is a central feature of type 1 and type 2 diabetes, and strategies to enhance beta cell mass are sought as potential regenerative therapies for diabetes (1; 2). Despite being a classic terminally differentiated cell type, beta cells are not entirely post mitotic, and rare beta cell divisions are responsible for homeostatic maintenance of beta cell mass (3 5). Furthermore, studies in rodents have shown that increased demand for insulin due to reduced insulin sensitivity or reduced beta cell mass triggers compensatory beta cell replication, leading to increased beta cell mass (6 8). The pathways regulating beta cell replication have been intensely investigated. Glucose acting via glucose metabolism and the unfolded protein response has emerged as a key driver of cell cycle entry of quiescent beta cells (7; 9 11), and other growth factors and hormones have also been implicated in basal and compensatory beta cell replication under distinct conditions such as pregnancy (12; 13). Intracellularly, multiple signaling molecules are involved in the transmission of mitogenic stimuli to the cell division cycle machinery of beta cells (14; 15), including most notably the calcium calcineurin NFAT pathway (16; 17). Despite this important progress, major gaps remain in our understanding of beta cell replication. To a large extent, this results from the rarity of beta cell replication in vivo. Dividing beta cells have been identified, counted and localized in situ using immunostaining for markers such as Ki67 or BrdU, but it has not been possible so far to systematically characterize their biology at a genome wide scale. Consequently, the molecular changes occurring in replicating beta cells in vivo remain largely unknown.
We have reasoned that the study of the transcriptome of replicating beta cells will require the isolation of these cells from islets while still alive, so as to preserve their labile mRNA. To achieve this, we have previously developed a transgenic mouse strain in which all cells express a fusion between the destruction box of cyclin B1 and green fluorescent protein (CcnB1 GFP) (18; 19). In these mice, GFP is constitutively transcribed in all tissues from a weak
3 Diabetes Page 4 of 65
PGK promoter, but the GFP protein is rapidly degraded by the proteasome in quiescent cells. Degradation of the CcnB1 GFP fusion ceases when cells pass through the S G2 M phases of cell cycle, thus increasing the level of GFP and enabling the identification and sorting of live replicating cells. We have initially used this strain to characterize the transcriptome of replicating hepatocytes, providing a proof of concept as well as insights into the biology of cell division in the liver (19). In the present study, we used this transgene to isolate replicating and quiescent pancreatic beta cells from juvenile mice and analyzed their transcriptome by RNA seq. Our data provide the first comprehensive view of the genes that are activated in spontaneously replicating beta cells in vivo, including many which have not been previously associated with cell cycle regulation in general, and in beta cell proliferation in particular. In addition we uncover a differential regulation of genes involved in beta cell function, which escape the global transcriptional increase in replicating cells.
Research Design and Methods
Mice CcnB1 eGFP mice, generated by infecting single cell embryos with a lentivirus constitutively expressing a fusion between the destruction box of Cyclin B1 and GFP (18), were previously described (19). These mice were bred with RIP Cre (20) and Rosa LSL Tomato (obtained from the Jackson laboratory) mice. All animal experiments were performed in accordance with guidelines established by the joint ethics committee (IACUC) of the Hebrew University and Hadassah Medical Center. The Hebrew University is an AAALAC International accredited institute.
Flow cytometry and cell sorting Islets were isolated following collagenase perfusion as described (21). Islet cells were dissociated to single cells by treatment with Trypsin/EDTA, stained with the Zn2+ binding dye TSQ (22) and sorted on a FACS Aria (Becton Dickinson). For flow cytometry analysis, islet cells were fixed and permeabilized using Cytofix/Cytoperm and Perm/Wash solutions (BD
4 Page 5 of 65 Diabetes
Pharmingen). Immunostaining was performed in Perm/Wash solution using the following primary antibodies: Guinea Pig anti-insulin (Dako), Goat anti Pdx1 (a generous gift from Chris Wright), mouse anti Nkx6.1 (Beta Cell Biology Consortium). Secondary antibodies were from Jackson ImmunoResearch Laboratories. Immunostaining for Ki67 was performed with the Alexa Fluor 647 conjugated Mouse anti Ki67 (BD Pharmingen).
RNA-seq and analysis Total RNA from ~ 1,000 10,000 sorted β cells was isolated by TRIzol (Invitrogen) extraction followed by RNeasy Plus Micro Kit (Qiagen). Poly(A)+ RNA was amplified using MessageAmp™ II aRNA Amplification Kit (Ambion) as described (23). Amplified RNA was fragmented and processed for library generation using Illumina's TruSeq RNA Seq Sample Prep Kit following manufacturer's instructions. The RNA Seq libraries were subsequently sequenced on Illumina HiSeq 2500. The resulting data was loaded into Galaxy (24). TopHat 2.0.5 was used to map the 50bp single reads to the NCBI37/mm9 assembly of the mouse genome. Gene expression analysis of the RNA seq data was conducted using the R package DESeq (25). Differentially expressed genes between replicating and non replicating cells were selected based on FDR (Benjamini Hochberg) ≤0.05. Gene set enrichment analysis based on the hypergeometric test was performed using the Genomica software (http://genomica.weizmann.ac.il/). In our analysis we considered gene sets with a p value below 0.01 and a false discovery rate (FDR) below 0.05 to be significant. Gene sets were compiled from the MSigDB collections (26) or from the literature as described in the text.
Quantitative Real-Time PCR Total RNA (1 ng) was used for first strand cDNA synthesis using random primers (Roche, Indianapolis, IN, USA) and reverse transcriptase (ImProm II, Promega, Madison, WI, USA). Real time PCR was performed with SYBR Green Fast mix (Quanta Biosciences) in 96 well plates using the Bio Rad real time thermal cycler CFX96™. All reactions were performed in triplicates with three biological replicates. The relative amount of mRNA was
5 Diabetes Page 6 of 65
calculated using the comparative CT method after normalization to β actin. Briefly, we calculated ∆Ct values between each gene and β actin, and ∆∆Ct values were calculated between the ∆Ct of each replicate and the average ∆Ct for GFP negative replicates. We used the following primers: Actb forward (5′ cacagcttctttgcagctcct 3′) and reverse (5′ gtcatccatggcgaactgg 3′), Top2A forward (5′ agcagattagcttcgtcaacagc 3′) and reverse (5′ acatgtctgccgcccttaga 3′), Ki67 forward (5′ ttgaccgctcctttaggtatgaa 3′) and reverse (5′ ttccaagggactttcctgga 3′), Pnlip forward (5′ ccacattgctggggaggctgg 3′) and reverse (5′ tcagcggggtccaaccctgt 3′) , Hars forward (5′ ggagtggagcggatcttttc 3′) and reverse (5′ tcagtctctcctccagcagc 3′), Pabpc1 forward (5′ atcctctccatccgggtct 3′) and reverse (5′ ggtgtccaaagcacgttcc 3′), Slc38a4 forward (5′ aagcccagggtgctgagaa 3′) and reverse (5′ ggccgtccgggaattg 3′), Glul forward (5′ cccaacaagctggtgctatg 3′) and reverse (5′ ggttgctcaccatgtccatt 3′), Ero1lb forward (5′ tgattcgcaggaccactttt 3′) and reverse (5′ cccttgtagccagtgtaccg 3′), Slc30a8 forward (5′ tttgtggttgtcatcgaggc 3′) and reverse (5′ gtcaccacccagatgcaaag 3′), Gck forward (5′ cacggtggccacaatgatc 3′) and reverse (5′ cagccggtgcccacaa 3′), Cpe forward (5′ gtcacctcggctaaggatgg 3′) and reverse (5′ gtttccaggagcaagcaatcg 3′), Scg5 forward (5′ ggaagcggaggagtgtcaat 3′) and reverse (5′ tgccacaacattgtccaacc 3′), Slc2a2 forward (5′ aaccgggatgattggcatgt 3′) and reverse (5′ ggcgaatttatccagcagca 3′).
Single-molecule RNA FISH Dissociated islet cells from Ccnb1 GFP mice were seeded on Collagen coated coverslips, fixed with 4% Paraformaldehyde and permeabilized with 70% ice cold ethanol. We performed single molecule RNA FISH as described previously (27). We used GFP fluorescence or smFISH for Ki67 mRNA (28) to specifically label replicating cells. Table S lists probe sequences. Images were taken with a Nikon Ti E inverted fluorescence microscope equipped with a ×100 oil immersion objective and a Photometrics Pixis 1024 CCD camera using MetaMorph software (Molecular Devices, Downington, PA). The image plane pixel dimension was 0.13 m. Cells were manually segmented and dots were automatically counted using the ImageM software (29). For each cell
6 Page 7 of 65 Diabetes
dots were counted only in the Z stacks for which the cell was in focus. In addition, expression per cell was computed as the number of mRNA dots divided by the number of Z stacks quantified per cell, to include cells that only partially appeared within the image stack.
Mitochondrial membrane potential Islets isolated from Ccnb1 eGFP mice were incubated overnight in standard RPMI 1640 culture medium (Gibco). The islets were then dissociated to single cells using Trypsin/EDTA. Single cell suspensions were pre incubated in Krebs Ringer buffer (KRB) supplemented with 0.5% BSA and 3mM glucose at 37°C for 30 min. Following pre incubation, cells were incubated for 90 min at 37°C in KRB with either 3mM or 16mM glucose and tetramethylrhodamineethylester (TMRE) (7nmol/l) (Life Technologies). Cell suspensions were analysed using FACS Aria (Becton Dickinson).
Results
Sorting live replicating beta-cells
To define the transcriptional program of replicating beta cells we used CcnB1 GFP mice to sort replicating and quiescent cells isolated from the islets of Langerhans of 1 month old mice. A BrdU pulse labelling experiment in-vivo confirmed that the rare replicating beta cells were GFP positive (Figure S1D). Sorting replicating beta cells proved particularly challenging given the low percentage of proliferating beta cells at this stage (~ 1% GFP positive cells). In addition, in preliminary experiments we found that sorted GFP+ islet cells had large amounts of acinar specific genes, reflecting contamination by replicating acinar cells and making it difficult to identify beta cell specific changes in gene expression (not shown). To overcome this problem we used two different strategies to isolate beta cells, prior to the split to GFP+ and GFP populations. In one approach, we stained dispersed CcnB1 GFP islet cells with the beta cell specific Zinc binding fluorescent dye TSQ (22), and
7 Diabetes Page 8 of 65
sorted TSQ+ cells (highly enriched for beta cells) that were GFP+ or GFP (Figure S1A). In an alternative approach, we generated compound Insulin Cre; Rosa LSL Tomato; CcnB1 GFP transgenic mice (Figure S1B, C). From these mice we sorted Tomato+ cells (highly enriched for beta cells) that were GFP+ or GFP . Each experiment included pooled islets from 6 8 mice and was performed in biological duplicates, resulting in two sets of Tomato positive and two sets of TSQ positive sorted cell fractions, each set consisting of quiescent (GFP negative) and replicating (GFP positive) cells. Thus altogether we obtained 4 independent samples of GFP+ cells and 4 matched samples of GFP cells. To assess the purity of RNA preparations, we measured by Real time RT PCR the RNA levels of the acinar specific gene Pancreatic Lipase (Pnlip). Both TSQ and the Tomato reporter dramatically reduced the presence of contaminating acinar mRNA compared with unstained cells from dissociated islets (Figure 1A), suggesting a strong enrichment for beta cells. Real time RT PCR revealed a >80 fold increase in the mRNA level of the cell cycle marker Ki67 in the GFP positive cell fractions compared with unstained or GFP negative cells. Together these results indicated that the two sorting strategies successfully enriched for replicating beta cells.
Genes upregulated in replicating beta-cells
The GFP+ fractions consisted of ~1000 cells each and yielded ~5 ng mRNA, necessitating mRNA amplification prior to sequencing. We amplified RNA using T7 based in vitro transcription (23), prepared libraries and performed RNA sequencing. After evaluation of sequence quality and mapping to the mouse genome we used DESeq (25) to measure differential expression between replicating and quiescent beta cells (four biological replicates in each group). A heatmap of sample to sample distance matrix confirmed that the TSQ and Tomato samples were highly similar whereas gene expression differences between the GFP negative and positive samples were greater (Figure S1E). This analysis revealed 3312 differentially expressed genes (FDR ≤ 0.05), including 2067 genes that were upregulated and 1245 genes
8 Page 9 of 65 Diabetes
that were downregulated in replicating beta cells. The levels of the majority of transcripts detected in beta cells did not change between GFP and GFP+ cells (but this depended on the method of normalization, see below).
The genes most significantly induced in replicating beta cells included known cell cycle regulated genes, in particular genes involved in mitotic processes: cyclins, cyclin dependent kinases (CDKs) and genes encoding components of the cytoskeleton, microtubules, centrosomes and mitotic spindle, as expected from cells in the S G2 M phases of the cell cycle (Table 1). Gene Ontology (GO) analysis of the proliferating beta cell signature revealed the expected enrichment for genes involved in DNA synthesis and mitosis, and in proliferation associated functions including DNA repair and chromatin remodeling (Figure 1B). We also observed upregulation of gene sets associated with RNA processing and splicing (Figure 1B and Table S1). These gene sets were described before in the context of hepatocyte proliferation (19), but their link to the cell division cycle remains poorly understood. Importantly, some of the activated genes have not been previously annotated as belonging to the generic proliferation associated GO categories and were not identified as cell cycle regulated in genome wide expression studies (Table 2), and hence represent novel cell cycle related genes.
Downregulation of genes encoding beta-cell function in replicating beta- cells
We next examined the genes that were repressed in replicating beta cells. GO analysis of downregulated gene sets in replicating beta cells showed a striking association with biological processes critical for beta cell function, such as golgi vesicle transport, secretion and regulation of insulin secretion (Figure 2A). Among these were genes involved in insulin processing (Ero1 Like Beta (S. Cerevisiae) (Ero1lb), Proprotein Convertase Subtilisin/Kexin Type 2 (Pcsk2), Carboxypeptidase E (Cpe)) and secretion (Secretogranin V (Scg5), Vesicle-Associated Membrane Protein 4 (Vamp4), Syntaxin 4a (Stx4a) Syntaxin 5a (Stx5a), Synaptotagmin-Like 4 (Sytl4)), and genes
9 Diabetes Page 10 of 65
encoding insulin granule proteins (RAB3A, Member RAS Oncogene Family (Rab3a), Heat Shock 70kDa Protein 5 (Glucose Regulated Protein, 78kDa) (Hspa5), Cathepsin D (Ctsd) and Clusterin (Clu)) (Table 3) (30). Genes involved in glucose uptake and metabolism, including some that play a role in glucose stimulated insulin secretion (GSIS), were also repressed (Solute Carrier Family 2 (Facilitated Glucose Transporter), Member 2 (Slc2a2), Glucose 6 Phosphatase, Catalytic, 2 (G6pc2), Isocitrate Dehydrogenase 1 (NADP+), Soluble (Idh1), Solute Carrier Family 25 (Mitochondrial Carrier; Citrate Transporter), Member 1 (Slc25a1) and Glutamate Dehydrogenase 1 (Glud1)). Interestingly Urocortin 3 (Ucn3), a marker of beta cell maturation (31) was also significantly downregulated in replicating beta cells. These results suggest that beta cell replication is associated with reduced expression of genes that are required for the main function of differentiated beta cells: production, processing, storage and release of insulin in response to glucose. This is consistent with our observation that replicating hepatocytes transiently revert to a less mature, or differentiated, transcriptome (19). Repression of genes encoding beta cell function occurred also in more rapidly proliferating and less mature beta cells, isolated from mice at postnatal day 7 (Figure S4).
A recent study has revealed that the unfolded protein response (UPR) during mild ER stress correlates with, and triggers beta cell proliferation in the context of high glucose (11). Strikingly the UPR markers Heat Shock 70kDa Protein 5 (Hspa5/BiP) and Activating Transcription Factor 6 (Atf6) were repressed in replicating beta cells (Table 3 and data not shown). This finding suggests that although high glucose mediated mild ER stress can stimulate cell cycle entry of beta cells, active UPR is not an integral part of the replication program of these cells at homeostasis.
To better define the transcriptome changes in replicating beta cells and delineate the relationship between beta cell replication and maturation, we generated gene sets from published transcriptomes of beta cells at different developmental stages (31). We found a significant overlap between genes activated during postnatal beta cell maturation and genes repressed in replicating beta cells. Similarly, genes repressed in maturing beta cells were
10 Page 11 of 65 Diabetes
significantly overrepresented among genes induced in replicating beta cells (Figure 2B). As expected, genes downregulated during beta cell maturation and induced in replicating beta cells were enriched for cell cycle associated GO categories. Further, genes induced in beta cell maturation and repressed in replicating beta cells were enriched for beta cell functions (Figure 2C). Together, these results indicate that the transcriptome of replicating beta cells reflects a less mature state.
To assess if reduced expression of genes encoding beta cell function occurs in human beta cells, we examined the published transcriptome of a recently described human beta cell line upon a shift from proliferation to quiescence, induced by Cre mediated excision of T antigen and hTERT (32). Cell cycle exit of these cells was accompanied by activation of genes associated with beta cell function, which significantly overlapped with genes repressed in replicating mouse beta cells (Figure S2). As expected, cell cycle genes activated in replicating mouse beta cells were silenced in the human beta cell line after growth arrest. Thus reduced expression of genes encoding beta cell function during beta cell replication is a feature conserved between mice and humans.
To address the underlying molecular mechanisms, we searched for information about the regulation of genes repressed in replicating beta cells. Enrichment analysis revealed that repressed genes were regulated by key beta cell transcription factors. Genes repressed in replicating beta cells significantly overlapped with genes whose promoters were bound by the NK6 Homeobox 1 (Nkx6.1) or Pancreatic And Duodenal Homeobox 1 (Pdx1) proteins, and with genes that were repressed in Nkx6.1, Pdx1, V Maf Avian
Musculoaponeurotic Fibrosarcoma Oncogene Homolog A (MafA) and HNF1 Homeobox A (Hnf1a) mutant beta cells (33 36) (Figure 3A). Notwithstanding this observation, RNAseq data and qRT PCR analysis revealed that Nkx6.1, Mafa and Pdx1 transcripts are not significantly reduced in replicating beta cells (not shown). Similarly, Neuronal Differentiation 1 (NeuroD1), an additional transcription factor regulating beta cell function is not significantly repressed in replicating beta cells. Moreover, FACS quantification of Pdx1 and Nkx6.1 proteins by co immunostaining for these proteins and Ki67
11 Diabetes Page 12 of 65
revealed that their levels were identical in replicating and quiescent beta cells (Figure 3B). These results suggest that functional beta cell genes are reduced in replicating cells via post translational modifications of the responsible transcription factors, or alternatively that other mechanisms act to reduce expression of functional genes.
Global upregulation of gene expression in replicating beta-cells
We noticed that most repressed genes in replicating beta cells were decreased approximately 2 fold (Figure S3). We reasoned that the transition from quiescence to proliferation might be accompanied by a global doubling in mRNA content per cell, as observed in studies of cell lines (37 39). The normalization method used in differential expression analysis software assumes that the compared cell populations produce the same amount of RNA per cell. Under this assumption, a situation where global mRNA content increases but a subset of genes maintains constant expression levels might be falsely interpreted as downregulation of the unchanged gene subset. One solution to this problem is to normalize the RNA seq data to the number of cells, using spike in standards reflecting cell number (40). However our use of very small cell populations (~1,000 GFP+ beta cells per preparation) precluded the quantification of cell number prior to RNA isolation and the use of RNA spike in standards.
To test the hypothesis that genes showing apparent stable expression levels were in fact upregulated in replicating beta cells, whereas genes that appear downregulated were in fact unchanged in quiescent and replicating cells, we used single molecule RNA in situ hybridization (smRNA FISH) (27). Using this approach, we quantified the number of individual RNA transcripts from selected genes, in individual beta cells that were either quiescent or replicating. Dissociated islet cells from CcnB1 GFP mice were mounted and fixed, and hybridized with probes to specific genes as well as the cell cycle marker Ki67, in addition to imaging GFP fluorescence. Analysis of transcript number per cell showed that genes whose expression levels appeared unchanged in our RNAseq data (Beta Actin (Actb), Histidyl tRNA Synthetase
12 Page 13 of 65 Diabetes
(Hars), Paired Box 6 (Pax6)) were in fact increased in GFP positive replicating cells. Strikingly, RNA transcripts from ‘repressed’ genes (Glut2/Slc2a2 and Glutamate Ammonia Ligase (Glul)) remained constant in dividing beta cells (Figure 4A, B). When we normalized the number of Glut2 or Glul transcripts to the number of Actb transcripts per cell, we observed a statistically significant decline in Glut2 and Glul expression in replicating GFP+ beta cells (Figure 4C). The significant ~two fold increase in Actb transcript levels in replicating beta cells was confirmed in more than five independent smRNA FISH experiments. Based on this observation, we used the Actb gene in qRT PCR analysis as a gene standard. We selected from the RNA seq data a panel of unchanged genes and genes that showed decreased expression in GFP+ replicating beta cells. Normalizing to Actb, qRT PCR analysis confirmed that unchanged genes (Hars, Poly(A) Binding Protein, Cytoplasmic 1 (Pabpc1), Solute Carrier Family 38, Member 4 (Slc38a4)) were regulated similarly to Actb (i.e. were present in higher levels in replicating cells). In contrast, a set of genes encoding beta cell function (Glul, Ero1lb, Solute Carrier Family 30 (Zinc
Transporter), Member 8 (Slc30a8), Glukokinase (Gck), Cpe, Scg5, Slc2a2) that were seen as downregulated in RNA seq, were reduced ~2 fold in replicating beta cells compared with Actb (Figure 4D), implying that they were resistant to the general increase in RNA. Together our data reveal differential transcription dynamics in replicating beta cells in vivo: transcript levels of most genes are approximately doubled, while a subset of genes, enriched for beta cell functions, is refractory to this global upregulation. The mechanism underlying this bimodal transcriptional regulation is still unclear. However it implies that post mitotic daughter cells will carry reduced amounts of RNAs encoding for proteins involved in beta cell mature state and function. These transcripts must be replenished post division to maintain the differentiated status of the beta cells after they exit cell cycle.
No evidence for aerobic glycolysis in replicating beta-cells
A hallmark of cell proliferation is aerobic glycolysis (the Warburg effect), thought to be important for allocating precursors to the biosynthetic needs of
13 Diabetes Page 14 of 65
proliferating cells (41). Aerobic glycolysis occurs in tumors and in rapidly proliferating lymphocytes (42; 43). Surprisingly, our transcriptome analysis did not reveal evidence for a glycolytic shift in replicating beta cells. Several glycolytic genes were in fact significantly repressed (Figure 5A). Relative downregulation of Gck, Glut2 and AldoA was confirmed by qRT PCR (Figure 4D and not shown). Moreover, Lactate Dehydrogenase A (Ldha), a key determinant of aerobic glycolysis and the gene encoding lactate transporter (Solute carrier family 16, member 1; Slc16a1/Mct1), which are both specifically repressed in beta cells (to allow for accurate coupling of glucose sensing to ATP generation) were not activated (Table S2). Similarly the expression levels of genes encoding Hexokinases (Hk1, Hk2, Hk3) remained low in replicating beta cells. Interestingly, Ldha is expressed at high levels in the chronically proliferating human beta cell line and is repressed upon the shift of cells to quiescence (32). To further examine cellular metabolism in replicating beta cells, we stained islet cells with TMRE, a fluorescent probe for monitoring mitochondrial membrane potential. As expected, high glucose enhanced the TMRE signal (Figure 5B and 5C). Strikingly, replicating (GFP+) islet cells had a stronger TMRE signal than quiescent (GFP ) cells, indicative of enhanced mitochondrial activity and implying active oxidative phosphorylation (Figure 5D and 5E). These data suggest that the Warburg effect is not implemented in homeostatic proliferation of beta cells. Interestingly, a recent study showed that quiescent hematopoietic stem cells entering the cell division cycle also have increased mitochondrial activity (44). Potentially aerobic glycolysis is a feature of frequent cell division cycles, as in cancer and immune cell activation, and not of quiescent cells bursting into rare cell division cycles. Further work will establish if and how the metabolism of replicating beta cells is adapted to meet the biosynthetic needs of one cell turning into two.
Discussion
The cell cycle machinery of beta-cells
14 Page 15 of 65 Diabetes
Understanding the molecular biology underlying beta cell proliferation is a major challenge for regenerative biology. Beta cell lines are not suitable models since by definition they have defective cell cycle control, and rare replicating beta cells in vivo have been inaccessible for systematic analysis. Using the CcnB1 GFP cell cycle reporter, we generated a comprehensive transcriptome of beta cell replication in vivo. Genes upregulated in replicating beta cells included members of the canonical cell cycle machinery, as well as other genes previously shown to be associated with cell proliferation (Table S3 1 and S4). In addition, multiple upregulated genes were previously associated with cancer, but not with proliferation of normal cells (Table 2 and Table S3 2). Our data suggest that these genes are novel components of the endogenous cell cycle machinery, that likely affect tumorigenesis via impacting the cell cycle.
Furthermore, 140 genes activated at least two fold (beyond the global amplification of expression) were annotated with functions unrelated to the cell cycle, with unknown function, or simply unannotated cDNA or predicted genes (Table S3 3). We anticipate that those which are strongly induced in replicating beta cells (Table 1B) are bona fide novel players in the cell cycle machinery at least in beta cells. For example, Katanin p60 subunit A like 2 (Katnal2), which is associated with microtubule organization (GO classification), might be involved in beta cell mitosis. Mitochondrial fission regulator 2 (Mtfr2) whose expression (both at the RNA and protein levels) is highly correlated with that of well characterized cell cycle genes (Cdc25c, Cdt1 and Kif18b) is another interesting novel effector of beta cell proliferation.
Ongoing studies with the CcnB1 GFP system in additional tissues are expected to define the global and cell type specific in vivo proliferation signatures of normal and cancerous cells.
Global upregulation of gene expression and exclusion of genes encoding differentiated function
15 Diabetes Page 16 of 65
Replicating beta cells had reduced levels of genes involved in beta cell maturation and function. In principle, this could reflect the biology of a specialized sub population of replication prone, less differentiated beta cells. However previous studies have found no evidence for such a situation, and instead concluded that beta cell mass homeostasis relies on infrequent proliferation of differentiated beta cells, which all have the same potential to divide (3; 5; 45). Thus it is most likely that our data reflect the transcriptional changes that take place when a fully differentiated beta cell enters one cell division cycle.
Using single molecule RNA FISH we found that in fact, “repressed” genes in replicating beta cells are not down regulated but rather their mRNA levels remain constant in the face of a global doubling of mRNA levels. A global increase in mRNA levels in replicating cells has been described (37 39), and is thought to set the stage for the generation of two daughter cells with identical mRNA content to that of the mother cell. However the exclusion from this amplification of genes encoding differentiated functions is novel and will require in depth investigation. One mechanism that could account for the lower mRNA levels of some of the genes is late replication of their genomic loci during S phase. This mechanism contrasts with the established positive correlation between early replication and transcriptional activity (46). In addition, Raj and colleagues recently uncovered a generic mechanism of transcriptional dosage compensation that renders mRNA levels insensitive to the precise timing of DNA replication during S phase (39). An alternative mechanism could be that transcription factors activating the relatively ‘repressed’ genes are limiting, thus preventing the increased transcription despite increased DNA dosage. We note however that the cell cycle related global RNA increase has been reported in cells transiting from G0 to G1, prior to DNA replication (37). An additional possibility is that differentiated genes have a distinct chromatin structure that underlies the lagging phenomenon. However expressed housekeeping genes and expressed tissue specific genes are not known to differ in chromatin structure. Another potential determinant of the process is Myc, a key transcription factor participating in cell replication and proposed to be a global amplifier of transcription in
16 Page 17 of 65 Diabetes
activated lymphocytes and embryonic stem cells (47; 48). The seemingly repressed genes in replicating beta cells may be low affinity Myc targets that are “left behind” during global amplification. Future experiments will attempt to distinguish between these and other models, to understand how specific beta cell genes escape global transcriptional amplification during the cell cycle.
Regardless of the mechanism, our findings imply that a beta cell which has completed mitosis will have reduced levels of transcripts required for its function. The dynamics accounting for upregulation of these genes post mitosis are an interesting topic for further investigation. Finally, while replicating beta cells clearly maintain their overall identity and are not de differentiating, our results do show a fundamental distinction between the programs of differentiation and replication, as we have shown before for replicating hepatocytes (19).
The list of genes “repressed” in replicating beta cells is highly enriched for components of the physiological function of beta cells, namely glucose stimulated insulin secretion. We speculate that additional genes in this list, not previously associated with beta cell function, are a rich source of novel candidate regulators of beta cell function. Ongoing work in our lab is testing this idea systematically.
In conclusion, we describe a comprehensive catalogue of the transcriptome of replicating beta cells in vivo, including multiple upregulated genes not associated previously with beta cell replication. This resource will be useful for future investigations of determinants of beta cell replication, towards the identification of targets for boosting beta cell regeneration in diabetes.
Acknowledgements
We thank Tamar Hashimshony and Itai Yanai for useful discussions and help with the CEL Seq procedure.
17 Diabetes Page 18 of 65
Funding
Supported by grants from the Juvenile Diabetes Research Foundation, Beta Cell Biology Consortium (BCBC) / Human Islet Research Network (HIRN), The Helmsley Charitable Trust, the European Research Commission (ERC consolidator grant), The EU Seventh Framework Program (grant agreement n_241883), the BIRAX, the DON foundation, the Israel Science Foundation and I CORE Program of The Israel Science Foundation #41.11, and the Alex U. Soyka Pancreatic Cancer Research Program (to YD). A.E. was supported by the Israel Science foundation (Grant 1361/14). Supported in part by a grant from USAID's American Schools and Hospitals Abroad Program for the upgrading of the Hebrew University Medical School Flow Cytometry laboratory. AH was supported by a post doctoral fellowship from JDRF.
Duality of Interest
The authors declare no conflict of interest related to this work.
Author contributions
AK, BG, AE, SI and YD designed the experiments. AK, IC, NC, MM, OF, SE, YN and AH performed experiments. AK, BG, AE, SI and YD wrote the manuscript. YD is the guarantor of this work and, as such, had full access to all the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis.
References
1. Desgraz R, Bonal C, Herrera PL: beta cell regeneration: the pancreatic intrinsic faculty. Trends Endocrinol Metab 22:34 43, 2011
2. Prentki M, Nolan CJ: Islet beta cell failure in type 2 diabetes. J Clin Invest 116:1802 1812, 2006
3. Dor Y, Brown J, Martinez OI, Melton DA: Adult pancreatic beta cells are formed by self duplication rather than stem cell differentiation. Nature 429:41 46, 2004
4. Meier JJ, Butler AE, Saisho Y, Monchamp T, Galasso R, Bhushan A, Rizza RA, Butler PC: Beta cell replication is the primary mechanism subserving the postnatal expansion of beta cell mass in humans. Diabetes 57:1584 1594, 2008
18 Page 19 of 65 Diabetes
5. Teta M, Rankin MM, Long SY, Stein GM, Kushner JA: Growth and regeneration of adult beta cells does not involve specialized progenitors. Dev Cell 12:817 826, 2007
6. Nir T, Melton DA, Dor Y: Recovery from diabetes in mice by beta cell regeneration. J Clin Invest 117:2553 2561, 2007
7. Porat S, Weinberg Corem N, Tornovsky Babaey S, Schyr Ben Haroush R, Hija A, Stolovich Rain M, Dadon D, Granot Z, Ben Hur V, White P, Girard CA, Karni R, Kaestner KH, Ashcroft FM, Magnuson MA, Saada A, Grimsby J, Glaser B, Dor Y: Control of pancreatic beta cell regeneration by glucose metabolism. Cell Metab 13:440 449, 2011
8. Terauchi Y, Takamoto I, Kubota N, Matsui J, Suzuki R, Komeda K, Hara A, Toyoda Y, Miwa I, Aizawa S, Tsutsumi S, Tsubamoto Y, Hashimoto S, Eto K, Nakamura A, Noda M, Tobe K, Aburatani H, Nagai R, Kadowaki T: Glucokinase and IRS 2 are required for compensatory beta cell hyperplasia in response to high fat diet induced insulin resistance. J Clin Invest 117:246 257, 2007
9. Hija A, Salpeter S, Klochendler A, Grimsby J, Brandeis M, Glaser B, Dor Y: G0 G1 transition and the restriction point in pancreatic beta cells in vivo. Diabetes 63:578 584, 2014
10. Kassem S, Bhandari S, Rodriguez Bada P, Motaghedi R, Heyman M, Garcia Gimeno MA, Cobo Vuilleumier N, Sanz P, Maclaren NK, Rahier J, Glaser B, Cuesta Munoz AL: Large islets, beta cell proliferation, and a glucokinase mutation. N Engl J Med 362:1348 1350, 2010
11. Sharma RB, O'Donnell AC, Stamateris RE, Ha B, McCloskey KM, Reynolds PR, Arvan P, Alonso LC: Insulin demand regulates beta cell number via the unfolded protein response. J Clin Invest 125:3831 3846, 2015
12. Kim H, Toyofuku Y, Lynn FC, Chak E, Uchida T, Mizukami H, Fujitani Y, Kawamori R, Miyatsuka T, Kosaka Y, Yang K, Honig G, van der Hart M, Kishimoto N, Wang J, Yagihashi S, Tecott LH, Watada H, German MS: Serotonin regulates pancreatic beta cell mass during pregnancy. Nat Med 16:804 808, 2010
13. Rieck S, White P, Schug J, Fox AJ, Smirnova O, Gao N, Gupta RK, Wang ZV, Scherer PE, Keller MP, Attie AD, Kaestner KH: The transcriptional response of the islet to pregnancy in mice. Mol Endocrinol 23:1702 1712, 2009
14. Bernal Mizrachi E, Kulkarni RN, Scott DK, Mauvais Jarvis F, Stewart AF, Garcia Ocana A: Human beta cell proliferation and intracellular signaling part 2: still driving in the dark without a road map. Diabetes 63:819 831, 2014
15. Vetere A, Choudhary A, Burns SM, Wagner BK: Targeting the pancreatic beta cell to treat diabetes. Nat Rev Drug Discov 13:278 289, 2014
19 Diabetes Page 20 of 65
16. Heit JJ, Apelqvist AA, Gu X, Winslow MM, Neilson JR, Crabtree GR, Kim SK: Calcineurin/NFAT signalling regulates pancreatic beta cell growth and function. Nature 443:345 349, 2006
17. Wang P, Alvarez Perez JC, Felsenfeld DP, Liu H, Sivendran S, Bender A, Kumar A, Sanchez R, Scott DK, Garcia Ocana A, Stewart AF: A high throughput chemical screen reveals that harmine mediated inhibition of DYRK1A increases human pancreatic beta cell replication. Nat Med 21:383 388, 2015
18. Clute P, Pines J: Temporal and spatial control of cyclin B1 destruction in metaphase. Nat Cell Biol 1:82 87, 1999
19. Klochendler A, Weinberg Corem N, Moran M, Swisa A, Pochet N, Savova V, Vikesa J, Van de Peer Y, Brandeis M, Regev A, Nielsen FC, Dor Y, Eden A: A transgenic mouse marking live replicating cells reveals in vivo transcriptional program of proliferation. Dev Cell 23:681 690, 2012
20. Gannon M, Shiota C, Postic C, Wright CV, Magnuson M: Analysis of the Cre mediated recombination driven by rat insulin promoter in embryonic and adult mouse pancreas. Genesis 26:139 142, 2000
21. Noordeen NA, Khera TK, Sun G, Longbottom ER, Pullen TJ, da Silva Xavier G, Rutter GA, Leclerc I: Carbohydrate responsive element binding protein (ChREBP) is a negative regulator of ARNT/HIF 1beta gene expression in pancreatic islet beta cells. Diabetes 59:153 160, 2010
22. Jindal RM, Gray DW, McShane P, Morris PJ: Zinc specific N (6 methoxy 8 quinolyl) para toluenesulfonamide as a selective nontoxic fluorescence stain for pancreatic islets. Biotech Histochem 68:196 205, 1993
23. Hashimshony T, Wagner F, Sher N, Yanai I: CEL Seq: single cell RNA Seq by multiplexed linear amplification. Cell Rep 2:666 673, 2012
24. Blankenberg D, Von Kuster G, Coraor N, Ananda G, Lazarus R, Mangan M, Nekrutenko A, Taylor J: Galaxy: a web based genome analysis tool for experimentalists. Curr Protoc Mol Biol Chapter 19:Unit 19 10 11 21, 2010
25. Anders S, Huber W: Differential expression analysis for sequence count data. Genome Biol 11:R106, 2010
26. Subramanian A, Tamayo P, Mootha VK, Mukherjee S, Ebert BL, Gillette MA, Paulovich A, Pomeroy SL, Golub TR, Lander ES, Mesirov JP: Gene set enrichment analysis: a knowledge based approach for interpreting genome wide expression profiles. Proc Natl Acad Sci U S A 102:15545 15550, 2005
27. Raj A, van den Bogaard P, Rifkin SA, van Oudenaarden A, Tyagi S: Imaging individual mRNA molecules using multiple singly labeled probes. Nat Methods 5:877 879, 2008
20 Page 21 of 65 Diabetes
28. Itzkovitz S, Lyubimova A, Blat IC, Maynard M, van Es J, Lees J, Jacks T, Clevers H, van Oudenaarden A: Single molecule transcript counting of stem cell markers in the mouse intestine. Nat Cell Biol 14:106 114, 2011
29. Lyubimova A, Itzkovitz S, Junker JP, Fan ZP, Wu X, van Oudenaarden A: Single molecule mRNA detection and counting in mammalian tissue. Nat Protoc 8:1743 1758, 2013
30. Suckale J, Solimena M: The insulin secretory granule as a signaling hub. Trends Endocrinol Metab 21:599 609, 2010
31. Blum B, Hrvatin SS, Schuetz C, Bonal C, Rezania A, Melton DA: Functional beta cell maturation is marked by an increased glucose threshold and by expression of urocortin 3. Nat Biotechnol 30:261 264, 2012
32. Scharfmann R, Pechberty S, Hazhouz Y, von Bulow M, Bricout Neveu E, Grenier Godard M, Guez F, Rachdi L, Lohmann M, Czernichow P, Ravassard P: Development of a conditionally immortalized human pancreatic beta cell line. J Clin Invest 124:2087 2098, 2014
33. Hang Y, Yamamoto T, Benninger RK, Brissova M, Guo M, Bush W, Piston DW, Powers AC, Magnuson M, Thurmond DC, Stein R: The MafA transcription factor becomes essential to islet beta cells soon after birth. Diabetes 63:1994 2005, 2014
34. Sachdeva MM, Claiborn KC, Khoo C, Yang J, Groff DN, Mirmira RG, Stoffers DA: Pdx1 (MODY4) regulates pancreatic beta cell susceptibility to ER stress. Proc Natl Acad Sci U S A 106:19090 19095, 2009
35. Servitja JM, Pignatelli M, Maestro MA, Cardalda C, Boj SF, Lozano J, Blanco E, Lafuente A, McCarthy MI, Sumoy L, Guigo R, Ferrer J: Hnf1alpha (MODY3) controls tissue specific transcriptional programs and exerts opposed effects on cell growth in pancreatic islets and liver. Mol Cell Biol 29:2945 2959, 2009
36. Taylor BL, Liu FF, Sander M: Nkx6.1 is essential for maintaining the functional state of pancreatic beta cells. Cell Rep 4:1262 1275, 2013
37. Darzynkiewicz Z, Traganos F, Melamed MR: New cell cycle compartments identified by multiparameter flow cytometry. Cytometry 1:98 108, 1980
38. Mayle A, Luo M, Jeong M, Goodell MA: Flow cytometry analysis of murine hematopoietic stem cells. Cytometry A 83:27 37, 2013
39. Padovan Merhar O, Nair GP, Biaesch AG, Mayer A, Scarfone S, Foley SW, Wu AR, Churchman LS, Singh A, Raj A: Single mammalian cells compensate for differences in cellular volume and DNA copy number through independent global transcriptional mechanisms. Mol Cell 58:339 352, 2015
21 Diabetes Page 22 of 65
40. Loven J, Orlando DA, Sigova AA, Lin CY, Rahl PB, Burge CB, Levens DL, Lee TI, Young RA: Revisiting global gene expression analysis. Cell 151:476 482, 2012
41. Vander Heiden MG, Cantley LC, Thompson CB: Understanding the Warburg effect: the metabolic requirements of cell proliferation. Science 324:1029 1033, 2009
42. Wang T, Marquardt C, Foker J: Aerobic glycolysis during lymphocyte proliferation. Nature 261:702 705, 1976
43. Warburg O: On respiratory impairment in cancer cells. Science 124:269 270, 1956
44. Walter D, Lier A, Geiselhart A, Thalheimer FB, Huntscha S, Sobotta MC, Moehrle B, Brocks D, Bayindir I, Kaschutnig P, Muedder K, Klein C, Jauch A, Schroeder T, Geiger H, Dick TP, Holland Letz T, Schmezer P, Lane SW, Rieger MA, Essers MA, Williams DA, Trumpp A, Milsom MD: Exit from dormancy provokes DNA damage induced attrition in haematopoietic stem cells. Nature 520:549 552, 2015
45. Brennand K, Huangfu D, Melton D: All beta cells contribute equally to islet growth and maintenance. PLoS Biol 5:e163, 2007
46. Schwaiger M, Schubeler D: A question of timing: emerging links between transcription and replication. Curr Opin Genet Dev 16:177 183, 2006
47. Nie Z, Hu G, Wei G, Cui K, Yamane A, Resch W, Wang R, Green DR, Tessarollo L, Casellas R, Zhao K, Levens D: c Myc is a universal amplifier of expressed genes in lymphocytes and embryonic stem cells. Cell 151:68 79, 2012
48. Sabo A, Kress TR, Pelizzola M, de Pretis S, Gorski MM, Tesi A, Morelli MJ, Bora P, Doni M, Verrecchia A, Tonelli C, Faga G, Bianchi V, Ronchi A, Low D, Muller H, Guccione E, Campaner S, Amati B: Selective transcriptional regulation by Myc in cellular growth control and lymphomagenesis. Nature 511:488 492, 2014
Figure legends
Figure 1: Ccnb1 GFP marks replicating cells and allows for FACS sorting of quiescent and replicating beta cells. A. qRT PCR analysis of sorted
22 Page 23 of 65 Diabetes
unstained, TSQ stained and Tomato positive islet cells. Results were normalized to Actb. Pnlip and Ki67 expression levels are presented relative to the expression in unstained islets and GFP negative sorted cells, respectively. B. Gene Ontology (GO) enrichment analysis of upregulated genes (FDR≤0.05) in replicating beta cells. Overrepresentation was computed using a statistical test based on hypergeometric distribution. Gene sets with a p value below 0.01 and a false discovery rate (FDR) below 0.05 were considered to be significant.
Figure 2: Genes repressed in replicating beta cells are involved in beta cell function and maturation. A. GO analysis of genes downregulated in replicating beta cells. B. Significant overrepresentation of genes upregulated in development in genes repressed in replicating beta cells (FDR ≤0.05) and conversely, of genes repressed in development in genes induced in replicating beta cells (FDR ≤0.05). c. Genes induced in maturation and repressed in replication are associated with beta cell function. Genes repressed in maturation and activated in replication are associated with cell cycle biological processes. Overrepresentation was computed using a statistical test based on hypergeometric distribution.
Figure 3: Targets of Nkx6.1, Pdx1 and MafA are repressed in replicating beta cells. A. Genes repressed in replicating beta cells are significantly enriched for targets of the beta cell transcription factors. The overrepresentation significance was computed using a statistical test based on hypergeometric distribution. B. FACS histograms of islet cells immunostained for Insulin, Ki67 and Nkx6.1 or Pdx1. Cells were gated on Insulin+ beta cells. Controls represent cells immunostained with isotype control.
23 Diabetes Page 24 of 65
Figure 4: Quantification of RNA molecules by smRNA FISH in quiescent (GFP ) and replicating (GFP+) beta cells. A. Representative image of sm RNA FISH for the detection and measurement of single mRNA molecules of Actb, Glut2 and Ki67, as indicated. Actb level is elevated in GFP+ (arrow) compared to GFP cells (arrowhead, 267 vs. 156 transcripts respectively) whereas Glut2 levels remain unchanged (60 vs. 61 respectively). Ki67 (marker for replicating cell) is expressed only in GFP+ cell. Scale bar is 10 m. Image is a maximal projection of 12 optical sections spaced 0.3 m. B. Quantification based on 15 20 optical sections spaced 0.3 m in the Z direction. Mean numbers (with SEM) of RNA molecules per optical Z section per cell (≥20 GFP+ and GFP cells) for the five measured genes. Each dot represents measurements from a single cell. C. The ratios of Glut2 / Actb and Glul / Actb transcripts were computed per cell. Statistical significance was assessed using the nonparametric Mann Whitney test (B and C) (* p<0.05, *** p<0.0001) D. Quantitative Real Time PCR (qRT PCR) analysis of the indicated mRNAs. Relative mRNA levels (+/ standard error) were calculated after normalization to Actb (n=3, * p<0.05, ** p<0.005, paired t test).
Figure 5: Metabolic changes in replicating beta cells. A. Glycolytic genes repressed in GFP+ (replicating beta cells). Graph shows the mean expression (+/ standard error) in GFP+ beta cells relative to quiescent GFP beta cells, as derived from the RNA seq data. All GFP+ values represent significant fold changes compared with GFP values, as computed by DESeq (FDR<0.05). B- E: Mitochondrial membrane potential (∆Ψm) measured by TMRE staining in dissociated islet cells following incubation in low (3mM) and high glucose (16mM). TMRE intensity is shown for GFP negative (B) and GFP positive (C) islet cells incubated at both glucose concentrations; TMRE staining is shown in GFP and GFP+ islet cells after incubation in low (3mM) and high (16mM) glucose (D and E, respectively).
24 Page 25 of 65 Diabetes
Table 1: Top 30 genes upregulated in replicating beta cells, sorted from lowest FDR (BH) (False detection rate, Benjamini Hochberg). DESeq was used to normalize the counts and compute log2(FC) (log2 fold change) and FDR.
25 Diabetes Page 26 of 65
Table 2: Top 30 most significantly induced genes in replicating beta cells not previously annotated as cell cycle regulated, and not present in cell cycle related gene sets (compiled from cell cycle GO categories, Whitfield cell cycle and Benporath cycling genes from MSigDB). Genes associated with cancer (candidate oncogenes, tumor suppressor genes or genes highly expressed in cancer) are marked in bold. DESeq was used to normalize counts, compute log2(FC) (log2 fold change) and calculate FDR (BH) (False detection rate, Benjamini Hochberg).
26 Page 27 of 65 Diabetes
Table 3: Genes involved in secretion, encoding for insulin granule proteins, regulating GSIS, repressed in replicating beta-cells. log2(FC) (log2 fold change), FDR (BH) (False detection rate, Benjamini Hochberg) as calculated by DESeq after count normalization.
27 Diabetes Page 28 of 65
Figure 1: Ccnb1 GFP marks replicating cells and allows for FACS sorting of quiescent and replicating beta cells. A. qRT PCR analysis of sorted unstained, TSQ stained and Tomato positive islet cells. Results were normalized to Actb. Pnlip and Ki67 expression levels are presented relative to the expression in unstained islets and GFP negative sorted cells, respectively. B. Gene Ontology (GO) enrichment analysis of upregulated genes (FDR≤0.05) in replicating beta cells. Overrepresentation was computed using a statistical test based on hypergeometric distribution. Gene sets with a p value below 0.01 and a false discovery rate (FDR) below 0.05 were considered to be significant. 249x321mm (300 x 300 DPI)
Page 29 of 65 Diabetes
Figure 2: Genes repressed in replicating beta cells are involved in beta cell function and maturation. A. GO analysis of genes downregulated in replicating beta cells. B. Significant overrepresentation of genes upregulated in development in genes repressed in replicating beta cells (FDR ≤0.05) and conversely, of genes repressed in development in genes induced in replicating beta cells (FDR ≤0.05). c. Genes induced in maturation and repressed in replication are associated with beta cell function. Genes repressed in maturation and activated in replication are associated with cell cycle biological processes. Overrepresentation was computed using a statistical test based on hypergeometric distribution. 294x455mm (300 x 300 DPI)
Diabetes Page 30 of 65
Figure 3: Targets of Nkx6.1, Pdx1 and MafA are repressed in replicating beta-cells. A. Genes repressed in replicating beta-cells are significantly enriched for targets of the beta-cell transcription factors. The overrepresentation significance was computed using a statistical test based on hypergeometric distribution. B. FACS histograms of islet cells immunostained for Insulin, Ki67 and Nkx6.1 or Pdx1. Cells were gated on Insulin+ beta-cells. Controls represent cells immunostained with isotype control. 186x182mm (300 x 300 DPI)
Page 31 of 65 Diabetes
Figure 4: Quantification of RNA molecules by smRNA FISH in quiescent (GFP ) and replicating (GFP+) beta cells. A. Representative image of sm RNA FISH for the detection and measurement of single mRNA molecules of Actb, Glut2 and Ki67, as indicated. Actb level is elevated in GFP+ (arrow) compared to GFP cells (arrowhead, 267 vs. 156 transcripts respectively) whereas Glut2 levels remain unchanged (60 vs. 61 respectively). Ki67 (marker for replicating cell) is expressed only in GFP+ cell. Scale bar is 10µm. Image is a maximal projection of 12 optical sections spaced 0.3µm. B. Quantification based on 15 20 optical sections spaced 0.3µm in the Z direction. Mean numbers (with SEM) of RNA molecules per optical Z section per cell (≥20 GFP+ and GFP cells) for the five measured genes. Each dot represents measurements from a single cell. C. The ratios of Glut2 / Actb and Glul / Actb transcripts were computed per cell. Statistical significance was assessed using the nonparametric Mann Whitney test (B and C) (* p<0.05, *** p<0.0001) D. Quantitative Real Time PCR (qRT PCR) analysis of the indicated mRNAs. Relative mRNA levels (+/ standard error) were calculated after normalization to Actb (n=3, * p<0.05, ** p<0.005, paired t test). 295x350mm (300 x 300 DPI) Diabetes Page 32 of 65
Page 33 of 65 Diabetes
Figure 5: Metabolic changes in replicating beta cells. A. Glycolytic genes repressed in GFP+ (replicating beta cells). Graph shows the mean expression (+/ standard error) in GFP+ beta cells relative to quiescent GFP beta cells, as derived from the RNA seq data. All GFP+ values represent significant fold changes compared with GFP values, as computed by DESeq (FDR<0.05). B E: Mitochondrial membrane potential (∆Ψm) measured by TMRE staining in dissociated islet cells following incubation in low (3mM) and high glucose (16mM). TMRE intensity is shown for GFP negative (B) and GFP positive (C) islet cells incubated at both glucose concentrations; TMRE staining is shown in GFP and GFP+ islet cells after incubation in low (3mM) and high (16mM) glucose (D and E, respectively). 162x132mm (300 x 300 DPI)
A Diabetes B Page 34 of 65
4 10 4 4 10 10
3 3 TSQ-posive 10 10 Tomato+
3 10 GFP-posive 2 2
TSQ 10 10 GFP GFP GFP-posive
1 1 10 10 2 Tomato+ 10 GFP-negave 0 GFP-negave 0 10 0 256 512 768 1024 10 0 1 2 3 4 FSC-A 0 256 512 768 1024 10 10 10 10 10 FSC-A Tomato C
Tomato DAPI Insulin DAPI Tomato Insulin DAPI D
GFP BrdU Insulin GFP BrdU
E Color key and histogram 6 3
Count 0 0 75 150 Value
TSQ Tomato GFP- Tomato TSQ TSQ TSQ + Tomato GFP Tomato TSQ TSQ TSQ TSQ Tomato Tomato Tomato Tomato GFP+ GFP- Figure S2 Page 35of65 3.3E-256 3.7E-71 pvalue -1.3 1.3 -1.3
Quiescent (GFP -)
Replicang (GFP +) Downregulateda T-Ag er excision Upregulateda T-Ag er excision Diabetes Gene sets Gene Log2 (Fold Change) Figure S3 Replicang vs Quiescent Repressedgenes Diabetes Page 36of65 Page 37 of 65 Diabetes
Figure S4
1000
* 100
10 GFP- ***** GFP+
1
0.1 Relave expression levels (Log10 scale) (Log10 levels expression Relave Top2A Glul Glut2 Ero1lb Gck Scg5 Diabetes Page 38 of 65
Legends to supplementary figures
Supplementary Figure S1: Flow cytometry analysis showing gating strategies for the sorting of live quiescent (GFP-negative) and replicating (GFP-positive) beta-cells, and evidence for beta-cell specificity of sorting. A. Beta-cells were gated using TSQ-staining of dissociated islet cells from CcnB1-GFP transgenic mice. B. Beta-cells were alternatively isolated by sorting Tomato-positive islet cells from Insulin-Cre;Rosa-LSL-Tomato, CcnB1- GFP transgenic mice. C. Beta-cell specificity: Tomato is exclusively expressed in Insulin-positive cells. Pancreatic sections from 1 month-old Insulin-Cre; Rosa-LSL-Tomato transgenic mice were immunostained for DsRed (Tomato) (red) and insulin (green) and nuclei were counterstained with DAPI (blue). Original magnification: 400. Tomato is expressed in the majority of insulin positive cells, and only in insulin-positive cells. D. GFP marks replicating beta-cells in pancreatic sections. Ccnb1-GFP transgenic mice were sacrificed 3h after BrdU injection and pancreatic sections were immunostained for BrdU (red), GFP (green) and Insulin (white), and nuclei were counterstained with DAPI (blue). Original magnification: 400. E. Heatmap showing the Euclidian distances between the different RNA-seq samples as calculated from the variance stabilizing transformation of the RNA-seq read counts (DESeq) (25).
Supplementary Figure S2: Genes repressed in replicating beta-cells significantly overlap with genes upregulated in human beta-cell-line after excision of T-Ag and hTERT. Conversely, genes induced in replicating beta- cells are significantly correlated with genes downregulated in beta-cell-line after excision of T-Ag and hTERT. For each gene set (row) (genes activated or repressed upon cell cycle exit induced by T-Ag excision), the mean expression of the overlapping differentially expressed genes in each experiment (column) is shown, after logarithmic transformation and row centering. The overrepresentation significance (p-value) was computed using a statistical test based on hypergeometric distribution.
1 Page 39 of 65 Diabetes
Supplementary Figure S3: Most repressed genes in replicating cells are downregulated roughly two-fold (Log2 (fold change) =-1). Scatter plot showing Log2 (Fold change) of repressed genes (1245 genes) in replicating cells (Fold change was calculated by DESeq after count normalization).
Supplementary Figure S4: Quantitative RT-PCR (qRT-PCR) analysis of the cell-cycle gene Top2A and selected beta-cell maturation genes in sorted beta- cells isolated from Ccnb1-GFP P7 pups. For each gene the mean expression value in GFP+ cells (n=3, FACS experiments) +/- standard error is presented relative to GFP- cells after normalization to beta-actin (Actb). * P<0.05 (t-test)
2 Diabetes Page 40 of 65
Supplementary Table 1: Genes upregulated in replicating beta-cells, associated with RNA processing-GO category. Genes associated with the RNA splicing GO category are marked in bold. log2(FC) (log2 fold change). FDR (BH) (False detection rate, Benjamini-Hochberg). Page 41 of 65 Diabetes
Gene GFP- GFP+ log2FoldChange FDR Ldha 5.1 5.2 0.0 1 Slc16a1 3.4 9.4 1.5 0.3 Hk1 8.6 9.8 0.2 1 Hk2 0.0 0.7 1 Hk3 0.5 0.5 -0.2 1 Supplementary Table 2: Genes encoding beta-cells ‘disallowed’ genes involved in glucose metabolism are expressed at very low levels and are not significantly differentially expressed in replicating cells. GFP- and GFP+ values are mean normalized counts (DESeq) for quiescent and replicating beta-cells, respectively. FDR (BH) (False detection rate, Benjamini- Hochberg).
Diabetes Page 42 of 65
Supplementary table S3-1. Genes previously associated with cell cycle/proliferation, upregulated in replicating beta-cells Gene Gene description log2FoldChange padj Top2a topoisomerase (DNA) II alpha 7.38 3.3E-137 Cdk1 cyclin-dependent kinase 1 7.41 5.8E-135 Hmmr hyaluronan mediated motility receptor 7.28 1.8E-125 (RHAMM) Pbk PDZ binding kinase 6.91 3E-125 Cenpf centromere protein F 7.04 1.5E-123 Iqgap3 IQ motif containing GTPase activating protein 3 8.29 1.3E-122 Nusap1 nucleolar and spindle associated protein 1 7.21 2.7E-122 Arhgef39 Rho guanine nucleotide exchange factor (GEF) 8.19 1.2E-120 39 Cdca3 cell division cycle associated 3 6.77 4.9E-118 Cdca8 cell division cycle associated 8 7.04 4.9E-118 Neil3 nei like 3 (E. coli) 7.59 6.6E-118 Cdc20 cell division cycle 20 6.88 4E-117 Aurkb aurora kinase B 7.67 1.4E-116 Plk1 polo-like kinase 1 7.66 1.4E-115 Tpx2 TPX2, microtubule-associated protein homolog 6.72 5.8E-115 (Xenopus laevis) Troap trophinin associated protein 8.03 2.1E-114 Fam64a family with sequence similarity 64, member A 7.26 8.5E-114 Ckap2l cytoskeleton associated protein 2-like 6.67 1.7E-113 Cenpa centromere protein A 6.59 2.5E-113 Cenpe centromere protein E 6.91 5.4E-113 Birc5 baculoviral IAP repeat-containing 5 6.74 2.2E-112 Ccnb2 cyclin B2 6.54 9.7E-112 Ska1 spindle and kinetochore associated complex 8.15 9.7E-112 subunit 1 Ccna2 cyclin A2 6.51 1.5E-111 Mxd3 Max dimerization protein 3 7.15 2.4E-111 Casc5 cancer susceptibility candidate 5 7.48 5E-108 Aspm asp (abnormal spindle)-like, microcephaly 6.72 8.6E-106 associated (Drosophila) Kif23 kinesin family member 23 6.79 9.8E-106 Ankle1 ankyrin repeat and LEM domain containing 1 7.53 9.8E-106 Shcbp1 Shc SH2-domain binding protein 1 6.87 8.2E-104 Ccnb1 cyclin B1 7.16 1.2E-102 Ndc80 NDC80 homolog, kinetochore complex 6.78 1.2E-101 component (S. cerevisiae) Cdca2 cell division cycle associated 2 6.47 2.1E-100 Prc1 protein regulator of cytokinesis 1 6.02 4E-100 Ncaph non-SMC condensin I complex, subunit H 6.61 1E-99 Page 43 of 65 Diabetes
Asf1b ASF1 anti-silencing function 1 homolog B (S. 6.14 1.3E-99 cerevisiae) Cdca5 cell division cycle associated 5 6.66 2.2E-99 Spc24 SPC24, NDC80 kinetochore complex component, 6.24 3.1E-99 homolog (S. cerevisiae) Melk maternal embryonic leucine zipper kinase 7.02 6.32E-98 Mis18bp1 MIS18 binding protein 1 6.36 8.49E-98 Ect2 ect2 oncogene 6.22 2.9E-97 Cdc25c cell division cycle 25C 6.95 4.09E-97 Dlgap5 discs, large (Drosophila) homolog-associated 6.34 1.91E-96 protein 5 Nuf2 NUF2, NDC80 kinetochore complex component, 6.01 5.39E-93 homolog (S. cerevisiae) Esco2 establishment of cohesion 1 homolog 2 (S. 7.36 7.17E-92 cerevisiae) Knstrn kinetochore-localized astrin/SPAG5 binding 5.58 1.25E-90 Ube2t ubiquitin-conjugating enzyme E2T (putative) 5.96 1.25E-90 Gas2l3 growth arrest-specific 2 like 3 5.88 3.08E-90 Gtse1 G two S phase expressed protein 1 7.06 2.13E-89 Cenpi centromere protein I 6.84 9.26E-89 Rad51ap1 RAD51 associated protein 1 6.13 1.17E-88 Kif18b kinesin family member 18B 7.57 4.76E-87 Nek2 NIMA (never in mitosis gene a)-related 6.61 3.41E-86 expressed kinase 2 Cep55 centrosomal protein 55 6.41 4.83E-85 Smc2 structural maintenance of chromosomes 2 5.34 8.43E-85 Kif22 kinesin family member 22 5.72 9.16E-85 Cdkn2c cyclin-dependent kinase inhibitor 2C (p18, 5.18 3.65E-82 inhibits CDK4) Kif2c kinesin family member 2C 6.55 3.69E-81 Gsg2 germ cell-specific gene 2 6.47 4.33E-81 Ncapg2 non-SMC condensin II complex, subunit G2 5.22 2.16E-80 Bub1b budding uninhibited by benzimidazoles 1 7.33 2.34E-79 homolog, beta (S. cerevisiae) Cdkn3 cyclin-dependent kinase inhibitor 3 5.71 9.68E-79 Rad51 RAD51 homolog 5.37 1.02E-78 Ncapg non-SMC condensin I complex, subunit G 5.63 1.47E-78 Bub1 budding uninhibited by benzimidazoles 1 7.17 1E-77 homolog (S. cerevisiae) Tacc3 transforming, acidic coiled-coil containing 5.18 1.55E-77 protein 3 Cenpw centromere protein W 5.49 1.78E-76 Clspn claspin 6.01 2.08E-76 Cks2 CDC28 protein kinase regulatory subunit 2 6.38 3.72E-76 Diabetes Page 44 of 65
Bard1 BRCA1 associated RING domain 1 5.62 5.87E-75 Mad2l1 MAD2 mitotic arrest deficient-like 1 5.00 9.77E-75 Smtn smoothelin 8.30 3.86E-74 Ccnf cyclin F 5.61 9.76E-74 Oip5 Opa interacting protein 5 6.27 1.03E-73 Ncapd2 non-SMC condensin I complex, subunit D2 5.09 4.8E-73 Cenpl centromere protein L 5.42 7.15E-72 Fignl1 fidgetin-like 1 5.75 7.29E-71 Kif14 kinesin family member 14 7.10 7.55E-71 Haus4 HAUS augmin-like complex, subunit 4 5.20 1.16E-70 Ska3 spindle and kinetochore associated complex 6.03 3.33E-70 subunit 3 Fam111a family with sequence similarity 111, member A 5.02 9.37E-70 Aurka aurora kinase A 4.72 1.01E-69 Dbf4 DBF4 homolog (S. cerevisiae) 5.13 3.34E-69 Sgol2 shugoshin-like 2 (S. pombe) 6.17 4.16E-69 Rrm2 ribonucleotide reductase M2 4.84 7.59E-69 Brca1 breast cancer 1 5.15 1.97E-68 Brip1 BRCA1 interacting protein C-terminal helicase 1 5.67 6.82E-68 Cenpn centromere protein N 4.99 5.78E-67 Pole polymerase (DNA directed), epsilon 5.31 2.29E-66 C330027C09Rik RIKEN cDNA C330027C09 gene 4.73 3.7E-66 Cdc25b cell division cycle 25B 4.84 5.4E-66 Ube2c ubiquitin-conjugating enzyme E2C 7.84 6.43E-66 Kif18a kinesin family member 18A 5.51 6.61E-66 Ccdc99 spindle apparatus coiled-coil protein 1 5.40 7.31E-66 Stil Scl/Tal1 interrupting locus 6.21 7.52E-66 Zwilch zwilch kinetochore protein 5.18 3.72E-65 Prr11 proline rich 11 5.60 1.14E-64 Psrc1 proline/serine-rich coiled-coil 1 5.61 1.27E-64 Smc4 structural maintenance of chromosomes 4 4.34 3.78E-64 Cenph centromere protein H 5.21 7.12E-64 E2f8 E2F transcription factor 8 6.41 8.54E-64 Fbxo5 F-box protein 5 4.75 8.8E-64 Tubb5 tubulin, beta 5 class I 4.23 1.25E-63 Trip13 thyroid hormone receptor interactor 13 5.70 1.38E-63 Kif20a kinesin family member 20A 5.01 1.7E-62 Ercc6l excision repair cross-complementing rodent 6.31 6.62E-62 repair deficiency complementation group 6 like Cenpk centromere protein K 5.04 1.66E-61 Tmem48 transmembrane protein 48 4.71 4.12E-61 Cenpp centromere protein P 4.81 4.28E-60 Page 45 of 65 Diabetes
Kif11 kinesin family member 11 6.65 1.81E-59 Dtl denticleless homolog (Drosophila) 4.73 1.92E-59 Diap3 diaphanous homolog 3 (Drosophila) 5.42 7.25E-59 Exo1 exonuclease 1 5.56 1.15E-58 Ezh2 enhancer of zeste homolog 2 (Drosophila) 4.28 2.7E-57 Kif15 kinesin family member 15 5.26 3.3E-57 Mcm10 minichromosome maintenance deficient 10 (S. 4.92 6.58E-57 cerevisiae) Plk4 polo-like kinase 4 4.67 3.32E-56 Ckap2 cytoskeleton associated protein 2 6.73 3.45E-56 Mastl microtubule associated serine/threonine kinase- 4.94 1.03E-55 like Atad2 ATPase family, AAA domain containing 2 4.41 1.04E-55 Wdr62 WD repeat domain 62 5.25 2.41E-55 Tyms thymidylate synthase 4.13 3.07E-55 Kif4 kinesin family member 4 7.26 8.19E-54 Sgol1 shugoshin-like 1 (S. pombe) 6.33 1.05E-53 Cep72 centrosomal protein 72 5.45 1.1E-53 Lig1 ligase I, DNA, ATP-dependent 4.08 1.19E-53 Brca2 breast cancer 2 4.62 1.19E-53 Rfc4 replication factor C (activator 1) 4 4.40 4.98E-53 Lrr1 leucine rich repeat protein 1 6.30 1.85E-52 Cdc45 cell division cycle 45 4.07 9.32E-52 Mcm3 minichromosome maintenance deficient 3 (S. 4.23 1.26E-51 cerevisiae) Paf RIKEN cDNA 2810417H13 gene 5.58 3.83E-51 Reep4 receptor accessory protein 4 4.02 1.13E-50 Cit citron 3.84 1.66E-50 Stmn1 stathmin 1 6.46 9.23E-50 Tk1 thymidine kinase 1 3.89 1.53E-49 Mis18a MIS18 kinetochore protein homolog A (S. 4.11 5.34E-49 pombe) Fancb Fanconi anemia, complementation group B 4.95 8.95E-49 Stk17b serine/threonine kinase 17b (apoptosis-inducing) 4.07 9.06E-49 Anln anillin, actin binding protein 6.86 9.06E-49 Hells helicase, lymphoid specific 4.59 1.31E-48 Dscc1 defective in sister chromatid cohesion 1 5.27 1.87E-48 homolog (S. cerevisiae) Fam83d family with sequence similarity 83, member D 3.98 2.32E-48 Psmc3ip proteasome (prosome, macropain) 26S subunit, 4.44 7.11E-48 ATPase 3, interacting protein Cdt1 chromatin licensing and DNA replication factor 1 4.16 7.93E-48 Ttk Ttk protein kinase 5.92 9E-48 Diabetes Page 46 of 65
Chek2 checkpoint kinase 2 5.84 1.44E-47 Depdc1b DEP domain containing 1B 4.96 1.5E-47 Hn1 hematological and neurological expressed 3.79 2.58E-47 sequence 1 Mybl1 myeloblastosis oncogene-like 1 5.33 3.46E-47 Racgap1 Rac GTPase-activating protein 1 3.65 7.9E-47 Mlf1ip myeloid leukemia factor 1 interacting protein 5.70 1.48E-46 Mki67 antigen identified by monoclonal antibody Ki 67 6.48 2.12E-46 Clhc1 aurora kinase A and ninein interacting protein 6.82 8.58E-46 Chaf1b chromatin assembly factor 1, subunit B (p60) 4.08 1.26E-45 Parpbp PARP1 binding protein 5.96 4.71E-45 E2f7 E2F transcription factor 7 4.44 1.34E-44 Fam33a spindle and kinetochore associated complex 3.61 2.1E-44 subunit 2 Blm Bloom syndrome, RecQ helicase-like 4.61 1.12E-43 Chtf18 CTF18, chromosome transmission fidelity factor 6.80 1.58E-43 18 Dsn1 DSN1, MIND kinetochore complex component, 5.39 1.92E-43 homolog (S. cerevisiae) Rrm1 ribonucleotide reductase M1 3.71 3.59E-43 Plk-ps1 polo-like kinase, pseudogene 1 6.09 4.71E-43 Foxm1 forkhead box M1 6.37 6.45E-43 Rad18 RAD18 homolog (S. cerevisiae) 3.70 8.71E-42 Gen1 Gen homolog 1, endonuclease (Drosophila) 4.74 9.02E-42 Rad54b RAD54 homolog B (S. cerevisiae) 5.74 2.62E-41 Cdc6 cell division cycle 6 4.33 2.83E-41 Cenpt centromere protein T 3.75 4.26E-41 Chaf1a chromatin assembly factor 1, subunit A (p150) 5.52 9.98E-41 Pold1 polymerase (DNA directed), delta 1, catalytic 3.71 1.58E-40 subunit Hjurp Holliday junction recognition protein 3.93 1.78E-40 Fanca Fanconi anemia, complementation group A 4.81 1.97E-40 Spag5 sperm associated antigen 5 6.54 4E-40 Miip migration and invasion inhibitory protein 3.47 9.21E-40 Ccne1 cyclin E1 3.65 1.14E-39 Haus3 HAUS augmin-like complex, subunit 3 3.59 2.36E-39 Mcm5 minichromosome maintenance deficient 5, cell 4.10 4.61E-39 division cycle 46 (S. cerevisiae) Atad5 ATPase family, AAA domain containing 5 4.35 1.09E-38 Mms22l MMS22-like, DNA repair protein 3.77 1.32E-38 Lmnb1 lamin B1 4.09 1.97E-38 Cdk5rap2 CDK5 regulatory subunit associated protein 2 3.37 2.24E-38 Cenpq centromere protein Q 3.45 1.42E-37 Page 47 of 65 Diabetes
Nde1 nuclear distribution gene E homolog 1 (A 3.35 3.8E-37 nidulans) Sass6 spindle assembly 6 homolog (C. elegans) 3.94 4.8E-37 Rcc1 regulator of chromosome condensation 1 3.53 7.63E-37 Gmnn geminin 3.37 1.69E-36 Haus8 4HAUS augmin-like complex, subunit 8 4.15 1.9E-36 Prim1 DNA primase, p49 subunit 3.20 2.25E-36 Ddias DNA damage-induced apoptosis suppressor 3.87 3.08E-36 Eri2 exoribonuclease 2 3.58 3.27E-36 Pola1 polymerase (DNA directed), alpha 1 3.61 4.13E-36 Espl1 extra spindle poles-like 1 (S. cerevisiae) 7.40 4.29E-36 Timeless timeless circadian clock 1 4.85 6.31E-36 Mcm8 minichromosome maintenance deficient 8 (S. 3.69 9.08E-36 cerevisiae) Mcm7 minichromosome maintenance deficient 7 (S. 3.31 3.5E-35 cerevisiae) Rad54l RAD54 like (S. cerevisiae) 3.64 3.53E-35 Eme1 essential meiotic endonuclease 1 homolog 1 (S. 4.37 4.31E-35 pombe) Dhfr dihydrofolate reductase 3.22 5.41E-35 Kif20b kinesin family member 20B 6.27 1.02E-34 Dek DEK oncogene (DNA binding) 3.00 2.15E-34 Cdk2 cyclin-dependent kinase 2 3.92 4.38E-34 Enkd1 enkurin domain containing 1 3.52 1.18E-33 Skp2 S-phase kinase-associated protein 2 (p45) 4.20 2.68E-33 Dna2 DNA replication helicase 2 homolog (yeast) 4.12 3.78E-33 Ticrr TOPBP1-interacting checkpoint and replication 5.48 4.37E-33 regulator Bora bora, aurora kinase A activator 4.64 1.21E-32 Tube1 epsilon-tubulin 1 3.69 2.24E-32 Fancg Fanconi anemia, complementation group G 3.89 5.16E-32 Nsl1 NSL1, MIND kinetochore complex component, 5.53 5.07E-31 homolog (S. cerevisiae) Hmgb2 high mobility group box 2 3.21 1.33E-30 Kif24 kinesin family member 24 3.92 2.8E-30 Gins1 GINS complex subunit 1 (Psf1 homolog) 3.93 3.23E-30 G2e3 G2/M-phase specific E3 ubiquitin ligase 2.81 5.22E-30 Rpa2 replication protein A2 2.88 5.3E-30 Mdc1 mediator of DNA damage checkpoint 1 2.86 1.05E-29 Xrcc2 X-ray repair complementing defective repair in 3.33 1.79E-29 Chinese hamster cells 2 Pola2 polymerase (DNA directed), alpha 2 3.15 1.83E-29 Fancd2 Fanconi anemia, complementation group D2 6.92 3.38E-29 Diabetes Page 48 of 65
Rbl1 retinoblastoma-like 1 (p107) 3.26 4.43E-29 Prim2 DNA primase, p58 subunit 3.07 1.04E-28 Bok BCL2-related ovarian killer protein 3.00 1.97E-28 Dnmt1 DNA methyltransferase (cytosine-5) 1 2.86 2.33E-28 Dck deoxycytidine kinase 2.90 2.79E-28 H2afv H2A histone family, member V 2.68 3.45E-28 Tuba1b tubulin, alpha 1B 3.24 4.41E-28 Haus1 HAUS augmin-like complex, subunit 1 3.05 8.43E-28 Ctc1 CTS telomere maintenance complex component 2.79 1.82E-27 1 Tonsl tonsoku-like, DNA repair protein 3.34 2.19E-27 Mcm6 minichromosome maintenance deficient 6 (MIS5 2.73 2.39E-27 homolog, S. pombe) (S. cerevisiae) Ccna1 cyclin A1 6.59 5.86E-27 Pcna proliferating cell nuclear antigen 2.64 6.32E-27 Pcna-ps2 proliferating cell nuclear antigen pseudogene 2 2.65 7.22E-27 Mutyh mutY homolog (E. coli) 3.85 8.97E-27 Hat1 histone aminotransferase 1 2.63 9.52E-27 Cks1b CDC28 protein kinase 1b 3.41 1.74E-26 Palb2 partner and localizer of BRCA2 5.43 1.77E-26 Nrm nurim (nuclear envelope membrane protein) 5.42 1.85E-26 Mcm2 minichromosome maintenance deficient 2 2.78 1.95E-26 mitotin (S. cerevisiae) Dtymk deoxythymidylate kinase 2.62 4.74E-26 Cenpm centromere protein M 5.37 5.61E-26 Ttf2 transcription termination factor, RNA 3.00 1.56E-25 polymerase II Gins2 GINS complex subunit 2 (Psf2 homolog) 3.67 1.64E-25 Wdhd1 WD repeat and HMG-box DNA binding protein 1 2.98 4.38E-25 Ccdc123 centrosomal protein 89 2.57 1.43E-24 Pcnt pericentrin (kendrin) 2.64 1.93E-24 Gins3 GINS complex subunit 3 (Psf3 homolog) 2.75 3.85E-24 Cchcr1 coiled-coil alpha-helical rod protein 1 3.14 3.85E-24 Cep57l1 centrosomal protein 57-like 1 2.89 8.49E-24 Cenpo centromere protein O 3.03 1.18E-23 Arhgap19 Rho GTPase activating protein 19 7.01 2.05E-23 Rad51l1 RAD51 homolog B 6.21 4.36E-23 Pole2 polymerase (DNA directed), epsilon 2 (p59 3.31 6.56E-23 subunit) Tipin timeless interacting protein 2.45 8.81E-23 Cep128 centrosomal protein 128 5.27 8.81E-23 Tinf2 Terf1 (TRF1)-interacting nuclear factor 2 2.52 1.27E-22 Spc25 SPC25, NDC80 kinetochore complex component, 2.35 1.28E-22 Page 49 of 65 Diabetes
homolog (S. cerevisiae) Gemin6 gem (nuclear organelle) associated protein 6 2.45 1.65E-22 Dcaf15 DDB1 and CUL4 associated factor 15 2.56 4.43E-22 Lsm3 LSM3 homolog, U6 small nuclear RNA associated 2.50 5.89E-22 (S. cerevisiae) Rfc3 replication factor C (activator 1) 3 2.50 7.82E-22 Pif1 PIF1 5'-to-3' DNA helicase homolog (S. 6.79 8.41E-22 cerevisiae) Kntc1 kinetochore associated 1 4.02 8.67E-22 Incenp inner centromere protein 5.75 8.67E-22 Nxt1 NTF2-related export protein 1 2.49 1.12E-21 Tmpo thymopoietin 2.48 1.76E-21 Kifc1 kinesin family member C1 6.77 1.99E-21 Cep152 centrosomal protein 152 3.46 2.14E-21 E2f2 E2F transcription factor 2 2.94 2.18E-21 Nup155 nucleoporin 155 2.52 2.25E-21 Recql4 RecQ protein-like 4 4.50 2.71E-21 Lin9 lin-9 homolog (C. elegans) 2.73 6.35E-21 Cdc7 cell division cycle 7 (S. cerevisiae) 3.43 9.23E-21 Talpid3 RIKEN cDNA 2700049A03 gene 2.45 1.2E-20 Ckap5 cytoskeleton associated protein 5 2.29 1.35E-20 Haus6 HAUS augmin-like complex, subunit 6 2.77 3.28E-20 Fzr1 fizzy/cell division cycle 20 related 1 (Drosophila) 2.27 4.28E-20 L3mbtl2 l(3)mbt-like 2 (Drosophila) 2.40 5.39E-20 H2afz H2A histone family, member Z 2.29 9.86E-20 Rad9 RAD9 homolog A 2.65 1.11E-19 Lin54 lin-54 homolog (C. elegans) 2.34 1.24E-19 Apitd1 apoptosis-inducing, TAF9-like domain 1 3.07 1.43E-19 Suv39h1 suppressor of variegation 3-9 homolog 1 3.18 1.55E-19 (Drosophila) Pkmyt1 protein kinase, membrane associated 3.62 2.19E-19 tyrosine/threonine 1 Nfib nuclear factor I/B 5.46 2.49E-19 Rfc5 replication factor C (activator 1) 5 2.33 2.6E-19 Rasa3 RAS p21 protein activator 3 4.90 2.64E-19 Nup85 nucleoporin 85 2.22 3.96E-19 Suv39h2 suppressor of variegation 3-9 homolog 2 2.67 1.79E-18 (Drosophila) Aaas achalasia, adrenocortical insufficiency, alacrimia 4.02 2.59E-18 Cep135 centrosomal protein 135 2.53 2.61E-18 Naa38 N(alpha)-acetyltransferase 38, NatC auxiliary 2.44 2.93E-18 subunit Ccdc46 centrosomal protein 112 2.76 2.93E-18 Diabetes Page 50 of 65
Gpsm2 G-protein signalling modulator 2 (AGS3-like, C. 3.89 2.93E-18 elegans) Nsg1 neuron specific gene family member 1 3.18 4.67E-18 Mtbp Mdm2, transformed 3T3 cell double minute p53 3.69 4.72E-18 binding protein Rad50 RAD50 homolog (S. cerevisiae) 2.37 6.36E-18 Nt5dc2 5'-nucleotidase domain containing 2 2.07 7.24E-18 Ccdc14 coiled-coil domain containing 14 3.16 8.39E-18 Pold2 polymerase (DNA directed), delta 2, regulatory 2.12 8.67E-18 subunit Ncapd3 non-SMC condensin II complex, subunit D3 2.78 1.27E-17 Tubg1 tubulin, gamma 1 2.11 1.36E-17 Phf19 PHD finger protein 19 4.78 1.64E-17 Rnaseh2b ribonuclease H2, subunit B 2.22 2.41E-17 Scml2 sex comb on midleg-like 2 (Drosophila) 4.59 4.51E-17 Cep97 centrosomal protein 97 2.18 5.68E-17 Nasp nuclear autoantigenic sperm protein (histone- 2.12 6.95E-17 binding) Ssna1 Sjogren's syndrome nuclear autoantigen 1 2.05 7.09E-17 Dnajc9 DnaJ (Hsp40) homolog, subfamily C, member 9 2.04 9.49E-17 Pom121 nuclear pore membrane protein 121 2.22 9.51E-17 Polq polymerase (DNA directed), theta 5.09 1.01E-16 Cep192 centrosomal protein 192 2.12 2.96E-16 Haus5 HAUS augmin-like complex, subunit 5 2.31 3.27E-16 Calm2 calmodulin 2 1.95 3.42E-16 Msh5 mutS homolog 5 (E. coli) 2.42 3.63E-16 Hirip3 HIRA interacting protein 3 2.74 4.08E-16 Vrk1 vaccinia related kinase 1 2.00 4.11E-16 Mnd1 meiotic nuclear divisions 1 homolog (S. 3.86 4.31E-16 cerevisiae) Topbp1 topoisomerase (DNA) II binding protein 1 2.96 4.93E-16 Mybl2 myeloblastosis oncogene-like 2 3.32 4.98E-16 Sun2 Sad1 and UNC84 domain containing 2 2.23 5.05E-16 Ncaph2 non-SMC condensin II complex, subunit H2 1.99 5.17E-16 Slbp stem-loop binding protein 2.06 6.91E-16 Mcm4 minichromosome maintenance deficient 4 2.11 9.03E-16 homolog (S. cerevisiae) Syne2 spectrin repeat containing, nuclear envelope 2 2.12 9.47E-16 Cep110 centrosomal protein 110 2.50 1.18E-15 Rfc2 replication factor C (activator 1) 2 1.96 1.34E-15 Nup62 nucleoporin 62 1.96 1.45E-15 Ccsap centriole, cilia and spindle associated protein 2.29 1.48E-15 Cdca7l cell division cycle associated 7 like 3.52 2.88E-15 Page 51 of 65 Diabetes
Alyref Aly/REF export factor 1.99 3.18E-15 Orc1 origin recognition complex, subunit 1 3.99 3.24E-15 Anapc15 anaphase prompoting complex C subunit 15 2.26 4.09E-15 Nudt1 nudix (nucleoside diphosphate linked moiety X)- 2.50 4.78E-15 type motif 1 Bub3 budding uninhibited by benzimidazoles 3 1.88 5.32E-15 homolog (S. cerevisiae) Cbx5 chromobox 5 1.88 5.89E-15 Fanci Fanconi anemia, complementation group I 5.77 9.34E-15 Kifc5b kinesin family member C5B 5.34 9.81E-15 Ccdc15 coiled-coil domain containing 15 2.95 1.2E-14 Rnaseh2c ribonuclease H2, subunit C 3.25 1.34E-14 Tuba1c tubulin, alpha 1C 2.32 1.47E-14 Casp7 caspase 7 2.50 1.79E-14 Chek1 checkpoint kinase 1 2.18 1.96E-14 Cdca4 cell division cycle associated 4 1.96 2.38E-14 Aplf aprataxin and PNKP like factor 2.67 2.87E-14 Snrpe small nuclear ribonucleoprotein E 1.98 3.71E-14 Zranb3 zinc finger, RAN-binding domain containing 3 2.73 3.95E-14 Usp1 ubiquitin specific peptidase 1 1.87 4.05E-14 Shmt1 serine hydroxymethyltransferase 1 (soluble) 3.31 5.03E-14 Ube2s ubiquitin-conjugating enzyme E2S 2.36 5.36E-14 Ccdc21 centrosomal protein 85 1.88 5.66E-14 Rbbp8 retinoblastoma binding protein 8 1.95 9.02E-14 Rtel1 regulator of telomere elongation helicase 1 2.32 9.57E-14 Terf1 telomeric repeat binding factor 1 1.93 1.01E-13 Ifit2 interferon-induced protein with 5.74 2.36E-13 tetratricopeptide repeats 2 Ddx11 DEAD/H (Asp-Glu-Ala-Asp/His) box helicase 11 4.41 2.4E-13 Nedd1 neural precursor cell expressed, developmentally 2.16 3.41E-13 down-regulated gene 1 Tubb4b tubulin, beta 4B class IVB 1.77 3.76E-13 Nup37 nucleoporin 37 1.97 3.91E-13 Nucks1 nuclear casein kinase and cyclin-dependent 1.75 4.37E-13 kinase substrate 1 Pttg1 pituitary tumor-transforming gene 1 3.80 5.56E-13 Mphosph9 M-phase phosphoprotein 9 1.80 7.62E-13 Snrnp25 small nuclear ribonucleoprotein 25 (U11/U12) 2.02 9.08E-13 Ppp2r5d protein phosphatase 2, regulatory subunit B 1.90 1.06E-12 (B56), delta isoform Ccp110 centriolar coiled coil protein 110 1.91 1.09E-12 Sclt1 sodium channel and clathrin linker 1 1.84 1.18E-12 Ran RAN, member RAS oncogene family 1.72 1.84E-12 Diabetes Page 52 of 65
Ift80 intraflagellar transport 80 1.72 4.6E-12 Fgfr1op Fgfr1 oncogene partner 1.76 5.13E-12 Fam72a family with sequence similarity 72, member A 2.71 7.84E-12 Pa2g4 proliferation-associated 2G4 1.68 9.87E-12 Cntln centlein, centrosomal protein 1.85 1.04E-11 Rb1 retinoblastoma 1 1.70 1.73E-11 Rad51c RAD51 homolog C 1.98 2.71E-11 Cep250 centrosomal protein 250 2.03 2.91E-11 Poc1a POC1 centriolar protein homolog A 4.13 3.28E-11 (Chlamydomonas) Hmgn5 high-mobility group nucleosome binding domain 1.68 3.38E-11 5 Ankrd32 ankyrin repeat domain 32 1.95 3.84E-11 Pms2 postmeiotic segregation increased 2 (S. 1.80 4.33E-11 cerevisiae) Rfwd3 ring finger and WD repeat domain 3 1.84 4.7E-11 Casp8 caspase 8 1.79 6.77E-11 Apip APAF1 interacting protein 1.70 1.1E-10 Whsc1 Wolf-Hirschhorn syndrome candidate 1 (human) 1.62 1.23E-10 Cntrob centrobin, centrosomal BRCA2 interacting 2.52 1.23E-10 protein Poc5 POC5 centriolar protein homolog 1.72 1.24E-10 (Chlamydomonas) Mtap1a microtubule-associated protein 1 A 3.70 1.29E-10 Snrpd1 small nuclear ribonucleoprotein D1 2.03 1.32E-10 Lmnb2 lamin B2 2.17 1.38E-10 Rab13 RAB13, member RAS oncogene family 1.99 2.5E-10 Nup205 nucleoporin 205 2.15 2.84E-10 Dut deoxyuridine triphosphatase 2.46 2.86E-10 Myh10 myosin, heavy polypeptide 10, non-muscle 1.65 3.07E-10 Anp32b acidic (leucine-rich) nuclear phosphoprotein 32 1.54 3.45E-10 family, member B Triobp TRIO and F-actin binding protein 1.62 3.89E-10 Srgap2 SLIT-ROBO Rho GTPase activating protein 2 1.95 4.96E-10 Net1 neuroepithelial cell transforming gene 1 1.81 7E-10 Rnaseh2a ribonuclease H2, large subunit 1.63 7.62E-10 Dleu2 deleted in lymphocytic leukemia, 2 1.71 8.9E-10 Nup107 nucleoporin 107 2.09 9.1E-10 Parp2 poly (ADP-ribose) polymerase family, member 2 1.54 9.77E-10 Ddx39 DEAD (Asp-Glu-Ala-Asp) box polypeptide 39 1.54 1.02E-09 Mum1 melanoma associated antigen (mutated) 1 1.57 1.11E-09 Taf5 TAF5 RNA polymerase II, TATA box binding 1.73 1.87E-09 protein (TBP)-associated factor Page 53 of 65 Diabetes
Tubd1 tubulin, delta 1 1.66 1.96E-09 Cdan1 congenital dyserythropoietic anemia, type I 1.70 2.51E-09 (human) Nphp4 nephronophthisis 4 (juvenile) homolog (human) 1.86 2.59E-09 Setd8 SET domain containing (lysine 1.48 3.53E-09 methyltransferase) 8 Rhno1 RAD9-HUS1-RAD1 interacting nuclear orphan 1 1.95 4.44E-09 Pold3 polymerase (DNA-directed), delta 3, accessory 1.52 5.71E-09 subunit Smc6 structural maintenance of chromosomes 6 1.43 6.12E-09 Lbr lamin B receptor 1.47 7.06E-09 Smc1a structural maintenance of chromosomes 1A 1.45 7.71E-09 Rangap1 RAN GTPase activating protein 1 1.40 9.04E-09 Mbd6 methyl-CpG binding domain protein 6 1.53 1.14E-08 Zcwpw1 zinc finger, CW type with PWWP domain 1 3.25 1.15E-08 Nup133 nucleoporin 133 1.97 1.21E-08 Banf1 barrier to autointegration factor 1 1.94 1.24E-08 E2f1 E2F transcription factor 1 1.47 1.75E-08 Rmi2 RMI2, RecQ mediated genome instability 2, 4.08 1.84E-08 homolog (S. cerevisiae) Tmem209 transmembrane protein 209 1.52 1.89E-08 Larp7 La ribonucleoprotein domain family, member 7 1.46 1.89E-08 Srrt serrate RNA effector molecule homolog 1.41 2.09E-08 (Arabidopsis) Mad2l1bp MAD2L1 binding protein 1.58 2.91E-08 Tdp1 tyrosyl-DNA phosphodiesterase 1 1.48 3.14E-08 Odf2 outer dense fiber of sperm tails 2 1.40 3.16E-08 Slx4 SLX4 structure-specific endonuclease subunit 1.61 3.25E-08 homolog (S. cerevisiae) Rfc1 replication factor C (activator 1) 1 1.41 3.94E-08 Ssrp1 structure specific recognition protein 1 1.36 4.16E-08 Ppil1 peptidylprolyl isomerase (cyclophilin)-like 1 1.46 4.16E-08 Calm3 calmodulin 3 1.35 4.3E-08 Cpsf4 cleavage and polyadenylation specific factor 4 1.59 4.72E-08 Suz12 suppressor of zeste 12 homolog (Drosophila) 1.38 6.05E-08 Orc6 origin recognition complex, subunit 6 1.36 6.52E-08 Atr ataxia telangiectasia and Rad3 related 1.49 6.86E-08 Nup160 nucleoporin 160 1.46 7.37E-08 Hmgn2 high mobility group nucleosomal binding domain 1.79 7.41E-08 2 Ipo9 importin 9 1.35 7.79E-08 Meaf6 MYST/Esa1-associated factor 6 1.39 8.27E-08 Als2cr4 transmembrane protein 237 1.40 8.67E-08 Diabetes Page 54 of 65
Evl Ena-vasodilator stimulated phosphoprotein 1.63 9.28E-08 Nsmce4a non-SMC element 4 homolog A (S. cerevisiae) 1.32 1.09E-07 Xrcc1 X-ray repair complementing defective repair in 1.36 1.1E-07 Chinese hamster cells 1 Ddx20 DEAD (Asp-Glu-Ala-Asp) box polypeptide 20 1.48 1.11E-07 Med30 mediator complex subunit 30 1.52 1.12E-07 Cep57 centrosomal protein 57 1.34 1.18E-07 Dot1l DOT1-like, histone H3 methyltransferase (S. 1.39 1.21E-07 cerevisiae) Anp32e acidic (leucine-rich) nuclear phosphoprotein 32 1.30 1.21E-07 family, member E Rpp30 ribonuclease P/MRP 30 subunit 1.54 1.28E-07 Rad21 RAD21 homolog (S. pombe) 1.48 1.46E-07 Cc2d2a coiled-coil and C2 domain containing 2A 1.69 1.85E-07 Stra13 stimulated by retinoic acid 13 1.36 2.84E-07 Dnaaf2 dynein, axonemal assembly factor 2 1.41 3.03E-07 Dctpp1 dCTP pyrophosphatase 1 2.67 3.12E-07 Arl4c ADP-ribosylation factor-like 4C 2.10 3.13E-07 Cdk19 cyclin-dependent kinase 19 2.50 3.61E-07 Ruvbl2 RuvB-like protein 2 1.76 3.74E-07 Ctps cytidine 5'-triphosphate synthase 1.33 4.41E-07 Pole3 polymerase (DNA directed), epsilon 3 (p17 1.32 4.43E-07 subunit) H2afx H2A histone family, member X 4.00 4.68E-07 Lrwd1 leucine-rich repeats and WD repeat domain 1.43 5.2E-07 containing 1 Xpo1 exportin 1, CRM1 homolog (yeast) 1.29 5.58E-07 Smarcc1 SWI/SNF related, matrix associated, actin 1.30 5.61E-07 dependent regulator of chromatin, subfamily c, member 1 Ccne2 cyclin E2 2.13 5.64E-07 Polr2a polymerase (RNA) II (DNA directed) polypeptide 1.30 5.68E-07 A Nsmce1 non-SMC element 1 homolog (S. cerevisiae) 1.29 6.54E-07 Rpa3 replication protein A3 2.02 6.94E-07 Pagr1a PAXIP1 associated glutamate rich protein 1A 1.33 7.4E-07 Katnb1 katanin p80 (WD40-containing) subunit B 1 1.41 7.41E-07 Ywhah tyrosine 3-monooxygenase/tryptophan 5- 1.25 8.03E-07 monooxygenase activation protein, eta polypeptide Wbp7 WW domain binding protein 7 1.38 8.32E-07 Smchd1 SMC hinge domain containing 1 1.32 8.74E-07 Casp8ap2 caspase 8 associated protein 2 1.45 8.96E-07 Brd9 bromodomain containing 9 1.28 8.99E-07 Page 55 of 65 Diabetes
Exosc2 exosome component 2 1.32 1.03E-06 Nop56 NOP56 ribonucleoprotein 1.27 1.04E-06 Hnrnpul1 heterogeneous nuclear ribonucleoprotein U-like 1.30 1.04E-06 1 Lyar Ly1 antibody reactive clone 1.29 1.13E-06 Gins4 GINS complex subunit 4 (Sld5 homolog) 1.32 1.18E-06 Asxl1 additional sex combs like 1 1.31 1.25E-06 Siva1 SIVA1, apoptosis-inducing factor 1.39 1.73E-06 Snrpa1 small nuclear ribonucleoprotein polypeptide A' 1.25 1.78E-06 Mast2 microtubule associated serine/threonine kinase 1.25 1.89E-06 2 Ppp2r4 protein phosphatase 2A, regulatory subunit B 1.19 2.63E-06 (PR 53) Ttll9 tubulin tyrosine ligase-like family, member 9 3.23 2.67E-06 Trim28 tripartite motif-containing 28 1.18 2.85E-06 Fam48a suppressor of Ty 20 1.31 2.88E-06 Kif22-ps kinesin family member 22, pseudogene 6.12 2.89E-06 Sap30 sin3 associated polypeptide 1.45 3.3E-06 Cenpc1 centromere protein C1 1.30 3.59E-06 Wrap53 WD repeat containing, antisense to TP53 1.26 3.85E-06 Sip1 gem (nuclear organelle) associated protein 2 1.38 4.03E-06 Lin52 lin-52 homolog (C. elegans) 1.34 4.2E-06 Itgb3bp integrin beta 3 binding protein (beta3- 1.32 4.45E-06 endonexin) Ppm1g protein phosphatase 1G (formerly 2C), 1.16 4.84E-06 magnesium-dependent, gamma isoform Nup54 nucleoporin 54 1.36 5.19E-06 Thoc7 THO complex 7 homolog (Drosophila) 1.20 5.25E-06 Hmgxb4 HMG box domain containing 4 1.29 5.4E-06 Hcfc1 host cell factor C1 1.26 5.79E-06 Nup43 nucleoporin 43 1.27 6.32E-06 Poln DNA polymerase N 6.03 6.48E-06 Lsm2 LSM2 homolog, U6 small nuclear RNA associated 2.99 6.57E-06 (S. cerevisiae) Nup35 nucleoporin 35 1.36 6.84E-06 Cdkn2d cyclin-dependent kinase inhibitor 2D (p19, 4.22 7.06E-06 inhibits CDK4) Cbx1 chromobox 1 1.16 7.45E-06 Hmgb1 high mobility group box 1 1.36 7.63E-06 Zw10 zw10 kinetochore protein 1.18 7.64E-06 Hp1bp3 heterochromatin protein 1, binding protein 3 1.15 7.99E-06 Cdc27 cell division cycle 27 1.17 9.02E-06 Prpf40b PRP40 pre-mRNA processing factor 40 homolog 1.26 9.13E-06 Diabetes Page 56 of 65
B (yeast) Mre11a meiotic recombination 11 homolog A (S. 1.23 9.51E-06 cerevisiae) Odf2l outer dense fiber of sperm tails 2-like 1.22 9.57E-06 Epb4.1l2 erythrocyte protein band 4.1-like 2 2.56 9.8E-06 Tcerg1 transcription elongation regulator 1 (CA150) 1.16 1.11E-05 Raly hnRNP-associated with lethal yellow 1.14 1.41E-05 Scmh1 sex comb on midleg homolog 1 1.21 1.53E-05 Ddx39b DEAD (Asp-Glu-Ala-Asp) box polypeptide 39B 1.10 1.66E-05 Rbmx RNA binding motif protein, X chromosome 1.10 5.77E-05 Ddb2 damage specific DNA binding protein 2 1.52 8.8E-05 Bcl2l12 BCL2-like 12 (proline rich) 2.59 0.0001 Arpp19 cAMP-regulated phosphoprotein 19 0.96 0.0003 Polk polymerase (DNA directed), kappa 1.09 0.0007 Myb myeloblastosis oncogene 5.39 0.0011 Maz MYC-associated zinc finger protein (purine- 2.49 0.0013 binding transcription factor) Kifc5c-ps kinesin family member C5C, pseudogene 5.29 0.0021 Smc5 structural maintenance of chromosomes 5 1.12 0.0043 Polh polymerase (DNA directed), eta (RAD 30 related) 2.13 0.0050 Hist1h2ak histone cluster 1, H2ak 4.31 0.0095 Polg polymerase (DNA directed), gamma 0.86 0.0106 Pmf1 polyamine-modulated factor 1 5.30 0.0176 Cdkn2a cyclin-dependent kinase inhibitor 2A 2.75 0.0179 Ets1 E26 avian leukemia oncogene 1, 5' domain 2.56 0.0225 Hist1h2ag histone cluster 1, H2ag 4.48 0.0361 H1fx H1 histone family, member X 3.48 0.0467
Page 57 of 65 Diabetes
Supplementary table S3-2. Candidate Cancer genes with no documented function in cell-cycle, upregulated in replicating beta-cells Gene Description Function Log2(FC) FDR Rgs12 regulator of G-protein May function as a guanosine 4.62 5.37E-47 signaling 12 triphosphatase (GTPase)-activating protein as well as a transcriptional repressor. This protein may play a role in tumorigenesis Zmynd10 zinc finger, MYND Tumor suppressor function, methylated in 4.45 3.15E-35 domain containing 10 cancer Vangl1 vang-like 1 (van gogh, Vangl1 and Vangl2 are membrane 3.24 6.03E-25 Drosophila) proteins that play an important role in neurogenesis. At the cellular level, Vangl proteins regulate the establishment of planar cell polarity (PCP) Aim1 absent in melanoma 1 Associated with cancer 2.65 1.76E-22 Flna filamin, alpha Binds actin cytoskeleton, involved in 2.44 4.71E-19 remodeling the cytoskeleton to effect changes in cell shape and migration Acsl5 acyl-CoA synthetase Convert free long-chain fatty acids into 1.43 1.05E-08 long-chain family fatty acyl-CoA esters, and thereby play a member 5 key role in lipid biosynthesis and fatty acid degradation. increased levels in malignant gliomas Usp21 ubiquitin specific Regulates gene expression via histone 1.48 1.51E-07 peptidase 21 H2A deubiquitination (By similarity). Candidate cancer gene (NCI Cancer Gene Index) Sephs1 selenophosphate Synthesizes selenophosphate from 1.37 2.89E-07 synthetase 1 selenide and ATP Pcdhga8 protocadherin gamma Potential calcium-dependent cell- 1.18 5.09E-06 subfamily C, 4 adhesion protein. May be involved in the establishment and maintenance of specific neuronal connections in the brain. Candidate cancer gene (NCI Cancer Gene Index) Ptpru protein tyrosine Roles in cell-cell recognition and adhesion 1.35 8.56E-06 phosphatase, receptor type, U Slc25a40 solute carrier family 25, Belongs to the SLC25 family of 1.05 9.64E-04 member 40 mitochondrial carrier proteins. Candidate cancer gene (NCI Cancer Gene Index) Scrib scribbled homolog Planar cell polarity gene, overexpressed in 1.68 4.88E-11 (Drosophila) cancer Cbfb core binding factor beta Associated with prostate cancer growth 1.14 1.09E-05 Tchp trichoplein, keratin Mitostatin, mitochondrial protein, 1.39 3.58E-06 filament binding potential Tumor suppressor Phactr4 phosphatase and actin Tumor suppressor, overexpression 1.22 8.98E-06 regulator 4 restrains cell proliferation and transformation Diabetes Page 58 of 65
Ehf ets homologous factor Putative tumor suppressor 1.67 1.00E-05 Cyp39a1 cytochrome P450, This gene encodes a member of the 3.96 4.44E-48 family 39, subfamily a, cytochrome P450 superfamily of enzymes. polypeptide 1 This endoplasmic reticulum protein is involved in the conversion of cholesterol to bile acids Sapcd2 suppressor APC domain Highly xpressed in cancer, promotes 6.77 8.38E-102 containing 2 cancer cell growth Trim59 tripartite motif- Oncogenic activity via the Ras pathway 4.32 2.11E-57 containing 59 Depdc1a DEP domain containing High expression in myeloma, its inhibition 6.59 2.62E-54 1a delays plasma cell growth Ccdc18 coiled-coil domain Candidate susceptibility gene for common 6.69 8.68E-52 containing 18 familial colorectal cancer Serpinb8 serine (or cysteine) Expressed in pancreas neuroendocrine 4.82 1.10E-35 peptidase inhibitor, tumors clade B, member 8 Lrdd leucine-rich and death Positively regulated by the tumor 3.29 4.54E-26 domain containing suppressor p53 and to induce cell apoptosis in response to DNA damage, which suggests a role for this gene as an effector of p53-dependent apoptosis Neurl1b neuralized homolog 1b Candidate gene from amplified locus 5.27 5.67E-26 (Drosophila) associated with brain metastasis in NSCLC Pradc1 protease-associated Secreted protein, candidate susceptibility 2.13 3.69E-17 domain containing 1 gene for familial colorectal cancer Hdgf hepatoma-derived Implicated in cancer cell growth and 1.99 8.84E-17 growth factor development Sae1 SUMO1 activating Required for myc induced tumorigenesis, 1.80 1.41E-13 enzyme subunit 1 inactivation leads to mitotic catastrophe Oscp1 organic solute carrier Potential tumor suppressor 2.01 5.66E-13 partner 1 Senp1 SUMO1/sentrin specific Might play a role in colon cancer cells 1.88 9.01E-12 peptidase 1 proliferation, silencing results in upregulation of cdk inhibitors and cell cycle arrest Sult2b1 sulfotransferase family, Promotes proliferation of hepatocytes 2.02 2.37E-11 cytosolic, 2B, member and HCC cells 1 Nrip3 nuclear receptor Translocation partner of MLL in acute 1.92 1.40E-10 interacting protein 3 myeloid leukemia Rnf26 ring finger protein 26 Upregulated in cancer 1.69 7.25E-08 Nacc1 nucleus accumbens Overexpressed in cancer 1.64 1.01E-07 associated 1, BEN and BTB (POZ) domain containing Mpp1 membrane protein, Role in polarity, putative tumor 1.29 6.61E-06 palmitoylated suppressor
Page 59 of 65 Diabetes
Supplementary table S3-3. Genes upregulated in replicating beta-cells, not associated with cancer or cell cycle/proliferation Gene Name Gene description Log2(FC) padj Gene Biotype D17H6S56E-5 DNA segment, Chr 17, human D6S56E 5 5.45 2.37E-91 protein coding Tcf19 transcription factor 19 5.18 6.63E-81 protein coding 4930579G24Rik RIKEN cDNA 4930579G24 gene 5.58 2.97E-78 protein coding BC030867 cDNA sequence BC030867 7.20 6.79E-70 protein coding 2810442I21Rik RIKEN cDNA 2810442I21 gene 5.85 3.3E-66 processed transcript Slc9a5 solute carrier family 9 (sodium/hydrogen 6.26 1.24E-59 protein exchanger), member 5 coding Mtfr2 mitochondrial fission regulator 2 5.94 1.61E-59 protein coding Sez6 seizure related gene 6 6.92 2.4E-59 protein coding Pbx4 pre B cell leukemia homeobox 4 5.25 2.74E-55 protein coding 4930427A07Rik RIKEN cDNA 4930427A07 gene 4.17 8.27E-53 protein coding Ccdc34 coiled-coil domain containing 34 3.86 1.71E-50 protein coding Zfp367 zinc finger protein 367 3.51 3.44E-43 protein coding 4930452B06Rik RIKEN cDNA 4930452B06 gene 5.23 3.43E-42 protein coding 2700094K13Rik RIKEN cDNA 2700094K13 gene 3.33 5.08E-41 protein coding 4930422G04Rik RIKEN cDNA 4930422G04 gene 3.90 1.46E-39 protein coding Katnal2 katanin p60 subunit A-like 2 3.88 2.51E-37 protein coding Tbc1d31 WD repeat domain 67 3.34 1.94E-35 protein coding 5830418K08Rik RIKEN cDNA 5830418K08 gene 3.27 2.15E-35 protein coding BC055324 cDNA sequence BC055324 4.51 2.21E-33 protein coding Ccdc77 coiled-coil domain containing 77 2.96 7.38E-30 protein coding Rgs3 regulator of G-protein signaling 3 3.15 3.04E-28 protein coding Diabetes Page 60 of 65
4933404O12Rik RIKEN cDNA 4933404O12 gene 2.81 6.23E-27 ncRNA Heatr7b1 maestro heat-like repeat family member 2A 3.46 8.15E-27 protein coding BC048355 2'-deoxynucleoside 5'-phosphate N- 4.16 3.6E-26 protein hydrolase 1 coding Wdr90 WD repeat domain 90 2.62 5.84E-26 protein coding Slc25a10 solute carrier family 25 (mitochondrial 3.37 1.42E-25 protein carrier, dicarboxylate transporter), member coding 10 Stom stomatin 3.50 9.36E-25 protein coding Svopl SV2 related protein homolog (rat)-like 2.91 1.23E-24 protein coding Psat1 phosphoserine aminotransferase 1 2.55 6.87E-24 protein coding Efcab11 EF-hand calcium binding domain 11 5.64 7.74E-24 protein coding D030056L22Rik RIKEN cDNA D030056L22 gene 2.58 3.51E-23 protein coding Zfp101 zinc finger protein 101 2.78 4.38E-23 protein coding Pih1d1 PIH1 domain containing 1 2.47 1.28E-22 protein coding Ccdc61 coiled-coil domain containing 61 2.69 3.47E-22 protein coding Dnase1l1 deoxyribonuclease 1-like 1 3.00 4.43E-22 protein coding Exosc8 exosome component 8 2.61 6.96E-22 protein coding Cmc2 COX assembly mitochondrial protein 2 2.60 1.54E-20 protein coding Pmp22 peripheral myelin protein 22 2.36 1.98E-20 protein coding Snhg5 small nucleolar RNA host gene 5 (non- 2.39 2.39E-20 ncRNA protein coding) Lmf2 lipase maturation factor 2 2.39 7.05E-20 protein coding Zfp41 zinc finger protein 41 3.27 3.69E-19 protein coding Slfn9 schlafen 9 5.13 7.21E-18 protein coding Eri1 exoribonuclease 1 2.15 1.08E-17 protein coding Fam167a family with sequence similarity 167, 2.83 1.21E-17 protein member A coding Pomt1 protein-O-mannosyltransferase 1 2.72 3.72E-17 protein Page 61 of 65 Diabetes
coding Prdx4 peroxiredoxin 4 2.05 4.51E-17 protein coding Sord sorbitol dehydrogenase 2.20 4.52E-17 protein coding Arhgap18 Rho GTPase activating protein 18 2.32 6.41E-17 protein coding Cklf chemokine-like factor 2.96 9.71E-17 protein coding Cby1 chibby homolog 1 (Drosophila) 2.08 1.01E-16 protein coding Hspb6 heat shock protein, alpha-crystallin-related, 2.05 1.19E-16 protein B6 coding Tmem194 transmembrane protein 194 3.01 1.65E-16 protein coding Fam100b UBA-like domain containing 2 2.08 2.59E-16 protein coding Kpna2 karyopherin (importin) alpha 2 2.49 3.82E-16 protein coding Tagap1 T cell activation GTPase activating protein 1 2.08 1.03E-13 protein coding Cep83os centrosomal protein 83, opposite strand 1.84 1.39E-12 ncRNA 4933439C10Rik RIKEN cDNA 4933439C10 gene 1.99 1.99E-12 processed transcript Samd1 sterile alpha motif domain containing 1 1.90 2.78E-12 protein coding Gm7535 predicted gene 7535 2.01 3.85E-12 protein coding BC052040 cDNA sequence BC052040 1.86 5.11E-12 protein coding Aldh16a1 aldehyde dehydrogenase 16 family, 1.96 6.83E-12 protein member A1 coding Ccdc163 coiled-coil domain containing 163 1.90 7.48E-12 protein coding Fxyd6 FXYD domain-containing ion transport 1.63 1.47E-11 protein regulator 6 coding Rasip1 Ras interacting protein 1 2.01 1.55E-11 protein coding Fam122b family with sequence similarity 122, 2.08 2.56E-11 protein member B coding BC053749 cDNA sequence BC053749 2.65 7.24E-11 protein coding Gm1673 predicted gene 1673 2.46 7.57E-11 protein coding 1700052N19Rik RIKEN cDNA 1700052N19 gene 1.72 1.73E-10 protein coding Diabetes Page 62 of 65
Tmed1 transmembrane emp24 domain containing 2.06 1.81E-10 protein 1 coding Spata24 spermatogenesis associated 24 1.85 2.53E-10 protein coding Cpt1c carnitine palmitoyltransferase 1c 1.79 2.99E-10 protein coding 1600002H07Rik RIKEN cDNA 1600002H07 gene 1.82 3.63E-10 protein coding Mns1 meiosis-specific nuclear structural protein 1 1.53 3.95E-10 protein coding Alg13 asparagine-linked glycosylation 13 1.99 4.33E-10 protein coding 2610528E23Rik cms small ribosomal subunit 1 1.83 5.47E-10 protein coding C230052I12Rik RIKEN cDNA C230052I12 gene 2.16 6.97E-10 protein coding 2810025M15Rik RIKEN cDNA 2810025M15 gene 1.61 1.04E-09 protein coding Donson downstream neighbor of SON 1.67 1.25E-09 protein coding Alg14 asparagine-linked glycosylation 14 1.61 1.32E-09 protein coding 1700029F09Rik testis expressed 30 1.53 1.49E-09 protein coding Eif1ad eukaryotic translation initiation factor 1A 1.52 2.35E-09 protein domain containing coding Tmem129 transmembrane protein 129 1.49 5.71E-09 protein coding Dars2 aspartyl-tRNA synthetase 2 (mitochondrial) 1.57 9.59E-09 protein coding Lcorl ligand dependent nuclear receptor 1.45 1E-08 protein corepressor-like coding Cyth2 cytohesin 2 1.42 1.1E-08 protein coding Csrp1 cysteine and glycine-rich protein 1 1.47 1.53E-08 protein coding Cdkn2aipnl CDKN2A interacting protein N-terminal like 1.47 1.78E-08 protein coding Dgkz diacylglycerol kinase zeta 1.51 2.21E-08 protein coding 1500009L16Rik RIKEN cDNA 1500009L16 gene 1.43 2.22E-08 protein coding 2700029M09Rik RIKEN cDNA 2700029M09 gene 1.42 2.22E-08 protein coding Hspa14 heat shock protein 14 1.40 3.12E-08 protein coding Page 63 of 65 Diabetes
Sdk1 sidekick homolog 1 (chicken) 1.58 4.52E-08 protein coding Mrs2 MRS2 magnesium homeostasis factor 1.57 6.84E-08 protein homolog (S. cerevisiae) coding Arhgap33 Rho GTPase activating protein 33 3.75 6.96E-08 protein coding Cnih4 cornichon homolog 4 (Drosophila) 1.55 8.17E-08 protein coding Phka2 phosphorylase kinase alpha 2 1.64 9.23E-08 protein coding 1700066M21Rik RIKEN cDNA 1700066M21 gene 1.50 9.71E-08 protein coding B230120H23Rik RIKEN cDNA B230120H23 gene 1.62 1.83E-07 protein coding Atp2b4 ATPase, Ca++ transporting, plasma 1.34 1.92E-07 protein membrane 4 coding Rdbp negative elongation factor complex 1.31 2.04E-07 protein member E, Rdbp coding Lrrc40 leucine rich repeat containing 40 1.36 2.84E-07 protein coding Ubap2 ubiquitin-associated protein 2 1.34 2.87E-07 protein coding Tmem194b transmembrane protein 194B 1.81 3.28E-07 protein coding Gm8186 predicted gene 8186 1.68 3.86E-07 protein coding 4930503L19Rik RIKEN cDNA 4930503L19 gene 2.30 4.43E-07 protein coding Slc4a8 solute carrier family 4 (anion exchanger), 1.58 4.53E-07 protein member 8 coding 2610020H08Rik RIKEN cDNA 2610020H08 gene 2.45 5.93E-07 protein coding Nmral1 NmrA-like family domain containing 1 1.31 6.14E-07 protein coding 9430015G10Rik RIKEN cDNA 9430015G10 gene 3.31 6.5E-07 protein coding Tmem107 transmembrane protein 107 1.21 1.73E-06 protein coding Tmem43 transmembrane protein 43 1.26 2.17E-06 protein coding Reep2 receptor accessory protein 2 1.29 2.51E-06 protein coding Ttc9c tetratricopeptide repeat domain 9C 1.27 2.67E-06 protein coding Ndufa5 NADH dehydrogenase (ubiquinone) 1 alpha 1.21 2.7E-06 protein subcomplex, 5 coding Diabetes Page 64 of 65
Siah1b seven in absentia 1B 1.40 2.76E-06 protein coding Pgp phosphoglycolate phosphatase 1.35 2.85E-06 protein coding Hdgfrp2 hepatoma-derived growth factor, related 1.23 2.97E-06 protein protein 2 coding Pdik1l PDLIM1 interacting kinase 1 like 1.43 3.23E-06 protein coding Tmem186 transmembrane protein 186 1.47 3.58E-06 protein coding 8430406I07Rik mitochondrial genome maintainance 1.38 3.81E-06 protein exonuclease 1 coding Aarsd1 alanyl-tRNA synthetase domain containing 1.17 4.73E-06 protein 1 coding Vars valyl-tRNA synthetase 1.20 4.86E-06 protein coding Rnf157 ring finger protein 157 2.22 4.94E-06 protein coding Plch1 phospholipase C, eta 1 1.53 5.69E-06 protein coding Fsd1l fibronectin type III and SPRY domain 1.24 7.16E-06 protein containing 1-like coding Pmm2 phosphomannomutase 2 1.18 7.31E-06 protein coding Crat carnitine acetyltransferase 1.26 8.44E-06 protein coding 2610027L16Rik NOP9 nucleolar protein 1.29 8.96E-06 protein coding Lonrf3 LON peptidase N-terminal domain and ring 1.84 1.33E-05 protein finger 3 coding Etaa1 Ewing's tumor-associated antigen 1 1.34 1.34E-05 protein coding Taf9 TAF9 RNA polymerase II, TATA box binding 1.16 1.34E-05 protein protein (TBP)-associated factor coding Tmem188 CTD nuclear envelope phosphatase 1 1.11 1.49E-05 protein regulatory subunit 1 coding Alg8 asparagine-linked glycosylation 8 (alpha- 1.15 2.19E-05 protein 1,3-glucosyltransferase) coding Dvl2 dishevelled 2, dsh homolog (Drosophila) 1.26 3.56E-05 protein coding Alg6 asparagine-linked glycosylation 6 (alpha- 1.10 5.74E-05 protein 1,3,-glucosyltransferase) coding Cox7a2 cytochrome c oxidase subunit VIIa 2 1.03 8.1E-05 protein coding Ndufaf3 NADH dehydrogenase (ubiquinone) 1 alpha 1.05 8.21E-05 protein subcomplex, assembly factor 3 coding Page 65 of 65 Diabetes
Ndufaf2 NADH dehydrogenase (ubiquinone) 1 alpha 1.19 0.0001 protein subcomplex, assembly factor 2 coding Atp5k ATP synthase, H+ transporting, 1.00 0.0002 protein mitochondrial F1F0 complex, subunit e coding Stat2 signal transducer and activator of 1.03 0.0005 protein transcription 2 coding
Diabetes Page 66 of 65
Supplementary Table 4. Cell-cycle and Proliferation-associated gene sets (MSigDB) BIOCARTA_G1_PATHWAY BIOCARTA_CELLCYCLE_PATHWAY CELL_CYCLE_ARREST_GO_0007050 CELL_CYCLE_CHECKPOINT_GO_0000075 CELL_CYCLE_GO_0007049 CELL_CYCLE_PHASE CENTROSOME_CYCLE DNA_DAMAGE_CHECKPOINT DNA_INTEGRITY_CHECKPOINT KEGG_CELL_CYCLE WHITFIELD_CELL_CYCLE_LITERATURE S_PHASE_OF_MITOTIC_CELL_CYCLE M_PHASE_OF_MITOTIC_CELL_CYCLE M_PHAS E MITOTIC_CELL_CYCLE_CHECKPOINT S_PHASE INTERPHASE_OF_MITOTIC_CELL_CYCLE INTERPHASE REACTOME_CELL_CYCLE REACTOME_CELL_CYCLE_CHECKPOINTS REACTOME_REGULATION_OF_MITOTIC_CELL_CYCLE WHITFIELD_CELL_CYCLE_G1_S WHITFIELD_CELL_CYCLE_G2 WHITFIELD_CELL_CYCLE_G2_M WHITFIELD_CELL_CYCLE_M_G1 WHITFIELD_CELL_CYCLE_S STEGMEIER_PRE-MITOTIC_CELL_CYCLE_REGULATORS BENPORATH_PROLIFERATION