DOCSLIB.ORG

Molecular Insights to Crustacean Phylogeny

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Molecular Insights to Crustacean Phylogeny MOLECULAR INSIGHTS TO CRUSTACEAN PHYLOGENY DISSERTATION zur Erlangung des Doktorgrades (Dr. rer. nat.) an der Mathematisch-Naturwissenschaftlichen Fakultät der Rheinischen Friedrich-Wilhelms-Universität Bonn vorgelegt von BJOERN MARCUS VON REUMONT Bonn – Oktober 2009 Angefertigt mit der Genehmigung der Mathematisch-Naturwissenschaftlichen Fakultät der Rheinischen Friedrich-Wilhelms-Universität Bonn. Diese Dissertation wurden am Zoologischen Forschungsmuseum Alexander Koenig in Bonn durchgeführt. Tag der mündlichen Prüfung 29.01.2010 Erscheinungsjahr 2010 Betreuer Prof. Dr. Johann-Wolfgang Waegele Prof. Dr. Bernhard Y. Misof […] Make up your mind, plan before and follow that plan. […] An unforgivenable sin is quitting. Never give up and keep on going. The only struggle should be to solve the problem or survive. […] Focus on the task and on the moment. […] Excerpts of a cave diving manual This basic philosophy for cave diving is not only useful in cave diving but also generally in live and was indeed helping not only once conducting this thesis. And while diving… Dedicated to my family and all good friends – a permanent, safe mainline Contents Molecular insights to crustacean phylogeny CONTENTS SUMMARY / ZUSAMMENFASSUNG 1. INTRODUCTION 1 1.1 CRUSTACEANS AND THEIR CONTROVERSIAL PHYLOGENY – A SHORT OVERVIEW 2 1.2 CONTRADICTING PHYLOGENY HYPOTHESES OF MAJOR CRUSTACEAN GROUPS 6 1.3 EARLY CONCEPTS OF ARTHROPODS AND MAJOR CLADES IN A MODERN BACKGROUND 8 1.4 QUINTESSENCE OF RECENT ARTHROPOD STUDIES 11 1.5 METHODOLOGICAL BACKGORUND 13 1.5.1 THE FUNDAMENT OF ALL MOLECULAR ANALYSES – TAXON CHOICE & 14 ALIGNMENT RECONSTRCUTION 1.5.2 SINGLE GENE DATA – INCORPORATING BACKGROUND KNOWLEDGE TO rRNA ANALYSES 15 1.5.3 PHYLOGENOMIC DATA – A GENERAL OVERVIEW 16 1.6 AIMS OF THE THESIS 19 1.7 SHORT INTRODUCTION AND OVERVIEW OF ANALYSES [A-C] 20 2. MATERIAL AND METHODS 21 2.1 SPECIES CHOICE, COLLECTION AND FIELDWORK 21 2.2 LABORATORY METHODS 26 2.3 DATA ANALYSES METHODS PRIOR TO PHYLOGENETIC TREE RECONSTRUCTION 30 2.3.1 SEQUENCE PROCESSING AND QUALITY CONTROL 31 2.3.2 MULTIPLE SEQUENCE ALIGNMENT 32 2.3.3 ALIGNMENT OPTIMIZATION BASED ON SECONDARY STRUCTURE INFORMATION 32 2.3.4 EVALUATING STRUCTURE AND SIGNAL BY NETWORK RECONSTRUCTION 33 2.3.5 ALIGNMENT EVALUATION AND PROCESSING 33 2.4 ANALYSES [A]| CAN 16S, 18S AND COI IMPROVE CRUSTACEAN PHYLOGENY WITHIN 35 ARTHROPODS? COMPARING “USUAL” STANDARD VS. SECONDARY STRUCTURE BASED APPROACHES. 2.4.1 OBJECTIVES 35 2.4.2 TAXON SAMPLING 35 2.4.3 ANALYSIS DESIGN 35 2.4.4 PHYLOGENETIC TREE RECONSTRUCTION 37 2.5 ANALYSIS [B]: IS IMPLEMENTATION OF SECONDARY STRUCTURE BASED ALIGNMENT 40 OPTIMIZATION AND TIME-HETEROGENEITY A SOLUTION TO SOLVE PHYLOGENY WITHIN ARTHROPODS? 2.5.1 OBJECTIVES 40 2.5.2 TAXON SAMPLING 40 2.5.3 ANALYSIS DESIGN 41 2.5.4 PHYLOGENETIC TREE RECONSTRUCTION 42 2.6 ANALYSES [C]: ENLIGTHS PHYLOGENOMIC DATA CRUSTACEAN PHYLOGENY WITHIN ARTHROPODS 46 – OR STICK OLD PROBLEMS TO THE ANALYSES OF THIS NEW LARGE SCALE DATA? 2.6.1 OBJECTIVES 46 2.6.2 TAXON SAMPLING 46 2.6.3 ANALYSIS DESIGN 47 2.6.4 PHYLOGENETIC TREE RECONSTRUCTION 53 Molecular insights to crustacean phylogeny Contents 2.7 ANALYSIS OF HEMOCYANIN STRUCTURE IN REMIPEDIA 55 2.7.1 OBJECTIVES 55 2.7.2 ANALYSIS DESIGN 55 2.7.3 PHYLOGENETIC TREE RECONSTRUCTION 55 3. RESULTS 57 3.1 ANALYSES [A]| CAN 16S, 18S AND COI IMPROVE CRUSTACEAN PHYLOGENY WITHIN 57 ARTHROPODS? COMPARING “USUAL” STANDARD VS. SECONDARY STRUCTURE BASED APPROACHES. 3.1.1 DATA SIGNAL AND SPLIT SUPPORTING PATTERNS 57 3.1.2 BASE COMPOSITIONS 60 3.1.3 PHYLOGENETIC RECONSTRUCTION 61 3.1.4 PROBLEMATICS OF THE DATA 65 3.2 ANALYSIS [B]: IS IMPLEMENTATION OF SECONDARY STRUCTURE BASED ALIGNMENT 66 OPTIMIZATION AND TIME-HETEROGENEITY A SOLUTION TO SOLVE PHYLOGENY WITHIN ARTHROPODS? 3.2.1 FINAL DATASET AND SPLIT SUPPORTING PATTERNS 66 3.2.2 COMPOSITIONAL HETEROGENEITY OF BASE FREQUENCY 68 3.2.3 PHYLOGENETIC MODEL TESTING & RECONSTRUCTIONS 69 3.2.4 RESULTING TOPOLOGIES 71 3.3 ANALYSES [C]: ENLIGTHS PHYLOGENOMIC DATA CRUSTACEAN PHYLOGENY WITHIN ARTHROPODS 75 – OR STICK OLD PROBLEMS TO THE ANALYSES OF THIS NEW LARGE SCALE DATA? 3.3.1 RESULTING TOPOLOGY OF THE UNREDUCED DATASET 75 3.3.2 RESULTING TOPOLOGIES OF THE REDUCED, OPTIMAL DATA SUBSET 76 3.3.3 DIFFERENCES IN ML AND BAYESIAN TOPOLOGIES OGF THE REDUCED DATA SUBSET 78 3.3.4 PROBLEMATICS IN RESULTING TOPOLOGIES OF THE BAYESIAN CHAINS 78 3.4 ANALYSIS OF HEMOCYANIN STRUCTURE IN REMIPEDIA 81 3.4.2 PHYLOGENETIC RECONSTRUCTION AND RESULTING TREE 81 4. DISCUSSION 83 4.1 SEPARATE METHODOLOGICAL DISCUSSION OF ANALYSIS [A-C] 83 4.1.1 ANALYSES [A] 83 4.1.2 ANALYSES [B] 85 4.1.3 ANALYSES [C] 88 4.2 PANCRUSTACEAN PHYLOGENY DISCUSSION 91 4.3 ARTHROPOD PHYLOGENY DISCUSSION 103 4.4 GENERAL MEHTODOLODICAL DISCUSSION 107 4.5 CONCLUSIONS AND FURTHER ASPECTS 114 5. REFERENCES 117 6. ABREVIATIONS 140 7. INDEX OF FIGURES AND TABLES 141 8. ACKNOWLEDGEMENT 143 9. SUPPLEMENT I 10. CURRICULUM VITAE –ERKLÄRUNG Above picture: Derocheilocaris typicus, a specimen of the Mystacocarida Cover picture: Some of the rather small but beautiful crustaceans (from above left: Branchiura, Mystacocarida, Copepoda, Ostracoda, Cladocera, Branchiopoda and Remipedia. Molecular insights to crustacean phylogeny Abstract / Zusammenfassung ABSTRACT A key role in arthropod phylogeny plays a group of organisms that was already in the focus of taxonomic research of Charles Darwin in the mid of the 19th century, namely the Crustacea. This extremely divers group comprises small species like the Mystacocarida (Derocheilocaris typicus) with only 0.3 mm body size or such big representatives like the Japanese giant crab (Macrocheira kaempferi) with a span width of almost 4 m. Generally accepted are six major crustacean taxa, the Malacostraca (Latreille, 1802), Branchiopoda (Latreille, 1817), Remipedia (Yager, 1981), Cephalocarida (Sanders, 1955), Maxillopoda (Dahl, 1956) and Ostracoda (Latreille 1802). The validity of the taxon Maxillopoda is to date still disputed. The monophyly of some crustacean groups like the Malacostraca and Branchiopoda is generally accepted, but for several other groups unclear. This thesis aims to resolve internal relationships of the major crustacean groups inferring phylogenies with molecular data. The crustaceans are in addition of eminent interest to enlight the question how land was successfully conquered by arthropod taxa. New molecular and neuroanatomical data support the scenario that the Hexapoda might have evolved from Crustacea. The thesis further seeks to address the possible close relationship of Crustacea and Hexapoda. That issue is closely linked to the partly still debated position of crustaceans within arthropods and the supposable sister-group of the Crustacea. Most molecular studies of crustaceans relied on single gene or multigene analyses in which for most cases partly sequenced rRNA genes were used. However, intensive data quality and alignment assessments prior to phylogenetic reconstructions are not conducted in most studies. Additionally, a complex modeling and the implementation of compositional base heterogeneity along lineages are missing. One methodological aim in this thesis was to implement new tools to infer data quality, to improve alignment quality and to test the impact of complex modeling of the data. Two of the three phylogenetic analyses in this thesis are also based on rRNA genes. In analysis (A) 16S rRNA, 18S rRNA and COI sequences were analyzed. RY coding of the COI fragment, an alignment procedure that considers the secondary structure of RNA molecules and the exclusion of alignment positions of ambiguous positional homology was performed to improve data quality. Anyhow, by extensive network reconstructions it was shown that the signal quality in the chosen and commonly used markers is not suitable to infer crustacean phylogeny, despite the extensive data processing and optimization. This result draws a new light on previous studies relying on these markers. In analyses (B) completely sequenced 18S and 28S rRNA genes were used to reconstruct the phylogeny. Base compositional heterogeneity was taken into account based on the finding of analysis (A), additionally to secondary structure alignment optimization and alignment assessment. The complex modeling to compare time-heterogeneous versus time- homogenous processes in combination with mixed models for an implementation of secondary structures was only possible applying the Bayesian software package PHASE. The results clearly demonstrated that complex modeling counts and that ignoring time- Abstract / Zusammenfassung Molecular insights to crustacean phylogeny heterogeneous processes can mislead phylogenetic reconstructions. Some results enlight the phylogeny of Crustaceans, for the first time the Cephalocarida (Hutchinsoniella macracantha) were placed in a clade with the Branchiopoda, which morphologically is plausible. Unfortunately, the internal relationships of most crustacean groups were still poorly supported. Compared to the time-homogeneous tree the time-heterogeneous tree gives lower support values for some nodes. It can be suggested, that the incorporation of base compositional heterogeneity in phylogenetic analysis improves the reliability of the topology. The Pancrustacea are supported maximally in both approaches, but internal relations are not reliably reconstructed. One result of this analysis is that the phylogenetic signal in rRNA data might be eroded for crustaceans. Recent publications presented analyses based on phylogenomic data, to reconstruct mainly metazoan
Load more

Recommended publications
  • Chemical Composition and Pharmacological Mechanism of Ephedra- Glycyrrhiza Drug Pair Against Coronavirus Disease 2019 (COVID-19)
    www.aging-us.com AGING 2021, Vol. 13, No. 4 Research Paper Chemical composition and pharmacological mechanism of ephedra- glycyrrhiza drug pair against coronavirus disease 2019 (COVID-19) Xiaoling Li1,*, Qin Qiu2,*, Mingyue Li3,*, Haowen Lin4, Shilin Cao5,6, Qu Wang4, Zishi Chen5, Wenhao Jiang5, Wen Zhang7, Yuge Huang8, Hui Luo9, Lianxiang Luo9,10 1Animal Experiment Center of Guangdong Medical University, Zhanjiang 524023, Guangdong, China 2Graduate School of Guangdong Medical University, Zhanjiang 524023, Guangdong, China 3Department of Pathology and Laboratory Medicine, Perelman School of Medicine, University of Pennsylvania, Philadelphia, PA 19104, USA 4The First Clinical College of Guangdong Medical University, Zhanjiang 524023, Guangdong, China 5Group of Sustainable Biochemical Engineering, School of Food Science and Engineering, Foshan University, Foshan 528000, Guangdong, China 6Sustainable Biochemical and Biosynthetic Engineering Center, Foshan Wu-Yuan Biotechnology Co., Ltd., Guangdong Biomedical Industrial Base, Foshan 528000, Guangdong, China 7Aditegen LLC, Jersey, NJ 07310, USA 8Department of Pediatrics, the Affiliated Hospital of Guangdong Medical University, Zhanjiang 524001, Guangdong, China 9The Marine Biomedical Research Institute, Guangdong Medical University, Zhanjiang 524023, Guangdong, China 10Marine Medical Research Institute of Zhanjiang, Zhanjiang 524023, Guangdong, China *Equal contribution Correspondence to: Lianxiang Luo; email: [email protected] Keywords: COVID-19, ephedra, glycyrrhiza, network pharmacology, molecular docking Received: August 26, 2020 Accepted: November 30, 2020 Published: February 13, 2021 Copyright: © 2021 Li et al. This is an open access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Traditional Chinese medicine (TCM) had demonstrated effectiveness in the prevention and control of COVID-19.
    [Show full text]
  • Phylum Arthorpoda
    CAPITULO 15. ORDENES DE HEXAPODA. ___________________________________________________________ 15.1 Orden Protura. Estos organismos son diminutos, miden entre 0.6 a 2.5 mm de longitud. Las partes bucales son del tipo succionador primitivo, esto es que las mandíbulas son largas y delgadas pero no forman un tubo succionador similar al de los insectos alados. Carecen de ojos, antenas y alas; el segundo y tercer par de patas son cortas y al parecer no tienen alguna función especial, en tanto que el primer par tienen una función sensorial, por lo que las llevan en una posición elevada semejando antenas. Los tarsos son unisegmentados. Los primeros tres segmentos abdominales cuentan con estilos. El abdomen no presenta cercos (Figura 15.1). La metamorfosis en estos hexápodos es gradual. Al emerger la larva del huevo, ésta cuenta con nueve segmentos abdominales y en cada una de sus tres mudas la larva adiciona un segmento anterior a la porción apical o telson, de tal manera que el abdomen del organismo adulto aparenta ser de 12 segmentos. Los proturos viven en hábitats húmedos y se les ha separado por medio de embudos de Berlese de muestras de humus, hojas muertas, musgo, líquenes; también se han colectado debajo de corteza de madera en descomposición. Algunas especies se han colectado en nidos subterráneos de mamíferos; aparentemente éstos están asociados a hongos. Para alimentarse ellos pican el micelio de los hongos asociados con las raíces de plantas vasculares; aunque el efecto de este tipo de alimentación todavía no se ha determinado. Estos organismos tienen una distribución mundial, actualmente existen aproximadamente 200 especies descritas, agrupadas en 57 géneros y en 17 subfamilias y ocho familias.
    [Show full text]
  • PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41
    American Society of Human Genetics 62nd Annual Meeting November 6–10, 2012 San Francisco, California PLATFORM ABSTRACTS Abstract Abstract Numbers Numbers Tuesday, November 6 41. Genes Underlying Neurological Disease Room 134 #196–#204 2. 4:30–6:30pm: Plenary Abstract 42. Cancer Genetics III: Common Presentations Hall D #1–#6 Variants Ballroom 104 #205–#213 43. Genetics of Craniofacial and Wednesday, November 7 Musculoskeletal Disorders Room 124 #214–#222 10:30am–12:45 pm: Concurrent Platform Session A (11–19): 44. Tools for Phenotype Analysis Room 132 #223–#231 11. Genetics of Autism Spectrum 45. Therapy of Genetic Disorders Room 130 #232–#240 Disorders Hall D #7–#15 46. Pharmacogenetics: From Discovery 12. New Methods for Big Data Ballroom 103 #16–#24 to Implementation Room 123 #241–#249 13. Cancer Genetics I: Rare Variants Room 135 #25–#33 14. Quantitation and Measurement of Friday, November 9 Regulatory Oversight by the Cell Room 134 #34–#42 8:00am–10:15am: Concurrent Platform Session D (47–55): 15. New Loci for Obesity, Diabetes, and 47. Structural and Regulatory Genomic Related Traits Ballroom 104 #43–#51 Variation Hall D #250–#258 16. Neuromuscular Disease and 48. Neuropsychiatric Disorders Ballroom 103 #259–#267 Deafness Room 124 #52–#60 49. Common Variants, Rare Variants, 17. Chromosomes and Disease Room 132 #61–#69 and Everything in-Between Room 135 #268–#276 18. Prenatal and Perinatal Genetics Room 130 #70–#78 50. Population Genetics Genome-Wide Room 134 #277–#285 19. Vascular and Congenital Heart 51. Endless Forms Most Beautiful: Disease Room 123 #79–#87 Variant Discovery in Genomic Data Ballroom 104 #286–#294 52.
    [Show full text]
  • Oxyethira Albiceps (Mclachlan, 1862) INFORMATION SHEET ECOLOGY
    Identification Key to Campbell Island Freshwater Invertebrates McMurtrie, Sinton & Winterbourn (2014) Oxyethira albiceps (McLachlan, 1862) INFORMATION SHEET ECOLOGY Classification Phylum: Arthropoda Class: Insecta Order: Trichoptera Family: Hydoptilidae Genus: Oxyethira Specific name: albiceps Common name: micro-caddisfly Original combination: Hydroptila albiceps McLachlan, 1862 Distinguishing Features FIguRe 1. Oxyethira albiceps whole animal, showing lateral and dorsal view As in all Trichoptera larvae, Oxyethira albiceps have a sclerotised head. All three thoracic segments have sclerotised plates on the and the abdomen is soft. They have three pairs of segmented legs. The abdomen lacks prolegs but has a pair of posterior claws with subsidiary hooks. Late-instar Oxyethira albiceps larvae occupy a transparent, roughly axe-head shaped, portable case (Fig. 1). First instar larvae have no case, however, they can be recognised by very long hairs (setae) projecting posteriorly, and on their legs (Fig. 2). FIguRe 2. Oxyethira albiceps whole animal Comments insects inhabiting New Zealand, including notes on their relation Oxyethira albiceps is widely distributed on the three main islands to angling. London, West Newman & Co. 102 p. of New Zealand (North, South, Stewart), and Snares, Antipodes, Auckland, Campbell, and Chatham islands. Leader, J. P. 1970. Hairs of the Hydroptilidae (Trichoptera). Tane 16: 121–130. McLachlan, R. 1862. Characters of New Species of Exotic Original Description Trichoptera; also of One New Species inhabiting Britain. Hydroptila albiceps McLachlan (1862): Larvae not described Transactions of the Royal Entomological Society of London 11 (3): First description of larval biology by Hudson (1904). A detailed 301–311. morphological description is provided by Cowley (1978). How to Cite this Information Sheet References & Further Reading McMurtrie, S.A., Sinton, A.M.R., & Winterbourn, M.J.
    [Show full text]
  • Going Deeper Into High and Low Phylogenetic Relationships of Protura
    G C A T T A C G G C A T genes Article Going Deeper into High and Low Phylogenetic Relationships of Protura 1, , 2,3, 3 1 1 Antonio Carapelli * y , Yun Bu y, Wan-Jun Chen , Francesco Nardi , Chiara Leo , Francesco Frati 1 and Yun-Xia Luan 3,4,* 1 Department of Life Sciences, University of Siena, Via A. Moro 2, 53100 Siena, Italy; [email protected] (F.N.); [email protected] (C.L.); [email protected] (F.F.) 2 Natural History Research Center, Shanghai Natural History Museum, Shanghai Science & Technology Museum, Shanghai 200041, China; [email protected] 3 Key Laboratory of Insect Developmental and Evolutionary Biology, Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200032, China; [email protected] 4 Guangdong Provincial Key Laboratory of Insect Developmental Biology and Applied Technology, Institute of Insect Science and Technology, School of Life Sciences, South China Normal University, Guangzhou 510631, China * Correspondence: [email protected] (A.C.); [email protected] (Y.-X.L.); Tel.: +39-0577-234410 (A.C.); +86-18918100826 (Y.-X.L.) These authors contributed equally to this work. y Received: 16 March 2019; Accepted: 5 April 2019; Published: 10 April 2019 Abstract: Proturans are small, wingless, soil-dwelling arthropods, generally associated with the early diversification of Hexapoda. Their bizarre morphology, together with conflicting results of molecular studies, has nevertheless made their classification ambiguous. Furthermore, their limited dispersal capability (due to the primarily absence of wings) and their euedaphic lifestyle have greatly complicated species-level identification.
    [Show full text]
  • Arachnida, Solifugae) with Special Focus on Functional Analyses and Phylogenetic Interpretations
    HISTOLOGY AND ULTRASTRUCTURE OF SOLIFUGES Comparative studies of organ systems of solifuges (Arachnida, Solifugae) with special focus on functional analyses and phylogenetic interpretations HISTOLOGIE UND ULTRASTRUKTUR DER SOLIFUGEN Vergleichende Studien an Organsystemen der Solifugen (Arachnida, Solifugae) mit Schwerpunkt auf funktionellen Analysen und phylogenetischen Interpretationen I N A U G U R A L D I S S E R T A T I O N zur Erlangung des akademischen Grades doctor rerum naturalium (Dr. rer. nat.) an der Mathematisch-Naturwissenschaftlichen Fakultät der Ernst-Moritz-Arndt-Universität Greifswald vorgelegt von Anja Elisabeth Klann geboren am 28.November 1976 in Bremen Greifswald, den 04.06.2009 Dekan ........................................................................................................Prof. Dr. Klaus Fesser Prof. Dr. Dr. h.c. Gerd Alberti Erster Gutachter .......................................................................................... Zweiter Gutachter ........................................................................................Prof. Dr. Romano Dallai Tag der Promotion ........................................................................................15.09.2009 Content Summary ..........................................................................................1 Zusammenfassung ..........................................................................5 Acknowledgments ..........................................................................9 1. Introduction ............................................................................
    [Show full text]
  • Supplementary Materials
    Lists of figures Figure S1: A-B: Principal Component Analysis (PCA) was applied to 3 pairs of SCEC tissues (red) and matched adjacent normal tissues (blue) that were characterized by the gene expression of all probes on Affymetrix HG U133 Plus 2.0 Array. C: Box plot of SCEC group. D: Pearson’s correlation matrix of SCEC group. 17 / 25 Figure S2: MvA plot of SCEC group. Figure S3: Volcano plots of probe sets differing between SCEC and matched normal tissues. Fold change (X axis) is plotted against statistical significance (Y axis) for each probe sets. Genes altered with a fold change ≥2 and FDR <0.01 are depicted in red. Grey represents genes in the arrays that were not found to differ significantly between cancerous samples and matched normal samples. Figure S4: Gene regulatory network plotted by the top 120 DEGs (ranked by FDR) of SCEC groups. 18 / 25 Figure S5: DNA copy number change profiles in 3 pairs of SCEC samples. The CNVs frequency of the whole genome was analyzed by aCGH. Gains were marked in red and losses in bule. Lists of tables Table S1. Primers used in qRT-PCR for microarray gene expression validation Gene Forward Primer (5’-3’) Reverse Primer (5’-3’) Product β-actin AAGGTGACAGCAGTCGGTT TGTGTGGACTTGGGAGAGG 195bp INSM1 GTATTCGCTGTGTTCATGGTC CGCTACATACATAGAGAGCAGAG 79bp ASCL1 AACTCCCATCACCTCTAACA TGAGACGAAAGACACCAACT 120bp NRCAM GATGGCGAAGAATGAAGTT ACAGTGAGGGATAAGGTGTG 141bp NUF2 ATGATGCCAGTGAACTCTGAA GACTTGTCCGTTTTGCTTTTG 160bp 19 / 25 SNAP25 CCTGGATATGGGCAATGAGAT ACACGGGTGGGCACACTTA 146bp PTP4A3 GCTTCCTCATCACCCACAA CCGTACTTCTTCAGGTCCTCA
    [Show full text]
  • Pleomothra Apletocheles and Godzilliognomus Frondosus, Two New Genera and Species of Remipede Crustaceans (Godzilliidae) from Anchialine Caves of the Bahamas
    BULLETIN OF MARINE SCIENCE, 44(3): 1195-1206, 1989 CORAL REEF PAPER PLEOMOTHRA APLETOCHELES AND GODZILLIOGNOMUS FRONDOSUS, TWO NEW GENERA AND SPECIES OF REMIPEDE CRUSTACEANS (GODZILLIIDAE) FROM ANCHIALINE CAVES OF THE BAHAMAS Jill Yager ABSTRACT Two new genera and species of the crustacean class Remipedia, Pleornothra apletocheles and Godzi/liognornus frondosus, are described from anchialine caves on Abaco and Grand Bahama Island in the northern Bahamas. The new taxa are placed in the family Godzilliidae. The familial characters are revised, and a key to all species is included. Extensive collecting efforts in anchialine caves of the West Indies and along the coast of Quintana Roo, Mexico, have produced a number of interesting crustacean species (Bowman, 1987; Holsinger and Yager, 1985; Yager, 1987b). Recent field studies in the Bahamas have resulted in the collection of two new genera and species of the crustacean class Remipedia. These new taxa are described below. Their description brings the total number ofremipede species to nine. These new genera differ markedly from remipedes in the family Speleonectidae Yager (1981) and are placed in the family Godzilliidae (Schram et aI., 1986). Because the diagnosis ofthis family was originally based on a single species from caves in The Turks and Caicos (Yager and Schram, 1986), discovery of these new taxa requires expanding the familial definition. In addition, a key to the nine described species of remipedes is given below. The Bahamian archipelago is an area rich in drowned karst. Anchialine caves are submerged caves characterized by having inland surface openings and sub- surface connections to the nearby sea, These caves are very common throughout the Bahamian island chain.
    [Show full text]
  • Taxonomic Revision and Insights Into the Speciation Mode of the Spider Dysdera Erythrina Species-Complex (Araneae&Thinsp;:&A
    AUTHORS’ PAGE PROOFS: NOT FOR CIRCULATION CSIRO PUBLISHING Invertebrate Systematics http://dx.doi.org/10.1071/IS16071 Taxonomic revision and insights into the speciation mode of the spider Dysdera erythrina species-complex (Araneae : Dysderidae): sibling species with sympatric distributions Milan Rezá cA,G, Miquel A. Arnedo B, Vera Opatova B,C,D, Jana MusilováA,E, Veronika Rezá cová F and Jirí Král D ABiodiversity Lab, Crop Research Institute, Drnovská 507, CZ-161 06 Prague 6-Ruzyne, Czechia. BDepartment of Animal Biology & Biodiversity Research Institute, Universitat de Barcelona, Av. Diagonal 643, 08028 Barcelona, Spain. CDepartment of Zoology, Faculty of Science, Charles University in Prague, Vinicná 7, CZ-128 44 Prague 2, Czechia. DDepartment of Biological Sciences and Auburn University Museum of Natural History, Auburn University, Auburn, AL 36849, USA. ELaboratory of Arachnid Cytogenetics, Department of Genetics and Microbiology, Faculty of Science, Charles University in Prague, Vinicná 5, CZ-128 44 Prague 2, Czechia. FLaboratory of Fungal Biology, Institute of Microbiology, Academy of Sciences of the Czech Republic, CZ-142 20 Prague, Czechia. GCorresponding author. Email: [email protected] ONLY Abstract. The genus Dysdera Latreille, 1804, a species-rich group of spiders that includes specialised predators of woodlice, contains several complexes of morphologically similar sibling species. Here we investigate species limits in the D. erythrina (Walckenaer, 1802) complex by integrating phenotypic, cytogenetic and molecular data, and use this information to gain further knowledge on its origin and evolution. We describe 16 new species and redescribe four 5 poorly known species belonging to this clade. The distribution of most of the species in the complex is limited to southern France and thenorth-eastern Iberian Peninsula.
    [Show full text]
  • Pancrustacean Phylogeny in the Light of New Phylogenomic Data
    MBE Advance Access published November 1, 2011 Pancrustacean phylogeny in the light of new phylogenomic data: support for Remipedia as the possible sister group of Hexapoda Research Article Downloaded from Bjoern M von Reumont1§, Ronald A Jenner2, Matthew A Wills3, Emiliano 4 4 5 6 Dell’Ampio , Günther Pass , Ingo Ebersberger , Benjamin Meyer , Stefan http://mbe.oxfordjournals.org/ Koenemann7, Thomas M Iliffe8, Alexandros Stamatakis9, Oliver Niehuis1, Karen Meusemann1, Bernhard Misof 1 at Vienna University Library on November 11, 2011 1 Zoologisches Forschungsmuseum Alexander Koenig, Adenauerallee 160, D-53113 Bonn, Germany 2 Department of Zoology, The Natural History Museum, Cromwell Road, London SW7 5BD, United Kingdom 3 Department of Biology and Biochemistry, University of Bath, The Avenue, Claverton Down, BA2 7AY, UK, Bath, United Kingdom 4 Department of Evolutionary Biology, University of Vienna, Althanstraße 14, A- 1090, Vienna, Austria 5 Center for Integrative Bioinformatics Vienna (CIBIV), University of Vienna, Medical University of Vienna, University of Veterinary Medicine Vienna, Dr. Bohrgasse 9, A-1030 Vienna, Austria 6 Biozentrum Grindel und Zoologisches Museum, Universität Hamburg, Martin- Luther-King Platz 3, D-20146 Hamburg, Germany - 1 - Ó The Author 2011. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: [email protected] 7 Section Biology, Science and Technology, University of Siegen, Adolf-Reichwein- Straße
    [Show full text]
  • Molecular Species Delimitation and Biogeography of Canadian Marine Planktonic Crustaceans
    Molecular Species Delimitation and Biogeography of Canadian Marine Planktonic Crustaceans by Robert George Young A Thesis presented to The University of Guelph In partial fulfilment of requirements for the degree of Doctor of Philosophy in Integrative Biology Guelph, Ontario, Canada © Robert George Young, March, 2016 ABSTRACT MOLECULAR SPECIES DELIMITATION AND BIOGEOGRAPHY OF CANADIAN MARINE PLANKTONIC CRUSTACEANS Robert George Young Advisors: University of Guelph, 2016 Dr. Sarah Adamowicz Dr. Cathryn Abbott Zooplankton are a major component of the marine environment in both diversity and biomass and are a crucial source of nutrients for organisms at higher trophic levels. Unfortunately, marine zooplankton biodiversity is not well known because of difficult morphological identifications and lack of taxonomic experts for many groups. In addition, the large taxonomic diversity present in plankton and low sampling coverage pose challenges in obtaining a better understanding of true zooplankton diversity. Molecular identification tools, like DNA barcoding, have been successfully used to identify marine planktonic specimens to a species. However, the behaviour of methods for specimen identification and species delimitation remain untested for taxonomically diverse and widely-distributed marine zooplanktonic groups. Using Canadian marine planktonic crustacean collections, I generated a multi-gene data set including COI-5P and 18S-V4 molecular markers of morphologically-identified Copepoda and Thecostraca (Multicrustacea: Hexanauplia) species. I used this data set to assess generalities in the genetic divergence patterns and to determine if a barcode gap exists separating interspecific and intraspecific molecular divergences, which can reliably delimit specimens into species. I then used this information to evaluate the North Pacific, Arctic, and North Atlantic biogeography of marine Calanoida (Hexanauplia: Copepoda) plankton.
    [Show full text]
  • Tcc Anamassocatto.Pdf (1.628Mb)
    UNIVERSIDADE FEDERAL DO PARANÁ ANA CARLA SANTIN MASSOCATTO PADRÕES DE DISTRIBUIÇÃO DE ANELÍDEOS INTERSTICIAIS NAS MARCAS DE ONDULAÇÕES DO PARQUE NACIONAL MARINHO DAS ILHAS DOS CURRAIS, SUL DO BRASIL PONTAL DO PARANÁ 2019 ANA CARLA SANTIN MASSOCATTO PADRÕES DE DISTRIBUIÇÃO DE ANELÍDEOS INTERSTICIAIS NAS MARCAS DE ONDULAÇÕES DO PARQUE NACIONAL MARINHO DAS ILHAS DOS CURRAIS, SUL DO BRASIL TCC apresentado ao curso de Graduação em Oceanografia, Setor de Ciências da Terra, Universidade Federal do Paraná, como requisito parcial à obtenção do título de Bacharel em Oceanografia. Orientador: Prof. Dr. Maikon Di Domenico PONTAL DO PARANÁ 2019 CATALOGAÇÃO NA FONTE: UFPR / SiBi - Biblioteca do Centro de Estudos do Mar Liliam Maria Orquiza – CRB-9/712 Massocatto, Ana Carla Santin M419p Padrões de distribuição de anelídeos intersticiais nas marcas de ondulações do Parque Nacional Marinho das Ilhas dos Currais, Sul do Brasil. / Ana Carla Santin Massocatto. – Pontal do Paraná, 2019. 54 f.: il., 29 cm. Orientador: Prof. Dr. Maikon Di Domenico. Monografia (Graduação) – Curso de Oceanografia, Centro de Estudos do Mar, Setor Reitoria, Universidade Federal do Paraná. 1. Meiofauna. 2. Anelídeos intersticiais. 3. Marcas de Ondulação. 4. Granulometria. I. Título. II. Di Domenico, Maikon. III. Universidade Federal do Paraná. CDD 595.147 A todos os professores empenhados com a educação de qualidade. AGRADECIMENTOS A Universidade Federal do Paraná, ao Centro de Estudos do Mar e todos os seus funcionários, pela oportunidade de realizar este trabalho, pelo espaço e pelos recursos didático-científicos. Ao Dr. Maikon Di Domenico grande amigo e professor, por aceitar a me orientar, pelo incentivo e auxílio, pelos momentos de riso no laboratório, pelo crescimento pessoal que me proporcionou.
    [Show full text]